WorldWideScience

Sample records for specific pcr detection

  1. Specific PCR-based detection of Alternaria helianthi

    Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.

    2012-01-01

    Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...

  2. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  3. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  4. High Specificity of Quantitative Methylation-Specific PCR Analysis for MGMT Promoter Hypermethylation Detection in Gliomas

    Paola Parrella

    2009-01-01

    Full Text Available Normal brain tissue from 28 individuals and 50 glioma samples were analyzed by real-time Quantitative Methylation-Specific PCR (QMSP. Data from this analysis were compared with results obtained on the same samples by MSP. QMSP analysis demonstrated a statistically significant difference in both methylation level (P=.000009 Mann Whitney Test and frequencies (P=.0000007, Z-test in tumour samples as compared with normal brain tissues. Although QMSP and MSP showed similar sensitivity, the specificity of QMSP analysis was significantly higher (93%; CI95%: 84%–100% as compared with MSP (64%; 95%CI: 46%–82%. Our results suggest that QMSP analysis may represent a powerful tool to identify glioma patients that will benefit from alkylating agents chemotherapy.

  5. Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

    Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

    2010-01-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

  6. Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

    Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

    2009-09-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

  7. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii

    Linke Sonja

    2006-01-01

    Full Text Available Abstract Background Coxiella burnetii, the bacterium causing Q fever, is an obligate intracellular biosafety level 3 agent. Detection and quantification of these bacteria with conventional methods is time consuming and dangerous. During the last years, several PCR based diagnostic assays were developed to detect C. burnetii DNA in cell cultures and clinical samples. We developed and evaluated TaqMan-based real-time PCR assays that targeted the singular icd (isocitrate dehydrogenase gene and the transposase of the IS1111a element present in multiple copies in the C. burnetii genome. Results To evaluate the precision of the icd and IS1111 real-time PCR assays, we performed different PCR runs with independent DNA dilutions of the C. burnetii Nine Mile RSA493 strain. The results showed very low variability, indicating efficient reproducibility of both assays. Using probit analysis, we determined that the minimal number of genome equivalents per reaction that could be detected with a 95% probability was 10 for the icd marker and 6.5 for the IS marker. Plasmid standards with cloned icd and IS1111 fragments were used to establish standard curves which were linear over a range from 10 to 107 starting plasmid copy numbers. We were able to quantify cell numbers of a diluted, heat-inactivated Coxiella isolate with a detection limit of 17 C. burnetii particles per reaction. Real-time PCR targeting both markers was performed with DNA of 75 different C. burnetii isolates originating from all over the world. Using this approach, the number of IS1111 elements in the genome of the Nine Mile strain was determined to be 23, close to 20, the number revealed by genome sequencing. In other isolates, the number of IS1111 elements varied widely (between seven and 110 and seemed to be very high in some isolates. Conclusion We validated TaqMan-based real-time PCR assays targeting the icd and IS1111 markers of C. burnetii. The assays were shown to be specific, highly

  8. Group-specific multiplex PCR detection systems for the identification of flying insect prey.

    Daniela Sint

    Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.

  9. Alpha toxin specific PCR for detection of toxigenic strains of Clostridium perfringens in Poultry

    Malmarugan Shanmugasamy

    2012-12-01

    Full Text Available Aim : Isolation of clostridium perfirngens from necrotic enteritis cases in poultry and confirmation by alpha toxin specific PCR Materials and methods: Robertson cooked meat medium with Brain Heart Infusion broth was used for isolation of C. perfringens from intestinal contents of necrotic enteritis suspected birds. Positive cultures from perfringens agar were further confirmed by biochemical tests and subjected to alpha toxin specific PCR. Results: Twenty Clostridium perfringens isolates were isolated from intestinal contents of thirty five NE suspected birds. Out of the twenty isolates, fourteen were isolated from commercial broilers of 2 to 6 wk of age and six from commercial layers of 9 to 15 wk of age. Frequency of isolation of C. perfringens was more with Robertson cooked meat medium with BHI broth than thioglycollate broth alone. When positive cultures were streaked on to clostridial agar appreciable luxuriant growths were obtained and the selective streaking of these colonies on perfringens agar with supplements revealed rough and black colonies with sulphate reduction. The isolates produced rough and black colonies with sulphate reduction on perfringens agar, double zone haemolysis on sheep blood agar, stormy clot fermentation on milk medium and opalescence on egg yolk medium. The isolates were found negative for oxidase, catalase, liquefied gelatin, fermented glucose, maltose, lactose and sucrose except mannitol. All the fourteen isolates obtained from commercial broilers proved the alpha toxin producing strains of C. perfringens when they were subjected to alpha toxin specific PCR. Conclusion : This study revealed alpha toxin specific PCR is highly useful for detection of toxigenic strains of Clostridium perfringens in poultry [Vet. World 2012; 5(6.000: 365-368

  10. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  11. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  12. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  13. Development of an improved species specific PCR test for detection of Haemophilus parasuis

    Angen, Øystein; Oliveira, Simone; Ahrens, Peter

    2007-01-01

    , the present PCR test was found to be 100% species specific for H. parasuis, in contrast to the PCR test of Oliveira et al., which also tested positive for strains belonging to A. indolicus, A. porcinus, and A. minor, species commonly occurring in the upper respiratory tract. However, when the PCR test...... with representatives of H. parasuis. The test was further evaluated on 55 clinical samples from 16 Danish pigs suspected for being infected with H. parasuis, showing polyserositis or septicemia at autopsy as well as on 492 nasal swabs. The test was compared with the performance of a PCR test earlier published...... by Oliveira et al. [Oliveira, S., Galina, L., Pijoan, C., 2001. Development of a PCR test to diagnose Haemophilus parasuis infections. J. Vet. Diagn. Invest. 13, 495-501]. The sensitivity of the present PCR test was found to be slightly lower when applied on clinical samples from diseased pigs and 10-fold...

  14. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  15. Detection of MPL mutations by a novel allele-specific PCR-based strategy.

    Furtado, Larissa V; Weigelin, Helmut C; Elenitoba-Johnson, Kojo S J; Betz, Bryan L

    2013-11-01

    MPL mutation testing is recommended in patients with suspected primary myelofibrosis or essential thrombocythemia who lack the JAK2 V617F mutation. MPL mutations can occur at allelic levels below 15%, which may escape detection by commonly used mutation screening methods such as Sanger sequencing. We developed a novel multiplexed allele-specific PCR assay capable of detecting most recurrent MPL exon 10 mutations associated with primary myelofibrosis and essential thrombocythemia (W515L, W515K, W515A, and S505N) down to a sensitivity of 2.5% mutant allele. Test results were reviewed from 15 reference cases and 1380 consecutive specimens referred to our laboratory for testing. Assay performance was compared to Sanger sequencing across a series of 58 specimens with MPL mutations. Positive cases consisted of 45 with W515L, 6 with S505N, 5 with W515K, 1 with W515A, and 1 with both W515L and S505N. Seven cases had mutations below 5% that were undetected by Sanger sequencing. Ten additional cases had mutation levels between 5% and 15% that were not consistently detected by sequencing. All results were easily interpreted in the allele-specific test. This assay offers a sensitive and reliable solution for MPL mutation testing. Sanger sequencing appears insufficiently sensitive for robust MPL mutation detection. Our data also suggest the relative frequency of S505N mutations may be underestimated, highlighting the necessity for inclusion of this mutation in MPL test platforms. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  16. Detection of Legionella bozemanae, a New Cause of Septic Arthritis, by PCR Followed by Specific Culture

    Just, Søren Andreas; Knudsen, John Bonde; Uldum, Søren Anker

    2012-01-01

    Legionella bozemanae is a rare isolate in clinical specimens. We describe a case of joint infection due to L. bozemanae in an immunocompromised patient with dermatomyositis. Without the use of PCR screening or culture on specialized medium, the organism would not have been detected.......Legionella bozemanae is a rare isolate in clinical specimens. We describe a case of joint infection due to L. bozemanae in an immunocompromised patient with dermatomyositis. Without the use of PCR screening or culture on specialized medium, the organism would not have been detected....

  17. Quantitative threefold allele-specific PCR (QuanTAS-PCR) for highly sensitive JAK2 V617F mutant allele detection

    Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander

    2013-01-01

    The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a

  18. Tus-Ter-lock immuno-PCR assays for the sensitive detection of tropomyosin-specific IgE antibodies.

    Johnston, Elecia B; Kamath, Sandip D; Lopata, Andreas L; Schaeffer, Patrick M

    2014-02-01

    The increasing prevalence of food allergies requires development of specific and sensitive tests capable of identifying the allergen responsible for the disease. The development of serologic tests that can detect specific IgE antibodies to allergenic proteins would, therefore, be highly received. Here we present two new quantitative immuno-PCR assays for the sensitive detection of antibodies specific to the shrimp allergen tropomyosin. Both assays are based on the self-assembling Tus-Ter-lock protein-DNA conjugation system. Significantly elevated levels of tropomyosin-specific IgE were detected in sera from patients allergic to shrimp. This is the first time an allergenic protein has been fused with Tus to enable specific IgE antibody detection in human sera by quantitative immuno-PCR.

  19. Methylation-Specific PCR Unraveled

    Sarah Derks

    2004-01-01

    Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.

  20. Multiplex PCR for specific and robust detection of Xanthomonas campestris pv. musacearum in pure culture and infected plant material

    Adriko, John; Aritua, V.; Mortensen, Carmen Nieves

    2012-01-01

    The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...

  1. Improving specificity of Bordetella pertussis detection using a four target real-time PCR.

    Helena Martini

    Full Text Available The incidence of whooping cough, a contagious respiratory disease caused by Bordetella pertussis, is on the rise despite existing vaccination programmes. Similar, though usually milder, respiratory symptoms may be caused by other members of the Bordetella genus: B. parapertussis, B. holmesii, and B. bronchiseptica. Pertussis diagnosis is mostly done using PCR, but the use of multiple targets is necessary in order to differentiate the different Bordetella spp. with sufficient sensitivity and specificity. In this study we evaluate a multiplex PCR assay for the differentiation of B. pertussis from other Bordetella spp., using the targets IS481, IS1001, IS1002, and recA. Moreover, we retrospectively explore the epidemiology of Bordetella spp. infections in Belgium, using the aforementioned assay over a three-year period, from 2013 until 2015.

  2. Improving specificity of Bordetella pertussis detection using a four target real-time PCR

    Detemmerman, Liselot; Soetens, Oriane; Yusuf, Erlangga; Piérard, Denis

    2017-01-01

    The incidence of whooping cough, a contagious respiratory disease caused by Bordetella pertussis, is on the rise despite existing vaccination programmes. Similar, though usually milder, respiratory symptoms may be caused by other members of the Bordetella genus: B. parapertussis, B. holmesii, and B. bronchiseptica. Pertussis diagnosis is mostly done using PCR, but the use of multiple targets is necessary in order to differentiate the different Bordetella spp. with sufficient sensitivity and specificity. In this study we evaluate a multiplex PCR assay for the differentiation of B. pertussis from other Bordetella spp., using the targets IS481, IS1001, IS1002, and recA. Moreover, we retrospectively explore the epidemiology of Bordetella spp. infections in Belgium, using the aforementioned assay over a three-year period, from 2013 until 2015. PMID:28403204

  3. Detection of Echinococcus multilocularis by MC-PCR: evaluation of diagnostic sensitivity and specificity without gold standard

    Helene Wahlström

    2016-03-01

    Full Text Available Introduction: A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR, allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Materials and methods: Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108 and autumn 2012 (n=69 in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. Results and discussion: This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI 0.80–0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76–0.88, which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94–0.99 for the MC-PCR and 0.99 (95% PCI 0.99–1 for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997–1. One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. Conclusion: The sensitivity of the MC-PCR (0.88 was comparable to the sensitivity of SCT (0.83.

  4. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  5. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  6. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  7. Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe.

    Ahonsi, Monday O; Ling, Yin; Kageyama, Koji

    2010-11-01

    Phytophthora nicotianae and Pythium helicoides are important water-borne oomycete pathogens of irrigated ornamentals particularly ebb-and-flow irrigated kalanchoe in Japan. We developed novel PCR-based sequence characterized amplified region markers and assays for rapid identification and species-specific detection of both pathogens in separate PCR reactions or simultaneously in a duplex PCR.

  8. PCR Primer Specific CaMV 35S Promoter to Detect Transgenic Soybean in Indonesia Commercial Soy Bean and Tempeh

    Tri Joko Raharjo

    2017-11-01

    Full Text Available In the framework of the supervision and enforcement of the regulation regarding the content of soybean transgenic in food and processed foods such as tempeh, a reliable testing method is indispensable. Performance specific primer PCR amplification with promoter of CaMV 35S tested to detect the presence of GMOs. The parameters tested were specificity, precision and cut off detection using CRM transgenic soybean. The method is reliable to detect transgenic soybean specifically and has the annealing temperature at 59 °C during the 30 cycle standard PCR condition. The method did not show any false positive and false negative results meaning good precision. The cut off the methods is up to 2 copies total DNA of soybean or less than 104 copies of the CaMV 35S promoter. Observation to the commercial soybeans and tempeh found that most of the commercially available soybean in Indonesia are transgenic (8 of 10 sample while all tested tempeh sample were detected have been fermented from transgenic soybeans.

  9. Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR.

    Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li

    2003-09-01

    Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

  10. Detection of all Chlamydophila and Chlamydia spp. of veterinary interest using species-specific real-time PCR assays.

    Pantchev, Alexandra; Sting, Reinhard; Bauerfeind, Rolf; Tyczka, Judith; Sachse, Konrad

    2010-12-01

    The aim of the present study was to analyse the occurrence of chlamydiae in several mammalian host species. Clinical samples that previously tested positive in a Chlamydiaceae-specific real-time PCR were retested using six species-specific real-time PCR assays to identify the chlamydial species involved. Chlamydophila (Cp.) abortus was the agent most frequently found in cattle, sheep, horses, goats, and pigs. Detection in cattle of Cp. psittaci (11% of samples) and Chlamydia (C.) suis (9%), as well as Cp. psittaci in a goat sample was somewhat unexpected. DNA of two different chlamydiae was identified in 56 (12.7%) of 440 samples tested. Cp. felis was the predominant species found in cats, while in guinea pigs and rabbits only Cp. caviae was detected. Interestingly, the latter two pathogens were also identified in samples from dogs. The data show that mixed chlamydial infections are not rare and suggest an extended host range of individual species. Copyright © 2009 Elsevier Ltd. All rights reserved.

  11. Development and validation of a real-time PCR assay for specific and sensitive detection of canid herpesvirus 1.

    Decaro, Nicola; Amorisco, Francesca; Desario, Costantina; Lorusso, Eleonora; Camero, Michele; Bellacicco, Anna Lucia; Sciarretta, Rossana; Lucente, Maria Stella; Martella, Vito; Buonavoglia, Canio

    2010-10-01

    A TaqMan-based real-time PCR assay targeting the glycoprotein B-encoding gene was developed for diagnosis of canid herpesvirus 1 (CHV-1) infection. The established assay was highly specific, since no cross-reactions were observed with other canine DNA viruses, including canine parvovirus type 2, canine minute virus, or canine adenovirus types 1 and 2. The detection limit was 10(1) and 1.20 x 10(1) DNA copies per 10 microl(-1) of template for standard DNA and a CHV-1-positive kidney sample, respectively: about 1-log higher than a gel-based PCR assay targeting the thymidine kinase gene. The assay was also reproducible, as shown by satisfactory low intra-assay and inter-assay coefficients of variation. CHV-1 isolates of different geographical origins were recognised by the TaqMan assay. Tissues and clinical samples collected from three pups which died of CHV-1 neonatal infection were also tested, displaying a wide distribution of CHV-l DNA in their organs. Unlike other CHV-1-specific diagnostic methods, this quantitative assay permits simultaneous detection and quantitation of CHV-1 DNA in a wide range of canine tissues and body fluids, thus providing a useful tool for confirmation of a clinical diagnosis, for the study of viral pathogenesis and for evaluation of the efficacy of vaccines and antiviral drugs. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  12. Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

    Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

    2017-08-01

    Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

  13. Development and validation of Burkholderia pseudomallei-specific real-time PCR assays for clinical, environmental or forensic detection applications.

    Erin P Price

    Full Text Available The bacterium Burkholderia pseudomallei causes melioidosis, a rare but serious illness that can be fatal if untreated or misdiagnosed. Species-specific PCR assays provide a technically simple method for differentiating B. pseudomallei from near-neighbor species. However, substantial genetic diversity and high levels of recombination within this species reduce the likelihood that molecular signatures will differentiate all B. pseudomallei from other Burkholderiaceae. Currently available molecular assays for B. pseudomallei detection lack rigorous validation across large in silico datasets and isolate collections to test for specificity, and none have been subjected to stringent quality control criteria (accuracy, precision, selectivity, limit of quantitation (LoQ, limit of detection (LoD, linearity, ruggedness and robustness to determine their suitability for environmental, clinical or forensic investigations. In this study, we developed two novel B. pseudomallei specific assays, 122018 and 266152, using a dual-probe approach to differentiate B. pseudomallei from B. thailandensis, B. oklahomensis and B. thailandensis-like species; other species failed to amplify. Species specificity was validated across a large DNA panel (>2,300 samples comprising Burkholderia spp. and non-Burkholderia bacterial and fungal species of clinical and environmental relevance. Comparison of assay specificity to two previously published B. pseudomallei-specific assays, BurkDiff and TTS1, demonstrated comparable performance of all assays, providing between 99.7 and 100% specificity against our isolate panel. Last, we subjected 122018 and 266152 to rigorous quality control analyses, thus providing quantitative limits of assay performance. Using B. pseudomallei as a model, our study provides a framework for comprehensive quantitative validation of molecular assays and provides additional, highly validated B. pseudomallei assays for the scientific research community.

  14. Sika deer (Cervus nippon)-specific real-time PCR method to detect fraudulent labelling of meat and meat products.

    Kaltenbrunner, Maria; Hochegger, Rupert; Cichna-Markl, Margit

    2018-05-08

    Since game meat is more valuable and expensive than meat from domesticated animal species it is a potential target for adulteration. Analytical methods must allow the identification and quantification of meat species to be applicable for the detection of fraudulent labelling. We developed a real-time PCR assay for the authentication of sika deer (Cervus nippon) and products thereof. The primer/probe system amplifies a 71 bp fragment of the kappa-casein precursor gene. Since the target sequence contained only one sika deer-specific base, we introduced a deliberate base mismatch in the forward primer. The real-time PCR assay did not show cross-reactivity with 19 animal and 49 plant species tested. Low cross-reactivity was observed with red deer, fallow deer, reindeer and moose. However, with a ΔCt value of ≥11.79 between sika deer and the cross-reacting species, cross-reactivity will not affect the accuracy of the method. LOD and LOQ, determined by analysing serial dilutions of a DNA extract containing 1% (w/w) sika deer DNA in pig DNA, were 0.3% and 0.5%, respectively. The accuracy was evaluated by analysing DNA mixtures and DNA isolates from meat extract mixtures and meat mixtures. In general, recoveries were in the range from 70 to 130%.

  15. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  16. Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

    Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

    2016-03-01

    The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

  17. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  18. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  19. Establishment of a minor groove binder-probe based quantitative real time PCR to detect Borrelia burgdorferi sensu lato and differentiation of Borrelia spielmanii by ospA-specific conventional PCR

    Strube Christina

    2010-08-01

    Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from

  20. Development of a taqman-based real-time PCR assay for the rapid and specific detection of novel duck- origin goose parvovirus.

    Wang, Jianchang; Wang, Jinfeng; Cui, Yuan; Nan, Huizhu; Yuan, Wanzhe

    2017-08-01

    A real-time PCR assay was developed for specific detection of novel duck-origin goose parvovirus (N-GPV), the etiological agent of duck beak atrophy and dwarfism syndrome (BADS). The detection limit of the assay was 10 2 copies. The assay was useful in the prevention and control of BADS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Evaluation of dual target-specific real-time PCR for the detection of Kingella kingae in a Danish paediatric population

    de Knegt, Victoria Elizabeth; Kristiansen, Gitte Qvist; Schønning, Kristian

    2017-01-01

    BACKGROUND: We aimed to evaluate the relevance of dual target real-time polymerase chain (PCR) assays targeting the rtxA and cpn60 genes of the paediatric pathogen Kingella kingae. We also studied for the first time the clinical and epidemiological features of K. kingae infections in a Danish pop......-value: peak in autumn. CONCLUSION: Dual target-specific real-time PCR markedly improved the detection of K. kingae in clinical specimens when compared to culture methods....

  2. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  3. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  4. Molecular detection and species-specific identification of medically important Aspergillus species by real-time PCR in experimental invasive pulmonary aspergillosis.

    Walsh, Thomas J; Wissel, Mark C; Grantham, Kevin J; Petraitiene, Ruta; Petraitis, Vidmantas; Kasai, Miki; Francesconi, Andrea; Cotton, Margaret P; Hughes, Johanna E; Greene, Lora; Bacher, John D; Manna, Pradip; Salomoni, Martin; Kleiboeker, Steven B; Reddy, Sushruth K

    2011-12-01

    Diagnosis of invasive pulmonary aspergillosis (IPA) remains a major challenge to clinical microbiology laboratories. We developed rapid and sensitive quantitative PCR (qPCR) assays for genus- and species-specific identification of Aspergillus infections by use of TaqMan technology. In order to validate these assays and understand their potential diagnostic utility, we then performed a blinded study of bronchoalveolar lavage (BAL) fluid specimens from well-characterized models of IPA with the four medically important species. A set of real-time qPCR primers and probes was developed by utilizing unique ITS1 regions for genus- and species-specific detection of the four most common medically important Aspergillus species (Aspergillus fumigatus, A. flavus, A. niger, and A. terreus). Pan-Aspergillus and species-specific qPCRs with BAL fluid were more sensitive than culture for detection of IPA caused by A. fumigatus in untreated (P < 0.0007) and treated (P ≤ 0.008) animals, respectively. For infections caused by A. terreus and A. niger, culture and PCR amplification from BAL fluid yielded similar sensitivities for untreated and treated animals. Pan-Aspergillus PCR was more sensitive than culture for detection of A. flavus in treated animals (P = 0.002). BAL fluid pan-Aspergillus and species-specific PCRs were comparable in sensitivity to BAL fluid galactomannan (GM) assay. The copy numbers from the qPCR assays correlated with quantitative cultures to determine the pulmonary residual fungal burdens in lung tissue. Pan-Aspergillus and species-specific qPCR assays may improve the rapid and accurate identification of IPA in immunocompromised patients.

  5. Development of Candida-Specific Real-Time PCR Assays for the Detection and Identification of Eight Medically Important Candida Species.

    Zhang, Jing; Hung, Guo-Chiuan; Nagamine, Kenjiro; Li, Bingjie; Tsai, Shien; Lo, Shyh-Ching

    2016-01-01

    Culture-based identification methods have been the gold standard for the diagnosis of fungal infection. Currently, molecular technologies such as real-time PCR assays with short turnaround time can provide desirable alternatives for the rapid detection of Candida microbes. However, most of the published PCR primer sets are not Candida specific and likely to amplify DNA from common environmental contaminants, such as Aspergillus microbes. In this study, we designed pan-Candida primer sets based on the ribosomal DNA-coding regions conserved within Candida but distinct from those of Aspergillus and Penicillium. We demonstrate that the final two selected pan-Candida primer sets would not amplify Aspergillus DNA and could be used to differentiate eight medically important Candida pathogens in real-time PCR assays based on their melting profiles, with a sensitivity of detection as low as 10 fg of Candida genomic DNA. Moreover, we further evaluated and selected species-specific primer sets covering Candida albicans, Candida glabrata, Candida tropicalis, and Candida dubliniensis and show that they had high sensitivity and specificity. These real-time PCR primer sets could potentially be assembled into a single PCR array for the rapid detection of Candida species in various clinical settings, such as corneal transplantation.

  6. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  7. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage

  8. Detection of Mycobacterium Tuberculosis by using PCR

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  9. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Steven

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18, is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer.Tissue blocks from 35 cases of in situ or invasive cervical squamous cell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 by conventional PCR using type specific primers, and for the housekeeping gene...

  10. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. A TaqMan-based real time PCR assay for specific detection and quantification of Xylella fastidiosa strains causing bacterial leaf scorch in oleander.

    Guan, Wei; Shao, Jonathan; Singh, Raghuwinder; Davis, Robert E; Zhao, Tingchang; Huang, Qi

    2013-02-15

    A TaqMan-based real-time PCR assay was developed for specific detection of strains of X. fastidiosa causing oleander leaf scorch. The assay uses primers WG-OLS-F1 and WG-OLS-R1 and the fluorescent probe WG-OLS-P1, designed based on unique sequences found only in the genome of oleander strain Ann1. The assay is specific, allowing detection of only oleander-infecting strains, not other strains of X. fastidiosa nor other plant-associated bacteria tested. The assay is also sensitive, with a detection limit of 10.4fg DNA of X. fastidiosa per reaction in vitro and in planta. The assay can also be applied to detect low numbers of X. fastidiosa in insect samples, or further developed into a multiplex real-time PCR assay to simultaneously detect and distinguish diverse strains of X. fastidiosa that may occupy the same hosts or insect vectors. Specific and sensitive detection and quantification of oleander strains of X. fastidiosa should be useful for disease diagnosis, epidemiological studies, management of oleander leaf scorch disease, and resistance screening for oleander shrubs. Published by Elsevier B.V.

  12. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

    McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...

  13. Numeric definition of the clinical performance of the nested reverse transcription-PCR for detection of hematogenous epithelial cells and correction for specific mRNA of non-target cell origin as evaluated for prostate cancer cells

    Schamhart, Denis; Swinnen, Johannes; Kurth, Karl-Heinz; Westerhof, Alex; Kusters, Ron; Borchers, Holger; Sternberg, Cora

    2003-01-01

    Background: Inappropriate quality management,of reverse transcription-PCR (RT-PCR) assays for the detection of blood-borne prostate cancer (PCa) cells hampers clinical conclusions. Improvement of the RT-PCR-methodology for prostate-specific, antigen (PSA) mRNA should focus on an appropriate numeric.

  14. Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

    Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

    2009-08-26

    Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

  15. A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

    Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

    2012-06-01

    The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

  16. Use of next generation sequencing data to develop a qPCR method for specific detection of EU-unauthorized genetically modified Bacillus subtilis overproducing riboflavin.

    Barbau-Piednoir, Elodie; De Keersmaecker, Sigrid C J; Delvoye, Maud; Gau, Céline; Philipp, Patrick; Roosens, Nancy H

    2015-11-11

    Recently, the presence of an unauthorized genetically modified (GM) Bacillus subtilis bacterium overproducing vitamin B2 in a feed additive was notified by the Rapid Alert System for Food and Feed (RASFF). This has demonstrated that a contamination by a GM micro-organism (GMM) may occur in feed additives and has confronted for the first time,the enforcement laboratories with this type of RASFF. As no sequence information of this GMM nor any specific detection or identification method was available, Next GenerationSequencing (NGS) was used to generate sequence information. However, NGS data analysis often requires appropriate tools, involving bioinformatics expertise which is not alwayspresent in the average enforcement laboratory. This hampers the use of this technology to rapidly obtain critical sequence information in order to be able to develop a specific qPCRdetection method. Data generated by NGS were exploited using a simple BLAST approach. A TaqMan® qPCR method was developed and tested on isolated bacterial strains and on the feed additive directly. In this study, a very simple strategy based on the common BLAST tools that can be used by any enforcement lab without profound bioinformatics expertise, was successfully used toanalyse the B. subtilis data generated by NGS. The results were used to design and assess a new TaqMan® qPCR method, specifically detecting this GM vitamin B2 overproducing bacterium. The method complies with EU critical performance parameters for specificity, sensitivity, PCR efficiency and repeatability. The VitB2-UGM method also could detect the B. subtilis strain in genomic DNA extracted from the feed additive, without prior culturing step. The proposed method, provides a crucial tool for specifically and rapidly identifying this unauthorized GM bacterium in food and feed additives by enforcement laboratories. Moreover, this work can be seen as a case study to substantiate how the use of NGS data can offer an added value to easily

  17. Restriction Cascade Exponential Amplification (RCEA) assay with an attomolar detection limit: a novel, highly specific, isothermal alternative to qPCR.

    Ghindilis, Andrey L; Smith, Maria W; Simon, Holly M; Seoudi, Ihab A; Yazvenko, Nina S; Murray, Iain A; Fu, Xiaoqing; Smith, Kenneth; Jen-Jacobson, Linda; Xu, Shuang-Yong

    2015-01-13

    An alternative to qPCR was developed for nucleic acid assays, involving signal rather than target amplification. The new technology, Restriction Cascade Exponential Amplification (RCEA), relies on specific cleavage of probe-target hybrids by restriction endonucleases (REase). Two mutant REases for amplification (Ramp), S17C BamHI and K249C EcoRI, were conjugated to oligonucleotides, and immobilized on a solid surface. The signal generation was based on: (i) hybridization of a target DNA to a Ramp-oligonucleotide probe conjugate, followed by (ii) specific cleavage of the probe-target hybrid using a non-immobilized recognition REase. The amount of Ramp released into solution upon cleavage was proportionate to the DNA target amount. Signal amplification was achieved through catalysis, by the free Ramp, of a restriction cascade containing additional oligonucleotide-conjugated Ramp and horseradish peroxidase (HRP). Colorimetric quantification of free HRP indicated that the RCEA achieved a detection limit of 10 aM (10(-17) M) target concentration, or approximately 200 molecules, comparable to the sensitivity of qPCR-based assays. The RCEA assay had high specificity, it was insensitive to non-specific binding, and detected target sequences in the presence of foreign DNA. RCEA is an inexpensive isothermal assay that allows coupling of the restriction cascade signal amplification with any DNA target of interest.

  18. PCR specific for Actinobacillus pleuropneumoniae serotype 3

    Zhou, L.; Jones, S.C.P.; Angen, Øystein

    2008-01-01

    , but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...

  19. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  20. Detection and Serogrouping of Dichelobacter nodosus Infection by Use of Direct PCR from Lesion Swabs To Support Outbreak-Specific Vaccination for Virulent Footrot in Sheep.

    McPherson, Andrew S; Dhungyel, Om P; Whittington, Richard J

    2018-04-01

    Virulent footrot is an economically significant disease in most sheep-rearing countries. The disease can be controlled with vaccine targeting the fimbriae of virulent strains of the essential causative agent, Dichelobacter nodosus However, the bacterium is immunologically heterogeneous, and 10 distinct fimbrial serogroups have been identified. Ideally, in each outbreak the infecting strains would be cultured and serogrouped so that the appropriate serogroup-specific mono- or bivalent vaccine could be administered, because multivalent vaccines lack efficacy due to antigenic competition. If clinical disease expression is suspected to be incomplete, culture-based virulence tests are required to confirm the diagnosis, because control of benign footrot is economically unjustifiable. Both diagnosis and vaccination are conducted at the flock level. The aims of this study were to develop a PCR-based procedure for detecting and serogrouping D. nodosus directly from foot swabs and to determine whether this could be done accurately from the same cultured swab. A total of 269 swabs from the active margins of foot lesions of 261 sheep in 12 Merino sheep flocks in southeastern Australia were evaluated. DNA extracts taken from putative pure cultures of D. nodosus and directly from the swabs were evaluated in PCR assays for the 16S rRNA and fimA genes of D. nodosus Pure cultures were tested also by the slide agglutination test. Direct PCR using extracts from swabs was more sensitive than culture for detecting and serogrouping D. nodosus strains. Using the most sensitive sample collection method of the use of swabs in lysis buffer, D. nodosus was more likely to be detected by PCR in active than in inactive lesions, and in lesions with low levels of fecal contamination, but lesion score was not a significant factor. PCR conducted on extracts from swabs in modified Stuart's transport medium that had already been used to inoculate culture plates had lower sensitivity. Therefore, if

  1. Development of an RT-qPCR assay for the specific detection of a distinct genetic lineage of the infectious bursal disease virus.

    Tomás, Gonzalo; Hernández, Martín; Marandino, Ana; Techera, Claudia; Grecco, Sofia; Hernández, Diego; Banda, Alejandro; Panzera, Yanina; Pérez, Ruben

    2017-04-01

    The infectious bursal disease virus (IBDV) is a major health threat to the world's poultry industry despite intensive controls including proper biosafety practices and vaccination. IBDV (Avibirnavirus, Birnaviridae) is a non-enveloped virus with a bisegmented double-stranded RNA genome. The virus is traditionally classified into classic, variant and very virulent strains, each with different epidemiological relevance and clinical implications. Recently, a novel worldwide spread genetic lineage was described and denoted as distinct (d) IBDV. Here, we report the development and validation of a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay for the specific detection of dIBDVs in the global poultry industry. The assay employs a TaqMan-MGB probe that hybridizes with a unique molecular signature of dIBDV. The assay successfully detected all the assessed strains belonging to the dIBDV genetic lineage, showing high specificity and absence of cross-reactivity with non-dIBDVs, IBDV-negative samples and other common avian viruses. Using serial dilutions of in vitro-transcribed RNA we obtained acceptable PCR efficiencies and determination coefficients, and relatively small intra- and inter-assay variability. The assay demonstrated a wide dynamic range between 10 3 and 10 8 RNA copies/reaction. This rapid, specific and quantitative assay is expected to improve IBDV surveillance and control worldwide and to increase our understanding of the molecular epidemiology of this economically detrimental poultry pathogen.

  2. Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

    Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-02-18

    In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

  3. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    Leyla Esfandiari

    2016-07-01

    Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  4. Establishment of real time allele specific locked nucleic acid quantitative PCR for detection of HBV YIDD (ATT mutation and evaluation of its application.

    Yongbin Zeng

    Full Text Available BACKGROUND: Long-term use of nucleos(tide analogues can increase risk of HBV drug-resistance mutations. The rtM204I (ATT coding for isoleucine is one of the most important resistance mutation sites. Establishing a simple, rapid, reliable and highly sensitive assay to detect the resistant mutants as early as possible is of great clinical significance. METHODS: Recombinant plasmids for HBV YMDD (tyrosine-methionine-aspartate-aspartate and YIDD (tyrosine-isoleucine-aspartate-aspartate were constructed by TA cloning. Real time allele specific locked nucleic acid quantitative PCR (RT-AS-LNA-qPCR with SYBR Green I was established by LNA-modified primers and evaluated with standard recombinant plasmids, clinical templates (the clinical wild type and mutant HBV DNA mixture and 102 serum samples from nucleos(tide analogues-experienced patients. The serum samples from a chronic hepatitis B (CHB patient firstly received LMV mono therapy and then switched to LMV + ADV combined therapy were also dynamically analyzed for 10 times. RESULTS: The linear range of the assay was between 1×10(9 copies/μl and 1 × 10(2 copies/μl. The low detection limit was 1 × 10(1 copies/μl. Sensitivity of the assay were 10(-6, 10(-4 and 10(-2 in the wild-type background of 1 × 10(9 copies/μl, 1 × 10(7 copies/μl and 1 × 10(5 copies/μl, respectively. The sensitivity of the assay in detection of clinical samples was 0.03%. The complete coincidence rate between RT-AS-LNA-qPCR and direct sequencing was 91.2% (93/102, partial coincidence rate was 8.8% (9/102, and no complete discordance was observed. The two assays showed a high concordance (Kappa = 0.676, P = 0.000. Minor variants can be detected 18 weeks earlier than the rebound of HBV DNA load and alanine aminotransferase level. CONCLUSIONS: A rapid, cost-effective, high sensitive, specific and reliable method of RT-AS-LNA-qPCR with SYBR Green I for early and absolute quantification of HBV YIDD (ATT coding for isoleucine

  5. Development and Validation of a TaqMan Real-Time PCR Assay for the Specific Detection and Quantification of Fusarium fujikuroi in Rice Plants and Seeds.

    Carneiro, Greice Amaral; Matić, Slavica; Ortu, Giuseppe; Garibaldi, Angelo; Spadaro, Davide; Gullino, Maria Lodovica

    2017-07-01

    Bakanae disease, which is caused by the seedborne pathogen Fusarium fujikuroi, is found throughout the world on rice. A TaqMan real-time PCR has been developed on the TEF 1-α gene to detect F. fujikuroi in different rice tissues. Three primer/probe sets were tested. The selected set produced an amplicon of 84 bp and was specific for F. fujikuroi with respect to eight Fusarium species of rice and six other rice common pathogens. The assay was validated for specificity, selectivity, sensitivity, repeatability, and reproducibility. The detection limit was set at 27.5 fg of DNA, which is approximately equivalent to one haploid genome of F. fujikuroi. The developed TaqMan real-time assay was able to efficiently detect and quantify F. fujikuroi from rice culms, leaves, roots, and seeds. At 1 week post-germination (wpg), the pathogen was more diffused in the green tissues, while at 3 wpg it was uniformly spread also in the roots. The highest concentration of F. fujikuroi was measured in the M6 cultivar, which showed around 1,450 fungal cells/g. The assay was sufficiently sensitive to detect a few genomic equivalents in the rice seeds, corresponding to 9.89 F. fujikuroi cells/g. The assay permitted bakanae disease to be detected in asymptomatic tissues at the early rice development stages.

  6. Minority drug-resistant HIV-1 variants in treatment naïve East-African and Caucasian patients detected by allele-specific real-time PCR.

    Halime Ekici

    Full Text Available To assess the presence of two major non-nucleoside reverse transcriptase inhibitors (NNRTI drug resistance mutations (DRMs, Y181C and K103N, in minor viral quasispecies of treatment naïve HIV-1 infected East-African and Swedish patients by allele-specific polymerase chain reaction (AS-PCR.Treatment naïve adults (n=191 with three epidemiological backgrounds were included: 92 Ethiopians living in Ethiopia; 55 East-Africans who had migrated to Sweden; and 44 Caucasians living in Sweden. The pol gene was analysed by standard population sequencing and by AS-PCR for the detection of Y181C and K103N.The Y181C was detected in the minority quasispecies of six Ethiopians (6.5%, in two Caucasians (4.5%, and in one East-African (1.8%. The K103N was detected in one East- African (1.8%, by both methods. The proportion of mutants ranged from 0.25% to 17.5%. Additional DRMs were found in all three treatment naïve patient groups by population sequencing.Major NNRTI mutations can be found by AS-PCR in minor quasispecies of treatment naïve HIV-1 infected Ethiopians living in Ethiopia, in East-African and Caucasian patients living in Sweden in whom population sequencing reveal wild-type virus only. Surveys with standard sequencing are likely to underestimate transmitted drug resistance and the presence of resistant minor quasispecies in treatment naïve patients should be topic for future large scale studies.

  7. Rapid and Specific Detection of Acidovorax avenae subsp. citrulli Using SYBR Green-Based Real-Time PCR Amplification of the YD-Repeat Protein Gene.

    Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk

    2015-09-01

    The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.

  8. Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

    Paula Rogério Fernandes

    2008-09-01

    rDNA (ITS1 and ITS2. A pair of primers was constructed for the genus-specific amplification of a 648 bp fragment and two others to amplify T. foetus species-specific fragments of 343 and 429 bp. No cross amplification was observed against Bos taurus genomic DNA neither against the DNA of usual bovine genital pathogens. Both, single and nested-PCR assays, presented analytical sensitivity to detect at least two T. foetus organisms.

  9. A real-time PCR assay with improved specificity for detection and discrimination of all clinically relevant Bordetella species by the presence and distribution of three Insertion Sequence elements

    Ossewaarde Jacobus M

    2011-01-01

    Full Text Available Abstract Background In Dutch laboratories molecular detection of B. pertussis and B. parapertussis is commonly based on insertion sequences IS481 and IS1001, respectively. Both IS elements are more widely spread among Bordetella species. Both Bordetella holmesii, and B. bronchiseptica can harbour IS481. Also, IS1001 is found among B. bronchiseptica. IS481, and IS1001 based PCR thus lacks specificity when used for detection of specific Bordetella spp. Findings We designed a PCR based on IS1002, another IS element that is present among Bordetella species, and exploited it as a template in combination with PCR for IS481, and IS1001. In combining the PCRs for IS481, IS1001, and IS1002, and including an inhibition control, we were able to detect and discriminate all clinically relevant Bordetella species. Conclusions We developed an improved PCR method for specific detection of B. pertussis, B. parapertussis, B. holmesii, and B. bronchiseptica.

  10. Detection of EGFR mutations in plasma and biopsies from non-small cell lung cancer patients by allele-specific PCR assays

    Weber, Britta; Meldgaard, Peter; Hager, Henrik

    2014-01-01

    samples with allele-specific PCR assays. METHODS: Pairs of the diagnostic biopsy and plasma obtained just prior to start of erlotinib treatment were collected from 199 patients with adenocarcinoma of non-small-cell lung cancer. DNA from both sample types was isolated and examined for the presence...... of mutations in exons 18-21 of the EGFR gene, employing the cobas(®) EGFR Tissue Test and cobas(®) EGFR Blood Test (in development, Roche Molecular Systems, Inc., CA, USA). RESULTS: Test results were obtained in all 199 (100%) plasma samples and 196/199 (98%) of the biopsies. EGFR-activating mutations were...... identified in 24/199 (12%) plasma samples and 28/196 (14%) biopsy samples, and 17/196 (9%) matched pairs contained the same mutation. Six EGFR mutations were present only in plasma samples but not in the biopsy samples. The overall concordance of the EGFR gene mutations detected in plasma and biopsy tissue...

  11. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    Assawamakin Anunchai

    2007-08-01

    Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number

  12. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  13. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  14. Using group-specific PCR to detect predation of mayflies (Ephemeroptera) by wolf spiders (Lycosidae) at a mercury-contaminated site.

    Northam, Weston T; Allison, Lizabeth A; Cristol, Daniel A

    2012-02-01

    Bioaccumulation of contaminants can occur across ecosystem boundaries via transport by emergent aquatic insects. In the South River, Virginia, USA, aquatic mercury has contaminated songbirds nesting in adjacent riparian forests. Spiders contribute the majority of mercury to these songbirds' diets. We tested the hypothesis that massive annual mayfly emergences provide a vector for mercury from river sediments to the Lycosid spiders most frequently eaten by contaminated songbirds. We designed mayfly-specific PCR primers that amplified mtDNA from 76% of adult mayflies collected at this site. By combining this approach with an Agilent 2100 electrophoresis system, we created a highly sensitive test for mayfly predation by Lycosids, commonly known as wolf spiders. In laboratory spider feeding trials, mayfly DNA could be detected up to 192h post-ingestion; however, we detected no mayfly predation in a sample of 110 wolf spiders collected at the site during mayfly emergence. We suggest that mayfly predation is not an important mechanism for dietary transfer of mercury to wolf spiders and their avian predators at the South River. Instead, floodplain soil should be considered as a potential proximate source for mercury in the terrestrial food web. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. A multiplex PCR for detection of six viruses in ducks.

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  16. Estimating sensitivity and specificity of a PCR for boot socks to detect Campylobacter in broiler primary production using Bayesian latent class analysis

    Matt, Monika; Nordentoft, Steen; Ian, Kopacka

    2016-01-01

    samples were collected at slaughter.The results were evaluated in the absence of a gold standard using a Bayesian latent class model. Austrian results showed higher sensitivity for PCR detection in sock samples (0.98; Bayesian credible interval (BCI) [0.93-1]) than for culture of faecal droppings (0....... Therefore the model results for the PCR sensitivity (0.88; BCI [0.83-0.97]) and cultural ISO-method in faecal samples (0.84; BCI [0.76-0.92]) are lower than for caecal samples (0.93; BCI [0.85-0.98]). In our study, PCR detection on boot sock samples is more sensitive than conventional culture. In view...

  17. [Optimized application of nested PCR method for detection of malaria].

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  18. Digital PCR for detection of citrus pathogens

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  19. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Stephen Jacques

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18 is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer. Tissue blocks from 35 cases of in situ or invasive cervical squamouscell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 and for the housekeeping gene beta-actin by conventional PCR using type...

  20. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  1. Transgene detection by digital droplet PCR.

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  2. Comparison of the sensitivity and specificity of real-time PCR and in situ hybridization in HPV16 and 18 detection in archival cervical cancer specimens

    Beata Biesaga

    2012-07-01

    Full Text Available The aim of this study was to analyze the correlation between real-time PCR (RT-PCR treated as a reference method and in situ hybridization with tyramide amplification system (ISH-TSA in the detection of HPV16 and 18 infection and the assessment of viral genome status. The study was performed on cervical cancer biopsies fixed in 10% neutral buffered formalin and embedded in paraffin obtained from 85 women. TaqMan-based 5’exonuclease RT-PCR with type-specific primers was used to assess HPV16 and 18 infections and genome status. Viral infection and genome status was also assessed by ISH-TSA. RT-PCR revealed 76 (89.4%, and ISH-TSA 81 (95.3% cancers with HPV16 and 18 infections. The ISH-TSA sensitivity and specificity were: 96.1% and 11.1% compared to RT-PCR. The difference between these techniques in HPV detection was significant (p = 0.000. Among 76 HPV16/18 positive cancers in RT-PCR, there were 30 (39.5% with integrated and 46 (60.5% with mixed viral genome form. According to ISH-TSA, there were 39 (51.3% samples with integrated and 37 with mixed form (48.7%. The sensitivity and specificity of ISH-TSA in genome status assessment were 70.0% and 60.9%, respectively. The difference between RT-PCR and ISH-TSA in genome state detection was not statistically significant (p = 0.391. These results suggest that ISH-TSA shows insufficient specificity in HPV detection for use in clinical practice. However, this assay could be applied for viral genome status assessment.

  3. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  4. Detection of Bacillus spores using PCR and FTA filters.

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  5. Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

    Ulrich Andergassen

    2013-01-01

    Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

  6. RT-PCR Detection of HIV in Republic of Macedonia

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  7. PCR detection of potato cyst nematode.

    Reid, Alex

    2009-01-01

    Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.

  8. Ureaplasma parvum prosthetic joint infection detected by PCR.

    Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

    2014-06-01

    We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Detection of Streptococcus pneumoniae in whole blood by PCR.

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

    1995-03-01

    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  10. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  11. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  12. Shape based kinetic outlier detection in real-time PCR

    D'Atri Mario

    2010-04-01

    Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.

  13. Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR

    Roman Wölfel

    2012-08-01

    Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

  14. Halal authenticity of gelatin using species-specific PCR.

    Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

    2015-10-01

    Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  17. The analysis of novel microRNA mimic sequences in cancer cells reveals lack of specificity in stem-loop RT-qPCR-based microRNA detection.

    Winata, Patrick; Williams, Marissa; McGowan, Eileen; Nassif, Najah; van Zandwijk, Nico; Reid, Glen

    2017-11-17

    MicroRNAs are frequently downregulated in cancer, and restoring expression has tumour suppressive activity in tumour cells. Our recent phase I clinical trial investigated microRNA-based therapy in patients with malignant pleural mesothelioma. Treatment with TargomiRs, microRNA mimics with novel sequence packaged in EGFR antibody-targeted bacterial minicells, revealed clear signs of clinical activity. In order to detect delivery of microRNA mimics to tumour cells in future clinical trials, we tested hydrolysis probe-based assays specific for the sequence of the novel mimics in transfected mesothelioma cell lines using RT-qPCR. The custom assays efficiently and specifically amplified the consensus mimics. However, we found that these assays gave a signal when total RNA from untransfected and control mimic-transfected cells were used as templates. Further investigation revealed that the reverse transcription step using stem-loop primers appeared to introduce substantial non-specific amplification with either total RNA or synthetic RNA templates. This suggests that reverse transcription using stem-loop primers suffers from an intrinsic lack of specificity for the detection of highly similar microRNAs in the same family, especially when analysing total RNA. These results suggest that RT-qPCR is unlikely to be an effective means to detect delivery of microRNA mimic-based drugs to tumour cells in patients.

  18. Detection of Tumor Markers in Prostate Cancer and Comparison of Sensitivity between Real Time and Nested PCR

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-01-01

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivi...

  19. Application of bioinformatics on the detection of pathogens by Pcr

    Rezig, Slim; Sakhri, Saber

    2007-01-01

    Salmonellas are the main responsible agent for the frequent food-borne gastrointestinal diseases. Their detection using classical methods are laborious and their results take a lot of time to be revealed. In this context, we tried to set up a revealing technique of the invA virulence gene, found in the majority of Salmonella species. After amplification with PCR using specific primers created and verified by bioinformatics programs, two couples of primers were set up and they appeared to be very specific and sensitive for the detection of invA gene. (Author)

  20. Strategy for Extracting DNA from Clay Soil and Detecting a Specific Target Sequence via Selective Enrichment and Real-Time (Quantitative) PCR Amplification ▿

    Yankson, Kweku K.; Steck, Todd R.

    2009-01-01

    We present a simple strategy for isolating and accurately enumerating target DNA from high-clay-content soils: desorption with buffers, an optional magnetic capture hybridization step, and quantitation via real-time PCR. With the developed technique, μg quantities of DNA were extracted from mg samples of pure kaolinite and a field clay soil. PMID:19633108

  1. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  2. FTA card utility for PCR detection of Mycobacterium leprae.

    Aye, Khin Saw; Matsuoka, Masanori; Kai, Masanori; Kyaw, Kyaw; Win, Aye Aye; Shwe, Mu Mu; Thein, Min; Htoo, Maung Maung; Htoon, Myo Thet

    2011-01-01

    The suitability of the FTA® elute card for the collection of slit skin smear (SSS) samples for PCR detection of Mycobacterium leprae was evaluated. A total of 192 SSS leprosy samples, of bacillary index (BI) 1 to 5, were collected from patients attending two skin clinics in Myanmar and preserved using both FTA® elute cards and 70% ethanol tubes. To compare the efficacy of PCR detection of DNA from each BI class, PCR was performed to amplify an M. leprae-specific repetitive element. Of the 192 samples, 116 FTA® elute card and 112 70% ethanol samples were PCR positive for M. leprae DNA. When correlated with BI, area under the curve (AUC) values of the respective receiver-operating characteristic curves were similar for the FTA® elute card and ethanol collection methods (AUC=0.6). Taken together, our results indicate that the FTA® elute card, which enables the collection, transport, and archiving of clinical samples, is an attractive alternative to ethanol preservation for the detection of M. leprae DNA.

  3. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  4. Specific detection of Echinococcus spp. from the Tibetan fox (Vulpes ferrilata) and the red fox (V. vulpes) using copro-DNA PCR analysis.

    Jiang, Weibin; Liu, Nan; Zhang, Gaotian; Renqing, Pengcuo; Xie, Fei; Li, Tiaoying; Wang, Zhenghuan; Wang, Xiaoming

    2012-10-01

    There are three Echinococcus species, Echinococcus granulosus, E. multilocularis, and E. shiquicus, which are distributed on the vast area of pastureland on the eastern Tibetan plateau in China. Tibetan foxes (Vulpes ferrilata) have been determined to be the main wild definitive host of E. multilocularis and E. shiquicus, but little information is available on the prevalence of these two parasites in Tibetan foxes. Consequently, the copro-prevalence of these parasites in foxes from the eastern Tibetan plateau was evaluated in this study. For each copro-DNA sample extracted from fox feces, a 133-bp segment of EgG1 Hae III was used to screen for infection with E. granulosus. Multiplex nested polymerase chain reaction (PCR) analysis was used to target an 874-bp segment of the mitochondrial COI gene to distinguish E. multilocularis and E. shiquicus. Among 184 fecal samples, 120 were from Tibetan foxes and six from red foxes (Vulpes vulpes). Of the fecal samples from Tibetan foxes, 74 (giving a copro-prevalence of 62%) showed the presence of Echinococcus spp.: 23 (19%) were found to contain E. multilocularis, 32 (27%) E. shiquicus, and 19 (16%) showed mixed infection with both E. multilocularis and E. shiquicus. Two fecal samples from red foxes were found to be infected with E. multilocularis. No fox feces were found to be infected with E. granulosus. Tests on zinc finger protein genes and a 105-bp fragment of the Sry gene found no significant difference in the prevalence of the two parasites between sexes. The efficiency of our multiplex nested PCR methods were compared with previous polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) methods and some problems associated with the copro-PCR were discussed.

  5. Development of a Species-Specific PCR Assay for Detection of Leishmania donovani in Clinical Samples from Patients with Kala-Azar and Post-Kala-Azar Dermal Leishmaniasis

    Salotra, Poonam; Sreenivas, G.; Pogue, Gregory P.; Lee, Nancy; Nakhasi, Hira L.; Ramesh, V.; Negi, N. S.

    2001-01-01

    We have developed a PCR assay that is capable of amplifying kinetoplast DNA (kDNA) of Leishmania donovani in a species-specific manner among Old World leishmanias. With Indian strains and isolates of L. donovani the assay was sensitive enough to detect kDNA in an amount equivalent to a single parasite or less. The extreme sensitivity of the assay was reflected in its ability to detect parasite DNA from small volumes of peripheral blood of patients with kala-azar (KA) and from skin lesions from patients with post-KA dermal leishmaniasis (PKDL). A total of 107 clinical leishmaniasis samples were analyzed. Of these 102 (95.3%) were positive by PCR. The test provided a diagnosis of KA with 96% sensitivity using patient whole-blood samples instead of bone marrow or spleen aspirates that are obtained by invasive procedures. The assay was also successful in the diagnosis of 45 of 48 PKDL cases (93.8%). Cross-reactions with pathogens prevalent in the area of endemicity, viz., Mycobacterium tuberculosis, Mycobacterium leprae, and Plasmodium spp., could be ruled out. Eighty-one control samples, including dermal scrapings from healthy portions of skin from patients with PKDL were all negative. Two of twenty controls from the area of endemicity were found positive by PCR assay; however, there was a good possibility that these two were asymptomatic carriers since they were serologically positive for KA. Thus, this PCR assay represents a tool for the diagnosis of KA and PKDL in Indian patients in a noninvasive manner, with simultaneous species identification of parasites in clinical samples. PMID:11230394

  6. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  8. Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

    Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

  9. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Real-Time PCR for Universal Phytoplasma Detection and Quantification

    Christensen, Nynne Meyn; Nyskjold, Henriette; Nicolaisen, Mogens

    2013-01-01

    Currently, the most efficient detection and precise quantification of phytoplasmas is by real-time PCR. Compared to nested PCR, this method is less sensitive to contamination and is less work intensive. Therefore, a universal real-time PCR method will be valuable in screening programs and in other...

  11. Detection of tumor markers in prostate cancer and comparison of sensitivity between real time and nested PCR.

    Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro

    2012-06-27

    The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivity by real time PCR and nested PCR. In real time PCR, there was a significant correlation between cell number and the RNA concentration obtained (R(2)=0.9944) for PSA, PSMA, and AR. We found it possible to detect these markers from a single LNCaP cell in both real time and nested PCR. By comparison, nested PCR reached a linear curve in fewer PCR cycles than real time PCR, suggesting that nested PCR may offer PCR results more quickly than real time PCR. In conclusion, nested PCR may offer tumor maker detection in PCa cells more quickly (with fewer PCR cycles) with the same high sensitivity as real time PCR. Further study is necessary to establish and evaluate the best tool for PCa tumor marker detection.

  12. Comparison of ELISA, nested PCR and sequencing and a novel qPCR for detection of Giardia isolates from Jordan.

    Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una

    2018-02-01

    Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  14. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  15. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  16. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  17. Multiplex RT-PCR detection of four aphid-borne strawberry viruses in Fragaria spp. in combination with a plant mRNA specific internal control

    Thompson, J. R.; Wetzel, S.; Klerks, M. M.; Vašková, Dana; Schoen, C. D.; Špak, Josef; Jelkmann, W.

    2003-01-01

    Roč. 111, - (2003), s. 85-93 ISSN 0166-0934 Grant - others:GA-(EU) QRLT-PL99-1553 Institutional research plan: CEZ:AV0Z5051902 Keywords : virus diseases * strawberry * detection methods Subject RIV: EE - Microbiology, Virology Impact factor: 1.826, year: 2003

  18. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.

    Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge

    2013-12-27

    Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.

  20. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  1. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  2. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    Wen, Weijia

    2011-03-03

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable chip with volumes as small as 1.25 µl, while the heating and cooling rate may be as fast as 12.7 °C/second ensuring that the total time needed of only 25 minutes to complete the 35 cycle PCR amplification. The PCR may be performed according to a two-temperature approach for denaturing and annealing (Td and Ta) of DNA with the PCR chip, with which the amplification of male-specific SRY gene marker by utilizing raw saliva may be achieved. The genetic identification may be in-situ detected after PCR by the optical detection system.

  3. Fast detection of genetic information by an optimized PCR in an interchangeable chip.

    Wu, Jinbo

    2012-02-01

    In this paper, we report the construction of a polymerase chain reaction (PCR) device for fast amplification and detection of DNA. This device consists of an interchangeable PCR chamber, a temperature control component as well as an optical detection system. The DNA amplification happens on an interchangeable chip with the volumes as low as 1.25 μl, while the heating and cooling rate was as fast as 12.7°C/second ensuring that the total time needed of only 25 min to complete the 35 cycle PCR amplification. An optimized PCR with two-temperature approach for denaturing and annealing (Td and Ta) of DNA was also formulated with the PCR chip, with which the amplification of male-specific sex determining region Y (SRY) gene marker by utilizing raw saliva was successfully achieved and the genetic identification was in-situ detected right after PCR by the optical detection system.

  4. Pure chromosome-specific PCR libraries from single sorted chromosomes

    VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

    1994-01-01

    Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

  5. Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

    Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2011-01-01

    It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

  6. gbpA as a Novel qPCR Target for the Species-Specific Detection of Vibrio cholerae O1, O139, Non-O1/Non-O139 in Environmental, Stool, and Historical Continuous Plankton Recorder Samples.

    Luigi Vezzulli

    Full Text Available The Vibrio cholerae N-acetyl glucosamine-binding protein A (GbpA is a chitin-binding protein involved in V. cholerae attachment to environmental chitin surfaces and human intestinal cells. We previously investigated the distribution and genetic variations of gbpA in a large collection of V. cholerae strains and found that the gene is consistently present and highly conserved in this species. Primers and probe were designed from the gbpA sequence of V. cholerae and a new Taq-based qPCR protocol was developed for diagnostic detection and quantification of the bacterium in environmental and stool samples. In addition, the positions of primers targeting the gbpA gene region were selected to obtain a short amplified fragment of 206 bp and the protocol was optimized for the analysis of formalin-fixed samples, such as historical Continuous Plankton Recorder (CPR samples. Overall, the method is sensitive (50 gene copies, highly specific for V. cholerae and failed to amplify strains of the closely-related species Vibrio mimicus. The sensitivity of the assay applied to environmental and stool samples spiked with V. cholerae ATCC 39315 was comparable to that of pure cultures and was of 102 genomic units/l for drinking and seawater samples, 101 genomic units/g for sediment and 102 genomic units/g for bivalve and stool samples. The method also performs well when tested on artificially formalin-fixed and degraded genomic samples and was able to amplify V. cholerae DNA in historical CPR samples, the earliest of which date back to August 1966. The detection of V. cholerae in CPR samples collected in cholera endemic areas such as the Benguela Current Large Marine Ecosystem (BCLME is of particular significance and represents a proof of concept for the possible use of the CPR technology and the developed qPCR assay in cholera studies.

  7. Detection of Flavobacterium psychrophilum from fish tissue and water samples by PCR amplification

    Wiklund, T.; Madsen, Lone; Bruun, Morten Sichlau

    2000-01-01

    investigation, the possible detection of Fl. psychrophilum from fish tissue and water samples was examined using nested PCR with DNA probes against a sequence of the 16S rRNA genes. The DNA was extracted using Chelex(R) 100 chelating resin. The primers, which were tested against strains isolated from diseased...... fish, healthy fish, fish farm environments and reference strains, proved to be specific for Fl. psychrophilum. The obtained detection limit of Fl. psychrophilum seeded into rainbow trout brain tissue was 0.4 cfu in the PCR tube, corresponding to 17 cfu mg(-1) brain tissue. The PCR-assay proved...... to be more sensitive than agar cultivation of tissue samples from the brain of rainbow trout injected with Fl. psychrophilum. In non-sterile fresh water seeded with Fl. psychrophilum the detection limit of the PCR- assay was 1.7 cfu in the PCR tube, corresponding to 110 cfu ml(-1) water. The PCR...

  8. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  9. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  10. Comparison of Established Diagnostic Methodologies and a Novel Bacterial smpB Real-Time PCR Assay for Specific Detection of Haemophilus influenzae Isolates Associated with Respiratory Tract Infections.

    Reddington, Kate; Schwenk, Stefan; Tuite, Nina; Platt, Gareth; Davar, Danesh; Coughlan, Helena; Personne, Yoann; Gant, Vanya; Enne, Virve I; Zumla, Alimuddin; Barry, Thomas

    2015-09-01

    Haemophilus influenzae is a significant causative agent of respiratory tract infections (RTI) worldwide. The development of a rapid H. influenzae diagnostic assay that would allow for the implementation of infection control measures and also improve antimicrobial stewardship for patients is required. A number of nucleic acid diagnostics approaches that detect H. influenzae in RTIs have been described in the literature; however, there are reported specificity and sensitivity limitations for these assays. In this study, a novel real-time PCR diagnostic assay targeting the smpB gene was designed to detect all serogroups of H. influenzae. The assay was validated using a panel of well-characterized Haemophilus spp. Subsequently, 44 Haemophilus clinical isolates were collected, and 36 isolates were identified as H. influenzae using a gold standard methodology that combined the results of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and a fucK diagnostic assay. Using the novel smpB diagnostic assay, 100% concordance was observed with the gold standard, demonstrating a sensitivity of 100% (95% confidence interval [CI], 90.26% to 100.00%) and a specificity of 100% (95% CI, 63.06% to 100.00%) when used on clinical isolates. To demonstrate the clinical utility of the diagnostic assay presented, a panel of lower RTI samples (n = 98) were blindly tested with the gold standard and smpB diagnostic assays. The results generated were concordant for 94/98 samples tested, demonstrating a sensitivity of 90.91% (95% CI, 78.33% to 97.47%) and a specificity of 100% (95% CI, 93.40% to 100.00%) for the novel smpB assay when used directly on respiratory specimens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. Standardization of diagnostic PCR for the detection of foodborne pathogens

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  12. Detection of mRNA by reverse transcription PCR as an indicator of viability in Phytophthora ramorum

    Antonio Chimento; Santa Olga Cacciola; Matteo Garbelotto

    2008-01-01

    Real-Time PCR technologies offer increasing opportunities to detect and study phytopathogenic fungi. They combine the sensitivity of conventional PCR with the generation of a specific fluorescent signal providing both real-time analysis of the reaction kinetics and quantification of specific DNA targets. Before the development of Real-Time PCR and...

  13. Detection and Analysis of Circular RNAs by RT-PCR.

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  14. PCR detection of Burkholderia multivorans in water and soil samples.

    Peeters, Charlotte; Daenekindt, Stijn; Vandamme, Peter

    2016-08-12

    Although semi-selective growth media have been developed for the isolation of Burkholderia cepacia complex bacteria from the environment, thus far Burkholderia multivorans has rarely been isolated from such samples. Because environmental B. multivorans isolates mainly originate from water samples, we hypothesized that water rather than soil is its most likely environmental niche. The aim of the present study was to assess the occurrence of B. multivorans in water samples from Flanders (Belgium) using a fast, culture-independent PCR assay. A nested PCR approach was used to achieve high sensitivity, and specificity was confirmed by sequencing the resulting amplicons. B. multivorans was detected in 11 % of the water samples (n = 112) and 92 % of the soil samples (n = 25) tested. The percentage of false positives was higher for water samples compared to soil samples, showing that the presently available B. multivorans recA primers lack specificity when applied to the analysis of water samples. The results of the present study demonstrate that B. multivorans DNA is commonly present in soil samples and to a lesser extent in water samples in Flanders (Belgium).

  15. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  16. Development of Nested-PCR Assay to Detect Acidovorax citrulli, a Causal Agent of Bacterial Fruit Blotch at Cucurbitaceae

    Young-Tak Kim

    2015-06-01

    Full Text Available The specific and sensitive nested-PCR method to detect Acidovorax citrulli, a causal agent of bacterial fruit blotch on cucurbitaceae, was developed. PCR primers were designed from the draft genome sequence which was obtained with the Next Generation Sequencing of A. citrulli KACC10651, and the nested-PCR primer set (Ac-ORF 21F/Ac-ORF 21R were selected by checking of specificity to A. citrulli with PCR assays. The selected nested-PCR primer amplified the 140 bp DNA only from A. citrulli strains, and detection sensitivity of the nested PCR increased 10,000 times of 1st PCR detection limit (10 ng genomic DNA/PCR. The nested PCR detected A. citrulli from the all samples of seed surface wash (external seed detection of the artificially inoculated watermelon seeds with 101 cfu/ml and above population of A. citrulli while the nested PCR could not detected A. citrulli from the mashed seed suspension (internal seed detection of the all artificially inoculated watermelon seeds. When the naturally infested watermelon seeds (10% seed infested rate with grow-out test used, the nested PCR detected A. citrulli from 2 seed samples out of 10 replication samples externally and 5 seed samples out of 10 replication samples internally. We believe that the nested-PCR developed in this study will be useful method to detect A. citrulli from the Cucurbitaceae seeds.

  17. A one-step, real-time PCR assay for rapid detection of rhinovirus.

    Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

  18. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  19. Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.

    Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús

    2018-01-01

    The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

    Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2015-07-01

    Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

  1. Detection of Trypanosoma congolense type savannah in field samples of buffy coats of bovins using PCR-ELISA

    Sidibe, I.

    2007-01-01

    PCR-ELISA was set up to detect strain of Trypanosoma congolense type savannah in field samples of buffy coats. Results of PCR-ELISA and PCR were compared and the sensibility and specificity of both techniques were also compared with those of the method of Murray [1] for the detection of TCS in 257 samples. The PCR products were labelling with DIG-dUTP during amplification cycles of the repetitive satellite DNA. A DNA biotinyled capture probe was used to detect the amplicon by ELISA in streptavidine coated microplates. Both of PCR-ELISA and PCR were more sensible and more specific than the method of Murray. Indeed, for the 257 samples analysed by the three techniques, PCR-ELISA and PCR have detected TCS in 98 and 97 samples respectively, whereas the method of Murray has detected TCS in only 39 samples. In addition, PCRELISA and PCR had almost the same sensibility and specificity. So, PCR-ELISA and PCR have respectively detected TCS in 38.62% and 39.22% of all the 334 samples analysed by both techniques during this study. At the end of this study, the cost of analyse by PCR-ELISA of a sample of buffy coat, was evaluated at 1993 FCFA or Euro 3,04. (author) [fr

  2. Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.

    West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D

    1995-01-01

    A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625

  3. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  4. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  5. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  6. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  7. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  8. Detection of hepatitis C virus RNA using reverse transcription PCR

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  9. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  10. Comparison of 454 Ultra-Deep Sequencing and Allele-Specific Real-Time PCR with Regard to the Detection of Emerging Drug-Resistant Minor HIV-1 Variants after Antiretroviral Prophylaxis for Vertical Transmission.

    Andrea Hauser

    Full Text Available Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS and allele-specific real-time PCR (ASPCR for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT.Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F. In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System.Drug-resistant HIV-variants were identified in 69% (20/29 of women by UDS and in 45% (13/29 by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24. By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41. The proportions of variants quantified by UDS were approximately 2-3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml, resulting in missing or insufficient sequence coverage.Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in the HIV-1 quasispecies.

  11. Real-Time PCR using a PCR Microchip with Integrated Thermal System and Polymer Waveguides for the Detection of Campylobacter jejuni

    Wang, Zhenyu; Sekulovic, Andrea; Kutter, Jörg Peter

    2006-01-01

    A novel real-time PCR microchip platform with integrated thermal system and polymer waveguides has been developed. By using the integrated optical system of the real-time PCR chip, cadF – a virulence gene of Campylobacter jejuni, could specifically be detected. Two different DNA binding dyes, SYTOX...

  12. A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.

    Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P

    2015-06-01

    Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.

  13. Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand.

    Stenhouse, Steven A; Plernsub, Suriya; Yanola, Jintana; Lumjuan, Nongkran; Dantrakool, Anchalee; Choochote, Wej; Somboon, Pradya

    2013-08-30

    Resistance to pyrethroid insecticides is widespread among populations of Aedes aegypti, the main vector for the dengue virus. Several different point mutations within the voltage-gated sodium channel (VGSC) gene contribute to such resistance. A mutation at position 1016 in domain II, segment 6 of the VGSC gene in Ae. aegypti leads to a valine to glycine substitution (V1016G) that confers resistance to deltamethrin. This study developed and utilized an allele-specific PCR (AS-PCR) assay that could be used to detect the V1016G mutation. The assay was validated against a number of sequenced DNA samples of known genotype and was determined to be in complete agreement. Larvae and pupae were collected from various localities throughout Thailand. Samples were reared to adulthood and their resistance status against deltamethrin was determined by standard WHO susceptibility bioassays. Deltamethrin-resistant and susceptible insects were then genotyped for the V1016G mutation. Additionally, some samples were genotyped for a second mutation at position 1534 in domain III (F1534C) which is also known to confer pyrethroid resistance. The bioassay results revealed an overall mortality of 77.6%. Homozygous 1016G individuals survived at higher rates than either heterozygous or wild-type (1016 V) mosquitoes. The 1016G mutation was significantly and positively associated with deltamethrin resistance and was widely distributed throughout Thailand. Interestingly, wild-type 1016 V mosquitoes tested were homozygous for the 1534C mutation, and all heterozygous mosquitoes were also heterozygous for 1534C. Mutant homozygous (G/G) mosquitoes expressed the wild-type (F/F) at position 1534. However, the presence of the 1534C mutation was not associated with deltamethrin resistance. Our bioassay results indicate that all populations sampled display some degree of resistance to deltamethrin. Homozygous 1016G mosquitoes were far likelier to survive such exposure. However, resistance in some

  14. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  15. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Yong Huang

    Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  16. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  17. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  18. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  19. Nested PCR for specific diagnosis of Taenia solium taeniasis.

    Mayta, Holger; Gilman, Robert H; Prendergast, Emily; Castillo, Janeth P; Tinoco, Yeny O; Garcia, Hector H; Gonzalez, Armando E; Sterling, Charles R

    2008-01-01

    Taeniasis due to Taenia solium is a disease with important public health consequences, since the larval stage is not exclusive to the animal intermediate, the pig, but also infects humans, causing neurocysticercosis. Early diagnosis and treatment of T. solium tapeworm carriers is important to prevent human cysticercosis. Current diagnosis based on microscopic observation of eggs lacks both sensitivity and specificity. In the present study, a nested-PCR assay targeting the Tso31 gene was developed for the specific diagnosis of taeniasis due to T. solium. Initial specificity and sensitivity testing was performed using stored known T. solium-positive and -negative samples. The assay was further analyzed under field conditions by conducting a case-control study of pretreatment stool samples collected from a population in an area of endemicity. Using the archived samples, the assay showed 97% (31/32) sensitivity and 100% (123/123) specificity. Under field conditions, the assay had 100% sensitivity and specificity using microscopy/enzyme-linked immunosorbent assay coproantigen testing as the gold standards. The Tso31 nested PCR described here might be a useful tool for the early diagnosis and prevention of taeniasis/cysticercosis.

  20. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  1. Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

    Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

    2015-07-01

    Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

    Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

    2015-01-01

    To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

  3. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  4. COMPARISON OF A GENUS-SPECIFIC CONVENTIONAL PCR AND A SPECIES-SPECIFIC NESTED-PCR FOR MALARIA DIAGNOSIS USING FTA COLLECTED SAMPLES FROM KINGDOM OF SAUDI ARABIA.

    Al-Harthi, Saeed A

    2015-12-01

    Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.

  5. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  6. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

    Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

  7. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  8. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  9. Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.

    María José Ramírez-Lázaro

    Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.

  10. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  11. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  13. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  14. Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

    Wan, Weijie; Yeow, John T W

    2012-04-01

    This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

  15. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  16. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  17. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  18. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  20. Evaluation of conventional PCR for detection of Strongylus vulgaris on horse farms.

    Bracken, M K; Wøhlk, C B M; Petersen, S L; Nielsen, M K

    2012-03-23

    Strongyle parasites are ubiquitous in grazing horses. Of these, the bloodworm Strongylus vulgaris is regarded as most pathogenic. Increasing levels of anthelmintic resistance in strongyle parasites has led to recommendations of decreased treatment intensities, and there is now a pronounced need for reliable tools for detection of parasite burdens in general and S. vulgaris in particular. The only method currently available for diagnosing S. vulgaris in practice is the larval culture, which is laborious and time-consuming, so veterinary practitioners most often pool samples from several horses together in one culture to save time. Recently, molecular tools have been developed to detect S. vulgaris in faecal samples. The aim of this study was to compare the performance of a conventional polymerase chain reaction (PCR) assay with the traditional larval culture and furthermore test the performance of pooled versus individual PCR for farm screening purposes. Faecal samples were obtained from 331 horses on 18 different farms. Farm size ranged from 6 to 56 horses, and horses aged between 2 months and 31 years. Larval cultures and PCR were performed individually on all horses. In addition, PCR was performed on 66 faecal pools consisting of 3-5 horses each. Species-specific PCR primers previously developed were used for the PCR. PCR and larval culture detected S. vulgaris in 12.1 and 4.5% of individual horses, respectively. On the farm level, eight farms tested positive with the larval culture, while 13 and 11 farms were positive with the individual and pooled PCRs, respectively. The individual PCR method was statistically superior to the larval culture, while no statistical difference could be detected between pooled and individual PCR for farm screening. In conclusion, pooled PCR appears to be a useful tool for farm screening for S. vulgaris. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Transient neonatal diabetes mellitus with macroglossia diagnosed by methylation specific PCR (MS-PCR

    Hye Young Jin

    2010-03-01

    Full Text Available Transient neonatal diabetes mellitus (TNDM has been associated with paternal uniparental isodisomy of chromosome 6, paternally inherited duplication of 6q24, or a methylation defect at a CpG island of the ZAC or HYMAI gene. We experienced a case of TNDM in which the patient presented with hyperglycemia, macroglossia, and intrauterine growth retardation, caused by a paternally derived HYMAI. An 18-day-old female infant was admitted to the hospital because of macroglossia and recurrent hyperglycemia. In addition to the macroglossia, she also presented with large fontanelles, micrognathia, and prominent eyes. Serum glucose levels were 200&#8211;300 mg/dL and they improved spontaneously 2 days after admission. To identify the presence of a maternal methylated allele, bisulfite-treated genomic DNA from peripheral blood was prepared and digested with BssHII after polymerase chain reaction (PCR amplification with methylation-specific HYMAI primers. PCR and restriction fragment length polymorphism analysis showed that the patient had only the paternal origin of the HYMA1 gene. TNDM is associated with a methylation defect in chromosome 6, suggesting that an imprinted gene on chromosome 6 is responsible for this phenotype.

  2. PCR

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  3. Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

    Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

    2017-02-08

    Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

  4. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  5. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  6. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  7. PCR detection of Bartonella spp. in the dog

    Jarmila Konvalinová

    2014-01-01

    Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.

  8. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  10. Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

    Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

  11. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  12. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  13. Detection of Mycoplasma hyopneumoniae in Bronchoalveolar Lavage Fluids of Pigs by PCR

    Baumeister, A. Katrin; Runge, Martin; Ganter, Martin; Feenstra, Anne A.; Delbeck, Friedrich; Kirchhoff, Helga

    1998-01-01

    In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 102 CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11 other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Friis medium and (ii) with DNA extracted from the BALFs. In addition, PCR was performed with postmortem lung washings from 19 of the 40 pigs, and immunofluorescence tests were carried out with sections of lungs from 18 of the 40 pigs. M. hyopneumoniae could not be detected in 18 of the 40 pigs by any of the five methods tested. The remaining 22 pigs showed a positive reaction by the PCR with DNA extracted from the BALFs and variable positive reactions by the other tests. A complete correspondence could be observed between the immunofluorescence test result and the result of PCR with DNA. The investigation shows that the PCR with DNA extracted from BALFs is a suitable technique for the sensitive and specific in vivo detection of M. hyopneumoniae. PMID:9650949

  14. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  15. Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

    da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

    2011-01-01

    The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

  16. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

    Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

    2014-12-01

    Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  18. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  19. Detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluids of pigs by PCR

    Baumeister, A.K.; Runge, M.; Ganter, Martin

    1998-01-01

    In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification...... other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Frus medium...... inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 10(2) CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11...

  20. Comparative analysis of minimal residual disease detection by multiparameter flow cytometry and enhanced ASO RQ-PCR in multiple myeloma

    Silvennoinen, R; Lundan, T; Kairisto, V; Pelliniemi, T-T; Putkonen, M; Anttila, P; Huotari, V; Mäntymaa, P; Siitonen, S; Uotila, L; Penttilä, T-L; Juvonen, V; Selander, T; Remes, K

    2014-01-01

    Multiparameter flow cytometry (MFC) and allele-specific oligonucleotide real-time quantitative PCR (ASO RQ-PCR) are the two most sensitive methods to detect minimal residual disease (MRD) in multiple myeloma (MM). We compared these methods in 129 paired post-therapy samples from 22 unselected, consecutive MM patients in complete/near complete remission. Appropriate immunophenotypic and ASO RQ-PCR-MRD targets could be detected and MRD analyses constructed for all patients. The high PCR coverage could be achieved by gradual widening of the primer sets used for clonality detection. In addition, for 13 (55%) of the patients, reverse orientation of the ASO primer and individual design of the TaqMan probe improved the sensitivity and specificity of ASO RQ-PCR analysis. A significant nonlinear correlation prevailed between MFC-MRD and PCR-MRD when both were positive. Discordance between the methods was found in 32 (35%) paired samples, which were negative by MFC-MRD, but positive by ASO RQ-PCR. The findings suggest that with the described technique, ASO RQ-PCR can be constructed for all patients with MM. ASO RQ-PCR is slightly more sensitive in MRD detection than 6−10-color flow cytometry. Owing to technical demands ASO RQ-PCR could be reserved for patients in immunophenotypic remission, especially in efficacy comparisons between different drugs and treatment modalities

  1. Development of a PCR technique specific for Demodex injai in biological specimens.

    Sastre, N; Ravera, I; Ferreira, D; Altet, L; Sánchez, A; Bardagí, M; Francino, O; Ferrer, L

    2013-09-01

    The identification of Demodex injai as a second Demodex species of dog opened new questions and challenges in the understanding on the Demodex-host relationships. In this paper, we describe the development of a conventional PCR technique based on published genome sequences of D. injai from GenBank that specifically detects DNA from D. injai. This technique amplifies a 238-bp fragment corresponding to a region of the mitochondrial 16S rDNA of D. injai. The PCR was positive in DNA samples obtained from mites identified morphologically as D. injai, which served as positive controls, as well as in samples from three cases of demodicosis associated with proliferation of mites identified as D. injai. Furthermore, the PCR was positive in 2 out of 19 healthy dogs. Samples of Demodex canis and Demodex folliculorum were consistently negative. Skin samples from seven dogs with generalized demodicosis caused by D. canis were all negative in the D. injai-specific PCR, demonstrating that in generalized canine demodicosis, mite proliferation is species-specific. This technique can be a useful tool in the diagnosis and in epidemiologic and pathogenic studies.

  2. Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.

    Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin

    2017-12-01

    Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.

  3. [Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

    Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

    2005-07-01

    To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

  4. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

    Maryam AlTamimi

    2017-01-01

    Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

  5. PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

    Prevost, S; Andre, S; Remize, F

    2010-12-01

    Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

  6. Improved detection of canine Angiostrongylus vasorum infection using real-time PCR and indirect ELISA.

    Jefferies, Ryan; Morgan, Eric R; Helm, Jenny; Robinson, Matthew; Shaw, Susan E

    2011-12-01

    This study reports the development of a real-time PCR assay and an indirect ELISA to improve on current detection of canine Angiostrongylus vasorum infection. A highly specific fluorescent probe-based, real-time PCR assay was developed to target the A. vasorum second internal transcribed spacer region and detected DNA in EDTA blood, lung tissue, broncho-alveolar larvage fluid, endotracheal mucus, pharyngeal swabs and faecal samples. PCR was fast (∼1 h), highly efficient when using EDTA blood samples, consistently detected a single molecule of parasite DNA and did not amplify DNA from other parasitic nematodes or definitive host species. An indirect ELISA was also developed using the soluble protein fraction from adult A. vasorum worms. Some cross-reactive antigen recognition was observed when tested against sera from dogs infected with Crenosoma vulpis (n = 8), Toxocara canis (n = 5) and Dirofilaria immitis (n = 5). This was largely overcome by setting the cut-off for a positive result at an appropriately high level. Field evaluation of the real-time PCR and ELISA was conducted by testing sera and EDTA blood from dogs with suspected A. vasorum infection (n = 148) and compared with the Baermann's larval migration test in faeces. Thirty-one dogs were positive by at least one test. Of these, 20 (65%) were detected by the Baermann method, 18 (58%) by blood PCR, 24 (77%) by ELISA and 28 (90%) by blood PCR and ELISA together. Combined testing using real-time PCR and ELISA therefore improved the detection rate of A. vasorum infection and holds promise for improved clinical diagnosis and epidemiological investigation.

  7. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  8. A MIQE-compliant real-time PCR assay for Aspergillus detection.

    Gemma L Johnson

    Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness

  9. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  10. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

    Kanako Komaki-Yasuda

    Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

  11. Development of PCR-based detection methods for the quarantine phytopathogen Synchytrium endobioticum, causal agent of wart disease

    Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.

    2005-01-01

    Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and

  12. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Fast detection of deletion breakpoints using quantitative PCR

    Gulshara Abildinova

    2016-01-01

    Full Text Available Abstract The routine detection of large and medium copy number variants (CNVs is well established. Hemizygotic deletions or duplications in the large Duchenne muscular dystrophy DMD gene responsible for Duchenne and Becker muscular dystrophies are routinely identified using multiple ligation probe amplification and array-based comparative genomic hybridization. These methods only map deleted or duplicated exons, without providing the exact location of breakpoints. Commonly used methods for the detection of CNV breakpoints include long-range PCR and primer walking, their success being limited by the deletion size, GC content and presence of DNA repeats. Here, we present a strategy for detecting the breakpoints of medium and large CNVs regardless of their size. The hemizygous deletion of exons 45-50 in the DMD gene and the large autosomal heterozygous PARK2 deletion were used to demonstrate the workflow that relies on real-time quantitative PCR to narrow down the deletion region and Sanger sequencing for breakpoint confirmation. The strategy is fast, reliable and cost-efficient, making it amenable to widespread use in genetic laboratories.

  14. Immunoliposome-PCR: a generic ultrasensitive quantitative antigen detection system

    He Junkun

    2012-06-01

    Full Text Available Abstract Background The accurate quantification of antigens at low concentrations over a wide dynamic range is needed for identifying biomarkers associated with disease and detecting protein interactions in high-throughput microarrays used in proteomics. Here we report the development of an ultrasensitive quantitative assay format called immunoliposome polymerase chain reaction (ILPCR that fulfills these requirements. This method uses a liposome, with reporter DNA encapsulated inside and biotin-labeled polyethylene glycol (PEG phospholipid conjugates incorporated into the outer surface of the liposome, as a detection reagent. The antigenic target is immobilized in the well of a microplate by a capture antibody and the liposome detection reagent is then coupled to a biotin-labeled second antibody through a NeutrAvidin bridge. The liposome is ruptured to release the reporter DNA, which serves as a surrogate to quantify the protein target using real-time PCR. Results A liposome detection reagent was prepared, which consisted of a population of liposomes ~120 nm in diameter with each liposome possessing ~800 accessible biotin receptors and ~220 encapsulated reporters. This liposome detection reagent was used in an assay to quantify the concentration of carcinoembryonic antigen (CEA in human serum. This ILPCR assay exhibited a linear dose–response curve from 10-10 M to 10-16 M CEA. Within this range the assay coefficient of variance was Conclusions The ILPCR assay has several advantages over other immuno-PCR methods. The reporter DNA and biotin-labeled PEG phospholipids spontaneously incorporate into the liposomes as they form, simplifying preparation of the detection reagent. Encapsulation of the reporter inside the liposomes allows nonspecific DNA in the assay medium to be degraded with DNase I prior to quantification of the encapsulated reporter by PCR, which reduces false-positive results and improves quantitative accuracy. The ability to

  15. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  16. Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R

    2014-01-01

    In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  17. Apparatus, System and Method for Fast Detection of Genetic Information by PCR in an Interchangeable Chip

    Wen, Weijia; Wu, Jinbo; Kodzius, Rimantas

    2011-01-01

    A polymerase chain reaction (PCR) device for fast amplification and detection of DNA includes an interchangeable PCR chamber, a temperature control component, and an optical detection system. The DNA amplification is performed on an interchangeable

  18. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  19. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  2. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

  3. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

    Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

    2011-09-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

  4. Improved Detection of Lassa Virus by Reverse Transcription-PCR Targeting the 5′ Region of S RNA▿

    Ölschläger, Stephan; Lelke, Michaela; Emmerich, Petra; Panning, Marcus; Drosten, Christian; Hass, Meike; Asogun, Danny; Ehichioya, Deborah; Omilabu, Sunday; Günther, Stephan

    2010-01-01

    The method of choice for the detection of Lassa virus is reverse transcription (RT)-PCR. However, the high degree of genetic variability of the virus poses a problem with the design of RT-PCR assays that will reliably detect all strains. Recently, we encountered difficulties in detecting some strains from Liberia and Nigeria in a commonly used glycoprotein precursor (GPC) gene-specific RT-PCR assay (A. H. Demby, J. Chamberlain, D. W. Brown, and C. S. Clegg, J. Clin. Microbiol. 32:2898-2903, 1...

  5. Chronic Chagas disease: PCR-xenodiagnosis without previous microscopic observation is a useful tool to detect viable Trypanosoma cruzi

    Miguel Saavedra

    2013-01-01

    Full Text Available We evaluate the elimination of the microscopic stage of conventional xenodiagnosis (XD to optimize the parasitological diagnosis of Trypanosoma cruzi in chronic Chagas disease. To this purpose we applied under informed consent two XD cages to 150 Chilean chronic chagasic patients. The fecal samples (FS of the triatomines at 30, 60 and 90 days post feeding were divided into two parts: in one a microscopic search for mobile trypomastigote and/or epimastigote forms was performed. In the other part, DNA extraction-purification for PCR directed to the conserved region of kDNA minicircles of trypanosomes (PCR-XD, without previous microscopic observation was done. An XD was considered positive when at least one mobile T. cruzi parasite in any one of three periods of incubation was observed, whereas PCR-XD was considered positive when the 330 bp band specific for T. cruzi was detected. 25 of 26 cases with positive conventional XD were PCR-XD positive (concordance 96.2%, whereas 85 of 124 cases with negative conventional XD were positive by PCR-XD (68.5%. Human chromosome 12 detected by Real-time PCR used as exogenous internal control of PCR-XD reaction allowed to discounting of PCR inhibition and false negative in 40 cases with negative PCR-XD. Conclusion: PCR-XD performed without previous microscopic observation is a useful tool for detection of viable parasites with higher efficiency then conventional XD.

  6. Chronic Chagas disease: PCR-xenodiagnosis without previous microscopic observation is a useful tool to detect viable Trypanosoma cruzi.

    Saavedra, Miguel; Zulantay, Inés; Apt, Werner; Martínez, Gabriela; Rojas, Antonio; Rodríguez, Jorge

    2013-01-01

    We evaluate the elimination of the microscopic stage of conventional xenodiagnosis (XD) to optimize the parasitological diagnosis of Trypanosoma cruzi in chronic Chagas disease. To this purpose we applied under informed consent two XD cages to 150 Chilean chronic chagasic patients. The fecal samples (FS) of the triatomines at 30, 60 and 90 days post feeding were divided into two parts: in one a microscopic search for mobile trypomastigote and/or epimastigote forms was performed. In the other part, DNA extraction-purification for PCR directed to the conserved region of kDNA minicircles of trypanosomes (PCR-XD), without previous microscopic observation was done. An XD was considered positive when at least one mobile T. cruzi parasite in any one of three periods of incubation was observed, whereas PCR-XD was considered positive when the 330 bp band specific for T. cruzi was detected. 25 of 26 cases with positive conventional XD were PCR-XD positive (concordance 96.2%), whereas 85 of 124 cases with negative conventional XD were positive by PCR-XD (68.5%). Human chromosome 12 detected by Real-time PCR used as exogenous internal control of PCR-XD reaction allowed to discounting of PCR inhibition and false negative in 40 cases with negative PCR-XD. PCR-XD performed without previous microscopic observation is a useful tool for detection of viable parasites with higher efficiency then conventional XD.

  7. Determining the analytical specificity of PCR-based assays for the diagnosis of IA: What is Aspergillus?

    Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen

    2017-06-01

    A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  9. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  10. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  11. A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

    Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

    2014-01-01

    Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

  12. Evaluation of a PCR for detection of Actinobacillus pleuropneumoniae in mixed bacterial cultures from tonsils

    Gram, T.; Ahrens, Peter; Nielsen, J.P.

    1996-01-01

    strains of A. lignieresii. The lower detection limit of the PCR test was 10(3) A. pleuropneumoniae CFU/PCR test tube and was not affected by addition of 10(6) E. coli CFU/PCR test tube. Mixed bacterial cultures from tonsils of 101 pigs from 9 different herds were tested by culture and by PCR using four...

  13. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  14. RT-PCR for detection of all seven genotypes of Lyssavirus genus.

    Vázquez-Morón, S; Avellón, A; Echevarría, J E

    2006-08-01

    The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.

  15. Human papillomavirus detection using PCR and ATR-FTIR for cervical cancer screening

    Rymsza, Taciana; Ribeiro, Eliane Aline; de Carvalho, Luis Felipe das Chagas e. Silva; Bhattacharjee, Tanmoy; de Azevedo Canevari, Renata

    2018-05-01

    The human papillomavirus (HPV) genital infection is considered one of the most common sexually transmitted diseases worldwide, and has been associated with cervical cancer. The objective of this study was to investigate the efficacy of the diagnostic methods: polymerase chain reaction (PCR) and Fourier transform infrared (FTIR) equipped with an ATR (Attenuated Total Reflectance) unit (Pike Tech) spectroscopy, to diagnose HPV infection in women undergoing gynecological examination. Seventeen patients (41.46%) of the 41 patients analyzed were diagnosed with exophytic/condyloma acuminate lesions by clinical analysis, 29 patients (70.7%) (G1 group) of the 41 patients, showed positive result for HPV cell injury by oncotic colpocitology and 12 patients (29.3%) (G2 group), presented negative result for cellular lesion and absence of clinical HPV lesion. Four samples were obtained per patient, which were submitted oncotic colpocitology analysis (Papanicolau staining, two samples), PCR (one sample) and ATR-FTIR analysis (one sample). L1 gene was amplified by PCR technique with specific GP5+/GP6+ and MY09/MY11 primers. PCR results were uniformly positive for presence of HPV in all analyzed samples. Multivariate analysis of ATR-FTIR spectra suggests no significant biochemical changes between groups and no clustering formed, concurring with results of PCR. This study suggests that PCR and ATR-FTIR are highly sensitive technique for HPV detection.

  16. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  17. The potential of TaqMan Array Cards for detection of multiple biological agents by real-time PCR.

    Phillip A Rachwal

    Full Text Available The TaqMan Array Card architecture, normally used for gene expression studies, was evaluated for its potential to detect multiple bacterial agents by real-time PCR. Ten PCR assays targeting five biological agents (Bacillus anthracis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, and Yersinia pestis were incorporated onto Array Cards. A comparison of PCR performance of each PCR in Array Card and singleplex format was conducted using DNA extracted from pure bacterial cultures. When 100 fg of agent DNA was added to Array Card channels the following levels of agent detection (where at least one agent PCR replicate returned a positive result were observed: Y. pestis 100%, B. mallei & F. tularensis 93%; B. anthracis 71%; B. pseudomallei 43%. For B. mallei & pseudomallei detection the BPM2 PCR, which detects both species, outperformed PCR assays specific to each organism indicating identification of the respective species would not be reproducible at the 100 fg level. Near 100% levels of detection were observed when 100 fg of DNA was added to each PCR in singleplex format with singleplex PCRs also returning sporadic positives at the 10 fg per PCR level. Before evaluating the use of Array Cards for the testing of environmental and clinical sample types, with potential levels of background DNA and PCR inhibitors, users would therefore have to accept a 10-fold reduction in sensitivity of PCR assays on the Array Card format, in order to benefit for the capacity to test multiple samples for multiple agents. A two PCR per agent strategy would allow the testing of 7 samples for the presence of 11 biological agents or 3 samples for 23 biological agents per card (with negative control channels.

  18. Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

    Chung Hyun-Jae

    2010-09-01

    Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

  19. Study On Application Of Molecular Techniques (RAPD-PCR And RAMP-PCR) To Detect Mutation In Rice Breeding

    Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham

    2007-01-01

    The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)

  20. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  1. A real-time PCR assay for the detection of atypical strains of Chlamydiaceae from pigeons.

    Aleksandar Zocevic

    Full Text Available Recent evidence of the occurrence of atypical Chlamydiaceae strains in pigeons, different from the established Chlamydiaceae, requires the development of a specific and rapid detection tool to investigate their prevalence and significance. Here is described a new real-time PCR assay that allows specific detection of atypical Chlamydiaceae from pigeons. The assay has been used to assess the dissemination of these strains in field samples collected from Parisian pigeon populations in 2009. The results suggest a limited dissemination compared to the usually higher prevalence of Chlamydia psittaci that is the main species associated with avian chlamydiosis.

  2. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

    2014-07-21

    Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

  3. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  4. Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method

    H Ansari

    2010-02-01

    Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.

  5. Sensitive PCR Detection of Meloidogyne arenaria, M. incognita, and M. javanica Extracted from Soil

    Qiu, Jinya Jack; Westerdahl, Becky B.; Anderson, Cindy; Williamson, Valerie M.

    2006-01-01

    We have developed a simple PCR assay protocol for detection of the root-knot nematode (RKN) species Meloidogyne arenaria, M. incognita, and M. javanica extracted from soil. Nematodes are extracted from soil using Baermann funnels and centrifugal flotation. The nematode-containing fraction is then digested with proteinase K, and a PCR assay is carried out with primers specific for this group of RKN and with universal primers spanning the ITS of rRNA genes. The presence of RKN J2 can be detected among large numbers of other plant-parasitic and free-living nematodes. The procedure was tested with several soil types and crops from different locations and was found to be sensitive and accurate. Analysis of unknowns and spiked soil samples indicated that detection sensitivity was the same as or higher than by microscopic examination. PMID:19259460

  6. PCR detection of groundwater bacteria associated with colloidal transport

    Cruz-Perez, P.; Stetzenbach, L.D.; Alvarez, A.J.

    1996-01-01

    Colloidal transport may increase the amount of contaminant material than that which could be transported by water flow alone. The role of colloids in groundwater contaminant transport is complicated and may involve many different processes, including sorption of elements onto colloidal particles, coagulation/dissolution, adsorption onto solid surfaces, filtration, and migration. Bacteria are known to concentrate minerals and influence the transport of compounds in aqueous environments and may also serve as organic colloids, thereby influencing subsurface transport of radionuclides and other contaminants. The initial phase of the project consisted of assembling a list of bacteria capable of sequestering or facilitating mineral transport. The development and optimization of the PCR amplification assay for the detection of the organisms of interest, and the examination of regional groundwaters for those organisms, are presented for subsequent research

  7. PCR detection of groundwater bacteria associated with colloidal transport

    Cruz-Perez, P.; Stetzenbach, L.D.; Alvarez, A.J.

    1996-02-29

    Colloidal transport may increase the amount of contaminant material than that which could be transported by water flow alone. The role of colloids in groundwater contaminant transport is complicated and may involve many different processes, including sorption of elements onto colloidal particles, coagulation/dissolution, adsorption onto solid surfaces, filtration, and migration. Bacteria are known to concentrate minerals and influence the transport of compounds in aqueous environments and may also serve as organic colloids, thereby influencing subsurface transport of radionuclides and other contaminants. The initial phase of the project consisted of assembling a list of bacteria capable of sequestering or facilitating mineral transport. The development and optimization of the PCR amplification assay for the detection of the organisms of interest, and the examination of regional groundwaters for those organisms, are presented for subsequent research.

  8. Optimization and Evaluation of a PCR Assay for Detecting Toxoplasmic Encephalitis in Patients with AIDS

    Joseph, Priya; Calderón, Maritza M.; Gilman, Robert H.; Quispe, Monica L.; Cok, Jaime; Ticona, Eduardo; Chavez, Victor; Jimenez, Juan A.; Chang, Maria C.; Lopez, Martín J.; Evans, Carlton A.

    2002-01-01

    Toxoplasma gondii is a common life-threatening opportunistic infection. We used experimental murine T. gondii infection to optimize the PCR for diagnostic use, define its sensitivity, and characterize the time course and tissue distribution of experimental toxoplasmosis. PCR conditions were adjusted until the assay reliably detected quantities of DNA derived from less than a single parasite. Forty-two mice were inoculated intraperitoneally with T. gondii tachyzoites and sacrificed from 6 to 72 h later. Examination of tissues with PCR and histology revealed progression of infection from blood to lung, heart, liver, and brain, with PCR consistently detecting parasites earlier than microscopy and with no false-positive results. We then evaluated the diagnostic value of this PCR assay in human patients. We studied cerebrospinal fluid and serum samples from 12 patients with AIDS and confirmed toxoplasmic encephalitis (defined as positive mouse inoculation and/or all of the Centers for Disease Control clinical diagnostic criteria), 12 human immunodeficiency virus-infected patients with suspected cerebral toxoplasmosis who had neither CDC diagnostic criteria nor positive mouse inoculation, 26 human immunodeficiency virus-infected patients with other opportunistic infections and no signs of cerebral toxoplasmosis, and 18 immunocompetent patients with neurocysticercosis. Eleven of the 12 patients with confirmed toxoplasmosis had positive PCR results in either blood or cerebrospinal fluid samples (6 of 9 blood samples and 8 of 12 cerebrospinal fluid samples). All samples from control patients were negative. This study demonstrates the high sensitivity, specificity, and clinical utility of PCR in the diagnosis of toxoplasmic encephalitis in a resource-poor setting. PMID:12454142

  9. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  10. Detection of Histoplasma capsulatum from clinical specimens by cycling probe-based real-time PCR and nested real-time PCR.

    Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko

    2016-05-01

    We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  12. Human minisatellite alleles detectable only after PCR amplification.

    Armour, J A; Crosier, M; Jeffreys, A J

    1992-01-01

    We present evidence that a proportion of alleles at two human minisatellite loci is undetected by standard Southern blot hybridization. In each case the missing allele(s) can be identified after PCR amplification and correspond to tandem arrays too short to detect by hybridization. At one locus, there is only one undetected allele (population frequency 0.3), which contains just three repeat units. At the second locus, there are at least five undetected alleles (total population frequency 0.9) containing 60-120 repeats; they are not detected because these tandem repeats give very poor signals when used as a probe in standard Southern blot hybridization, and also cross-hybridize with other sequences in the genome. Under these circumstances only signals from the longest tandemly repeated alleles are detectable above the nonspecific background. The structures of these loci have been compared in human and primate DNA, and at one locus the short human allele containing three repeat units is shown to be an intermediate state in the expansion of a monomeric precursor allele in primates to high copy number in the longer human arrays. We discuss the implications of such loci for studies of human populations, minisatellite isolation by cloning, and the evolution of highly variable tandem arrays.

  13. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR

    Lund, Marianne; Nordentoft, Steen; Pedersen, Karl

    2004-01-01

    A real-time PCR assay for detecting thermophilic Campylobacter spp. directly in chicken feces has been developed. DNA was isolated from fecal material by using magnetic beads followed by PCR with a prealiquoted PCR mixture, which had been stored at -18degreesC. Campylobacter could be detected...

  14. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  15. Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

    Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

    2016-01-01

    Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

  16. European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.

    Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  18. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  19. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  20. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  1. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

    Amanda de Faveri Pitz

    2013-12-01

    Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  2. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.

    Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José

    2013-01-01

    Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  3. Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.

    Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P

    2014-07-05

    The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the

  4. Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

    Whyte Paul

    2008-09-01

    Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

  5. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  6. A reverse transcriptase-PCR assay for detecting filarial infective larvae in mosquitoes.

    Sandra J Laney

    2008-06-01

    Full Text Available Existing molecular assays for filarial parasite DNA in mosquitoes cannot distinguish between infected mosquitoes that contain any stage of the parasite and infective mosquitoes that harbor third stage larvae (L3 capable of establishing new infections in humans. We now report development of a molecular L3-detection assay for Brugia malayi in vectors based on RT-PCR detection of an L3-activated gene transcript.Candidate genes identified by bioinformatics analysis of EST datasets across the B. malayi life cycle were initially screened by PCR using cDNA libraries as templates. Stage-specificity was confirmed using RNA isolated from infected mosquitoes. Mosquitoes were collected daily for 14 days after feeding on microfilaremic cat blood. RT-PCR was performed with primer sets that were specific for individual candidate genes. Many promising candidates with strong expression in the L3 stage were excluded because of low-level transcription in less mature larvae. One transcript (TC8100, which encodes a particular form of collagen was only detected in mosquitoes that contained L3 larvae. This assay detects a single L3 in a pool of 25 mosquitoes.This L3-activated gene transcript, combined with a control transcript (tph-1, accession # U80971 that is constitutively expressed by all vector-stage filarial larvae, can be used to detect filarial infectivity in pools of mosquito vectors. This general approach (detection of stage-specific gene transcripts from eukaryotic pathogens may also be useful for detecting infective stages of other vector-borne parasites.

  7. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  8. Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method

    Malorny, B.; Hoorfar, Jeffrey; Hugas, M.

    2003-01-01

    A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....

  9. The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs.

    Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz

    2015-06-01

    Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations.

  10. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A Novel PCR Assay for Detecting Brucella abortus and Brucella melitensis.

    Alamian, Saeed; Esmaelizad, Majid; Zahraei, Taghi; Etemadi, Afshar; Mohammadi, Mohsen; Afshar, Davoud; Ghaderi, Soheila

    2017-02-01

    Brucellosis is a major zoonotic disease that poses a significant public health threat worldwide. The classical bacteriological detection process used to identify Brucella spp. is difficult and time-consuming. This study aimed to develop a novel molecular assay for detecting brucellosis. All complete sequences of chromosome 1 with 2.1-Mbp lengths were compared among all available Brucella sequences. A unique repeat sequence (URS) locus on chromosome 1 could differentiate Brucella abortus from Brucella melitensis . A primer set was designed to flank the unique locus. A total of 136 lymph nodes and blood samples were evaluated and classified by the URS-polymerase chain reaction (PCR) method in 2013-2014. Biochemical tests and bacteriophage typing as the golden standard indicated that all Brucella spp. isolates were B. melitensis biovar 1 and B. abortus biovar 3. The PCR results were the same as the bacteriological method for detecting Brucella spp. The sensitivity and specificity of the URS-PCR method make it suitable for detecting B. abortus and B. melitensis . Quick detection of B. abortus and B. melitensis can provide the most effective strategies for control of these bacteria. The advantage of this method over other presented methods is that both B. abortus and B. melitensis are detectable in a single test tube. Furthermore, this method covered 100% of all B. melitensis and B. abortus biotypes. The development of this URS-PCR method is the first step toward the development of a novel kit for the molecular identification of B. abortus and B. melitensis .

  12. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  14. Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

    Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

    2017-09-01

    The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

  15. Comparative evaluation of a laboratory developed real-time PCR assay and the RealStar® HHV-6 PCR Kit for quantitative detection of human herpesvirus 6.

    Yip, Cyril C Y; Sridhar, Siddharth; Cheng, Andrew K W; Fung, Ami M Y; Cheng, Vincent C C; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2017-08-01

    HHV-6 reactivation in immunocompromised patients is common and may be associated with serious morbidity and mortality; therefore, early detection and initiation of therapy might be of benefit. Real-time PCR assays allow for early identification of HHV-6 reactivation to assist in providing a timely response. Thus, we compared the performance of an in-house developed HHV-6 quantitative PCR assay with a commercially available kit, the RealStar ® HHV-6 PCR Kit. The analytical sensitivity, analytical specificity, linearity, precision and accuracy of the in-house developed HHV-6 qPCR assay were evaluated. The diagnostic performance of the in-house HHV-6 qPCR assay was compared with the RealStar ® HHV-6 PCR Kit, using 72 clinical specimens and 17 proficiency testing samples. Linear regression analysis of the quantitative results showed a dynamic range from 2 to 10 log 10 copies/ml and a coefficient of determination (R 2 ) of 0.999 for the in-house assay. A dilution series demonstrated a limit of detection and a limit of quantification of 1.7 log 10 and 2 log 10 copies/ml, respectively. The precision of the assay was highly reproducible among runs with coefficients of variance (CV) ranging from 0.27% to 4.37%. A comparison of 27 matched samples showed an excellent correlation between the quantitative viral loads measured by the in-house HHV-6 qPCR assay and the RealStar ® HHV-6 PCR Kit (R 2 =0.926; PPCR Kit. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Droplet digital PCR for detection and quantification of circulating tumor DNA in plasma of head and neck cancer patients.

    van Ginkel, Joost H; Huibers, Manon M H; van Es, Robert J J; de Bree, Remco; Willems, Stefan M

    2017-06-19

    During posttreatment surveillance of head and neck cancer patients, imaging is insufficiently accurate for the early detection of relapsing disease. Free circulating tumor DNA (ctDNA) may serve as a novel biomarker for monitoring tumor burden during posttreatment surveillance of these patients. In this exploratory study, we investigated whether low level ctDNA in plasma of head and neck cancer patients can be detected using Droplet Digital PCR (ddPCR). TP53 mutations were determined in surgically resected primary tumor samples from six patients with high stage (II-IV), moderate to poorly differentiated head and neck squamous cell carcinoma (HNSCC). Subsequently, mutation specific ddPCR assays were designed. Pretreatment plasma samples from these patients were examined on the presence of ctDNA by ddPCR using the mutation-specific assays. The ddPCR results were evaluated alongside clinicopathological data. In all cases, plasma samples were found positive for targeted TP53 mutations in varying degrees (absolute quantification of 2.2-422 mutational copies/ml plasma). Mutations were detected in wild-type TP53 background templates of 7667-156,667 copies/ml plasma, yielding fractional abundances of down to 0.01%. Our results show that detection of tumor specific TP53 mutations in low level ctDNA from HNSCC patients using ddPCR is technically feasible and provide ground for future research on ctDNA quantification for the use of diagnostic biomarkers in the posttreatment surveillance of HNSCC patients.

  17. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  18. Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

    Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

    2016-11-01

    Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

  19. Comparison of antigen detection and quantitative PCR in the detection of chlamydial infection in koalas (Phascolarctos cinereus).

    Hanger, Jon; Loader, Joanne; Wan, Charles; Beagley, Kenneth W; Timms, Peter; Polkinghorne, Adam

    2013-03-01

    The gold standard method for detecting chlamydial infection in domestic and wild animals is PCR, but the technique is not suited to testing animals in the field when a rapid diagnosis is frequently required. The objective of this study was to compare the results of a commercially available enzyme immunoassay test for Chlamydia against a quantitative Chlamydia pecorum-specific PCR performed on swabs collected from the conjunctival sac, nasal cavity and urogenital sinuses of naturally infected koalas (Phascolarctos cinereus). The level of agreement for positive results between the two assays was low (43.2%). The immunoassay detection cut-off was determined as approximately 400 C. pecorum copies, indicating that the test was sufficiently sensitive to be used for the rapid diagnosis of active chlamydial infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals.

    Zhang, Xin; He, Chuan-Chuan; Liu, Jin-Ming; Li, Hao; Lu, Ke; Fu, Zhi-Qiang; Zhu, Chuan-Gang; Liu, Yi-Ping; Tong, Lai-Bao; Zhou, De-Bao; Zha, Li; Hong, Yang; Jin, Ya-Mei; Lin, Jiao-Jiao

    2017-04-13

    Schistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals. A specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties. The expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those

  1. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  2. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  3. Standardization of the PCR technique for the detection of delta toxin in Staphylococcus spp.

    C. Marconi

    2005-06-01

    Full Text Available Coagulase-negative staphylococci (CNS, components of the normal flora of neonates, have emerged as important opportunistic pathogens of nosocomial infections that occur in neonatal intensive care units. Some authors have reported the ability of some CNS strains, particularly Staphylococcus epidermidis, to produce a toxin similar to S. aureus delta toxin. This toxin is an exoprotein that has a detergent action on the membranes of various cell types resulting in rapid cell lysis. The objectives of the present study were to standardize the Polymerase Chain Reaction (PCR technique for the detection of the gene responsible for the production of delta toxin (hld gene in staphylococcal species isolated from catheters and blood cultures obtained from neonates, and to compare the results to those obtained with the phenotypic synergistic hemolysis method. Detection of delta toxin by the phenotypic and genotypic method yielded similar results for the S. aureus isolates. However, in S. epidermidis, a higher positivity was observed for PCR (97.4% compared to the synergistic hemolysis method (86.8%. Among CNS, S. epidermidis was the most frequent isolate and was a delta toxin producer. Staphylococcus simulans and S. warneri tested positive by the phenotypic method, but their positivity was not confirmed by PCR for the hld gene detection. These results indicate that different genes might be responsible for the production of this toxin in different CNS species, requiring highly specific primers for their detection. PCR was found to be a rapid and reliable method for the detection of the hld gene in S. aureus and S. epidermidis.

  4. A triplex quantitative real-time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7.

    Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-05-02

    Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.

  5. Comparative analysis of minimal residual disease detection using four-color flow cytometry, consensus IgH-PCR, and quantitative IgH PCR in CLL after allogeneic and autologous stem cell transplantation.

    Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M

    2004-10-01

    The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.

  6. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  7. Effects of prolonged chlorine exposures upon PCR detection of Helicobacter pylori DNA.

    The effect of low doses of free chlorine on the detection by qPCR of Helicobacter pylori (H. pylori) cells by qPCR in tap water was monitored. H. pylori target sequences (within suspended, intact cells at densities of 102 to 103 cells /ml) were rendered undetectable by qPCR an...

  8. Influence of volume of sample processed on detection of Chlamydia trachomatis in urogenital samples by PCR

    Goessens, W H; Kluytmans, J A; den Toom, N; van Rijsoort-Vos, T H; Niesters, B G; Stolz, E; Verbrugh, H A; Quint, W G

    In the present study, it was demonstrated that the sensitivity of the PCR for the detection of Chlamydia trachomatis is influenced by the volume of the clinical sample which is processed in the PCR. An adequate sensitivity for PCR was established by processing at least 4%, i.e., 80 microliters, of

  9. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi

    Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio

    2018-01-01

    A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297

  10. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  12. Detection of Mycoplasma synoviae infection in broiler breeder farms of Tehran province using PCR and culture methods

    Elhamnia, F.

    2010-07-01

    Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.

  13. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  14. Specific detection of Aspergillus fumigatus in sputum sample of ...

    We developed a two-step PCR assay that specifically amplifies a region of the 18S rRNA gene that is highly conserved in Aspergillus fumigatus. This assay allows direct and rapid detection of down to 10 fg of Aspergillus fumigatus DNA corresponding to 1 to 5 colony forming unit (CFU) per ml of sputum sample of pulmonary ...

  15. Real-time PCR for type-specific identification of herpes simplex in clinical samples: evaluation of type-specific results in the context of CNS diseases.

    Meylan, Sylvain; Robert, Daniel; Estrade, Christine; Grimbuehler, Valérie; Péter, Olivier; Meylan, Pascal R; Sahli, Roland

    2008-02-01

    HSV-1 and HSV-2 cause CNS infections of dissimilar clinico-pathological characteristics with prognostic and therapeutic implications. To validate a type-specific real-time PCR that uses MGB/LNA Taqman probes and to review the virologico-clinical data of 25 eligible patients with non-neonatal CNS infections. This real-time PCR was evaluated against conventional PCR (26 CSF and 20 quality controls), and LightCycler assay (51 mucocutaneous, 8 CSF and 32 quality controls) and culture/immunofluorescence (75 mucocutaneous) to assess typing with independent methods. Taqman real-time PCR detected 240 HSV genomes per ml CSF, a level appropriate for the management of patients, and provided unambiguous typing for the 104 positive (62 HSV-1 and 42 HSV-2) out the 160 independent clinical samples tested. HSV type diagnosed by Taqman real-time PCR predicted final diagnosis (meningitis versus encephalitis/meningoencephalitis, p<0.001) in 24/25 patients at time of presentation, in contrast to clinical evaluation. Our real-time PCR, as a sensitive and specific means for type-specific HSV diagnosis, provided rapid prognostic information for patient management.

  16. In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

    Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

    2003-03-01

    SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

  17. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  18. PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

    Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

    2007-01-01

    Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

  19. Sensitive detection of African swine fever virus using real-time PCR with a 5' conjugated minor groove binding probe

    McKillan, John; McMenamy, Michael; Hjertner, Bernt

    2010-01-01

    sensitive than the conventional PCR recommended by the OIE. Linear range was ten logs from 2 × 101 to 2 × 1010. The assay is rapid with an amplification time just over 2 h. The development of this assay provides a useful tool for the specific diagnosis of ASF in statutory or emergency testing programs......The design of a 5′ conjugated minor groove binder (MGB) probe real-time PCR assay is described for the rapid, sensitive and specific detection of African swine fever virus (ASFV) DNA. The assay is designed against the 9GL region and is capable of detecting 20 copies of a DNA standard. It does...

  20. Real-Time PCR Assay To Detect Smallpox Virus

    Sofi Ibrahim, M.; Kulesh, David A.; Saleh, Sharron S.; Damon, Inger K.; Esposito, Joseph J.; Schmaljohn, Alan L.; Jahrling, Peter B.

    2003-01-01

    We developed a highly sensitive and specific assay for the rapid detection of smallpox virus DNA on both the Smart Cycler and LightCycler platforms. The assay is based on TaqMan chemistry with the orthopoxvirus hemagglutinin gene used as the target sequence. With genomic DNA purified from variola virus Bangladesh 1975, the limit of detection was estimated to be approximately 25 copies on both machines. The assay was evaluated in a blinded study with 322 coded samples that included genomic DNA from 48 different isolates of variola virus; 25 different strains and isolates of camelpox, cowpox, ectromelia, gerbilpox, herpes, monkeypox, myxoma, rabbitpox, raccoonpox, skunkpox, vaccinia, and varicella-zoster viruses; and two rickettsial species at concentrations mostly ranging from 100 fg/μl to 1 ng/μl. Contained within those 322 samples were variola virus DNA, obtained from purified viral preparations, at concentrations of 1 fg/μl to 1 ng/μl. On the Smart Cycler platform, 2 samples with false-positive results were detected among the 116 samples not containing variola virus tested; i.e., the overall specificity of the assay was 98.3%. On the LightCycler platform, five samples with false-positive results were detected (overall specificity, 95.7%). Of the 206 samples that contained variola virus DNA ranging in concentrations from 100 fg/μl to 1 ng/μl, 8 samples were considered negative on the Smart Cycler platform and 1 sample was considered negative on the LightCycler platform. Thus, the clinical sensitivities were 96.1% for the Smart Cycler instrument and 99.5% for the LightCycler instrument. The vast majority of these samples were derived from virus-infected cell cultures and variola virus-infected tissues; thus, the DNA material contained both viral DNA and cellular DNA. Of the 43 samples that contained purified variola virus DNA ranging in concentration from 1 fg/μl to 1 ng/μl, the assay correctly detected the virus in all 43 samples on both the Smart Cycler

  1. Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.

    Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein

    2016-01-01

    We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

  2. Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear

    Gholamreza HASSANPOUR

    2016-12-01

    Full Text Available Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria.Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction.Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR.Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

  3. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  4. A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa

    2010-01-01

    Background Chronic lung infection with the bacterium Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF) and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa (Australian epidemic strain I; AES-I) has been found to be widespread in CF patients in eastern Australia. Methods Suppression subtractive hybridization (SSH) was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE), 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources. Results We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples. Conclusions We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the P. aeruginosa strain AES-I. We have also shown that Whatman FTA® Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum. PMID:20637114

  5. A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa

    Murphy Anna

    2010-07-01

    Full Text Available Abstract Background Chronic lung infection with the bacterium Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa (Australian epidemic strain I; AES-I has been found to be widespread in CF patients in eastern Australia. Methods Suppression subtractive hybridization (SSH was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE, 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources. Results We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples. Conclusions We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the P. aeruginosa strain AES-I. We have also shown that Whatman FTA® Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum.

  6. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Tu, Thomas; Jilbert, Allison R

    2017-01-01

    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  7. Use of species-specific PCR for the identification of 10 sea cucumber species

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  8. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  9. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  10. Detection of Fusarium oxysporum f.sp. basilici in substrates and roots by PCR.

    Pugliese, M; Ferrocino, I; Gullino, M L; Garibaldi, A

    2013-01-01

    Fusarium oxysporum is a soil-borne fungus that causes vascular wilts in a wide variety of plant species. Basil is recognized as an ecological niche for Fusarium oxysporum f.sp. basilici (FOB) and this fungus is now present in most countries where basil is cultivated. The rapid identification of the species affecting basil plants is necessary to define a successful method for crop protection. The aim of this study was to develop a PCR method for the rapid detection of Fusarium oxysporum f. sp. basilici in substrates. The specificity of the primers used was tested using the DNA extracted directly from substrate samples. Fusarium oxysporum f.sp. basilici was artificially inoculated with decreasing amounts in a commercial substrate (sphagnum peat moss) and in a mixture with 40% of municipal compost, after steam disinfestation. Basil seeds (cv. Fine verde) were sown in pots that were laid on a bench in the greenhouse. At time 0 and after 7, 14 and 21 days from the inoculation, substrate and root samples were collected and prepared for microbial analysis and for the DNA extraction. DNA extraction was carried out using NucleoSpin Soil Kit (Macherey-Nagel, Germany). PCR amplification for the specific detection was carried out using primer sets Bik 1 (5'-ATT CAA GAG CTA AAG GTC C-3') and Bik 4 (5'-TTT GAC CAA GAT AGA TGC C-3') for the first PCR, while primers Bik 1 + Bik 2 (5'-AAA GGT AGT ATA TCG GAG G-3') for the nested PCR to increase detection sensitivity. Disease incidence was also assessed 21 days after seeding. The results showed the presence of amplified fragments of the expected size when the concentration of F. oxysporum f.sp. basilici was at least 3.5 Log CFU g(-1) by using DNA extract directly from substrate, before roots were infected by the pathogen. The detection of Fusarium oxysporum f. sp. basilici by PCR method developed in this study is certainly simple and fast and can be useful for its reliable detection in substrate samples, but not to guarantee that

  11. Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

    Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

    2017-05-01

    Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Development and validation of a real-time PCR assay for the detection of anguillid herpesvirus 1.

    van Beurden, S J; Voorbergen-Laarman, M A; Roozenburg, I; van Tellingen, J; Haenen, O L M; Engelsma, M Y

    2016-01-01

    Anguillid herpesvirus 1 (AngHV1) causes a haemorrhagic disease with increased mortality in wild and farmed European eel, Anguilla anguilla (L.) and Japanese eel Anguilla japonica, Temminck & Schlegel). Detection of AngHV1 is currently based on virus isolation in cell culture, antibody-based typing assays or conventional PCR. We developed, optimized and concisely validated a diagnostic TaqMan probe based real-time PCR assay for the detection of AngHV1. The primers and probe target AngHV1 open reading frame 57, encoding the capsid protease and scaffold protein. Compared to conventional PCR, the developed real-time PCR is faster, less labour-intensive and has a reduced risk of cross-contamination. The real-time PCR assay was shown to be analytically sensitive and specific and has a high repeatability, efficiency and r(2) -value. The diagnostic performance of the assay was determined by testing 10% w/v organ suspensions and virus cultures from wild and farmed European eels from the Netherlands by conventional and real-time PCR. The developed real-time PCR assay is a useful tool for the rapid and sensitive detection of AngHV1 in 10% w/v organ suspensions from wild and farmed European eels. © 2015 John Wiley & Sons Ltd.

  13. Detection of Epstein Barr virus in formalin-fixed paraffin tissues by fluorescent direct in situ PCR

    N Marziliano

    2009-06-01

    Full Text Available Specific viral laboratory diagnosis of primary Epstein-Barr Virus (EBV infection is usually based on antibody-detection assays. However, molecular detection is also considered the reference standard assay for diagnosis of central nervous system infections and of most cases of nasopharyngeal carcinoma (NPC. One-step or nested polymerase chain reaction (PCR has rapidly replaced immunological assays based on virus-specific Ig antibodies for the laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis. In this article, we will present a rapid, sensitive and robust molecular tool for the viral detection of EBV (EBNA-1 within tissue specimens by making use of in situ PCR (IS-PCR.

  14. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  15. Fast real-time PCR for the detection of crustacean allergen in foods.

    Herrero, Beatriz; Vieites, Juan M; Espiñeira, Montserrat

    2012-02-29

    Crustaceans are one of the most common allergens causing severe food reaction. These food allergens are a health problem, and they have become very important; there are various regulations that establish that labeling must be present regarding these allergens to warn consumers. In the present work a fast real-time PCR, by a LNA probe, was developed. This allows the detection of crustaceans in all kinds of products, including processed products in which very aggressive treatments of temperature and pressure during the manufacturing process are used. This methodology provides greater sensitivity and specificity and reduces the analysis time of real-time PCR to 40 min. This methodology was further validated by means of simulating products likely to contain this allergen. For this, products present on the market were spiked with crustacean cooking water. The assay is a potential tool in issues related to the labeling of products and food security to protect the allergic consumer.

  16. Detection of Talaromyces marneffei from Fresh Tissue of an Inhalational Murine Pulmonary Model Using Nested PCR.

    Yinghui Liu

    Full Text Available Penicilliosis marneffei, often consecutive to the aspiration of Talaromyces marneffei (Penicillium marneffei, continues to be one of the significant causes of morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. Improving the accuracy of diagnosing this disease would aid in reducing the mortality of associated infections. In this study, we developed a stable and reproducible murine pulmonary model that mimics human penicilliosis marneffei using a nebulizer to deliver Talaromyces marneffei (SUMS0152 conidia to the lungs of BALB/c nude mice housed in exposure chamber. Using this model, we further revealed that nested PCR was sensitive and specific for detecting Talaromyces marneffei in bronchoalveolar lavage fluid and fresh tissues. This inhalation model may provide a more representative analysis tool for studying the development of penicilliosis marneffei, in addition to revealing that nested PCR has a predictive value in reflecting pulmonary infection.

  17. Detection of Talaromyces marneffei from Fresh Tissue of an Inhalational Murine Pulmonary Model Using Nested PCR

    Liu, Yinghui; Huang, Xiaowen; Yi, Xiuwen; He, Ya; Mylonakis, Eleftherios; Xi, Liyan

    2016-01-01

    Penicilliosis marneffei, often consecutive to the aspiration of Talaromyces marneffei (Penicillium marneffei), continues to be one of the significant causes of morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. Improving the accuracy of diagnosing this disease would aid in reducing the mortality of associated infections. In this study, we developed a stable and reproducible murine pulmonary model that mimics human penicilliosis marneffei using a nebulizer to deliver Talaromyces marneffei (SUMS0152) conidia to the lungs of BALB/c nude mice housed in exposure chamber. Using this model, we further revealed that nested PCR was sensitive and specific for detecting Talaromyces marneffei in bronchoalveolar lavage fluid and fresh tissues. This inhalation model may provide a more representative analysis tool for studying the development of penicilliosis marneffei, in addition to revealing that nested PCR has a predictive value in reflecting pulmonary infection. PMID:26886887

  18. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  19. Identification and Genetic Diversity of Etambutol Resistant Strains of Mycobacterium Tuberculosis by Allelic-Specific PCR and Spologiotyping

    Zahra Derakhshani Nezhad

    2012-09-01

    Full Text Available Background & Objectives: Ethambutol is one of the four main drugs in treatment of tuberculosis. The most common mutation associated with this drug resistance usually occurs in codon 306 of embB. The aim of this study was to detect ethambutol resistance using Allele-Specific PCR and Spoligotyping in various subtypes of Mycobacterium tuberculosis.   Methods : 140 sputum specimens were collected from suspected TB patients. They were digested and decontaminated using Pettrof method before culturing them on LJ medium. Drug susceptibility testing was performed on 106 culture positive specimens using proportional method. DNA was extracted from the isolated organisms and subsequently subjected to Allele-Specific PCR to detect any mutationin embB306. Spoligotyping was then used to determine the subtypes.   Results: Out of 106 cultures positive samples, 36 samples (33.9% showed resistance to ethambutol using proportional method. Allele-Specific PCR assay identified 93 as sensitive and 13 (27.6% as resistant strains. The results of PCR were in agreement with result of proportional method. The PCR method revealed that 61.5% of mutation occurred in the first and 38.5% in third nucleotides. Spoligotyping differentiated Mycobacterium tuberculosis strains into Beijing (10 9.4%, Bovis (2 1.8%, CAS (24 22.6%, EAI (1 0.9%, Haarlem (27 25.4%, LAM (5 4.7%, Manu (5 4.7%, T (27 25.4% and U( 2 1,8% families. The high frequency of mutation in embB gene was belonged to Haarlem, CAS and T subfamilies.   Conclusion: Based on results current study, mutations in the genes other than embB might have occurred in the resistant strains that gave negative result in Allele-Specific PCR assay. Therefore other mechanisms of resistance to this antibiotic should be investigated.

  20. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  1. Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia and Prevotella nigrescens in endodontic lesions detected by culture and by PCR.

    Gomes, B P F A; Jacinto, R C; Pinheiro, E T; Sousa, E L R; Zaia, A A; Ferraz, C C R; Souza-Filho, F J

    2005-08-01

    he aim of this study was to investigate the presence of four black-pigmented bacteria, Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia and Prevotella nigrescens, in endodontic infections by culture and polymerase chain reaction (PCR) analyses. Microbial samples were obtained from 50 teeth with untreated necrotic pulps (primary infection) and from 50 teeth with failing endodontic treatment (secondary infection). Microbiological strict anaerobic techniques were used for serial dilution, plating, incubation, and identification. For PCR detection, the samples were analyzed using species-specific primers of 16S rDNA and the downstream intergenic spacer region. Culture and PCR detected the test species in 13/100 and 50/100 of the study teeth, respectively. The organisms were cultured from 11/50 (22%) of primarily infected root canal samples and from 2/50 (4%) of secondary root canal samples. PCR detection identified the target species in 32/50 (64%) and 18/50 (36%) of primary and secondary infections, respectively. P. gingivalis was rarely isolated by culture methods (1%), but was the most frequently identified test species by PCR (38%). Similarly, P. endodontalis was not recovered by culture from any tooth studied, but was detected by PCR in 25% of the sampled teeth. PCR-based identification also showed higher detection rates of P. intermedia (33%) and P. nigrescens (22%) than culture (13%). In conclusion, P. gingivalis, P. endodontalis, P. intermedia, and P. nigrescens were identified more frequently in teeth with necrotic pulp than in teeth with failing endodontic treatment. Also, a higher frequency of black-pigmented species was detected by PCR than by culture.

  2. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  3. DNA barcoding of freshwater fishes and the development of a quantitative qPCR assay for the species-specific detection and quantification of fish larvae from plankton samples.

    Loh, W K W; Bond, P; Ashton, K J; Roberts, D T; Tibbetts, I R

    2014-08-01

    The barcoding of mitochondrial cytochrome c oxidase subunit 1 (coI) gene was amplified and sequenced from 16 species of freshwater fishes found in Lake Wivenhoe (south-eastern Queensland, Australia) to support monitoring of reservoir fish populations, ecosystem function and water health. In this study, 630-650 bp sequences of the coI barcoding gene from 100 specimens representing 15 genera, 13 families and two subclasses of fishes allowed 14 of the 16 species to be identified and differentiated. The mean ± s.e. Kimura 2 parameter divergence within and between species was 0.52 ± 0.10 and 23.8 ± 2.20% respectively, indicating that barcodes can be used to discriminate most of the fish species accurately. The two terapontids, Amniataba percoides and Leiopotherapon unicolor, however, shared coI DNA sequences and could not be differentiated using this gene. A barcoding database was established and a qPCR assay was developed using coI sequences to identify and quantify proportional abundances of fish species in ichthyoplankton samples from Lake Wivenhoe. These methods provide a viable alternative to the time-consuming process of manually enumerating and identifying ichthyoplankton samples. © 2014 The Fisheries Society of the British Isles.

  4. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  5. Real-Time Detection and Identification of Chlamydophila Species in Veterinary Specimens by Using SYBR Green-Based PCR Assays

    Nordentoft, Steen; Kabell, Susanne; Pedersen, Karl

    2011-01-01

    of Chlamydiaceae and differentiate the most prevalent veterinary Chlamydophila species: Cp. psittaci, Cp. abortus, Cp. felis, and Cp. caviae. By adding bovine serum albumin to the master mixes, target DNA could be detected directly in crude lysates of enzymatically digested conjunctival or pharyngeal swabs...... or tissue specimens from heart, liver, and spleen without further purification. The assays were evaluated on veterinary specimens where all samples were screened using a family-specific PCR, and positive samples were further tested using species-specific PCRs. Cp. psittaci was detected in 47 birds, Cp...... with a highly sensitive family-specific PCR, we were able to screen for Chlamydiaceae in veterinary specimens and confirm the species in positive samples with additional PCR assays....

  6. Comparison of bacteriological culture and PCR for detection of bacteria in ovine milk--sheep are not small cows.

    Zadoks, Ruth N; Tassi, Riccardo; Martin, Elena; Holopainen, Jani; McCallum, Sarah; Gibbons, James; Ballingall, Keith T

    2014-10-01

    Mastitis, inflammation of the mammary gland, is an important cause of disease, mortality, and production losses in dairy and meat sheep. Mastitis is commonly caused by intramammary infection with bacteria, which can be detected by bacterial culture or PCR. PathoProof (Thermo Fisher Scientific Ltd., Vantaa, Finland) is a commercially available real-time PCR system for the detection of bovine mastitis pathogens. Sheep differ from cattle in the bacterial species or bacterial strains that cause mastitis, as well as in the composition of their milk. The aim of this study was to evaluate whether the PathoProof system was suitable for detection of mastitis pathogens in sheep milk. Milk samples were collected aseptically from 219 udder halves of 113 clinically healthy ewes in a single flock. Aliquots were used for bacteriological culture and real-time PCR-based detection of bacteria. For species identified by culture, the diagnosis was confirmed by species-specific conventional PCR or by sequencing of a housekeeping gene. The majority of samples were negative by culture (74.4% of 219 samples) and real-time PCR (82.3% of 192 samples). Agreement was observed for 138 of 192 samples. Thirty-four samples were positive by culture only, mostly due to presence of species that are not covered by primers in the PCR system (e.g., Mannheimia spp.). Two samples were positive for Streptococcus uberis by culture but not by PCR directly from the milk samples. This was not due to inability of the PCR primers to amplify ovine Streptococcus uberis, as diluted DNA extracts from the same samples and DNA extracts from the bacterial isolates were positive by real-time PCR. For samples containing Staphylococcus spp., 11 samples were positive by culture and PCR, 9 by culture only, and 20 by PCR only. Samples that were negative by either method had lower bacterial load than samples that were positive for both methods, whereas no clear relation with species identity was observed. This study provides

  7. Preclinical detection of porcine circovirus type 2 infection using an ultrasensitive nanoparticle DNA probe-based PCR assay.

    Yong Huang

    Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.

  8. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  9. A novel method for detection of dioxins. Exonuclease protection mediated PCR assay

    Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College

    2004-09-15

    The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.

  10. New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

    Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

    2017-09-07

    Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

  11. Optimization of Quantitative PCR Methods for Enteropathogen Detection

    Liu, Jie; Gratz, Jean; Amour, Caroline; Nshama, Rosemary; Walongo, Thomas; Maro, Athanasia; Mduma, Esto; Platts-Mills, James; Boisen, Nadia; Nataro, James; Haverstick, Doris M.; Kabir, Furqan; Lertsethtakarn, Paphavee; Silapong, Sasikorn; Jeamwattanalert, Pimmada; Bodhidatta, Ladaporn; Mason, Carl; Begum, Sharmin; Haque, Rashidul; Praharaj, Ira; Kang, Gagandeep; Houpt, Eric R.

    2016-01-01

    Detection and quantification of enteropathogens in stool specimens is useful for diagnosing the cause of diarrhea but is technically challenging. Here we evaluate several important determinants of quantification: specimen collection, nucleic acid extraction, and extraction and amplification efficiency. First, we evaluate the molecular detection and quantification of pathogens in rectal swabs versus stool, using paired flocked rectal swabs and whole stool collected from 129 children hospitalized with diarrhea in Tanzania. Swabs generally yielded a higher quantification cycle (Cq) (average 29.7, standard deviation 3.5 vs. 25.3 ± 2.9 from stool, P<0.001) but were still able to detect 80% of pathogens with a Cq < 30 in stool. Second, a simplified total nucleic acid (TNA) extraction procedure was compared to separate DNA and RNA extractions and showed 92% (318/344) sensitivity and 98% (951/968) specificity, with no difference in Cq value for the positive results (ΔCq(DNA+RNA-TNA) = -0.01 ± 1.17, P = 0.972, N = 318). Third, we devised a quantification scheme that adjusts pathogen quantity to the specimen’s extraction and amplification efficiency, and show that this better estimates the quantity of spiked specimens than the raw target Cq. In sum, these methods for enteropathogen quantification, stool sample collection, and nucleic acid extraction will be useful for laboratories studying enteric disease. PMID:27336160

  12. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  13. Detection of Replication Competent Lentivirus Using a qPCR Assay for VSV-G

    Lindsey M. Skrdlant

    2018-03-01

    Full Text Available Lentiviral vectors are a common tool used to introduce new and corrected genes into cell therapy products for treatment of human diseases. Although lentiviral vectors are ideal for delivery and stable integration of genes of interest into the host cell genome, they potentially pose risks to human health, such as integration-mediated transformation and generation of a replication competent lentivirus (RCL capable of infecting non-target cells. In consideration of the latter risk, all cell-based products modified by lentiviral vectors and intended for patient use must be tested for RCL prior to treatment of the patient. Current Food and Drug Administration (FDA guidelines recommend use of cell-based assays to this end, which can take up to 6 weeks for results. However, qPCR-based assays are a quick alternative for rapid assessment of RCL in products intended for fresh infusion. We describe here the development and qualification of a qPCR assay based on detection of envelope gene sequences (vesicular stomatitis virus G glycoprotein [VSV-G] for RCL in accordance with Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE guidelines. Our results demonstrate the sensitivity, linearity, specificity, and reproducibility of detection of VSV-G sequences, with a low false-positive rate. These procedures are currently being used in our phase 1 clinical investigations.

  14. Testing the sensitivity of Nested PCR method to detect Aspergillus fumigates in experimentally infected Sputum samples

    Ramadan, A.; Soukkaria, S.

    2013-01-01

    Fungal infections caused by Aspergillus species generally are occupying a second place among invasive fungal infections in the world, especially A. fumigatus, which is considered the main cause of invasive Aspergillosis (IA). Although IA rarely infects immunocompetent individuals, however, it can lead to death in immunocompromised patients. Therefore, it is necessary to diagnose the infection early in order to treat the disease efficiently. However, the conventional diagnostic tools, currently used to detect infections, has low sensitivity and reliability. Polymerase chain reaction (PCR) technology distribution as a molecular and high sensitive technology has allowed us to make comparative study between sensitivity of traditional currently used diagnostic method and Nested-PCR, the result of the study of sputum samples that experimentally infected with different concentrations of A.fumigatus spores ramping from 10 to10 6 spore/ml, have high sensitivity and specificity of Nested-PCR in detecting the lower concentrations, comparing with traditional diagnostic method (culture on Sabouraud media) that were negative in all concetrations. (author)

  15. A new PCR assay for the detection and differentiation of Babesia canis and Babesia vogeli.

    Annoscia, Giada; Latrofa, Maria Stefania; Cantacessi, Cinzia; Olivieri, Emanuela; Manfredi, Maria Teresa; Dantas-Torres, Filipe; Otranto, Domenico

    2017-10-01

    Babesia spp. are globally distributed tick-borne protozoan parasites that infect the red blood cells of a wide range of vertebrate hosts, including humans. Diagnosis of babesiosis is often impeded by the transient presence of the parasites in peripheral blood, as well as by their pleomorphic nature. Given the reports of an expanding and, in some cases, sympatric geographical distribution of Babesia canis and Babesia vogeli in dogs and associated vectors, in Europe, the development of time-efficient and cost-effective diagnostic tools to detect and differentiate these two species is warranted. In this study, we designed and developed a novel polymerase chain reaction (PCR) assay targeting the parasite cytochrome c oxidase subunit 1 (cox1) gene, for the simultaneous detection and differentiation of B. canis and B. vogeli. The analytical sensitivity of the PCR was evaluated using serial dilutions of genomic DNA extracted from individual and artificially mixed canine blood samples infected by B. canis (3×10 2 infected erythrocytes/ml, ie/ml) and B. vogeli (2.1×10 1 ie/ml). The analytical specificity of the assay was assessed using blood samples positive for Hepatozoon canis, Ehrlichia canis, Anaplasma platys, Babesia microti, Babesia rossi and Theileria annae (syn. Babesia vulpes). The clinical specificity of the PCR assay was evaluated on 147 blood samples from dogs and 128 tick specimens (Dermacentor reticulatus and Rhipicephalus sanguineus sensu lato). Species-specific bands of the expected sizes (i.e., 750bp for B. canis and 450bp for B. vogeli), and two bands in the mixed blood samples were obtained. The PCR assay developed herein detected a low number of infected erythrocytes (i.e., 3×10 -2 B. canis, 2.1×10 -2 B. vogeli ie/ml). Of the 147 blood samples, nine (6.1%) were positive for B. canis and six (4.1%) for B. vogeli, whereas only one tick (D. reticulatus) was positive for B. canis. This PCR assay represents a rapid and reliable tool for the diagnosis of B

  16. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  17. Nested PCR detection of Plasmodium malariae from microscopy confirmed P. falciparum samples in endemic area of NE India.

    Dhiman, Sunil; Goswami, Diganta; Kumar, Dinesh; Rabha, Bipul; Sharma, Dhirendra Kumar; Bhola, Rakesh Kumar; Baruah, Indra; Veer, Vijay

    2013-11-01

    The present study evaluates the performance of OptiMAL-IT test and nested PCR assay in detection of malaria parasites. A total of 76 randomly selected blood samples collected from two malaria endemic areas were tested for malaria parasites using microscopy and OptiMAL-IT test in the field. PCR assays were performed in the laboratory using DNA extracted from blood spots of the same samples collected on the FTA classic cards. Of the total of 61 field confirmed malaria positive samples, only 58 (95%) were detected positive using microscopy in the laboratory. Sensitivity, specificity, positive predictive value, negative predictive value and false discovery rate of OptiMal-IT in comparison to the microscopy were 93%, 83%, 95%, 79% and 5%, respectively. On the other hand, the sensitivity and specificity of PCR assay were 97% and 100%, respectively, whereas positive predictive value, negative predictive value and false discovery rate were 100%, 90% and 0%, respectively. The overall performance of OptiMal-IT and PCR assays for malaria diagnosis was 76% and 97%, respectively. PCR assay enabled the identification of infection with Plasmodium malariae Laveran, 1881 in four samples misidentified by microscopy and Plasmodium-specific antigen (PAN) identified by the OptiMAL-IT test. In addition to the standard methods, such PCR assay could be useful to obtain the real incidence of each malaria parasite species for epidemiological perspectives.

  18. Detection of four important Eimeria species by multiplex PCR in a single assay.

    You, Myung-Jo

    2014-06-01

    The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples

    Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders

    2005-01-01

    species-specific detection of Campylobacter spp. in naturally infected pig faecal samples after an enrichment step, whereas the hybridization approach enhanced the specific isolation of C. jejuni (present in minority to C. coli) from pigs. Conclusions: The rt-PCR was specific for Campylobacter jejuni, C...... by phenotypic methods and the developed rt-PCR provides an easy and fast method for such differentiation. Detection of C. jejuni by colony hybridization may increase the isolation rate of this species from pig faeces....

  1. Allele-Specific DNA Methylation Detection by Pyrosequencing®

    Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten

    2015-01-01

    DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....

  2. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  3. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  4. Detection of methylated CDO1 in plasma of colorectal cancer; a PCR study.

    Keishi Yamashita

    Full Text Available BACKGROUND: Cysteine biology is important for the chemosensitivity of cancer cells. Our research has focused on the epigenetic silencing of cysteine dioxygenase type 1 (CDO1 in colorectal cancer (CRC. In this study, we describe detection of CDO1 methylation in the plasma of CRC patients using methylation specific PCR (Q-MSP and extensive analysis of the PCR reaction. METHODS: DNA was extracted from plasma, and analysed for methylation of the CDO1 gene using Q-MSP. The detection rate of CDO1 gene methylation was calculated and compared with that of diluted DNA extracted from "positive control" DLD1 cells. CDO1 gene methylation in the plasma of 40 CRC patients that were clinicopathologically analysed was then determined. RESULTS: (1 The cloned sequence analysis detected 93.3% methylation of the promoter CpG islands of the CDO1 gene of positive control DLD1 cells and 4.7% methylation of the negative control HepG2 CDO1 gene. (2 DLD1 CDO1 DNA could not be detected in this assay if the extracted DNA was diluted ∼1000 fold. The more DNA that was used for the PCR reaction, the more effectively it was amplified in Q-MSP. (3 By increasing the amount of DNA used, methylated CDO1 could be clearly detected in the plasma of 8 (20% of the CRC patients. However, the percentage of CRC patients detected by methylated CDO1 in plasma was lower than that detected by CEA (35.9% or CA19-9 (23.1% in preoperative serum. Combination of CEA/CA19-9 plus plasma methylated CDO1 could increase the rate of detection of curable CRC patients (39.3% as compared to CEA/CA19-9 (25%. CONCLUSION: We have described detection of CDO1 methylation in the plasma of CRC patients. Although CDO1 methylation was not detected as frequently as conventional tumor markers, analysis of plasma CDO1 methylation in combination with CEA/CA19-9 levels increases the detection rate of curable CRC patients.

  5. PCR detection and identification of oral streptococci in saliva samples using gtf genes.

    Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku

    2004-03-01

    Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.

  6. PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

    Xiaoming Zhou

    2009-11-01

    Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

  7. Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

    Qing Fan

    Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

  8. PCR Based Detection of Genetically Modified Soy in Processed Foods Commercially Available in Saudi Arabia

    Ibrahim Abdullah Alaraidh

    2009-06-01

    Full Text Available In this research, PCR (polymerase chain reaction technique was applied to detect the presence of GMO sold in the Saudi Arabian market. This method was applied to detect genetically modified soy (GM-soy in particular the roundup ready soy (RRS. To confirm the presence of soy, samples were first tested for the existence of the soy specific lectin gene.  A total of eighty samples were tested out of which two samples tested positive as GM-soy. Not surprisingly, the findings showed the existence of GM-soy in food products in Saudi. This supports the necessity of developing precise quantitative and qualitative ways for routine analyses and detection of GMO products in the Saudi Arabian market. With the discovery of GM products in the Saudi Arabian market it would be of no surprise that other Middle Eastern nations also knowingly or unknowingly import GM crops.

  9. Validation of qPCR Methods for the Detection of Mycobacterium in New World Animal Reservoirs.

    Genevieve Housman

    2015-11-01

    Full Text Available Zoonotic pathogens that cause leprosy (Mycobacterium leprae and tuberculosis (Mycobacterium tuberculosis complex, MTBC continue to impact modern human populations. Therefore, methods able to survey mycobacterial infection in potential animal hosts are necessary for proper evaluation of human exposure threats. Here we tested for mycobacterial-specific single- and multi-copy loci using qPCR. In a trial study in which armadillos were artificially infected with M. leprae, these techniques were specific and sensitive to pathogen detection, while more traditional ELISAs were only specific. These assays were then employed in a case study to detect M. leprae as well as MTBC in wild marmosets. All marmosets were negative for M. leprae DNA, but 14 were positive for the mycobacterial rpoB gene assay. Targeted capture and sequencing of rpoB and other MTBC genes validated the presence of mycobacterial DNA in these samples and revealed that qPCR is useful for identifying mycobacterial-infected animal hosts.

  10. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

    2012-03-23

    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  11. Comparison between single PCR and nested PCR in detection of human papilloma viruses in paraffin-embedded OSCC and fresh oral mucosa.

    Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars

    2015-01-01

    Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (pnested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  12. Detection of Hepatitis B and C Viruses in Almost All Hepatocytes by Modified PCR-Based In Situ Hybridization▿

    Nuriya, Hideko; Inoue, Kazuaki; Tanaka, Takeshi; Hayashi, Yukiko; Hishima, Tsunekazu; Funata, Nobuaki; Kaji, Kyosuke; Hayashi, Seishu; Kaneko, Shuichi; Kohara, Michinori

    2010-01-01

    Although PCR-based in situ hybridization (PCR-ISH) can be used to determine the distribution and localization of pathogens in tissues, this approach is hampered by its low specificity. Therefore, we used a highly specific and sensitive PCR-ISH method to reveal the lobular distribution and intracellular localization of hepatitis B virus (HBV) and HCV in chronic liver disease and to clarify the state of persistent HBV and HCV infection in the liver. HBV genomic DNA was detected in almost all hepatocytes, whereas HBV RNA or protein was differentially distributed only in a subset of the HBV DNA-positive region. Further, HCV genomic RNA was detected in almost all hepatocytes and was localized to the cytoplasm. HCV RNA was also detected in the epithelium of the large bile duct but not in endothelial cells, portal tracts, or sinusoidal lymphocytes. In patients with HBV and HCV coinfection, HCV RNA was localized to the noncancerous tissue, whereas HBV DNA was found only in the cancerous tissue. Using this novel PCR-ISH method, we could visualize the staining pattern of HBV and HCV in liver sections, and we obtained results consistent with those of real-time detection (RTD)-PCR analysis. In conclusion, almost all hepatocytes are infected with HBV or HCV in chronic liver disease; this finding implies that the viruses spreads throughout the liver in the chronic stage. PMID:20739486

  13. Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

    Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

    2013-07-30

    Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

  14. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  15. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    Rajeh Ali

    2014-06-20

    Jun 20, 2014 ... in 2013. Objectives: This study aimed to investigate S. aureus in some clinical samples by PCR and study .... culture, the isolates of S. aureus were incubated at 37 °C for. 18–24 h .... characteristics, and ability to form biofilm.

  16. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  17. Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

    Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

    2003-08-01

    Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

  18. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms

    Michelle de Campos Soriani Azevedo

    2017-01-01

    Full Text Available Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR, a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV and negative (NPV predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H, the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease.

  19. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms.

    Azevedo, Michelle de Campos Soriani; Ramuno, Natália Mortari; Fachin, Luciana Raquel Vincenzi; Tassa, Mônica; Rosa, Patrícia Sammarco; Belone, Andrea de Faria Fernandes; Diório, Suzana Madeira; Soares, Cleverson Teixeira; Garlet, Gustavo Pompermaier; Trombone, Ana Paula Favaro

    Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR), a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy) and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA) and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV) and negative (NPV) predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H), the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  20. Development of a PCR Assay to detect Papillomavirus Infection in the Snow Leopard

    Eng Curtis

    2011-07-01

    Full Text Available Abstract Background Papillomaviruses (PVs are a group of small, non-encapsulated, species-specific DNA viruses that have been detected in a variety of mammalian and avian species including humans, canines and felines. PVs cause lesions in the skin and mucous membranes of the host and after persistent infection, a subset of PVs can cause tumors such as cervical malignancies and head and neck squamous cell carcinoma in humans. PVs from several species have been isolated and their genomes have been sequenced, thereby increasing our understanding of the mechanism of viral oncogenesis and allowing for the development of molecular assays for the detection of PV infection. In humans, molecular testing for PV DNA is used to identify patients with persistent infections at risk for developing cervical cancer. In felids, PVs have been isolated and sequenced from oral papillomatous lesions of several wild species including bobcats, Asian lions and snow leopards. Since a number of wild felids are endangered, PV associated disease is a concern and there is a need for molecular tools that can be used to further study papillomavirus in these species. Results We used the sequence of the snow leopard papillomavirus UuPV1 to develop a PCR strategy to amplify viral DNA from samples obtained from captive animals. We designed primer pairs that flank the E6 and E7 viral oncogenes and amplify two DNA fragments encompassing these genes. We detected viral DNA for E6 and E7 in genomic DNA isolated from saliva, but not in paired blood samples from snow leopards. We verified the identity of these PCR products by restriction digest and DNA sequencing. The sequences of the PCR products were 100% identical to the published UuPV1 genome sequence. Conclusions We developed a PCR assay to detect papillomavirus in snow leopards and amplified viral DNA encompassing the E6 and E7 oncogenes specifically in the saliva of animals. This assay could be utilized for the molecular

  1. An immunomagnetic separation-real-time PCR system for the detection of Alicyclobacillus acidoterrestris in fruit products.

    Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli

    2014-04-03

    Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.

  2. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  3. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  4. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

  5. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

  6. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  7. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  8. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Use of real-time PCR to detect canine parvovirus in feces of free-ranging wolves.

    Mech, L David; Almberg, Emily S; Smith, Douglas; Goyal, Sagar; Singer, Randall S

    2012-04-01

    Using real-time PCR, we tested 15 wolf (Canis lupus) feces from the Superior National Forest (SNF), Minnesota, USA, and 191 from Yellowstone National Park (YNP), USA, collected during summer and 13 during winter for canine parvovirus (CPV)-2 DNA. We also tested 20 dog feces for CPV-2 DNA. The PCR assay was 100% sensitive and specific with a minimum detection threshold of 10(4) 50% tissue culture infective dose. Virus was detected in two winter specimens but none of the summer specimens. We suggest applying the technique more broadly especially with winter feces.

  10. Use of real-time PCR to detect canine parvovirus in feces of free-ranging wolves

    Mech, L. David; Almberg, Emily S.; Smith, Douglas; Goyal, Sagar; Singer, Randall S.

    2012-01-01

    Using real-time PCR, we tested 15 wolf (Canis lupus) feces from the Superior National Forest (SNF), Minnesota, USA, and 191 from Yellowstone National Park (YNP), USA, collected during summer and 13 during winter for canine parvovirus (CPV)-2 DNA. We also tested 20 dog feces for CPV-2 DNA. The PCR assay was 100% sensitive and specific with a minimum detection threshold of 104 50% tissue culture infective dose. Virus was detected in two winter specimens but none of the summer specimens. We suggest applying the technique more broadly especially with winter feces.

  11. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  12. Evaluation of PCR and DNA hybridization protocols for detection of viable enterotoxigenic Clostridium perfringens in irradiated beef

    Baez, L.A.; Juneja, V.K.; Thayer, D.W.; Sackitey, S.

    1997-01-01

    The sensitivity of DNA hybridization and polymerase chain reaction (PCR), was evaluated in irradiated cooked and raw beef samples. A membrane-based colony hybridization assay and a PCR protocol, both with specificity for the enterotoxin A gene of Clostridium perfringens, were compared with viable plate counts. The results of the colony hybridization procedure were in agreement with viable plate counts for detection and enumeration of enterotoxigenic C. perfringens. The PCR procedure combined a 4 h enrichment followed by a nucleic acid extraction step and assessed the amplification of 183 and 750 base pair enterotoxin gene targets. Detection of C. perfringens by PCR did not show a reliable correlation with viable plate counts or the colony hybridization assay. C. perfringens killed by irradiation were not detected by the plate count or colony hybridization methods; however, killed cells were detected with the PCR technique. By relying on the growth of viable cells for detection and/or enumeration, the colony hybridization and plate count methods provided a direct correlation with the presence of viable bacteria

  13. A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples.

    Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-03-18

    Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.

  14. A Novel Pretreatment-Free Duplex Chamber Digital PCR Detection System for the Absolute Quantitation of GMO Samples

    Pengyu Zhu

    2016-03-01

    Full Text Available Digital polymerase chain reaction (PCR has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ, sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO genome samples using commercial digital PCR detection systems.

  15. A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

    Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

    2016-01-01

    To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

  16. Evaluation of PMS-PCR technology for detection of Mycobacterium avium subsp. paratuberculosis directly from bovine fecal specimens.

    Salgado, M; Steuer, P; Troncoso, E; Collins, M T

    2013-12-27

    Mycobacterium avium subsp. paratuberculosis (MAP) causes paratuberculosis, or Johne's disease, in animals. Diagnosis of MAP infection is challenging because of the pathogen's fastidious in vitro growth requirements and low-level intermittent shedding in feces during the preclinical phase of the infection. Detection of these "low-shedders" is important for effective control of paratuberculosis as these animals serve as sources of infection for susceptible calves. Magnetic separation technology, used in combination with culture or molecular methods for the isolation and detection of pathogenic bacteria, enhances the analytical sensitivity and specificity of detection methods. The aim of the present study was to evaluate peptide-mediated magnetic separation (PMS) capture technology coupled with IS900 PCR using the Roche real-time PCR system (PMS-PCR), in comparison with fecal culture using BACTEC-MGIT 960 system, for detection of MAP in bovine fecal samples. Among the 351 fecal samples 74.9% (263/351) were PMS-PCR positive while only 12.3% (43/351) were MGIT culture-positive (p=0.0001). All 43 MGIT culture-positive samples were also positive by PMS-PCR. Mean PMS-PCR crossing-point (Cp) values for the 13 fecal samples with the highest number of MAP, based on time to detection, (26.3) were significantly lower than for the 17 fecal samples with technology provided results in a shorter time and yielded a higher number of positive results than MGIT culture. Earlier and faster detection of animals shedding MAP by PMS-PCR should significantly strengthen control efforts for MAP-infected cattle herds by helping to limit infection transmission at earlier stages of the infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

    2013-01-01

    Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

  18. Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

    Wen, Yan; Xing, Yan; Yuan, Lian-Chao; Liu, Jian; Zhang, Ying; Li, Huan-Ying

    2013-01-01

    We evaluated the sensitivity and specificity of a nested-polymerase chain reaction (PCR) method for detection of Mycobacterium leprae DNA from whole blood. Whole-blood specimens were subjected to nested-PCR amplification of M. leprae repeat DNA sequences in 49 multibacillary (MB) and 30 paucibacillary (PB) leprosy patients, 96 household contacts (HHCs), 18 tuberculosis (TB) patients, and 35 normal healthy individuals. M. leprae DNA was detected in 95.92% (47/49) of MB, 70% (21/30) of PB, and 6.25% (6/96) of HHC, but it was not detected in 18 TB or 35 normal controls. The sensitivities of the anti-bovine serum albumin (ND-O-BSA) immunoglobulin M (IgM) and antifusion protein of ML0405-ML2331 IgG for MB were 97.96% and 89.8%, and these values for PB were 70% and 53.33%. However, the ND-O-BSA enzyme-linked immunosorbent assay (ELISA) had lower specificity, with relatively high false-positive results for TB patients (16.67%) and normal healthy controls (10%). Based on these promising findings, we propose the use of nested PCR of whole-blood samples along with ELISA test for early detection of leprosy cases. PMID:23478578

  19. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  20. Fluorescence quantitative PCR in detection of HBV DNA

    Shen Zheng; Li Ming; Shen Xia

    2003-01-01

    Objective: To study the relationship between the serum content of HBV-DNA and expression of serological markers with HBV infection patients. Methods: Serum samples from 375 hepatitis B patients with different clinical status and 70 normal persons were quantitated for HBV-DNA by FQ-PCR. Results: The average of HBV-DNA contents in the patient in the groups of HBsAg (+) and of HBeAg(+) were significantly higher than those in the group of HBsAg(-) and of HBeAg(-). Even in the group of HBeAg negative, high HBV-DNA contents might still be present in both the HBeAg(+) and HBeAg(-) groups. Conclusion: FQ-PCR can be used to monitor the real state of HBV infection, replication and the course of disease

  1. SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

    Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

    2017-12-18

    Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first

  2. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  3. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  4. Evaluation of real-time PCR detection methods for detecting rice products contaminated by rice genetically modified with a CpTI-KDEL-T-nos transgenic construct.

    Nakamura, Kosuke; Akiyama, Hiroshi; Kawano, Noriaki; Kobayashi, Tomoko; Yoshimatsu, Kayo; Mano, Junichi; Kitta, Kazumi; Ohmori, Kiyomi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko

    2013-12-01

    Genetically modified (GM) rice (Oryza sativa) lines, such as insecticidal Kefeng and Kemingdao, have been developed and found unauthorised in processed rice products in many countries. Therefore, qualitative detection methods for the GM rice are required for the GM food regulation. A transgenic construct for expressing cowpea (Vigna unguiculata) trypsin inhibitor (CpTI) was detected in some imported processed rice products contaminated with Kemingdao. The 3' terminal sequence of the identified transgenic construct for expression of CpTI included an endoplasmic reticulum retention signal coding sequence (KDEL) and nopaline synthase terminator (T-nos). The sequence was identical to that in a report on Kefeng. A novel construct-specific real-time polymerase chain reaction (PCR) detection method for detecting the junction region sequence between the CpTI-KDEL and T-nos was developed. The imported processed rice products were evaluated for the contamination of the GM rice using the developed construct-specific real-time PCR methods, and detection frequency was compared with five event-specific detection methods. The construct-specific detection methods detected the GM rice at higher frequency than the event-specific detection methods. Therefore, we propose that the construct-specific detection method is a beneficial tool for screening the contamination of GM rice lines, such as Kefeng, in processed rice products for the GM food regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Detection of environmental sources of Histoplasma capsulatum in Chiang Mai, Thailand, by nested PCR.

    Norkaew, Treepradab; Ohno, Hideaki; Sriburee, Pojana; Tanabe, Koichi; Tharavichitkul, Prasit; Takarn, Piyawan; Puengchan, Tanpalang; Bumrungsri, Sara; Miyazaki, Yoshitsugu

    2013-12-01

    Histoplasmosis is a systemic mycosis caused by inhaling spores of Histoplasma capsulatum, a dimorphic fungus. This fungus grows in soil contaminated with bat and avian excreta. Each year, patients with disseminated histoplasmosis have been diagnosed in Chiang Mai, northern Thailand. No published information is currently available on the environmental sources of this fungus in Chiang Mai or anywhere else in Thailand. The aim of this study was to detect H. capsulatum in soil samples contaminated with bat guano and avian droppings by nested PCR. Two hundred and sixty-five samples were collected from the following three sources: soil contaminated with bat guano, 88 samples; soil contaminated with bird droppings, 86 samples; and soil contaminated with chicken droppings, 91 samples. Genomic DNA was directly extracted from each sample, and H. capsulatum was detected by nested PCR using a primer set specific to a gene encoding 100-kDa-like protein (HcI, HcII and HcIII, HcIV). Histoplasma capsulatum was detected in seven of 88 soil samples contaminated with bat guano, one of 21 soil samples contaminated with pigeon droppings and 10 of 91 soil samples contaminated with chicken droppings. The results indicate the possibility of the association of bat guano and chicken droppings with H. capsulatum in this area of Thailand.

  6. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    Ram, S.

    2012-01-01

    Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.

  7. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  8. Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method

    Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.

    2012-04-01

    Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR

  9. Citrus huanglongbing: validation of Real-Time PCR (qPCR for the detection of Candidatus Liberibacter asiaticus and Candidatus Liberibacter americanus in Colombia

    Jorge Evelio Ángel

    2014-12-01

    Full Text Available Citrus huanglongbing (HLB is the most destructive citrus disease. Two of the three known HLB-associated Candidatus Liberibacter species were recently found to be present in the Americas. In this study, eggs, nymphs and adults of Diaphorina citri Kuwayama (Hemiptera: Liviidae and suspect citrus plant materials were collected in 25 municipalities in the departments of Cundinamarca, Santander, Valle del Cauca, Meta and Quindio (Colombia. The detection sensitivity, specificity and assay performance of the 16S rDNA-based real-time PCR (qPCR were validated for the field survey of the disease in Colombia. The validation confirmed the reliability and robustness of the real-time PCR method for the detection of HLB bacteria in host citrus plant tissues and the vector D. citri. The diagnosis was performed for Candidatus Liberibacter asiaticus (Ca. L. asiaticus and for Candidatus Liberibacter americanus (Ca. L. americanus on 168 citrus plant material samples and 239 insect samples. Neither Ca. L. asiaticus nor Ca. L. americanus were detected in the host plants or insects vector, confirming the absence of the disease in the citrus-producing areas of Colombia.

  10. Nasal PCR assay for the detection of Mycobacterium leprae pra gene to study subclinical infection in a community.

    Arunagiri, Kamalanathan; Sangeetha, Gopalakrishnan; Sugashini, Padmavathy Krishnan; Balaraman, Sekar; Showkath Ali, M K

    2017-03-01

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. Identification of Mycobacterium leprae is difficult in part due to the inability of the leprosy bacillus to grow in vitro. A number of diagnostic methods for leprosy diagnosis have been proposed. Both serological tests and molecular probes have shown certain potential for detection and identification of Mycobacterium leprae in patients. In this study, we have investigated whether Mycobacterium leprae DNA from the nasal secretion of healthy household contacts and the non contacts could be detected through PCR amplification as a method to study the sub clinical infection in a community. A total of 200 samples, 100 each from contacts and non contacts representing all age groups and sex were included in this study. The M. leprae specific primer (proline-rich region) of pra gene was selected and PCR was performed using extracted DNA from the sample. A total of 13 samples were found to be positive for nasal PCR for pra gene among the male and female contacts out of which 7% were males and 6% were females. Even though several diagnostic tools are available to detect the cases of leprosy, they lack the specificity and sensitivity. PCR technology has demonstrated the improved diagnostic accuracy for epidemiological studies and requires minimal time. Although nasal PCR studies have been reported from many countries it is not usually recommended due to the high percentage of negative results in the contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Development and application of two independent real-time PCR assays to detect clinically relevant Mucorales species.

    Springer, Jan; Goldenberger, Daniel; Schmidt, Friderike; Weisser, Maja; Wehrle-Wieland, Elisabeth; Einsele, Hermann; Frei, Reno; Löffler, Jürgen

    2016-03-01

    PCR-based detection of Mucorales species could improve diagnosis of suspected invasive fungal infection, leading to a better patient outcome. This study describes two independent probe-based real-time PCR tests for detection of clinically relevant Mucorales, targeting specific fragments of the 18S and the 28S rRNA genes. Both assays have a short turnaround time, allow fast, specific and very sensitive detection of clinically relevant Mucorales and have the potential to be used as quantitative tests. They were validated on various clinical samples (fresh and formalin-fixed paraffin-embedded specimens, mainly biopsies, n = 17). The assays should be used as add-on tools to complement standard techniques; a combined approach of both real-time PCR assays has 100 % sensitivity. Genus identification by subsequent sequencing is possible for amplicons of the 18S PCR assay. In conclusion, combination of the two independent Mucorales assays described in this study, 18S and 28S, detected all clinical samples associated with proven Mucorales infection (n = 10). Reliable and specific identification of Mucorales is a prerequisite for successful antifungal therapy as these fungi show intrinsic resistance to voriconazole and caspofungin.

  12. Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.

    Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta

    2015-12-01

    Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be

  13. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

    Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

    2000-05-05

    Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

  15. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  16. An optimized pentaplex PCR for detecting DNA mismatch repair-deficient colorectal cancers.

    Ajay Goel

    2010-02-01

    Full Text Available Microsatellite instability (MSI is used to screen colorectal cancers (CRC for Lynch Syndrome, and to predict outcome and response to treatment. The current technique for measuring MSI requires DNA from normal and neoplastic tissues, and fails to identify tumors with specific DNA mismatch repair (MMR defects. We tested a panel of five quasi-monomorphic mononucleotide repeat markers amplified in a single multiplex PCR reaction (pentaplex PCR to detect MSI.We investigated a cohort of 213 CRC patients, comprised of 114 MMR-deficient and 99 MMR-proficient tumors. Immunohistochemical (IHC analysis evaluated the expression of MLH1, MSH2, PMS2 and MSH6. MSI status was defined by differences in the quasi-monomorphic variation range (QMVR from a pool of normal DNA samples, and measuring differences in allele lengths in tumor DNA.Amplification of 426 normal alleles allowed optimization of the QMVR at each marker, and eliminated the requirement for matched reference DNA to define MSI in each sample. Using > or = 2/5 unstable markers as the criteria for MSI resulted in a sensitivity of 95.6% (95% CI = 90.1-98.1% and a positive predictive value of 100% (95% CI = 96.6%-100%. Detection of MSH6-deficiency was limited using all techniques. Data analysis with a three-marker panel (BAT26, NR21 and NR27 was comparable in sensitivity (97.4% and positive predictive value (96.5% to the five marker panel. Both approaches were superior to the standard approach to measuring MSI.An optimized pentaplex (or triplex PCR offers a facile, robust, very inexpensive, highly sensitive, and specific assay for the identification of MSI in CRC.

  17. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  18. How to evaluate PCR assays for the detection of low-level DNA

    Banch-Clausen, Frederik; Urhammer, Emil; Rieneck, Klaus

    2015-01-01

    distribution describing parameters for singleplex real-time PCR-based detection of low-level DNA. The model was tested against experimental data of diluted cell-free foetal DNA. Also, the model was compared with a simplified formula to enable easy predictions. The model predicted outcomes that were...... not significantly different from experimental data generated by testing of cell-free foetal DNA. Also, the simplified formula was applicable for fast and accurate assay evaluation. In conclusion, the model can be applied for evaluation of sensitivity of real-time PCR-based detection of low-level DNA, and may also......High sensitivity of PCR-based detection of very low copy number DNA targets is crucial. Much focus has been on design of PCR primers and optimization of the amplification conditions. Very important are also the criteria used for determining the outcome of a PCR assay, e.g. how many replicates...

  19. A novel dNTP-limited PCR and HRM assay to detect Williams-Beuren syndrome.

    Zhang, Lichen; Zhang, Xiaoqing; You, Guoling; Yu, Yongguo; Fu, Qihua

    2018-06-01

    Williams-Beuren syndrome (WBS) is caused by a microdeletion of chromosome arm 7q11.23. A rapid and inexpensive genotyping method to detect microdeletion on 7q11.23 needs to be developed for the diagnosis of WBS. This study describes the development of a new type of molecular diagnosis method to detect microdeletion on 7q11.23 based upon high-resolution melting (HRM). Four genes on 7q11.23 were selected as the target genes for the deletion genotyping. dNTP-limited duplex PCR was used to amplify the reference gene, CFTR, and one of the four genes respectively on 7q11.23. An HRM assay was performed on the PCR products, and the height ratio of the negative derivative peaks between the target gene and reference gene was employed to analyze the copy number variation of the target region. A new genotyping method for detecting 7q11.23 deletion was developed based upon dNTP-limited PCR and HRM, which cost only 96 min. Samples from 15 WBS patients and 12 healthy individuals were genotyped by this method in a blinded fashion, and the sensitivity and specificity was 100% (95% CI, 0.80-1, and 95% CI, 0.75-1, respectively) which was proved by CytoScan HD array. The HRM assay we developed is an rapid, inexpensive, and highly accurate method for genotyping 7q11.23 deletion. It is potentially useful in the clinical diagnosis of WBS. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  1. EVA GREEN REAL-TIME PCR USED TO DETECT CELERY AS AN ALLERGEN IN FOOD

    Ondrej Škultéty

    2011-04-01

    Full Text Available EvaGreen®  Real-Time PCR method has been used for celery(Apium graveolens allergen detection. A primer designed in mannitol dehydrogenase gene region has been used for specific celery identification in sample. The results show possibility to create calibration curve using artificially adulterated samples. The increasing variability between parallel calibration of celery samples has been observed from 0.1 % to 100%. Detection limit has been set to value 0.1% in celery representing 1000 ppm. Fluorescent signal has been presented even in samples with lower percentage addition of celery but these samples have been excluded according to unspecific melting curve.doi:10.5219/138

  2. CRISPR is an optimal target for the design of specific PCR assays for salmonella enterica serotypes Typhi and Paratyphi A.

    Laetitia Fabre

    Full Text Available BACKGROUND: Serotype-specific PCR assays targeting Salmonella enterica serotypes Typhi and Paratyphi A, the causal agents of typhoid and paratyphoid fevers, are required to accelerate formal diagnosis and to overcome the lack of typing sera and, in some situations, the need for culture. However, the sensitivity and specificity of such assays must be demonstrated on large collections of strains representative of the targeted serotypes and all other bacterial populations producing similar clinical symptoms. METHODOLOGY: Using a new family of repeated DNA sequences, CRISPR (clustered regularly interspaced short palindromic repeats, as a serotype-specific target, we developed a conventional multiplex PCR assay for the detection and differentiation of serotypes Typhi and Paratyphi A from cultured isolates. We also developed EvaGreen-based real-time singleplex PCR assays with the same two sets of primers. PRINCIPAL FINDINGS: We achieved 100% sensitivity and specificity for each protocol after validation of the assays on 188 serotype Typhi and 74 serotype Paratyphi A strains from diverse genetic groups, geographic origins and time periods and on 70 strains of bacteria frequently encountered in bloodstream infections, including 29 other Salmonella serotypes and 42 strains from 38 other bacterial species. CONCLUSIONS: The performance and convenience of our serotype-specific PCR assays should facilitate the rapid and accurate identification of these two major serotypes in a large range of clinical and public health laboratories with access to PCR technology. These assays were developed for use with DNA from cultured isolates, but with modifications to the assay, the CRISPR targets could be used in the development of assays for use with clinical and other samples.

  3. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  4. Long-range PCR facilitates the identification of PMS2-specific mutations.

    Clendenning, Mark; Hampel, Heather; LaJeunesse, Jennifer; Lindblom, Annika; Lockman, Jan; Nilbert, Mef; Senter, Leigha; Sotamaa, Kaisa; de la Chapelle, Albert

    2006-05-01

    Mutations within the DNA mismatch repair gene, "postmeiotic segregation increased 2" (PMS2), have been associated with a predisposition to hereditary nonpolyposis colorectal cancer (HNPCC; Lynch syndrome). The presence of a large family of highly homologous PMS2 pseudogenes has made previous attempts to sequence PMS2 very difficult. Here, we describe a novel method that utilizes long-range PCR as a way to preferentially amplify PMS2 and not the pseudogenes. A second, exon-specific, amplification from diluted long-range products enables us to obtain a clean sequence that shows no evidence of pseudogene contamination. This method has been used to screen a cohort of patients whose tumors were negative for the PMS2 protein by immunohistochemistry and had not shown any mutations within the MLH1 gene. Sequencing of the PMS2 gene from 30 colorectal and 11 endometrial cancer patients identified 10 novel sequence changes as well as 17 sequence changes that had previously been identified. In total, putative pathologic mutations were detected in 11 of the 41 families. Among these were five novel mutations, c.705+1G>T, c.736_741del6ins11, c.862_863del, c.1688G>T, and c.2007-1G>A. We conclude that PMS2 mutation detection in selected Lynch syndrome and Lynch syndrome-like patients is both feasible and desirable. Published 2006 Wiley-Liss, Inc.

  5. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  6. Real-time PCR for detection of Theileria equi and Babesia caballi ...

    Real-time PCR for detection of Theileria equi and Babesia caballi parasites in ticks. ... This study aimed to develop a real-time PCR screening test for Babesia caballi and Theileria equi in ticks. Adult D. reticulatus were ... This test is suitable for application in epidemiological surveillance of equine babesiosis and theileriosis.

  7. Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies

    Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco

    2005-01-01

    Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and

  8. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

    Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

  9. Enrichment of methylated molecules using enhanced-ice-co-amplification at lower denaturation temperature-PCR (E-ice-COLD-PCR) for the sensitive detection of disease-related hypermethylation.

    Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg

    2018-05-01

    The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.

  10. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  11. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Cássia Yumi Ikuta

    2016-11-01

    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  12. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  14. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  15. Mung bean nuclease treatment increases capture specificity of microdroplet-PCR based targeted DNA enrichment.

    Zhenming Yu

    Full Text Available Targeted DNA enrichment coupled with next generation sequencing has been increasingly used for interrogation of select sub-genomic regions at high depth of coverage in a cost effective manner. Specificity measured by on-target efficiency is a key performance metric for target enrichment. Non-specific capture leads to off-target reads, resulting in waste of sequencing throughput on irrelevant regions. Microdroplet-PCR allows simultaneous amplification of up to thousands of regions in the genome and is among the most commonly used strategies for target enrichment. Here we show that carryover of single-stranded template genomic DNA from microdroplet-PCR constitutes a major contributing factor for off-target reads in the resultant libraries. Moreover, treatment of microdroplet-PCR enrichment products with a nuclease specific to single-stranded DNA alleviates off-target load and improves enrichment specificity. We propose that nuclease treatment of enrichment products should be incorporated in the workflow of targeted sequencing using microdroplet-PCR for target capture. These findings may have a broad impact on other PCR based applications for which removal of template DNA is beneficial.

  16. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  17. Improved detection of endoparasite DNA in soil sample PCR by the use of anti-inhibitory substances.

    Krämer, F; Vollrath, T; Schnieder, T; Epe, C

    2002-09-26

    Although there have been numerous microbial examinations of soil for the presence of human pathogenic developmental parasite stages of Ancylostoma caninum and Toxocara canis, molecular techniques (e.g. DNA extraction, purification and subsequent PCR) have scarcely been applied. Here, DNA preparations of soil samples artificially contaminated with genomic DNA or parasite eggs were examined by PCR. A. caninum and T. canis-specific primers based on the ITS-2 sequence were used for amplification. After the sheer DNA preparation a high content of PCR-interfering substances was still detectable. Subsequently, two different inhibitors of PCR-interfering agents (GeneReleaser, Bioventures Inc. and Maximator, Connex GmbH) were compared in PCR. Both substances increased PCR sensitivity greatly. However, comparison of the increase in sensitivity achieved with the two compounds demonstrated the superiority of Maximator, which enhanced sensitivity to the point of permitting positive detection of a single A. caninum egg and three T. canis eggs in a soil sample. This degree of sensitivity could not be achieved with GeneReleaser for either parasite Furthermore, Maximator not only increased sensitivity; it also cost less, required less time and had a lower risk of contamination. Future applications of molecular methods in epidemiological examinations of soil samples are discussed/elaborated.

  18. Absence of Mycoplasma-specific DNA sequence in brain, blood and CSF of patients with multiple sclerosis (MS): a study by PCR and real-time PCR.

    Casserly, Georgina; Barry, Thomas; Tourtellotte, Wallace W; Hogan, Edward L

    2007-02-15

    Mycoplasmas are the smallest of the known self-replicating organisms. They lack cell walls and are associated with numerous diseases in humans and animals. We are exploring the possibility that infection by Mycoplasma may induce the inflammatory demyelinating disease of the central nervous system (CNS) that is MS. The presence of specific Mycoplasma species DNA was sought in brain, serum and cerebrospinal fluid (CSF) of patients diagnosed with multiple sclerosis (MS) and other neurological diseases (OND) including inflammatory disorders. The MS samples from patients with active and progressive MS, as well as in remission, a variety of other neurological disease controls, including inflammatory CNS diseases such as meningitis, cryptococcal meningitis and encephalitis and other neurological disorders such as migraine were also examined. Clinical samples were provided by the National Neurological Research Specimen Bank and the Human Brain and Spinal Fluid Resource Centre, Los Angeles. Analysis was carried out by conventional PCR using Mycoplasma-specific primers (McAuliffe et al., 2005) that target the 16S rDNA gene in Mycoplasma species. The Mycoplasma-specific primers could detect 102 Mycoplasma species. In this study, 30 samples of human brain and 57 pairs of serum and CSF and were examined. No Mycoplasma-specific nucleic acid sequence was detected, and the consistent observation of an endogenous gene, human serum albumin (HSA), as a positive control documented the adequacy of the method. Real-time PCR analysis of serum and CSF was done also targeting utilizing the Mycoplasma 16S rDNA gene, and this also demonstrated the lack of Mycoplasma in these samples. The presence of Mycoplasma at extraneural sites in MS patients is now being explored.

  19. Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques

    PAULO Z. PASSAMANI

    2017-12-01

    Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

  20. Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

    Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

  1. Detection of unculturable bacteria in periodontal health and disease by PCR.

    Harper-Owen, R; Dymock, D; Booth, V; Weightman, A J; Wade, W G

    1999-05-01

    Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease.

  2. Multiplex real-time PCR for detection, identification and quantification of 'Candidatus Liberibacter solanacearum' in potato plants with zebra chip.

    Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene

    2009-07-01

    The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated

  3. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

    2014-01-01

    Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...

  4. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  5. Optimized Pan-species and speciation duplex real-time PCR assays for Plasmodium parasites detection in malaria vectors.

    Maurice Marcel Sandeu

    Full Text Available BACKGROUND: An accurate method for detecting malaria parasites in the mosquito's vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. METHODS: Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. RESULTS: The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6% and specificity (98%, compared to ELISA-CSP as the referent standard. The agreement between both methods was "excellent" (κ=0.8, P<0.05. The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P=0, 2. All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. CONCLUSION: This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the

  6. Species-specific PCR primers for detection of Xanthomonas vesicatoria

    Beran, P.; Mráz, Ivan

    2013-01-01

    Roč. 43, Jan (2013), s. 213-215 ISSN 0261-2194 R&D Projects: GA MZe QH71229 Institutional support: RVO:60077344 Keywords : Bacterial spot * Tomato * Pepper Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.539, year: 2013

  7. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  8. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  9. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

    Kang Feng-feng

    2012-03-01

    Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

  11. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  12. Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

    Jiashun Wang

    Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

  13. Bovine Papillomavirus in Brazil: Detection of Coinfection of Unusual Types by a PCR-RFLP Method

    R. F. Carvalho

    2013-01-01

    Full Text Available Bovine papillomavirus (BPV is recognized as a causal agent of benign and malignant tumors in cattle. Thirteen types of BPV are currently characterized and classified into three distinct genera, associated with different pathological outcomes. The described BPV types as well as other putative ones have been demonstrated by molecular biology methods, mainly by the employment of degenerated PCR primers. Specifically, divergences in the nucleotide sequence of the L1 gene are useful for the identification and classification of new papillomavirus types. On the present work, a method based on the PCR-RFLP technique and DNA sequencing was evaluated as a screening tool, allowing for the detection of two relatively rare types of BPV in lesions samples from a six-year-old Holstein dairy cow, chronically affected with cutaneous papillomatosis. These findings point to the dissemination of BPVs with unclear pathogenic potential, since two relatively rare, new described BPV types, which were first characterized in Japan, were also detected in Brazil.

  14. Performance of PCR-reverse blot hybridization assay for detection of rifampicin-resistant Mycobacterium leprae.

    Wang, Hye-young; Kim, Hyunjung; Kim, Yeun; Bang, Hyeeun; Kim, Jong-Pill; Hwang, Joo Hwan; Cho, Sang-Nae; Kim, Tae Ue; Lee, Hyeyoung

    2015-10-01

    Drug resistance in Mycobacterium leprae is a significant problem in countries where leprosy is endemic. A sensitive, specific, and high-throughput reverse blot hybridization assay (REBA) for the detection of genotypic resistance to rifampicin (RIF) was designed and evaluated. It has been shown that resistance to RIF in M. leprae involves mutations in the rpoB gene encoding the -subunit of the RNA polymerase. The PCR-REBA simultaneously detects both 6 wild-type regions and 5 different mutations (507 AGC, 513 GTG, 516 TAT, 531 ATG, and 531 TTC) including the most prevalent mutations at positions 507 and 531. Thirty-one clinical isolates provided by Korea Institute of Hansen-s Disease were analyzed by PCR-REBA with RIF resistance of rpoB gene. As a result, missense mutations at codons 507 AGC and 531 ATG with 2-nucleotide substitutions were found in one sample, and a missense mutation at codon 516 TAT and ΔWT6 (deletion of 530-534) was found in another sample. These cases were confirmed by DNA sequence analysis. This rapid, simple, and highly sensitive assay provides a practical alternative to sequencing for genotypic evaluation of RIF resistance in M. leprae.

  15. [Development and evaluation of a rapid PCR detection kit for Ophiocordyceps sinensis].

    Hou, Fei-Xia; Cao, Jing; Wang, Sha-Sha; Wang, Xi; Yuan, Yuan; Peng, Cheng; Wan, De-Guang; Guo, Jin-Lin

    2017-03-01

    Ophiocordyceps sinensis is a valuable traditional Chinese medicine. Due to resource shortage, expensive price and huge market demand, there are many adulterants of O. sinensis in markets. Therefore, it is necessary to establish a rapid and effective method for distinguishing O. sinensis. Based on the species-specific PCR of O. sinensis, this study developed a detection kit by optimizing the components and evaluated the specificity, detection limit, repeatability and shelf life of the kit. The results showed that when the quality of O. sinensis accounted for more than 1/200 of that mixture, it could be detected successfully. Moreover, only O. sinensis could be amplified and glowed bright green fluorescence under ultraviolet light. The kit was still in effect when it was placed at 37 ℃ for three days, which indicated that it was stable and effective for one year stored in 4 ℃. The kit in the same batch under different operation conditions, and in different batch under the same operation conditions gave the same result and accuracy, which showed good repeatability of the kit. It is simple, rapid and accurate to distinguish O. sinensis from its adulterants using the kit, and lays the foundation for commercialization of traditional Chinese medicine fast detection kit. Copyright© by the Chinese Pharmaceutical Association.

  16. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients.

    Alejandro G Schijman

    Full Text Available BACKGROUND: A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. METHODOLOGY/FINDINGS: An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU I, IV and VI (set A, human blood spiked with parasite cells (set B and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C. Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA, 13 satellite DNA (Sat-DNA and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05-0.5 parasites/mL whereas specific kDNA tests detected 5.10(-3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood. The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3-94.4%, specificity of 85

  17. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  18. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Development of a primer–probe energy transfer based real-time PCR for the detection of Swine influenza virus

    Kowalczyk, Andrzej; Markowska-Daniel, Iwona; Rasmussen, Thomas Bruun

    2013-01-01

    Swine influenza virus (SIV) causes a contagious and requiring official notification disease of pigs and humans. In this study, a real-time reverse transcription-polymerase chain reaction (RT-PCR) assay based on primer–probe energy transfer (PriProET) for the detection of SIV RNA was developed...... of the specific product amplification. The assay is specific for influenza virus with a sensitivity of detection limit of approximately 10 copies of RNA by PCR. Based on serial dilutions of SIV, the detection limit of the assay was approximately 0.003 TCID50/ml for H1N1 A/Swine/Poland/KPR9/2004 virus. The Pri...

  20. Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.

    Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua

    2016-10-11

    The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.

  1. Two quantitative real-time PCR assays for the detection of penaeid shrimp and blue crab, crustacean shellfish allergens.

    Eischeid, Anne C; Kim, Bang-hyun; Kasko, Sasha M

    2013-06-19

    Food allergen detection methods must be able to specifically detect minute quantities of an allergenic food in a complex food matrix. One technique that can be used is real-time PCR. For the work described here, real-time PCR assays were developed to detect penaeid shrimp and blue crab, crustacean shellfish allergens. The method was tested using shrimp meat and crab meat spiked into several types of foods, including canned soups, deli foods, meat, seafood, and prepared seafood products. Foods were spiked with either shrimp or crab at levels ranging from 0.1 to 10⁶ parts per million (ppm) and analyzed either raw or cooked by a variety of methods. Real-time PCR data were used to generate linear standard curves, and assays were evaluated with respect to linear range and reaction efficiency. Results indicate that both assays performed well in a variety of food types. High reaction efficiencies were achieved across a linear range of 6-8 orders of magnitude. Limits of detection were generally between 0.1 and 1 ppm. Cooking methods used to simulate thermal processing of foods had little effect on assay performance. This work demonstrates that real-time PCR can be a valuable tool in the detection of crustacean shellfish.

  2. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  4. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

    Ma Mingxiao

    Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

  5. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  6. New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV).

    Morozov, Vladimir A; Morozov, Alexey V; Denner, Joachim

    2016-05-01

    Pigs are frequently infected with porcine cytomegalovirus (PCMV). Infected adult animals may not present with symptoms of disease, and the vi