Prevalence of gastrointestinal bacterial pathogens in a population of zoo animals.

Science.gov (United States)

Stirling, J; Griffith, M; Blair, I; Cormican, M; Dooley, J S G; Goldsmith, C E; Glover, S G; Loughrey, A; Lowery, C J; Matsuda, M; McClurg, R; McCorry, K; McDowell, D; McMahon, A; Cherie Millar, B; Nagano, Y; Rao, J R; Rooney, P J; Smyth, M; Snelling, W J; Xu, J; Moore, J E

2008-04-01

Faecal prevalence of gastrointestinal bacterial pathogens, including Campylobacter, Escherichia coli O157:H7, Salmonella, Shigella, Yersinia, as well as Arcobacter, were examined in 317 faecal specimens from 44 animal species in Belfast Zoological Gardens, during July-September 2006. Thermophilic campylobacters including Campylobacter jejuni, Campylobacter coli and Campylobacter lari, were the most frequently isolated pathogens, where members of this genus were isolated from 11 animal species (11 of 44; 25%). Yersinia spp. were isolated from seven animal species (seven of 44; 15.9%) and included, Yersinia enterocolitica (five of seven isolates; 71.4%) and one isolate each of Yersinia frederiksenii and Yersinia kristensenii. Only one isolate of Salmonella was obtained throughout the entire study, which was an isolate of Salmonella dublin (O 1,9,12: H g, p), originating from tiger faeces after enrichment. None of the animal species found in public contact areas of the zoo were positive for any gastrointestinal bacterial pathogens. Also, water from the lake in the centre of the grounds, was examined for the same bacterial pathogens and was found to contain C. jejuni. This study is the first report on the isolation of a number of important bacterial pathogens from a variety of novel host species, C. jejuni from the red kangaroo (Macropus rufus), C. lari from a maned wolf (Chrysocyon brachyurus), Y. kristensenii from a vicugna (Vicugna vicugna) and Y. enterocolitica from a maned wolf and red panda (Ailurus fulgens). In conclusion, this study demonstrated that the faeces of animals in public contact areas of the zoo were not positive for the bacterial gastrointestinal pathogens examined. This is reassuring for the public health of visitors, particularly children, who enjoy this educational and recreational resource.

Fundación del primer bioterio MPF funcional de Colombia Foundation of a functional murine pathogen free animal facility in Colombia

Directory of Open Access Journals (Sweden)

Ómar Vesga

2003-02-01

Full Text Available Cualquier investigación donde se experimente con modelos animales exige que el estado microbiológico y genético de los mismos sea definido desde el principio y verificado periódicamente para garantizar la fiabilidad y certeza de los datos. Buscando producir ratones libres de patógenos murinos en Colombia, se importaron 173 reproductores no emparentados suizos albinos de la cepa ICR que se hospedaron bajo condiciones protocolizadas de aislamiento microbiológico en el Bioterio MPF de la Facultad de Medicina de la Universidad de Antioquia. Tras dos años de funcionamiento ininterrumpido, el control microbiológico demostró que los progenitores mantuvieron inalterada la flora con la cual fueron exportados a Colombia, que sus crías portan flora murina idéntica, y que la misma corresponde a la exigida internacionalmente. Diversas pruebas a la integridad de la barrera microbiológica condujeron a la detección y erradicación de un brote infeccioso por Parvovirus murino. El control reproductivo permitió mantener intacta la heterocigocidad de la cepa, denominada Udea:ICR(CD-1. In order to guarantee the accuracy of the data, experimentation with animal models requires well defined microbiological and genetic statuses with periodical verification. To produce murine pathogen free mice, an outbreeding program was set up by importing 173 non-related Swiss albino ICR breeders that were hosted under strict conditions of microbiological isolation in the animal facilities of the University of Antioquia Medical Faculty. After two years of uninterrupted reproduction, microbiological control demonstrated unaltered murine flora for both parents and offspring, the same with which original breeders were dispatched to Colombia, complying with current international standards. An outbreak of Murine Parvovirus (MPV was timely detected and erradicated thanks to strict testing of microbiological barriers. The breeding program allowed the production of animals free

Monitoring of Yersinia enterocolitica strains from free-living animals using different methods.

Science.gov (United States)

Syczyło, K; Platt-Samoraj, A; Bancerz-Kisiel, A; Szczerba-Turek, A; Lipczyńska, K; Jabłoński, A; Procajło, Z; Szweda, W

2016-01-01

The aim of the study was to monitor Y. enterocolitica strains from free-living animals captured during 2011-2014 hunting seasons in Poland using warm (ITC) and cold (PSB) enrichment and molecular examination. Over 1600 samples have been cultured. After ITC/PSB enrichment 237 strains presenting features characteristic for Y. enterocolitica were isolated. Molecular examination using multiplex PCR revealed 140 isolates from PSB and 78 from ITC. The concentration of pathogenic Yersinia in asymptomatic carriers is low and the PCR detection should be preceded by bacteriological examination.

Application of photostable quantum dots for indirect immunofluorescent detection of specific bacterial serotypes on small marine animals

International Nuclear Information System (INIS)

Decho, Alan W; Beckman, Erin M; Chandler, G Thomas; Kawaguchi, Tomohiro

2008-01-01

An indirect immunofluorescence approach was developed using semiconductor quantum dot nanocrystals to label and detect a specific bacterial serotype of the bacterial human pathogen Vibrio parahaemolyticus, attached to small marine animals (i.e. benthic harpacticoid copepods), which are suspected pathogen carriers. This photostable labeling method using nanotechnology will potentially allow specific serotypes of other bacterial pathogens to be detected with high sensitivity in a range of systems, and can be easily applied for sensitive detection to other Vibrio species such as Vibrio cholerae

Serosurvey for selected pathogens in free-ranging American black bears (Ursus americanus) in Maryland, USA.

Science.gov (United States)

Bronson, Ellen; Spiker, Harry; Driscoll, Cindy P

2014-10-01

American black bears (Ursus americanus) in Maryland, USA, live in forested areas in close proximity to humans and their domestic pets. From 1999 to 2011, we collected 84 serum samples from 63 black bears (18 males; 45 females) in five Maryland counties and tested them for exposure to infectious, including zoonotic, pathogens. A large portion of the bears had antibody to canine distemper virus and Toxoplasma gondii, many at high titers. Prevalences of antibodies to zoonotic agents such as rabies virus and to infectious agents of carnivores including canine adenovirus and canine parvovirus were lower. Bears also had antibodies to vector-borne pathogens common to bears and humans such as West Nile virus, Borrelia burgdorferi, Rickettsia rickettsii, and Anaplasma phagocytophilum. Antibodies were detected to Leptospira interrogans serovars Pomona, Icterohaemorrhagiae, Canicola, Grippotyphosa, and Bratislava. We did not detect antibodies to Brucella canis or Ehrlichia canis. Although this population of Maryland black bears demonstrated exposure to multiple pathogens of concern for humans and domesticated animals, the low levels of clinical disease in this and other free-ranging black bear populations indicate the black bear is likely a spillover host for the majority of pathogens studied. Nevertheless, bear populations living at the human-domestic-wildlife interface with increasing human and domestic animal exposure should continue to be monitored because this population likely serves as a useful sentinel of ecosystem health.

Disease Risk Assessments Involving Companion Animals: an Overview for 15 Selected Pathogens Taking a European Perspective.

Science.gov (United States)

Rijks, J M; Cito, F; Cunningham, A A; Rantsios, A T; Giovannini, A

2016-07-01

Prioritization of companion animal transmissible diseases was performed by the Companion Animals multisectoriaL interprofessionaL Interdisciplinary Strategic Think tank On zoonoses (CALLISTO) project. The project considered diseases occurring in domesticated species commonly kept as pets, such as dogs and cats, but also included diseases occurring in captive wild animals and production animal species. The prioritization process led to the selection of 15 diseases of prime public health relevance, agricultural economic importance, or both. An analysis was made of the current knowledge on the risk of occurrence and transmission of these diseases among companion animals, and from companion animals to man (zoonoses) or to livestock. The literature was scanned for risk assessments for these diseases. Studies were classified as import risk assessments (IRAs) or risk factor analyses (RFAs) in endemic areas. For those pathogens that are absent from Europe, only IRAs were considered; for pathogens present throughout Europe, only RFAs were considered. IRAs were identified for seven of the eight diseases totally or partially absent from Europe. IRAs for classical rabies and alveolar echinococcosis found an increased risk for introduction of the pathogen into officially disease-free areas as a consequence of abandoning national rules and adopting the harmonized EU rules for pet travel. IRAs for leishmaniosis focused on risk associated with the presence of persistently infected dogs in new geographical areas, taking into consideration the risk of disease establishment should a competent vector arise. IRAs for Crimean-Congo haemorrhagic fever and West Nile fever indicated that the likelihood of introduction via companion animals was low. IRAs for bluetongue paid no attention to the risk of introduction via companion animals, which was also the case for IRAs for foot-and-mouth disease, the only disease considered to be absent from Europe. RFAs dealing with the risk factors for

Occurrence of human pathogenic Clostridium botulinum among healthy dairy animals: an emerging public health hazard.

Science.gov (United States)

Abdel-Moein, Khaled A; Hamza, Dalia A

2016-01-01

The current study was conducted to investigate the occurrence of human pathogenic Clostridium botulinum in the feces of dairy animals. Fecal samples were collected from 203 apparently healthy dairy animals (50 cattle, 50 buffaloes, 52 sheep, 51 goats). Samples were cultured to recover C. botulinum while human pathogenic C. botulinum strains were identified after screening of all C. botulinum isolates for the presence of genes that encode toxins type A, B, E, F. The overall prevalence of C. botulinum was 18.7% whereas human pathogenic C. botulinum strains (only type A) were isolated from six animals at the rates of 2, 2, 5.8, and 2% for cattle, buffaloes, sheep, and goats, respectively. High fecal carriage rates of C. botulinum among apparently healthy dairy animals especially type A alarm both veterinary and public health communities for a potential role which may be played by dairy animals in the epidemiology of such pathogen.

In vitro meat: A future animal-free harvest.

Science.gov (United States)

Bhat, Zuhaib Fayaz; Kumar, Sunil; Bhat, Hina Fayaz

2017-03-04

In vitro meat production is a novel idea of producing meat without involving animals with the help of tissue engineering techniques. This biofabrication of complex living products by using various bioengineering techniques is a potential solution to reduce the ill effects of current meat production systems and can dramatically transform traditional animal-based agriculture by inventing "animal-free" meat and meat products. Nutrition-related diseases, food-borne illnesses, resource use and pollution, and use of farm animals are some serious consequences associated with conventional meat production methods. This new way of animal-free meat production may offer health and environmental advantages by reducing environmental pollution and resource use associated with current meat production systems and will also ensure sustainable production of designer, chemically safe, and disease-free meat as the conditions in an in vitro meat production system are controllable and manipulatable. Theoretically, this system is believed to be efficient enough to supply the global demand for meat; however, establishment of a sustainable in vitro meat production would face considerably greater technical challenges and a great deal of research is still needed to establish this animal-free meat culturing system on an industrial scale.

Cytotoxic and pathogenic properties of Klebsiella oxytoca isolated from laboratory animals.

Directory of Open Access Journals (Sweden)

Alison Darby

Full Text Available Klebsiella oxytoca is an opportunistic pathogen implicated in various clinical diseases in animals and humans. Studies suggest that in humans K. oxytoca exerts its pathogenicity in part through a cytotoxin. However, cytotoxin production in animal isolates of K. oxytoca and its pathogenic properties have not been characterized. Furthermore, neither the identity of the toxin nor a complete repertoire of genes involved in K. oxytoca pathogenesis have been fully elucidated. Here, we showed that several animal isolates of K. oxytoca, including the clinical isolates, produced secreted products in bacterial culture supernatant that display cytotoxicity on HEp-2 and HeLa cells, indicating the ability to produce cytotoxin. Cytotoxin production appears to be regulated by the environment, and soy based product was found to have a strong toxin induction property. The toxin was identified, by liquid chromatography-mass spectrometry and NMR spectroscopy, as low molecular weight heat labile benzodiazepine, tilivalline, previously shown to cause cytotoxicity in several cell lines, including mouse L1210 leukemic cells. Genome sequencing and analyses of a cytotoxin positive K. oxytoca strain isolated from an abscess of a mouse, identified genes previously shown to promote pathogenesis in other enteric bacterial pathogens including ecotin, several genes encoding for type IV and type VI secretion systems, and proteins that show sequence similarity to known bacterial toxins including cholera toxin. To our knowledge, these results demonstrate for the first time, that animal isolates of K. oxytoca, produces a cytotoxin, and that cytotoxin production is under strict environmental regulation. We also confirmed tilivalline as the cytotoxin present in animal K. oxytoca strains. These findings, along with the discovery of a repertoire of genes with virulence potential, provide important insights into the pathogenesis of K. oxytoca. As a novel diagnostic tool, tilivalline

Social and behavioral barriers to pathogen transmission in wild animal populations

Energy Technology Data Exchange (ETDEWEB)

Loehle, C.S.

1988-12-31

Disease and pathogens have been studied as regulators of animal populations but not really as selective forces. The authors propose that pathogens can be major selective forces influencing social behaviors when these are successful at reducing disease transmission. The behaviors whose evolution could have been influenced by pathogen effects include group size, group isolation, mixed species flocking, migration, seasonal sociality, social avoidance, and dominance behaviors. Mate choice, mating system, and sexual selection are put in a new light when examined in terms of disease transmission. It is concluded that pathogen avoidance is a more powerful selective force than has heretofore been recognized.

Quantitative studies of lymphoid organs, blood and lymph in inbred athymic and euthymic LEW rats under germfree and specified-pathogen-free conditions

DEFF Research Database (Denmark)

Klausen, B; Hougen, H P

1987-01-01

Four groups of inbred male LEW rats were examined: A, germfree athymic; B, specified pathogen free (SPF) athymic; C, germfree euthymic; D, SPF euthymic. All animals were killed at 18 weeks and compared with respect to body weight, histological appearance and cell density of the lymphoid organs, h...

COMPARAÇÃO DE DE SUÍNOS CONVENCIONAIS E SPF (Specific pathogen Free

Directory of Open Access Journals (Sweden)

Luiz Fernando de Oliveira e Silva Carvalho

1994-01-01

Full Text Available RESUMO O experimento foi conduzido com o objetivo de qualificar e quantificar possíveis diferenças entre a produtividade de suínos convencionais e suínos SPF (Specific Pathogen Free. Foram mensurados e comparados, para tanto, a idade aos 100 quilos (IA, o ganho de peso diário (GPD, a conversão alimentar (CA e a espessura de toucinho (ET de um grupo com 42 machos, provenientes de granjas convencionais (grupo SC e outro com 113 machos, oriundos de granja SPF (grupo SPF. A média de peso corporal dos animais de ambos os grupos era de aproximadamente 30 quilos, ao início do experimento. A comparação entre as médias obtidas, para cada um dos parâmetros estudados, revelou produtividade estatisticamente significativa e superior em favor do grupo SPF. Assim, as IAs, os G PDs, as CAs e as ETs, obtidas para os grupos SPF e SC foram de, respectivamente, 150,49 e 156,4 dias, 897,78 e 955,19 gramas, 2,17:1 e 2,39:1 e 16,13 e 13,95mm. No grupo SPF, conforme evidenciado, observou-se um maior acúmulo de tecido adiposo, fato que sugere um menor dispêndio de energia para o combate a enfermidades crônicas, neste grupo de animais. Com base em projeção econômica dos resultados obtidos, os autores sugerem que a criação de animais SPF, embora possa exigir algum trabalho para sua implantação, é extremamente vantajosa, representando alternativa viável para a suinocultura brasileira.

Risks to farm animals from pathogens in composted catering waste containing meat.

Science.gov (United States)

Gale, P

2004-07-17

Uncooked meat may contain animal pathogens, including bovine spongiform encephalopathy, foot-and-mouth disease virus, African swine fever virus and classical swine fever virus, and to prevent outbreaks of these diseases in farm animals, the disposal of meat from catering waste is controlled under the Animal By-Products Regulations. This paper estimates the risks to farm animals of grazing land on to which compost, produced by the composting of catering waste containing meat, has been applied. The factors controlling the level of risk are the separation of the meat at source, the efficiency of the composting process, and the decay and dilution of the pathogens in soil. The net pathogen destruction by the composting process is determined largely by the degree of bypass, and to accommodate the possibility of large joints or even whole carcases being discarded uncooked to catering waste, a time/temperature condition of 60 degrees C for two days is recommended. Where data are lacking, worst-case assumptions have been applied. According to the model, classical swine fever virus constitutes the highest risk, but the assessment shows that a two-barrier composting approach, together with a two-month grazing ban, reduces the risk to one infection in pigs every 190 years in England and Wales. This work defined the operational conditions for the composting of catering waste as set out in the Animal By-Products Regulations 2003 (SI 1482).

Sex-specific differences in pathogen susceptibility in honey bees (Apis mellifera).

Science.gov (United States)

Retschnig, Gina; Williams, Geoffrey R; Mehmann, Marion M; Yañez, Orlando; de Miranda, Joachim R; Neumann, Peter

2014-01-01

Sex-related differences in susceptibility to pathogens are a common phenomenon in animals. In the eusocial Hymenoptera the two female castes, workers and queens, are diploid and males are haploid. The haploid susceptibility hypothesis predicts that haploid males are more susceptible to pathogen infections compared to females. Here we test this hypothesis using adult male (drone) and female (worker) honey bees (Apis mellifera), inoculated with the gut endoparasite Nosema ceranae and/or black queen cell virus (BQCV). These pathogens were chosen due to previously reported synergistic interactions between Nosema apis and BQCV. Our data do not support synergistic interactions between N. ceranae and BQCV and also suggest that BQCV has limited effect on both drone and worker health, regardless of the infection level. However, the data clearly show that, despite lower levels of N. ceranae spores in drones than in workers, Nosema-infected drones had both a higher mortality and a lower body mass than non-infected drones, across all treatment groups, while the mortality and body mass of worker bees were largely unaffected by N. ceranae infection, suggesting that drones are more susceptible to this pathogen than workers. In conclusion, the data reveal considerable sex-specific differences in pathogen susceptibility in honey bees and highlight the importance of ultimate measures for determining susceptibility, such as mortality and body quality, rather than mere infection levels.

Comparison of methods and animal models commonly used for investigation of fecal microbiota: Effects of time, host and gender

DEFF Research Database (Denmark)

Bernbom, Nete; Nørrung, Birgit; Saadbye, Peter

2006-01-01

and specific pathogen free (SPF). or human flora associated (HFA). A higher variation (p animals. Analysis of DGGE and T-RFLP profiles of fecal microbiota from SPF and HFA rats revealed that variation over time was less significant than...

Pathogenic waterborne free-living amoebae: An update from selected Southeast Asian countries

Science.gov (United States)

Abdul Majid, Mohamad Azlan; Mahboob, Tooba; Mong, Brandon G. J.; Jaturas, Narong; Richard, Reena Leeba; Tian-Chye, Tan; Phimphila, Anusorn; Mahaphonh, Panomphanh; Aye, Kyaw Nyein; Aung, Wai Lynn; Chuah, Joon; Ziegler, Alan D.; Yasiri, Atipat; Sawangjaroen, Nongyao; Lim, Yvonne A. L.; Nissapatorn, Veeranoot

2017-01-01

Data on the distribution of free-living amoebae is still lacking especially in Southeast Asian region. The aquatic environment revealed a high occurrence of free-living amoebae (FLA) due to its suitable condition and availability of food source, which subsequently causes infection to humans. A total of 94 water samples consisted of both treated and untreated from Laos (31), Myanmar (42), and Singapore (21) were investigated for the presence of pathogenic FLA. Each water sample was filtered and cultured onto non-nutrient agar seeded with live suspension of Escherichia coli and incubated at room temperature. Morphological identification was conducted for both trophozoites and cysts via microscopic stains (Giemsa and immunofluorescence). The presence of Naegleria-like structures was the most frequently encountered in both treated and untreated water samples, followed by Acanthamoeba-like and Vermamoeba-like features. To identify the pathogenic isolates, species-specific primer sets were applied for molecular identification of Acanthamoeba, Naegleria, and Vermamoeba. The pathogenic species of Acanthamoeba lenticulata and A. triangularis were detected from untreated water samples, while Vermamoeba vermiformis was found in both treated and untreated water samples. Our results suggested that poor water quality as well as inadequate maintenance and treatment might be the cause of this alarming problem since chlorine disinfection is ineffective in eradicating these amoebas in treated water samples. Regular monitoring and examination of water qualities are necessary in order to control the growth, hence, further preventing the widespread of FLA infections among the public. PMID:28212409

Zoonotic pathogens isolated from wild animals and environmental samples at two California wildlife hospitals.

Science.gov (United States)

Siembieda, Jennifer L; Miller, Woutrina A; Byrne, Barbara A; Ziccardi, Michael H; Anderson, Nancy; Chouicha, Nadira; Sandrock, Christian E; Johnson, Christine K

2011-03-15

To determine types and estimate prevalence of potentially zoonotic enteric pathogens shed by wild animals admitted to either of 2 wildlife hospitals and to characterize distribution of these pathogens and of aerobic bacteria in a hospital environment. Cross-sectional study. Fecal samples from 338 animals in 2 wildlife hospitals and environmental samples from 1 wildlife hospital. Fecal samples were collected within 24 hours of hospital admission. Environmental samples were collected from air and surfaces. Samples were tested for zoonotic pathogens via culture techniques and biochemical analyses. Prevalence of pathogen shedding was compared among species groups, ages, sexes, and seasons. Bacterial counts were determined for environmental samples. Campylobacter spp, Vibrio spp, Salmonella spp, Giardia spp, and Cryptosporidium spp (alone or in combination) were detected in 105 of 338 (31%) fecal samples. Campylobacter spp were isolated only from birds. Juvenile passerines were more likely to shed Campylobacter spp than were adults; prevalence increased among juvenile passerines during summer. Non-O1 serotypes of Vibrio cholerae were isolated from birds; during an oil-spill response, 9 of 10 seabirds screened were shedding this pathogen, which was also detected in environmental samples. Salmonella spp and Giardia spp were isolated from birds and mammals; Cryptosporidium spp were isolated from mammals only. Floors of animal rooms had higher bacterial counts than did floors with only human traffic. Potentially zoonotic enteric pathogens were identified in samples from several species admitted to wildlife hospitals, indicating potential for transmission if prevention is not practiced.

Genetic recombination between human and animal parasites creates novel strains of human pathogen.

Science.gov (United States)

Gibson, Wendy; Peacock, Lori; Ferris, Vanessa; Fischer, Katrin; Livingstone, Jennifer; Thomas, James; Bailey, Mick

2015-03-01

Genetic recombination between pathogens derived from humans and livestock has the potential to create novel pathogen strains, highlighted by the influenza pandemic H1N1/09, which was derived from a re-assortment of swine, avian and human influenza A viruses. Here we investigated whether genetic recombination between subspecies of the protozoan parasite, Trypanosoma brucei, from humans and animals can generate new strains of human pathogen, T. b. rhodesiense (Tbr) responsible for sleeping sickness (Human African Trypanosomiasis, HAT) in East Africa. The trait of human infectivity in Tbr is conferred by a single gene, SRA, which is potentially transferable to the animal pathogen Tbb by sexual reproduction. We tracked the inheritance of SRA in crosses of Tbr and Tbb set up by co-transmitting genetically-engineered fluorescent parental trypanosome lines through tsetse flies. SRA was readily transferred into new genetic backgrounds by sexual reproduction between Tbr and Tbb, thus creating new strains of the human pathogen, Tbr. There was no evidence of diminished growth or transmissibility of hybrid trypanosomes carrying SRA. Although expression of SRA is critical to survival of Tbr in the human host, we show that the gene exists as a single copy in a representative collection of Tbr strains. SRA was found on one homologue of chromosome IV in the majority of Tbr isolates examined, but some Ugandan Tbr had SRA on both homologues. The mobility of SRA by genetic recombination readily explains the observed genetic variability of Tbr in East Africa. We conclude that new strains of the human pathogen Tbr are being generated continuously by recombination with the much larger pool of animal-infective trypanosomes. Such novel recombinants present a risk for future outbreaks of HAT.

Genetic recombination between human and animal parasites creates novel strains of human pathogen.

Directory of Open Access Journals (Sweden)

Wendy Gibson

2015-03-01

Full Text Available Genetic recombination between pathogens derived from humans and livestock has the potential to create novel pathogen strains, highlighted by the influenza pandemic H1N1/09, which was derived from a re-assortment of swine, avian and human influenza A viruses. Here we investigated whether genetic recombination between subspecies of the protozoan parasite, Trypanosoma brucei, from humans and animals can generate new strains of human pathogen, T. b. rhodesiense (Tbr responsible for sleeping sickness (Human African Trypanosomiasis, HAT in East Africa. The trait of human infectivity in Tbr is conferred by a single gene, SRA, which is potentially transferable to the animal pathogen Tbb by sexual reproduction. We tracked the inheritance of SRA in crosses of Tbr and Tbb set up by co-transmitting genetically-engineered fluorescent parental trypanosome lines through tsetse flies. SRA was readily transferred into new genetic backgrounds by sexual reproduction between Tbr and Tbb, thus creating new strains of the human pathogen, Tbr. There was no evidence of diminished growth or transmissibility of hybrid trypanosomes carrying SRA. Although expression of SRA is critical to survival of Tbr in the human host, we show that the gene exists as a single copy in a representative collection of Tbr strains. SRA was found on one homologue of chromosome IV in the majority of Tbr isolates examined, but some Ugandan Tbr had SRA on both homologues. The mobility of SRA by genetic recombination readily explains the observed genetic variability of Tbr in East Africa. We conclude that new strains of the human pathogen Tbr are being generated continuously by recombination with the much larger pool of animal-infective trypanosomes. Such novel recombinants present a risk for future outbreaks of HAT.

Pathogen Prevalence From Traditional Cage and Free Range Production

Science.gov (United States)

Overview: A study was conducted to determine if differences in pathogen prevalence occurred between a sister flock of conventional cage and free range laying hens. Both environmental and egg microbiology was monitored throughout 20 – 79 weeks of age. Salmonella, Campylobacter, and Listeria preval...

Radiation Sensitivity of some Food Borne Bacterial Pathogens in Animal Foods and Minced Meat

International Nuclear Information System (INIS)

Mohammed, W.S.; Ali, A.R.; Alexan, A.F.

2010-01-01

Bacteriological examination of 100 samples of animal food stuffs (fish meal and bone and meat meal; as models of dry food materials) and 50 samples of minced meat (as a model of moist food materials) revealed the isolation of different bacterial pathogens; Escherichia coli, Klebsiella spp., Pseudomonas aeruginosa, Proteus spp., Staph. aureus and Salmonella species, in a decreasing order of occurrence. In the experiment; the dry food stuffs were sterilized in autoclave and the minced meat was sterilized by gamma irradiation at 10 kGy. The efficacy of gamma irradiation against the inoculated bacterial isolates (E coli 0157: H7, Salmonella enteritidis and Staph. aureus) in animal food stuffs and minced meat was investigated. Irradiated samples were stored at room temperature (25 degree C) for 2 weeks. The food borne pathogens used in this study showed a difference in radiation sensitivity. E. coli 0157: H7, Staphylococcus aureus and Salmonella enteritidis were eradicated at 1, 2 and 3 kGy, respectively. Also, inoculated pathogens in minced meat were more sensitive to ionizing radiation than dry animal food stuffs. It could be concluded that low doses of gamma irradiation are effective means of inactivating pathogenic bacteria. This radiation sensitivity is related to the bacterial isolates and the evaluated growth

Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece

Science.gov (United States)

Diakou, Anastasia; Di Cesare, Angela; Accettura, Paolo Matteo; Barros, Luciano; Iorio, Raffaella; Paoletti, Barbara; Frangipane di Regalbono, Antonio; Halos, Lénaïg; Beugnet, Frederic; Traversa, Donato

2017-01-01

This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos) and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90%) was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3%) cats were positive for one single infection, while 91 (60.7%) for more than one pathogen. A high number of (n. 53) multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24%) and Dipylidium caninum (2%), while a high number of examined animals (58.8%) had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2%) and Leishmania infantum (6.1%). DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people. PMID:28141857

Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece.

Directory of Open Access Journals (Sweden)

Anastasia Diakou

2017-01-01

Full Text Available This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90% was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3% cats were positive for one single infection, while 91 (60.7% for more than one pathogen. A high number of (n. 53 multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24% and Dipylidium caninum (2%, while a high number of examined animals (58.8% had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2% and Leishmania infantum (6.1%. DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people.

Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece.

Science.gov (United States)

Diakou, Anastasia; Di Cesare, Angela; Accettura, Paolo Matteo; Barros, Luciano; Iorio, Raffaella; Paoletti, Barbara; Frangipane di Regalbono, Antonio; Halos, Lénaïg; Beugnet, Frederic; Traversa, Donato

2017-01-01

This survey investigated the distribution of various intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in four regions of Greece. A total number of one hundred and fifty cats living in three Islands (Crete, Mykonos and Skopelos) and in Athens municipality was established as a realistic aim to be accomplished in the study areas. All cats were examined with different microscopic, serological and molecular assays aiming at evaluating the occurrence of intestinal parasites, and exposure to or presence of vector-borne infections. A total of 135 cats (90%) was positive for one or more parasites and/or pathogens transmitted by ectoparasites. Forty-four (29.3%) cats were positive for one single infection, while 91 (60.7%) for more than one pathogen. A high number of (n. 53) multiple infections caused by feline intestinal and vector-borne agents including at least one zoonotic pathogen was detected. Among them, the most frequently recorded helminths were roundworms (Toxocara cati, 24%) and Dipylidium caninum (2%), while a high number of examined animals (58.8%) had seroreaction for Bartonella spp., followed by Rickettsia spp. (43.2%) and Leishmania infantum (6.1%). DNA-based assays revealed the zoonotic arthropod-borne organisms Bartonella henselae, Bartonella clarridgeiae, Rickettsia spp., and L. infantum. These results show that free-ranging cats living in areas of Greece under examination may be exposed to a plethora of internal parasites and vector-borne pathogens, some of them potentially able to infect humans. Therefore, epidemiological vigilance and appropriate control measures are crucial for the prevention and control of these infections and to minimize the risk of infection for people.

Pathogenic landscapes: Interactions between land, people, disease vectors, and their animal hosts

Science.gov (United States)

2010-01-01

Background Landscape attributes influence spatial variations in disease risk or incidence. We present a review of the key findings from eight case studies that we conducted in Europe and West Africa on the impact of land changes on emerging or re-emerging vector-borne diseases and/or zoonoses. The case studies concern West Nile virus transmission in Senegal, tick-borne encephalitis incidence in Latvia, sandfly abundance in the French Pyrenees, Rift Valley Fever in the Ferlo (Senegal), West Nile Fever and the risk of malaria re-emergence in the Camargue, and rodent-borne Puumala hantavirus and Lyme borreliosis in Belgium. Results We identified general principles governing landscape epidemiology in these diverse disease systems and geographic regions. We formulated ten propositions that are related to landscape attributes, spatial patterns and habitat connectivity, pathways of pathogen transmission between vectors and hosts, scale issues, land use and ownership, and human behaviour associated with transmission cycles. Conclusions A static view of the "pathogenecity" of landscapes overlays maps of the spatial distribution of vectors and their habitats, animal hosts carrying specific pathogens and their habitat, and susceptible human hosts and their land use. A more dynamic view emphasizing the spatial and temporal interactions between these agents at multiple scales is more appropriate. We also highlight the complementarity of the modelling approaches used in our case studies. Integrated analyses at the landscape scale allows a better understanding of interactions between changes in ecosystems and climate, land use and human behaviour, and the ecology of vectors and animal hosts of infectious agents. PMID:20979609

Immunogenicity of commercial, formaldehyde and binary ethylenimine inactivated Newcastle disease virus vaccines in specific pathogen free chickens

Directory of Open Access Journals (Sweden)

Razmaraii, N.

2012-06-01

Full Text Available Newcastle disease (ND is one of the most important diseases that affect birds; the epizootic nature of the disease has caused severe economic losses in the poultry industry worldwide. In this experiment ND virus (NDV was inactivated by two different chemicals binary ethylenimine (BEI and formaldehyde. Formaldehyde was used at 0.1%, while BEI was used at concentrations of 1 to 4 mM. NDV inactivation with BEI was done in various incubation temperatures and periods and the best result (30 °C, 4 mM BEI and 21 hrs treatment used as an experimental vaccine. Prepared inactivated NDV vaccines and a commercial vaccine were tested for their efficiency in generating humoral immune response in different groups of specific pathogen free (SPF chicks. Test groups received 0.2 ml formaldehyde inactivated NDV (NDVF, BEI inactivated NDV (NDVEI and Razi institute produced NDV vaccine (NDVR subcutaneously respectively. HI Log 2 total mean titer of NDVEI group (8.42 ± 0.12 were significantly higher than NDVF (7.64 ± 0.16 and NDVR (7.86 ± 0.11 groups (p<0.05. BEI-inactivated vaccine gave higher antibody titers than formaldehyde-inactivated vaccine and preserves both structural integrity and antigenicity of the virus. Thus, it might be possible to use these compounds as an inactivator agent for commercial NDV inactivated vaccines in future.

Aptamer-Based Technologies in Foodborne Pathogen Detection.

Science.gov (United States)

Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

2016-01-01

Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

Aptamer-Based Technologies in Foodborne Pathogen Detection

Directory of Open Access Journals (Sweden)

Jun Teng

2016-09-01

Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

Insect immunity shows specificity in protection upon secondary pathogen exposure.

Science.gov (United States)

Sadd, Ben M; Schmid-Hempel, Paul

2006-06-20

Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.

Isolation and Probiotic Potential of Lactobacillus Salivarius and Pediococcus Pentosaceus in Specific Pathogen Free Chickens

Directory of Open Access Journals (Sweden)

F Chen

Full Text Available ABSTRACT This study was conducted to isolate Lactobacillus salivarius and Pediococcus pentosaceus strains from cecal content and investigate their probiotic potential in specific pathogen free (SPF chickens. L. salivarius and P. pentosaceus strains were isolated from the cecal content of SPF chickens and identified by 16s rDNA sequence analysis by BLAST analysis at the National Center for Biotechnology Information and phylogenetic analysis using DNAStar software. In an in vivo experiment, 180 7-day-old SPF chickens were randomly assigned into three groups. Group 1 served as a control that was fed a basal diet without probiotic supplementation, and groups 2 and 3 were fed the basal diets supplemented with L. salivarius and P. pentosaceus at 2×108 CFU/g, respectively. Body weight (BW, average daily gain (ADG, feed conversion ratio (FCR, dressing percentage (DP, and the apparent digestibility of crude protein (AD-CP were calculated. We also determined meat color, fat content, shear force, water content and pH value of breast and thigh muscles; ammonia, urea nitrogen and uric acid content in plasma; fecal ammonia emission level and pH value; and Lactobacillus and Escherichia coli in ceca. Compared with the control group, L. salivarius and P. pentosaceus supplementation significantly increased BW, ADG, DP, AD-CP, fat content of meat, and the number of Lactobacillus in ceca (p<0.05, and decreased FCR, plasma ammonia content, fecal ammonia emission, and pH value and the number of E. coli in ceca (p<0.05. In the in vitro experiment, L. salivarius and P. pentosaceus treatments significantly decreased the ammonia content in medium compared with the control group without probiotic treatment (p<0.05. These results suggest that P. pentosaceus and L. salivarius strains show promising probiotic properties for improving growth, meat quality and microenvironment in chickens and decreasing ammonia content in the medium.

Immune responses and interactions following simultaneous application of live Newcastle disease, infectious bronchitis and avian metapneumovirus vaccines in specific-pathogen-free chicks.

Science.gov (United States)

Awad, Faez; Forrester, Anne; Baylis, Matthew; Lemiere, Stephane; Jones, Richard; Ganapathy, Kannan

2015-02-01

Interactions between live Newcastle disease virus (NDV), avian metapneumovirus (aMPV) and infectious bronchitis virus (IBV) vaccines following simultaneous vaccination of day old specific pathogen free (SPF) chicks were evaluated. The chicks were divided into eight groups: seven vaccinated against NDV, aMPV and IBV (single, dual or triple) and one unvaccinated as control. Haemagglutination inhibition (HI) NDV antibody titres were similar across all groups but were above protective titres. aMPV vaccine when given with other live vaccines suppressed levels of aMPV enzyme-linked immunosorbent assay (ELISA) antibodies. Cellular and local immunity induced by administration of NDV, aMPV or IBV vaccines (individually or together) showed significant increase in CD4+, CD8+ and IgA bearing B-cells in the trachea compared to the unvaccinated group. Differences between the vaccinated groups were insignificant. Simultaneous vaccination with live NDV, aMPV and IBV did not affect the protection conferred against aMPV or IBV. Copyright © 2014 Elsevier Ltd. All rights reserved.

A multi-analyte biosensor for the simultaneous label-free detection of pathogens and biomarkers in point-of-need animal testing.

Science.gov (United States)

Ewald, Melanie; Fechner, Peter; Gauglitz, Günter

2015-05-01

For the first time, a multi-analyte biosensor platform has been developed using the label-free 1-lambda-reflectometry technique. This platform is the first, which does not use imaging techniques, but is able to perform multi-analyte measurements. It is designed to be portable and cost-effective and therefore allows for point-of-need testing or on-site field-testing with possible applications in diagnostics. This work highlights the application possibilities of this platform in the field of animal testing, but is also relevant and transferable to human diagnostics. The performance of the platform has been evaluated using relevant reference systems like biomarker (C-reactive protein) and serology (anti-Salmonella antibodies) as well as a panel of real samples (animal sera). The comparison of the working range and limit of detection shows no loss of performance transferring the separate assays to the multi-analyte setup. Moreover, the new multi-analyte platform allows for discrimination between sera of animals infected with different Salmonella subtypes.

Mixed infections reveal virulence differences between host-specific bee pathogens.

Science.gov (United States)

Klinger, Ellen G; Vojvodic, Svjetlana; DeGrandi-Hoffman, Gloria; Welker, Dennis L; James, Rosalind R

2015-07-01

Dynamics of host-pathogen interactions are complex, often influencing the ecology, evolution and behavior of both the host and pathogen. In the natural world, infections with multiple pathogens are common, yet due to their complexity, interactions can be difficult to predict and study. Mathematical models help facilitate our understanding of these evolutionary processes, but empirical data are needed to test model assumptions and predictions. We used two common theoretical models regarding mixed infections (superinfection and co-infection) to determine which model assumptions best described a group of fungal pathogens closely associated with bees. We tested three fungal species, Ascosphaera apis, Ascosphaera aggregata and Ascosphaera larvis, in two bee hosts (Apis mellifera and Megachile rotundata). Bee survival was not significantly different in mixed infections vs. solo infections with the most virulent pathogen for either host, but fungal growth within the host was significantly altered by mixed infections. In the host A. mellifera, only the most virulent pathogen was present in the host post-infection (indicating superinfective properties). In M. rotundata, the most virulent pathogen co-existed with the lesser-virulent one (indicating co-infective properties). We demonstrated that the competitive outcomes of mixed infections were host-specific, indicating strong host specificity among these fungal bee pathogens. Published by Elsevier Inc.

Label and label-free based surface-enhanced Raman scattering for pathogen bacteria detection: A review.

Science.gov (United States)

Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun

2017-08-15

Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.

Assessment of the safety of aquatic animal commodities for international trade: the OIE Aquatic Animal Health code.

Science.gov (United States)

Oidtmann, B; Johnston, C; Klotins, K; Mylrea, G; Van, P T; Cabot, S; Martin, P Rosado; Ababouch, L; Berthe, F

2013-02-01

Trading of aquatic animals and aquatic animal products has become increasingly globalized during the last couple of decades. This commodity trade has increased the risk for the spread of aquatic animal pathogens. The World Organisation for Animal Health (OIE) is recognized as the international standard-setting organization for measures relating to international trade in animals and animal products. In this role, OIE has developed the Aquatic Animal Health Code, which provides health measures to be used by competent authorities of importing and exporting countries to avoid the transfer of agents pathogenic for animals or humans, whilst avoiding unjustified sanitary barriers. An OIE ad hoc group developed criteria for assessing the safety of aquatic animals or aquatic animal products for any purpose from a country, zone or compartment not declared free from a given disease 'X'. The criteria were based on the absence of the pathogenic agent in the traded commodity or inactivation of the pathogenic agent by the commercial processing used to produce the commodity. The group also developed criteria to assess the safety of aquatic animals or aquatic animal products for retail trade for human consumption from potentially infected areas. Such commodities were assessed considering the form and presentation of the product, the expected volume of waste tissues generated by the consumer and the likely presence of viable pathogenic agent in the waste. The ad hoc group applied the criteria to commodities listed in the individual disease chapters of the Aquatic Animal Health Code (2008 edition). Revised lists of commodities for which no additional measures should be required by the importing countries regardless of the status for disease X of the exporting country were developed and adopted by the OIE World Assembly of Delegates in May 2011. The rationale of the criteria and their application will be explained and demonstrated using examples. © 2012 Crown Copyright. Reproduced

Quantification of pathogen inactivation efficacy by free chlorine disinfection of drinking water for QMRA.

Science.gov (United States)

Petterson, S R; Stenström, T A

2015-09-01

To support the implementation of quantitative microbial risk assessment (QMRA) for managing infectious risks associated with drinking water systems, a simple modeling approach for quantifying Log10 reduction across a free chlorine disinfection contactor was developed. The study was undertaken in three stages: firstly, review of the laboratory studies published in the literature; secondly, development of a conceptual approach to apply the laboratory studies to full-scale conditions; and finally implementation of the calculations for a hypothetical case study system. The developed model explicitly accounted for variability in residence time and pathogen specific chlorine sensitivity. Survival functions were constructed for a range of pathogens relying on the upper bound of the reported data transformed to a common metric. The application of the model within a hypothetical case study demonstrated the importance of accounting for variable residence time in QMRA. While the overall Log10 reduction may appear high, small parcels of water with short residence time can compromise the overall performance of the barrier. While theoretically simple, the approach presented is of great value for undertaking an initial assessment of a full-scale disinfection contactor based on limited site-specific information.

Associations between pathogen-specific clinical mastitis and somatic cell count patterns

NARCIS (Netherlands)

Haas, de Y.; Veerkamp, R.F.; Barkema, H.W.; Gröhn, Y.T.; Schukken, Y.H.

2004-01-01

Associations were estimated between pathogen-specific cases of clinical mastitis (CM) and somatic cell count (SCC) patterns based on deviations from the typical curve for SCC during lactation and compared with associations between pathogen-specific CM and lactation average SCC. Data from 274 Dutch

Genetic parameters for pathogen-specific mastitis resistance in Danish Holstein cattle

DEFF Research Database (Denmark)

Sørensen, Lars Peter; Madsen, P.; Mark, Thomas

2009-01-01

The objective of this study was to estimate heritabilities for and genetic correlations among different pathogen-specific mastitis traits. The traits were unspecific mastitis, which is all mastitis treatments regardless of the causative pathogen as well as mastitis caused by Streptococcus...... caused by different pathogens has been shown to differ greatly. Sampling bias may be present because there were not pathogen information on all mastitis treatments and because some farms do not record pathogen information. Therefore, improved recording of pathogen information and mastitis treatment sin...

Protein Export According to Schedule: Architecture, Assembly, and Regulation of Type III Secretion Systems from Plant- and Animal-Pathogenic Bacteria

Science.gov (United States)

2012-01-01

Summary: Flagellar and translocation-associated type III secretion (T3S) systems are present in most Gram-negative plant- and animal-pathogenic bacteria and are often essential for bacterial motility or pathogenicity. The architectures of the complex membrane-spanning secretion apparatuses of both systems are similar, but they are associated with different extracellular appendages, including the flagellar hook and filament or the needle/pilus structures of translocation-associated T3S systems. The needle/pilus is connected to a bacterial translocon that is inserted into the host plasma membrane and mediates the transkingdom transport of bacterial effector proteins into eukaryotic cells. During the last 3 to 5 years, significant progress has been made in the characterization of membrane-associated core components and extracellular structures of T3S systems. Furthermore, transcriptional and posttranscriptional regulators that control T3S gene expression and substrate specificity have been described. Given the architecture of the T3S system, it is assumed that extracellular components of the secretion apparatus are secreted prior to effector proteins, suggesting that there is a hierarchy in T3S. The aim of this review is to summarize our current knowledge of T3S system components and associated control proteins from both plant- and animal-pathogenic bacteria. PMID:22688814

Survival of viral pathogens in animal feed ingredients under transboundary shipping models

Science.gov (United States)

Bauermann, Fernando V.; Niederwerder, Megan C.; Singrey, Aaron; Clement, Travis; de Lima, Marcelo; Long, Craig; Patterson, Gilbert; Sheahan, Maureen A.; Stoian, Ana M. M.; Petrovan, Vlad; Jones, Cassandra K.; De Jong, Jon; Ji, Ju; Spronk, Gordon D.; Minion, Luke; Christopher-Hennings, Jane; Zimmerman, Jeff J.; Rowland, Raymond R. R.; Nelson, Eric; Sundberg, Paul; Diel, Diego G.

2018-01-01

The goal of this study was to evaluate survival of important viral pathogens of livestock in animal feed ingredients imported daily into the United States under simulated transboundary conditions. Eleven viruses were selected based on global significance and impact to the livestock industry, including Foot and Mouth Disease Virus (FMDV), Classical Swine Fever Virus (CSFV), African Swine Fever Virus (ASFV), Influenza A Virus of Swine (IAV-S), Pseudorabies virus (PRV), Nipah Virus (NiV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Swine Vesicular Disease Virus (SVDV), Vesicular Stomatitis Virus (VSV), Porcine Circovirus Type 2 (PCV2) and Vesicular Exanthema of Swine Virus (VESV). Surrogate viruses with similar genetic and physical properties were used for 6 viruses. Surrogates belonged to the same virus families as target pathogens, and included Senecavirus A (SVA) for FMDV, Bovine Viral Diarrhea Virus (BVDV) for CSFV, Bovine Herpesvirus Type 1 (BHV-1) for PRV, Canine Distemper Virus (CDV) for NiV, Porcine Sapelovirus (PSV) for SVDV and Feline Calicivirus (FCV) for VESV. For the remaining target viruses, actual pathogens were used. Virus survival was evaluated using Trans-Pacific or Trans-Atlantic transboundary models involving representative feed ingredients, transport times and environmental conditions, with samples tested by PCR, VI and/or swine bioassay. SVA (representing FMDV), FCV (representing VESV), BHV-1 (representing PRV), PRRSV, PSV (representing SVDV), ASFV and PCV2 maintained infectivity during transport, while BVDV (representing CSFV), VSV, CDV (representing NiV) and IAV-S did not. Notably, more viruses survived in conventional soybean meal, lysine hydrochloride, choline chloride, vitamin D and pork sausage casings. These results support published data on transboundary risk of PEDV in feed, demonstrate survival of certain viruses in specific feed ingredients (“high-risk combinations”) under conditions simulating transport between

Evaluation of Patients with Community-Acquired Pneumonia Caused by Zoonotic Pathogens in an Area with a High Density of Animal Farms.

Science.gov (United States)

Huijskens, E G W; Smit, L A M; Rossen, J W A; Heederik, D; Koopmans, M

2016-03-01

Intensive animal farming could potentially lead to outbreaks of infectious diseases. Clinicians are at the forefront of detecting unusual diseases, but the lack of specificity of zoonotic disease symptoms makes this a challenging task. We evaluated patients with community-acquired pneumonia (CAP) with known and unknown aetiology in an area with a high livestock density and a potential association with animal farms in the proximity. Between 2008 and 2009, a period coinciding with a large Q fever outbreak in the Netherlands, patients with CAP were tested for the presence of possible respiratory pathogens. The presence and number of farm animals within 1 km of the patients' home address were assessed using geographic information system (GIS) and were compared between cases and age-matched control subjects. Of 408 patients with CAP, pathogens were detected in 275 (67.4%) patients. The presence of sheep and the number of goats were associated with CAP caused by Coxiella burnetii in a multiple logistic regression model (P 0.10). The use of GIS in combination with aetiology of CAP could be potentially used to target diagnostics and to identify outbreaks of rare zoonotic disease. © 2015 Blackwell Verlag GmbH.

Efficacy of fenbendazole formulated in a commercial primate diet for treating specific pathogen-free baboons (Papio cynocephalus anubis) infected with Trichuris trichiura.

Science.gov (United States)

Reichard, Mason V; Wolf, Roman F; Clingenpeel, Lindsay C; Doan, Sandra K; Jones, Amy N; Gray, Kristene M

2008-11-01

Trichuris trichiura is a common intestinal nematode parasite of captive baboons. We evaluated the efficacy of fenbendazole formulated in a commercial primate diet (FBZ-PD) for treating specific pathogen-free (SPF) baboons (Papio cynocephalus anubis) naturally infected with Trichuris trichiura. Twenty-nine baboons, housed indoors in 3 separate rooms, were fed FBZ-PD for 5 d, whereas 4 baboons housed in another isolated area served as untreated controls. The efficacy of FBZ-PD was measured as reduction in the number of T. trichiura eggs in host feces after treatment as determined by quantitative fecal flotation examination. All baboons that received FBZ-PD stopped shedding T. trichiura eggs by 7 d after initiation of treatment, and remained negative until at least 119 d after treatment. However, eggs of T. trichiura were present in the feces of 3 (10.3%) experimental baboons at 154 d after treatment. Untreated control baboons shed T. trichiura eggs throughout the entire study. Our results indicate that FBZ-PD was efficacious for treating SPF baboons infected with T. trichiura.

Graphene-interfaced electrical biosensor for label-free and sensitive detection of foodborne pathogenic E. coli O157:H7.

Science.gov (United States)

Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum

2017-05-15

E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

Pathogenicity of Cryptosporidium parvum - evaluation of an animal infection model

DEFF Research Database (Denmark)

Enemark, Heidi L.; Bille-Hansen, Vivi; Lind, Peter

2003-01-01

and rectum. The unintended presence of rotavirus in some of the experimental animals revealed an additive or synergistic effect between rotavirus and C. parvum as indicated by prolonged diarrhoea, increased oocyst shedding, decreased weight gain and elevated levels of serum haptoglobin and serum amyloid...... A (SAA) in piglets infected simultaneously with both pathogens. The difference in daily weight gain between infected and control animals was significant only for piglets co-infected with rotavirus. The acute phase response of haptoglobin and SAA was characterised by a large individual variation....... In piglets, co-infected with rotavirus, the levels of serum haptoglobin were 3.5 and 4.6 times higher in the infected versus the controls 6 and 9 dpi, respectively (mean values: 2411 mug/ml +/- S.D. 2023 and 1840 mug/ml +/- S.D. 1697). In the controls infected with rotavirus, peak haptoglobin concentration...

Streptococcus suis, an emerging drug-resistant animal and human pathogen

Directory of Open Access Journals (Sweden)

Claudio ePalmieri

2011-11-01

Full Text Available Streptococcus suis, a major porcine pathogen, has been receiving growing attention not only for its role in severe and increasingly reported infections in humans, but also for its involvement in drug resistance. Recent studies and the analysis of sequenced genomes have been providing important insights into the S. suis resistome, and have resulted in the identification of resistance determinants for tetracyclines, macrolides, aminoglycosides, chloramphenicol, antifolate drugs, streptothricin, and cadmium salts. Resistance gene-carrying genetic elements described so far include integrative and conjugative elements, transposons, genomic islands, phages, and chimeric elements. Some of these elements are similar to those reported in major streptococcal pathogens such as Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae and share the same chromosomal insertion sites. The available information strongly suggests that S. suis is an important antibiotic resistance reservoir that can contribute to the spread of resistance genes to the above-mentioned streptococci. S. suis is thus a paradigmatic example of possible intersections between animal and human resistomes.

The Chlamydia psittaci genome: a comparative analysis of intracellular pathogens.

Directory of Open Access Journals (Sweden)

Anja Voigt

Full Text Available Chlamydiaceae are a family of obligate intracellular pathogens causing a wide range of diseases in animals and humans, and facing unique evolutionary constraints not encountered by free-living prokaryotes. To investigate genomic aspects of infection, virulence and host preference we have sequenced Chlamydia psittaci, the pathogenic agent of ornithosis.A comparison of the genome of the avian Chlamydia psittaci isolate 6BC with the genomes of other chlamydial species, C. trachomatis, C. muridarum, C. pneumoniae, C. abortus, C. felis and C. caviae, revealed a high level of sequence conservation and synteny across taxa, with the major exception of the human pathogen C. trachomatis. Important differences manifest in the polymorphic membrane protein family specific for the Chlamydiae and in the highly variable chlamydial plasticity zone. We identified a number of psittaci-specific polymorphic membrane proteins of the G family that may be related to differences in host-range and/or virulence as compared to closely related Chlamydiaceae. We calculated non-synonymous to synonymous substitution rate ratios for pairs of orthologous genes to identify putative targets of adaptive evolution and predicted type III secreted effector proteins.This study is the first detailed analysis of the Chlamydia psittaci genome sequence. It provides insights in the genome architecture of C. psittaci and proposes a number of novel candidate genes mostly of yet unknown function that may be important for pathogen-host interactions.

The Chlamydia psittaci genome: a comparative analysis of intracellular pathogens.

Science.gov (United States)

Voigt, Anja; Schöfl, Gerhard; Saluz, Hans Peter

2012-01-01

Chlamydiaceae are a family of obligate intracellular pathogens causing a wide range of diseases in animals and humans, and facing unique evolutionary constraints not encountered by free-living prokaryotes. To investigate genomic aspects of infection, virulence and host preference we have sequenced Chlamydia psittaci, the pathogenic agent of ornithosis. A comparison of the genome of the avian Chlamydia psittaci isolate 6BC with the genomes of other chlamydial species, C. trachomatis, C. muridarum, C. pneumoniae, C. abortus, C. felis and C. caviae, revealed a high level of sequence conservation and synteny across taxa, with the major exception of the human pathogen C. trachomatis. Important differences manifest in the polymorphic membrane protein family specific for the Chlamydiae and in the highly variable chlamydial plasticity zone. We identified a number of psittaci-specific polymorphic membrane proteins of the G family that may be related to differences in host-range and/or virulence as compared to closely related Chlamydiaceae. We calculated non-synonymous to synonymous substitution rate ratios for pairs of orthologous genes to identify putative targets of adaptive evolution and predicted type III secreted effector proteins. This study is the first detailed analysis of the Chlamydia psittaci genome sequence. It provides insights in the genome architecture of C. psittaci and proposes a number of novel candidate genes mostly of yet unknown function that may be important for pathogen-host interactions.

Differences in pathogenicity of three animal isolates of Mycobacterium species in a mouse model.

Directory of Open Access Journals (Sweden)

Haodi Dong

Full Text Available Animal mycobacterioses are among the most important zoonoses worldwide. These are generally caused by either Mycobacterium tuberculosis (MTB, M. bovis (MBO or M. avium (MAV. To test the hypothesis that different species of pathogenic mycobacteria isolated from varied anatomic locations or animal species differ in virulence and pathogenicity, we performed experiments with three mycobacteria strains (NTSE-3(MTB, NTSE-4(MBO and NTSE-5 (MAV obtained from animal species. Spoligotyping analysis was used to confirm both MTB and MBO strains while the MAV strain was confirmed by 16s rDNA sequencing. BALB/c mice were intranasally infected with the three strains at low and high CFU doses to evaluate variations in pathogenicity. Clinical and pathological parameters were assessed. Infected mice were euthanized at 80 days post-inoculation (dpi. Measures of lung and body weights indicated that the MBO infected group had higher mortality, more weight loss, higher bacterial burden and more severe lesions in lungs than the other two groups. Cytokine profiles showed higher levels of TNF-α for MBO versus MTB, while MAV had the highest amounts of IFN-β in vitro and in vivo. In vitro levels of other cytokines such as IL-1β, IL-10, IL-12, IL-17, and IFN-β showed that Th1 cells had the strongest response in MBO infected mice and that Th2 cells were inhibited. We found that the level of virulence among the three isolates decreased in the following order MBO>MTB>MAV.

Human and Animal Isolates of Yersinia enterocolitica Show Significant Serotype-Specific Colonization and Host-Specific Immune Defense Properties

Science.gov (United States)

Schaake, Julia; Kronshage, Malte; Uliczka, Frank; Rohde, Manfred; Knuuti, Tobias; Strauch, Eckhard; Fruth, Angelika; Wos-Oxley, Melissa

2013-01-01

Yersinia enterocolitica is a human pathogen that is ubiquitous in livestock, especially pigs. The bacteria are able to colonize the intestinal tract of a variety of mammalian hosts, but the severity of induced gut-associated diseases (yersiniosis) differs significantly between hosts. To gain more information about the individual virulence determinants that contribute to colonization and induction of immune responses in different hosts, we analyzed and compared the interactions of different human- and animal-derived isolates of serotypes O:3, O:5,27, O:8, and O:9 with murine, porcine, and human intestinal cells and macrophages. The examined strains exhibited significant serotype-specific cell binding and entry characteristics, but adhesion and uptake into different host cells were not host specific and were independent of the source of the isolate. In contrast, survival and replication within macrophages and the induced proinflammatory response differed between murine, porcine, and human macrophages, suggesting a host-specific immune response. In fact, similar levels of the proinflammatory cytokine macrophage inflammatory protein 2 (MIP-2) were secreted by murine bone marrow-derived macrophages with all tested isolates, but the equivalent interleukin-8 (IL-8) response of porcine bone marrow-derived macrophages was strongly serotype specific and considerably lower in O:3 than in O:8 strains. In addition, all tested Y. enterocolitica strains caused a considerably higher level of secretion of the anti-inflammatory cytokine IL-10 by porcine than by murine macrophages. This could contribute to limiting the severity of the infection (in particular of serotype O:3 strains) in pigs, which are the primary reservoir of Y. enterocolitica strains pathogenic to humans. PMID:23959720

Host pathogen relations: exploring animal models for fungal pathogens.

Science.gov (United States)

Harwood, Catherine G; Rao, Reeta P

2014-06-30

Pathogenic fungi cause superficial infections but pose a significant public health risk when infections spread to deeper tissues, such as the lung. Within the last three decades, fungi have been identified as the leading cause of nosocomial infections making them the focus of research. This review outlines the model systems such as the mouse, zebrafish larvae, flies, and nematodes, as well as ex vivo and in vitro systems available to study common fungal pathogens.

Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

Science.gov (United States)

Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia

2015-01-01

Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839

Host Pathogen Relations: Exploring Animal Models for Fungal Pathogens

Directory of Open Access Journals (Sweden)

Catherine G. Harwood

2014-06-01

Full Text Available Pathogenic fungi cause superficial infections but pose a significant public health risk when infections spread to deeper tissues, such as the lung. Within the last three decades, fungi have been identified as the leading cause of nosocomial infections making them the focus of research. This review outlines the model systems such as the mouse, zebrafish larvae, flies, and nematodes, as well as ex vivo and in vitro systems available to study common fungal pathogens.

Virulence of luminescent and non-luminescent isogenic vibrios towards gnotobiotic Artemia franciscana larvae and specific pathogen-free Litopenaeus vannamei shrimp.

Science.gov (United States)

Phuoc, L H; Defoirdt, T; Sorgeloos, P; Bossier, P

2009-04-01

This study was conducted to test the virulence of luminescent (L) and non-luminescent (NL) isogenic strains of Vibrio campbellii LMG21363, Vibrio harveyi BB120 (wild type) and quorum-sensing mutant strains derived from the wild type such as Vibrio harveyi BB152, BB170, MM30 and BB886. The NL strains could be obtained by culturing rifampicin-resistant luminescent strains in the dark under static condition. The virulence of the L and NL strains was tested in gnotobiotic Artemia franciscana larvae challenged with 10(4) CFU ml(-1) of bacteria. All luminescent isogenic tested strains showed higher virulence compared to the NL strains. The virulence of L and NL V. campbellii and V. harveyi BB120 was also tested in specific pathogen-free juvenile shrimp upon intramuscular injection with 10(6) CFU of bacteria. In contrast with Artemia, there was no significant difference in mortality between the groups challenged with L and NL strains (P > 0.05). The non-luminescent strains were not able to revert back to the luminescent state and quorum sensing did not influence this phenotypic shift. Luminescent Vibrio strains can switch to a non-luminescent state by culturing them in static conditions. The NL strains become less virulent as verified in Artemia. The luminescent state of Vibrio cells in a culture needs to be verified in order to assure maintenance of virulence.

Animals devoid of pulmonary system as infection models in the study of lung bacterial pathogens

Science.gov (United States)

López Hernández, Yamilé; Yero, Daniel; Pinos-Rodríguez, Juan M.; Gibert, Isidre

2015-01-01

Biological disease models can be difficult and costly to develop and use on a routine basis. Particularly, in vivo lung infection models performed to study lung pathologies use to be laborious, demand a great time and commonly are associated with ethical issues. When infections in experimental animals are used, they need to be refined, defined, and validated for their intended purpose. Therefore, alternative and easy to handle models of experimental infections are still needed to test the virulence of bacterial lung pathogens. Because non-mammalian models have less ethical and cost constraints as a subjects for experimentation, in some cases would be appropriated to include these models as valuable tools to explore host–pathogen interactions. Numerous scientific data have been argued to the more extensive use of several kinds of alternative models, such as, the vertebrate zebrafish (Danio rerio), and non-vertebrate insects and nematodes (e.g., Caenorhabditis elegans) in the study of diverse infectious agents that affect humans. Here, we review the use of these vertebrate and non-vertebrate models in the study of bacterial agents, which are considered the principal causes of lung injury. Curiously none of these animals have a respiratory system as in air-breathing vertebrates, where respiration takes place in lungs. Despite this fact, with the present review we sought to provide elements in favor of the use of these alternative animal models of infection to reveal the molecular signatures of host–pathogen interactions. PMID:25699030

Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis

Science.gov (United States)

Rohmer, Laurence; Hocquet, Didier; Miller, Samuel I.

2011-01-01

It is interesting to speculate that the evolutionary drive of microbes to develop pathogenic characteristics was to access the nutrient resources that animals provided. Environments in animals that pathogens colonize have also driven the evolution of new bacterial characteristics to maximize these new nutritional opportunities. This review focuses on genomic and functional aspects of pathogen metabolism that allow efficient utilization of nutrient resources provided by animals. Similar to genes encoding specific virulence traits, some genes encoding metabolic functions have been horizontally acquired by pathogens to provide a selective advantage in host tissues. Selective advantage in host tissues can also be gained in some circumstances by loss of function due to mutations that alter metabolic capabilities. Greater understanding of bacterial metabolism within host tissues should be important for increased understanding of host-pathogen interactions and the development of future therapeutic strategies. PMID:21600774

Wildlife translocation: the conservation implications of pathogen exposure and genetic heterozygosity

Science.gov (United States)

2011-01-01

Background A key challenge for conservation biologists is to determine the most appropriate demographic and genetic management strategies for wildlife populations threatened by disease. We explored this topic by examining whether genetic background and previous pathogen exposure influenced survival of translocated animals when captive-bred and free-ranging bighorn sheep (Ovis canadensis) were used to re-establish a population that had been extirpated in the San Andres Mountains in New Mexico, USA. Results Although the free-ranging source population had significantly higher multi-locus heterozygosity at 30 microsatellite loci than the captive bred animals, neither source population nor genetic background significantly influenced survival or cause of death. The presence of antibodies to a respiratory virus known to cause pneumonia was associated with increased survival, but there was no correlation between genetic heterozygosity and the presence of antibodies to this virus. Conclusions Although genetic theory predicts otherwise, increased heterozygosity was not associated with increased fitness (survival) among translocated animals. While heterosis or genetic rescue effects may occur in F1 and later generations as the two source populations interbreed, we conclude that previous pathogen exposure was a more important marker than genetic heterozygosity for predicting survival of translocated animals. Every wildlife translocation is an experiment, and whenever possible, translocations should be designed and evaluated to test hypotheses that will further improve our understanding of how pathogen exposure and genetic variability influence fitness. PMID:21284886

Wildlife translocation: the conservation implications of pathogen exposure and genetic heterozygosity

Directory of Open Access Journals (Sweden)

Penedo M Cecilia T

2011-02-01

Full Text Available Abstract Background A key challenge for conservation biologists is to determine the most appropriate demographic and genetic management strategies for wildlife populations threatened by disease. We explored this topic by examining whether genetic background and previous pathogen exposure influenced survival of translocated animals when captive-bred and free-ranging bighorn sheep (Ovis canadensis were used to re-establish a population that had been extirpated in the San Andres Mountains in New Mexico, USA. Results Although the free-ranging source population had significantly higher multi-locus heterozygosity at 30 microsatellite loci than the captive bred animals, neither source population nor genetic background significantly influenced survival or cause of death. The presence of antibodies to a respiratory virus known to cause pneumonia was associated with increased survival, but there was no correlation between genetic heterozygosity and the presence of antibodies to this virus. Conclusions Although genetic theory predicts otherwise, increased heterozygosity was not associated with increased fitness (survival among translocated animals. While heterosis or genetic rescue effects may occur in F1 and later generations as the two source populations interbreed, we conclude that previous pathogen exposure was a more important marker than genetic heterozygosity for predicting survival of translocated animals. Every wildlife translocation is an experiment, and whenever possible, translocations should be designed and evaluated to test hypotheses that will further improve our understanding of how pathogen exposure and genetic variability influence fitness.

Causes and consequences of pathogenic processes in evolution: Implications from experimental epilepsy in animals

NARCIS (Netherlands)

Godlevsky, L.S.; Luijtelaar, E.L.J.M. van; Shandra, A.A.; Coenen, A.M.L.

2002-01-01

Examples from experimental epilepsy in animals are used to illustrate the view that a crucial role of the transfer of mechanisms from compensatory into pathogenic (e.g. lethal ones in the course of a disease), is played by the power of pathologic stimuli. In the genesis of epilepsy it is suggested

[Animals as a potential source of human fungal infections].

Science.gov (United States)

Dworecka-Kaszak, Bozena

2008-01-01

Changing environment is a reason, that many saprotrophic fungi became opportunists and in the end also maybe a pathogenic. Host specific adaptation is not so strong among fungi, so there are many common fungal pathogens for people and for animals. Animals suffering from dermatomycosis are well recognize as source of human superficial mycoses. Breeding of different exotic animals such as parrots, various Reptiles and Amphibians, miniature Rodents and keeping them as a pets in the peoples houses, have become more and more popular in the recent years. This article is shortly presenting which animals maybe a potential source of fungal infections for humans. Looking for the other mycoses as systemic mycoses, especially candidiasis or aspergilosis there are no data, which allow excluding sick animals as a source of infection for human, even if those deep mycoses have endogenic reactivation mechanism. Immunocompromised people are in high-risk group when they take care of animals. Another important source of potentially pathogenic, mostly air-born fungi may be animal use in experimental laboratory work. During the experiments is possible that laboratory workers maybe hurt and these animals and their environment, food and house boxes could be the possible source of microorganisms, pathogenic for humans or other animals. Unusual way to inoculate these potentially pathogens into the skin of laboratory personnel may cause granulomatous, local lesions on their hands.

Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

Energy Technology Data Exchange (ETDEWEB)

Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2016-11-18

To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and a fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.

Science.gov (United States)

Cheng, Wei; Li, He-Ping; Zhang, Jing-Bo; Du, Hong-Jie; Wei, Qi-Yong; Huang, Tao; Yang, Peng; Kong, Xian-Wei; Liao, Yu-Cai

2015-06-01

Fusarium head blight (FHB) in wheat and other small grain cereals is a globally devastating disease caused by toxigenic Fusarium pathogens. Controlling FHB is a challenge because germplasm that is naturally resistant against these pathogens is inadequate. Current control measures rely on fungicides. Here, an antibody fusion comprised of the Fusarium spp.-specific recombinant antibody gene CWP2 derived from chicken, and the endochitinase gene Ech42 from the biocontrol fungus Trichoderma atroviride was introduced into the elite wheat cultivar Zhengmai9023 by particle bombardment. Expression of this fusion gene was regulated by the lemma/palea-specific promoter Lem2 derived from barley; its expression was confirmed as lemma/palea-specific in transgenic wheat. Single-floret inoculation of independent transgenic wheat lines of the T3 to T6 generations revealed significant resistance (type II) to fungal spreading, and natural infection assays in the field showed significant resistance (type I) to initial infection. Gas chromatography-mass spectrometry analysis revealed marked reduction of mycotoxins in the grains of the transgenic wheat lines. Progenies of crosses between the transgenic lines and the FHB-susceptible cultivar Huamai13 also showed significantly enhanced FHB resistance. Quantitative real-time PCR analysis revealed that the tissue-specific expression of the antibody fusion was induced by salicylic acid drenching and induced to a greater extent by F. graminearum infection. Histochemical analysis showed substantial restriction of mycelial growth in the lemma tissues of the transgenic plants. Thus, the combined tissue-specific and pathogen-inducible expression of this Fusarium-specific antibody fusion can effectively protect wheat against Fusarium pathogens and reduce mycotoxin content in grain. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Bursal immunopathology responses of specific-pathogen-free chickens and red jungle fowl infected with very virulent infectious bursal disease virus.

Science.gov (United States)

Farhanah, Mohd Isa; Yasmin, Abdul Rahaman; Khanh, Nguyen Phuc; Yeap, Swee Keong; Hair-Bejo, Mohd; Omar, Abdul Rahman

2018-04-06

Very virulent infectious bursal disease virus (vvIBDV) targets B lymphocytes in the bursa of Fabricius (BF), causing immunosuppression and increased mortality rates in young birds. There have been few studies on the host immune response following vvIBDV infection at different inoculum doses in chickens with different genetic backgrounds. In this study, we characterized the immune responses of specific-pathogen-free (SPF) chickens and Malaysian red jungle fowl following infection with vvIBDV strain UPM0081 at 10 3.8 and 10 6.8 times the 50% embryo infectious dose (EID 50 ). The viral burden, histopathological changes, immune cell populations, and expression of immune-related genes were measured and compared between infected and uninfected bursa at specific intervals. The populations of KUL1 + , CD3 + CD4 + and CD3 + CD8 + cells were significantly increased in both types of chickens at 3 dpi, and there was significant early depletion of IgM + B cells at 1 dpi in the red jungle fowl. vvIBDV infection also induced differential expression of genes that are involved in Th1 and pro-inflammatory responses, with groups receiving the higher dose (10 6.8 EID 50 ) showing earlier expression of IFNG, IL12B, IL15, IL6, CXCLi2, IL28B, and TLR3 at 1 dpi. Although both chicken types showed equal susceptibility to infection, the red jungle fowl were clinically healthier than the SPF chickens despite showing more depletion of IgM + B cells and failure to induce IFNB activation. In conclusion, high-dose vvIBDV infection caused an intense early host immune response in the infected bursa, with depletion of IgM + B cells, bursal lesions, and cytokine expression as a response to mitigate the severity of the infection.

Epidemiology of pathogen-specific respiratory infections among three US populations.

Directory of Open Access Journals (Sweden)

Jennifer M Radin

Full Text Available Diagnostic tests for respiratory infections can be costly and time-consuming. Improved characterization of specific respiratory pathogens by identifying frequent signs, symptoms and demographic characteristics, along with improving our understanding of coinfection rates and seasonality, may improve treatment and prevention measures.Febrile respiratory illness (FRI and severe acute respiratory infection (SARI surveillance was conducted from October 2011 through March 2013 among three US populations: civilians near the US-Mexico border, Department of Defense (DoD beneficiaries, and military recruits. Clinical and demographic questionnaire data and respiratory swabs were collected from participants, tested by PCR for nine different respiratory pathogens and summarized. Age stratified characteristics of civilians positive for influenza and recruits positive for rhinovirus were compared to other and no/unknown pathogen. Seasonality and coinfection rates were also described.A total of 1444 patients met the FRI or SARI case definition and were enrolled in this study. Influenza signs and symptoms varied across age groups of civilians. Recruits with rhinovirus had higher percentages of pneumonia, cough, shortness of breath, congestion, cough, less fever and longer time to seeking care and were more likely to be male compared to those in the no/unknown pathogen group. Coinfections were found in 6% of all FRI/SARI cases tested and were most frequently seen among children and with rhinovirus infections. Clear seasonal trends were identified for influenza, rhinovirus, and respiratory syncytial virus.The age-stratified clinical characteristics associated with influenza suggest that age-specific case definitions may improve influenza surveillance and identification. Improving identification of rhinoviruses, the most frequent respiratory infection among recruits, may be useful for separating out contagious individuals, especially when larger outbreaks occur

Species-specific chitin-binding module 18 expansion in the amphibian pathogen Batrachochytrium dendrobatidis.

Science.gov (United States)

Abramyan, John; Stajich, Jason E

2012-01-01

Batrachochytrium dendrobatidis is the causative agent of chytridiomycosis, which is considered one of the driving forces behind the worldwide decline in populations of amphibians. As a member of the phylum Chytridiomycota, B. dendrobatidis has diverged significantly to emerge as the only pathogen of adult vertebrates. Such shifts in lifestyle are generally accompanied by various degrees of genomic modifications, yet neither its mode of pathogenicity nor any factors associated with it have ever been identified. Presented here is the identification and characterization of a unique expansion of the carbohydrate-binding module family 18 (CBM18), specific to B. dendrobatidis. CBM (chitin-binding module) expansions have been likened to the evolution of pathogenicity in a variety of fungus species, making this expanded group a prime candidate for the identification of potential pathogenicity factors. Furthermore, the CBM18 expansions are confined to three categories of genes, each having been previously implicated in host-pathogen interactions. These correlations highlight this specific domain expansion as a potential key player in the mode of pathogenicity in this unique fungus. The expansion of CBM18 in B. dendrobatidis is exceptional in its size and diversity compared to other pathogenic species of fungi, making this genomic feature unique in an evolutionary context as well as in pathogenicity. Amphibian populations are declining worldwide at an unprecedented rate. Although various factors are thought to contribute to this phenomenon, chytridiomycosis has been identified as one of the leading causes. This deadly fungal disease is cause by Batrachochytrium dendrobatidis, a chytrid fungus species unique in its pathogenicity and, furthermore, its specificity to amphibians. Despite more than two decades of research, the biology of this fungus species and its deadly interaction with amphibians had been notoriously difficult to unravel. Due to the alarming rate of worldwide

Recently Identified Mutations in the Ebola Virus-Makona Genome Do Not Alter Pathogenicity in Animal Models

Directory of Open Access Journals (Sweden)

Andrea Marzi

2018-05-01

Full Text Available Summary: Ebola virus (EBOV, isolate Makona, the causative agent of the West African EBOV epidemic, has been the subject of numerous investigations to determine the genetic diversity and its potential implication for virus biology, pathogenicity, and transmissibility. Despite various mutations that have emerged over time through multiple human-to-human transmission chains, their biological relevance remains questionable. Recently, mutations in the glycoprotein GP and polymerase L, which emerged and stabilized early during the outbreak, have been associated with improved viral fitness in cell culture. Here, we infected mice and rhesus macaques with EBOV-Makona isolates carrying or lacking those mutations. Surprisingly, all isolates behaved very similarly independent of the genotype, causing severe or lethal disease in mice and macaques, respectively. Likewise, we could not detect any evidence for differences in virus shedding. Thus, no specific biological phenotype could be associated with these EBOV-Makona mutations in two animal models. : Marzi et al. demonstrate that recently identified mutations in the EBOV-Makona genome, which appeared during the West African epidemic, do not significantly alter pathogenicity in IFNAR−/− mice and rhesus macaques. Other factors may have been more important for increased case numbers, case fatalities, and human-to-human transmission during this unprecedented epidemic. Keywords: Ebola virus, Ebola Makona, glycoprotein GP, polymerase L, GP mutation A82V, L mutation D759G, West African epidemic, pathogenicity

The commercial impact of pig Salmonella spp. infections in border-free markets during an economic recession.

Science.gov (United States)

Evangelopoulou, G; Kritas, S; Christodoulopoulos, G; Burriel, A R

2015-03-01

The genus Salmonella, a group of important zoonotic pathogens, is having global economic and political importance. Its main political importance results from the pathogenicity of many of its serovars for man. Serovars Salmonella Enteritidis and Salmonella Typhimurium are currently the most frequently associated to foodborne infections, but they are not the only ones. Animal food products contaminated from subclinically infected animals are a risk to consumers. In border free markets, an example is the EU, these consumers at risk are international. This is why, economic competition could use the risk of consumer infection either to restrict or promote free border trade in animals and their products. Such use of public health threats increases during economic recessions in nations economically weak to effectively enforce surveillance. In free trade conditions, those unable to pay the costs of pathogen control are unable to effectively implement agreed regulations, centrally decided, but leaving their enforcement to individual states. Free trade of animal food products depends largely on the promotion of safety, included in "quality," when traders target foreign markets. They will overtake eventually the markets of those ineffectively implementing agreed safety regulations, if their offered prices are also attractive for recession hit consumers. Nations unable to effectively enforce safety regulations become disadvantaged partners unequally competing with producers of economically robust states when it comes to public health. Thus, surveillance and control of pathogens like Salmonella are not only quantitative. They are also political issues upon which states base national trade decisions. Hence, the quantitative calculation of costs incurring from surveillance and control of animal salmonelloses, should not only include the cost for public health protection, but also the long term international economic and political costs for an individual state. These qualitative

Genetic parameters of pathogen-specific incidence of clinical mastitis in dairy cows

NARCIS (Netherlands)

Haas, de Y.; Barkema, H.W.; Veerkamp, R.F.

2002-01-01

The objective of this study was to estimate heritabilities for and genetic correlations among different pathogen-specific mastitis traits. The traits were unspecific mastitis, which is all mastitis treatments regardless of the causative pathogen as well as mastitis caused by Streptococcus

Opportunities for mitigating pathogen contamination during on-farm food production.

Science.gov (United States)

Doyle, Michael P; Erickson, Marilyn C

2012-01-16

preferably to animals that are suspected "super-shedders". Other promising on-farm intervention approaches have included breeding for pathogen resistance, vaccines, and dietary bacteriocins. To optimize interventions on a cost basis, studies have also determined that application of dietary interventions at specific time points in the animal's production cycle is a useful strategy to reduce pathogen carriage (e.g., probiotics to fertilized eggs and acidified feed to fattening swine). In conclusion, applicable management and intervention strategies may vary depending on the type of food under production; however, it is important to consider from a holistic view how any new intervention strategies will affect the overall production system in order to maintain a successful, efficient food production environment. Copyright © 2011 Elsevier B.V. All rights reserved.

PIML: the Pathogen Information Markup Language.

Science.gov (United States)

He, Yongqun; Vines, Richard R; Wattam, Alice R; Abramochkin, Georgiy V; Dickerman, Allan W; Eckart, J Dana; Sobral, Bruno W S

2005-01-01

A vast amount of information about human, animal and plant pathogens has been acquired, stored and displayed in varied formats through different resources, both electronically and otherwise. However, there is no community standard format for organizing this information or agreement on machine-readable format(s) for data exchange, thereby hampering interoperation efforts across information systems harboring such infectious disease data. The Pathogen Information Markup Language (PIML) is a free, open, XML-based format for representing pathogen information. XSLT-based visual presentations of valid PIML documents were developed and can be accessed through the PathInfo website or as part of the interoperable web services federation known as ToolBus/PathPort. Currently, detailed PIML documents are available for 21 pathogens deemed of high priority with regard to public health and national biological defense. A dynamic query system allows simple queries as well as comparisons among these pathogens. Continuing efforts are being taken to include other groups' supporting PIML and to develop more PIML documents. All the PIML-related information is accessible from http://www.vbi.vt.edu/pathport/pathinfo/

Health surveillance of specific pathogen-free and conventionally-housed mice and rats in Korea.

Science.gov (United States)

Seok, Seunghyeok; Park, Jonghwan; Cho, Suna; Baek, Minwon; Lee, Huiyoung; Kim, Dongjae; Yang, Kihwa; Jang, Dongdeuk; Han, Beomseok; Nam, Kitaek; Park, Jaehak

2005-01-01

The present study contains information about proper microbiological monitoring of laboratory animals' health and the standardization of microbiological monitoring methods in Korea. Microbiological quality control for laboratory animals, composed of biosecurity and health surveillance, is essential to guard against research complications and public health dangers that have been associated with adventitious infections. In this study, one hundred and twenty-two mice and ninety rats from laboratory animal breeding companies and one animal facility of the national universities in Korea were monitored in 2000-2003. Histopathologically, thickening of the alveolar walls and lymphocytic infiltration around the bronchioles were observed in mice and rats from microbiologically contaminated facilities. Cryptosporidial oocysts were observed in the gastric pits of only conventionally-housed mice and rats. Helicobacter spp. infection was also detected in 1 of 24 feces DNA samples in mice and 9 of 40 feces DNA samples in rats by PCR in 2003, but they were not Helicobacter hepaticus. This paper describes bacteriological, parasitological, and virological examinations of the animals.

A rapid method for selecting suitable animal species for studying pathogen interactions with plasma protein ligands in vivo.

Science.gov (United States)

Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel

2017-05-01

Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

International Society of Human and Animal Mycology (ISHAM)-ITS reference DNA barcoding database--the quality controlled standard tool for routine identification of human and animal pathogenic fungi.

Science.gov (United States)

Irinyi, Laszlo; Serena, Carolina; Garcia-Hermoso, Dea; Arabatzis, Michael; Desnos-Ollivier, Marie; Vu, Duong; Cardinali, Gianluigi; Arthur, Ian; Normand, Anne-Cécile; Giraldo, Alejandra; da Cunha, Keith Cassia; Sandoval-Denis, Marcelo; Hendrickx, Marijke; Nishikaku, Angela Satie; de Azevedo Melo, Analy Salles; Merseguel, Karina Bellinghausen; Khan, Aziza; Parente Rocha, Juliana Alves; Sampaio, Paula; da Silva Briones, Marcelo Ribeiro; e Ferreira, Renata Carmona; de Medeiros Muniz, Mauro; Castañón-Olivares, Laura Rosio; Estrada-Barcenas, Daniel; Cassagne, Carole; Mary, Charles; Duan, Shu Yao; Kong, Fanrong; Sun, Annie Ying; Zeng, Xianyu; Zhao, Zuotao; Gantois, Nausicaa; Botterel, Françoise; Robbertse, Barbara; Schoch, Conrad; Gams, Walter; Ellis, David; Halliday, Catriona; Chen, Sharon; Sorrell, Tania C; Piarroux, Renaud; Colombo, Arnaldo L; Pais, Célia; de Hoog, Sybren; Zancopé-Oliveira, Rosely Maria; Taylor, Maria Lucia; Toriello, Conchita; de Almeida Soares, Célia Maria; Delhaes, Laurence; Stubbe, Dirk; Dromer, Françoise; Ranque, Stéphane; Guarro, Josep; Cano-Lira, Jose F; Robert, Vincent; Velegraki, Aristea; Meyer, Wieland

2015-05-01

Human and animal fungal pathogens are a growing threat worldwide leading to emerging infections and creating new risks for established ones. There is a growing need for a rapid and accurate identification of pathogens to enable early diagnosis and targeted antifungal therapy. Morphological and biochemical identification methods are time-consuming and require trained experts. Alternatively, molecular methods, such as DNA barcoding, a powerful and easy tool for rapid monophasic identification, offer a practical approach for species identification and less demanding in terms of taxonomical expertise. However, its wide-spread use is still limited by a lack of quality-controlled reference databases and the evolving recognition and definition of new fungal species/complexes. An international consortium of medical mycology laboratories was formed aiming to establish a quality controlled ITS database under the umbrella of the ISHAM working group on "DNA barcoding of human and animal pathogenic fungi." A new database, containing 2800 ITS sequences representing 421 fungal species, providing the medical community with a freely accessible tool at http://www.isham.org/ and http://its.mycologylab.org/ to rapidly and reliably identify most agents of mycoses, was established. The generated sequences included in the new database were used to evaluate the variation and overall utility of the ITS region for the identification of pathogenic fungi at intra-and interspecies level. The average intraspecies variation ranged from 0 to 2.25%. This highlighted selected pathogenic fungal species, such as the dermatophytes and emerging yeast, for which additional molecular methods/genetic markers are required for their reliable identification from clinical and veterinary specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Jet set pets: examining the zoonosis risk in animal import and travel across the European Union

Directory of Open Access Journals (Sweden)

Fooks AR

2014-12-01

Full Text Available Anthony R Fooks,1,2 Nicholas Johnson1 1Wildlife Zoonoses and Vector-Borne Diseases Research Group, Animal and Plant Health Agency, Addlestone, Surrey, 2Department of Clinical Infection, University of Liverpool, Liverpool, UK Abstract: Ownership of companion animals or pets is popular throughout the world. Unfortunately, such animals are susceptible to and potential reservoirs of zoonotic pathogens. Close proximity to and contact with pets can lead to human infections. The distribution of zoonotic diseases associated with companion animals such as dogs and cats is not uniform around the world, and moving animals between regions, countries, and continents carries with it the risk of relocating the pathogens they might harbor. Critical among these zoonotic diseases are rabies, echinococcosis, and leishmania. In addition, the protozoan parasites, Toxoplasma gondii and Giardia duodenalis, are also significant agents for human disease of pet origin. Considerable effort is applied to controlling movements of companion animals, particularly dogs, into the European Union. However, free movement of people and their pets within the European Union is a risk factor for the translocation of diseases and their vectors. This review considers the current distribution of some of these diseases, the risks associated with pet travel, and the controls implemented within Europe to prevent the free movement of zoonotic pathogens. Keywords: zoonosis, companion animal, rabies, alveolar echinococcosis, leishmania

Pathogen-free, plasma-poor platelet lysate and expansion of human mesenchymal stem cells.

Science.gov (United States)

Iudicone, Paola; Fioravanti, Daniela; Bonanno, Giuseppina; Miceli, Michelina; Lavorino, Claudio; Totta, Pierangela; Frati, Luigi; Nuti, Marianna; Pierelli, Luca

2014-01-27

Supplements to support clinical-grade cultures of mesenchymal stem cells (MSC) are required to promote growth and expansion of these cells. Platelet lysate (PL) is a human blood component which may replace animal serum in MSC cultures being rich in various growth factors. Here, we describe a plasma poor pathogen-free platelet lysate obtained by pooling 12 platelet (PLT) units, to produce a standardized and safe supplement for clinical-grade expansion of MSC. PL lots were obtained by combining 2 6-unit PLT pools in additive solution (AS) following a transfusional-based procedure including pathogen inactivation (PI) by Intercept technology and 3 cycles of freezing/thawing, followed by membrane removal. Three PI-PL and 3 control PL lots were produced to compare their ability to sustain bone marrow derived MSC selection and expansion. Moreover, two further PL, subjected to PI or not, were also produced starting from the same initial PLT pools to evaluate the impact of PI on growth factor concentration and capacity to sustain cell growth. Additional PI-PL lots were used for comparison with fetal bovine serum (FBS) on MSC expansion. Immunoregulatory properties of PI-PL-generated MSC were documented in vitro by mixed lymphocyte culture (MLC) and peripheral blood mononuclear cells (PBMC) mitogen induced proliferation. PI-PL and PL control lots had similar concentrations of 4 well-described growth factors endowed with MSC stimulating ability. Initial growth and MSC expansion by PI-PL and PL controls were comparable either using different MSC populations or in head to head experiments. Moreover, PI-PL and PL control sustained similar MSC growth of frozen/thawed MSC. Multilineage differentiation of PI-derived and PI-PL-derived MSC were maintained in any MSC cultures as well as their immunoregulatory properties. Finally, no direct impact of PI on growth factor concentration and MSC growth support was observed, whereas the capacity of FBS to sustain MSC expansion in basic

A mathematical modelling framework for linked within-host and between-host dynamics for infections with free-living pathogens in the environment.

Science.gov (United States)

Garira, Winston; Mathebula, Dephney; Netshikweta, Rendani

2014-10-01

In this study we develop a mathematical modelling framework for linking the within-host and between-host dynamics of infections with free-living pathogens in the environment. The resulting linked models are sometimes called immuno-epidemiological models. However, there is still no generalised framework for linking the within-host and between-host dynamics of infectious diseases. Furthermore, for infections with free-living pathogens in the environment, there is an additional stumbling block in that there is a gap in knowledge on how environmental factors (through water, air, soil, food, fomites, etc.) alter many aspects of such infections including susceptibility to infective dose, persistence of infection, pathogen shedding and severity of the disease. In this work, we link the two subsystems (within-host and between-host models) by identifying the within-host and between-host variables and parameters associated with the environmental dynamics of the pathogen and then design a feedback of the variables and parameters across the within-host and between-host models using human schistosomiasis as a case study. We study the mathematical properties of the linked model and show that the model is epidemiologically well-posed. Using results from the analysis of the endemic equilibrium expression, the disease reproductive number R0, and numerical simulations of the full model, we adequately account for the reciprocal influence of the linked within-host and between-host models. In particular, we illustrate that for human schistosomiasis, the outcome of infection at the individual level determines if, when and how much the individual host will further transmit the infectious agent into the environment, eventually affecting the spread of the infection in the host population. We expect the conceptual modelling framework developed here to be applicable to many infectious disease with free-living pathogens in the environment beyond the specific disease system of human

Consensus report on the future of animal-free systemic toxicity testing

OpenAIRE

Leist, Marcel; Hasiwa, Nina; Rovida, Costanza; Daneshian, Mardas; Basketter, David; Kimber, Ian; Clewell, Harvey; Gocht, Tilman; Goldberg, Alan; Busquet, Francois; Rossi, Anna-Maria; Schwarz, Michael; Stephens, Martin; Taalman, Rob; Knudsen, Thomas B

2014-01-01

Since March 2013, animal use for cosmetics testing for the European market has been banned. This requires a renewed view on risk assessment in this field. However, in other fields as well, traditional animal experimentation does not always satisfy requirements in safety testing, as the need for human-relevant information is ever increasing. A general strategy for animal-free test approaches was outlined by the US National Research Council`s vision document for Toxicity Testing in the 21st Cen...

Isolation, antibiogram and pathogenicity of Salmonella spp. Recovered from slaughtered food animals in Nagpur region of Central India

Directory of Open Access Journals (Sweden)

D. G. Kalambhe

2016-02-01

Full Text Available Aim: To determine the prevalence, antibiogram and pathogenicity of Salmonella spp. in the common food animals slaughtered for consumption purpose at government approved slaughter houses located in and around Nagpur region during a period of 2010-2012. Materials and Methods: A total of 400 samples comprising 50 each of blood and meat from each slaughtered male cattle, buffaloes, pigs and goats were collected. Isolation was done by pre-enrichment in buffered peptone water and enrichment in Rappaport-Vassiliadis broth with subsequent selective plating onto xylose lysine deoxycholate agar. Presumptive Salmonella colonies were biochemically confirmed and analyzed for pathogenicity by hemolysin production and Congo red dye binding assay (CRDA. An antibiotic sensitivity test was performed to assess the antibiotic resistance pattern of the isolates. Results: A total of 10 isolates of Salmonella spp. from meat (3 from cattle, 1 from buffaloes and 6 from pigs with an overall prevalence of 5% among food animals was recorded. No isolation was reported from any blood samples. Pathogenicity assays revealed 100% and 80% positivity for CRDA and hemolytic activity, respectively. Antimicrobial sensitivity test showed multi-drug resistance. The overall resistance of 50% was noted for trimethoprim followed by ampicillin (20%. A maximum sensitivity (80% was reported to gentamycin followed by 40% each to ampicillin and trimethoprim, 30% to amikacin and 10% to kanamycin. Conclusion: The presence of multidrug resistant and potentially pathogenic Salmonella spp. in slaughtered food animals in Nagpur region can be a matter of concern for public health.

Searching for animal models and potential target species for emerging pathogens: Experience gained from Middle East respiratory syndrome (MERS coronavirus

Directory of Open Access Journals (Sweden)

Júlia Vergara-Alert

2017-06-01

Full Text Available Emerging and re-emerging pathogens represent a substantial threat to public health, as demonstrated with numerous outbreaks over the past years, including the 2013–2016 outbreak of Ebola virus in western Africa. Coronaviruses are also a threat for humans, as evidenced in 2002/2003 with infection by the severe acute respiratory syndrome coronavirus (SARS-CoV, which caused more than 8000 human infections with 10% fatality rate in 37 countries. Ten years later, a novel human coronavirus (Middle East respiratory syndrome coronavirus, MERS-CoV, associated with severe pneumonia, arose in the Kingdom of Saudi Arabia. Until December 2016, MERS has accounted for more than 1800 cases and 35% fatality rate. Finding an animal model of disease is key to develop vaccines or antivirals against such emerging pathogens and to understand its pathogenesis. Knowledge of the potential role of domestic livestock and other animal species in the transmission of pathogens is of importance to understand the epidemiology of the disease. Little is known about MERS-CoV animal host range. In this paper, experimental data on potential hosts for MERS-CoV is reviewed. Advantages and limitations of different animal models are evaluated in relation to viral pathogenesis and transmission studies. Finally, the relevance of potential new target species is discussed.

Animal-Free Chemical Safety Assessment

Directory of Open Access Journals (Sweden)

George D Loizou

2016-07-01

Full Text Available The exponential growth of the Internet of Things and the global popularity and remarkable decline in cost of the mobile phone is driving the digital transformation of medical practice. The rapidly maturing digital, nonmedical world of mobile (wireless devices, cloud computing and social networking is coalescing with the emerging digital medical world of omics data, biosensors and advanced imaging which offers the increasingly realistic prospect of personalized medicine. Described as a potential seismic shift from the current healthcare model to a wellness paradigm that is predictive, preventative, personalized and participatory, this change is based on the development of increasingly sophisticated biosensors which can track and measure key biochemical variables in people. Additional key drivers in this shift are metabolomic and proteomic signatures, which are increasingly being reported as pre-symptomatic, diagnostic and prognostic of toxicity and disease. These advancements also have profound implications for toxicological evaluation and safety assessment of pharmaceuticals and environmental chemicals. An approach based primarily on human in vivo and high-throughput in vitro human cell-line data is a distinct possibility. This would transform current chemical safety assessment practise which operates in a human data poor to a human data rich environment. This could also lead to a seismic shift from the current animal-based to an animal-free chemical safety assessment paradigm.

Pathogenicity determinants and antibiotic resistance profiles of enterococci from foods of animal origin in Turkey.

Science.gov (United States)

Elal Mus, Tulay; Cetinkaya, Figen; Cibik, Recep; Soyutemiz, Gul Ece; Simsek, Husniye; Coplu, Nilay

2017-12-01

In this study, the presence of genes responsible for the pathogenicity and antibiotic resistance profile of enterococci isolated from various foodstuffs of animal origin was investigated. The percentage prevalence of enterococci was 54.1% (203/375) and the average count was found to be 3.81 log cfu/ml-g. Species-specific primers revealed Enterococcus faecalis as the predominant species carrying one or more virulence-associated traits of efa, gelE, ace, esp and agg genetic markers. Only one E. faecium isolate (from milk) was positive for the esp gene. Regarding antibiotic resistance, the highest frequency of resistance was observed for tetracycline (21.7%), followed by quinupristin/dalfopristin (13.3%), ciprofloxacin (2.0%), penicillin (2.0%), linezolid (1.0%), ampicillin (1.0%), streptomycin (1.0%), and gentamicin (0.5%). Enterococcus faecalis showed a higher prevalence of antibiotic resistance than other enterococci. The percentage of multidrug resistance among the isolates was 3.4%. Twenty-nine E. faecalis isolates (26.6%) carrying one of the virulence-associated traits were at the same time resistant to at least one antibiotic. Our results show that foods of animal origin, including ready-to-eat products, may be reservoirs of antibiotic-resistant and potentially virulent enterococci.

Cytokines: applications in domestic food animals.

Science.gov (United States)

Blecha, F

1991-01-01

Cytokines such as human, bovine, and porcine interferons and human and bovine interleukin-1 and interleukin-2 have been used in vivo in cattle and pigs. Colony-stimulating factors and tumor necrosis factor alpha have been evaluated in vitro in food animals. Studies to evaluate cytokines in domestic food animals have shown that specific and nonspecific immunomodulation is possible in immunosuppressed or pathogen-exposed animals. Cytokine prophylaxis or therapy in food animals may have the greatest potential for control of respiratory disease and mastitis.

Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium

Energy Technology Data Exchange (ETDEWEB)

Ma, Li Jun; van der Does, H. C.; Borkovich, Katherine A.; Coleman, Jeffrey J.; Daboussi, Marie-Jose; Di Pietro, Antonio; Dufresne, Marie; Freitag, Michael; Grabherr, Manfred; Henrissat, Bernard; Houterman, Petra M.; Kang, Seogchan; Shim, Won-Bo; Wolochuk, Charles; Xie, Xiaohui; Xu, Jin Rong; Antoniw, John; Baker, Scott E.; Bluhm, Burton H.; Breakspear, Andrew; Brown, Daren W.; Butchko, Robert A.; Chapman, Sinead; Coulson, Richard; Coutinho, Pedro M.; Danchin, Etienne G.; Diener, Andrew; Gale, Liane R.; Gardiner, Donald; Goff, Steven; Hammond-Kossack, Kim; Hilburn, Karen; Hua-Van, Aurelie; Jonkers, Wilfried; Kazan, Kemal; Kodira, Chinnappa D.; Koehrsen, Michael; Kumar, Lokesh; Lee, Yong Hwan; Li, Liande; Manners, John M.; Miranda-Saavedra, Diego; Mukherjee, Mala; Park, Gyungsoon; Park, Jongsun; Park, Sook Young; Proctor, Robert H.; Regev, Aviv; Ruiz-Roldan, M. C.; Sain, Divya; Sakthikumar, Sharadha; Sykes, Sean; Schwartz, David C.; Turgeon, Barbara G.; Wapinski, Ilan; Yoder, Olen; Young, Sarah; Zeng, Qiandong; Zhou, Shiguo; Galagan, James; Cuomo, Christina A.; Kistler, H. Corby; Rep, Martijn

2010-03-18

Fusarium species are among the most important phytopathogenic and toxigenic fungi, having significant impact on crop production and animal health. Distinctively, members of the F. oxysporum species complex exhibit wide host range but discontinuously distributed host specificity, reflecting remarkable genetic adaptability. To understand the molecular underpinnings of diverse phenotypic traits and their evolution in Fusarium, we compared the genomes of three economically important and phylogenetically related, yet phenotypically diverse plant-pathogenic species, F. graminearum, F. verticillioides and F. oxysporum f. sp. lycopersici. Our analysis revealed greatly expanded lineage-specific (LS) genomic regions in F. oxysporum that include four entire chromosomes, accounting for more than one-quarter of the genome. LS regions are rich in transposons and genes with distinct evolutionary profiles but related to pathogenicity. Experimentally, we demonstrate for the first time the transfer of two LS chromosomes between strains of F. oxysporum, resulting in the conversion of a non-pathogenic strain into a pathogen. Transfer of LS chromosomes between otherwise genetically isolated strains explains the polyphyletic origin of host specificity and the emergence of new pathogenic lineages in the F. oxysporum species complex, putting the evolution of fungal pathogenicity into a new perspective.

The SEURAT-1 Approach towards Animal Free Human Safety Assessment

Science.gov (United States)

SEURAT-1 is a European public-private research consortium that is working towards animal-free testing of chemical compounds and the highest level of consumer protection. A research strategy was formulated based on the guiding principle to adopt a toxicological mode-of-action fram...

Outbreak of highly pathogenic avian influenza in Minnesota in 2015.

Science.gov (United States)

Fitzpatrick, Ann; Mor, Sunil K; Thurn, Mary; Wiedenman, Elizabeth; Otterson, Tracy; Porter, Robert E; Patnayak, Devi P; Lauer, Dale C; Voss, Shauna; Rossow, Stephanie; Collins, James E; Goyal, Sagar M

2017-03-01

The incursion of highly pathogenic avian influenza (HPAI) into the United States during 2014 resulted in an unprecedented foreign animal disease (FAD) event; 232 outbreaks were reported from 21 states. The disease affected 49.6 million birds and resulted in economic losses of $950 million. Minnesota is the largest turkey-producing state, accounting for 18% of U.S. turkey production. Areas with concentrated numbers of turkeys in Minnesota were the epicenter of the outbreak. The first case was presumptively diagnosed in the last week of February 2015 at the Minnesota Veterinary Diagnostic Laboratory (MVDL) and confirmed as HPAI H5N2 at the National Veterinary Services Laboratories on March 4, 2015. A total of 110 farms were affected in Minnesota, and the MVDL tested >17,000 samples from March to July 2015. Normal service was maintained to other clients of the laboratory during this major FAD event, but challenges were encountered with communications, staff burnout and fatigue, training requirements of volunteer technical staff, test kit validation, and management of specific pathogen-free egg requirements.

Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

Science.gov (United States)

Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

2017-02-01

Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

Peculiapities of free radioal processes in tissues of animals exposed to fast neutrons

International Nuclear Information System (INIS)

Fedorchenko, V.I.

1982-01-01

The influence of preliminary effect of gaseous medium with the alterated content of oxygen on post-radiation content of free radicals in tissues of irradiated rates, is studied. Results of experiments have shown that after the effect of ionizing radiation the content of free radicals in tissues of animals, adapted to hypoxy, is reduced, i. e. preliminary adaptation to hypoxy increases radiation resistance of animals. As compared with ''protective'' effect of preliminary adaptation to hypoxy in the case of affecting with X-rays and fast neutrons, no considerable difference is found

Social and Economic Aspects of the Transmission of Pathogenic Bacteria between Wildlife and Food Animals: A Thematic Analysis of Published Research Knowledge.

Science.gov (United States)

Fournier, A; Young, I; Rajić, A; Greig, J; LeJeune, J

2015-09-01

Wildlife is a known reservoir of pathogenic bacteria, including Mycobacterium bovis and Brucella spp. Transmission of these pathogens between wildlife and food animals can lead to damaging impacts on the agri-food industry and public health. Several international case studies have highlighted the complex and cross-sectoral challenges involved in preventing and managing these potential transmission risks. The objective of our study was to develop a better understanding of the socio-economic aspects of the transmission of pathogenic bacteria between wildlife and food animals to support more effective and sustainable risk mitigation strategies. We conducted qualitative thematic analysis on a purposive sample of 30/141 articles identified in a complementary scoping review of the literature in this area and identified two key themes. The first related to the framing of this issue as a 'wicked problem' that depends on a complex interaction of social factors and risk perceptions, governance and public policy, and economic implications. The second theme consisted of promising approaches and strategies to prevent and mitigate the potential risks from transmission of pathogenic bacteria between wildlife and food animals. These included participatory, collaborative and multidisciplinary decision-making approaches and the proactive incorporation of credible scientific evidence and local contextual factors into solutions. The integration of these approaches to address 'wicked problems' in this field may assist stakeholders and decision-makers in improving the acceptability and sustainability of future strategies to reduce the transmission of pathogenic bacteria between wildlife and food animals. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.

Exploiting amoeboid and non-vertebrate animal model systems to study the virulence of human pathogenic fungi.

Science.gov (United States)

Mylonakis, Eleftherios; Casadevall, Arturo; Ausubel, Frederick M

2007-07-27

Experiments with insects, protozoa, nematodes, and slime molds have recently come to the forefront in the study of host-fungal interactions. Many of the virulence factors required for pathogenicity in mammals are also important for fungal survival during interactions with non-vertebrate hosts, suggesting that fungal virulence may have evolved, and been maintained, as a countermeasure to environmental predation by amoebae and nematodes and other small non-vertebrates that feed on microorganisms. Host innate immune responses are also broadly conserved across many phyla. The study of the interaction between invertebrate model hosts and pathogenic fungi therefore provides insights into the mechanisms underlying pathogen virulence and host immunity, and complements the use of mammalian models by enabling whole-animal high throughput infection assays. This review aims to assist researchers in identifying appropriate invertebrate systems for the study of particular aspects of fungal pathogenesis.

Immunogenetic variation and differential pathogen exposure in free-ranging cheetahs across Namibian farmlands.

Directory of Open Access Journals (Sweden)

Aines Castro-Prieto

Full Text Available Genes under selection provide ecologically important information useful for conservation issues. Major histocompatibility complex (MHC class I and II genes are essential for the immune defence against pathogens from intracellular (e.g. viruses and extracellular (e.g. helminths origins, respectively. Serosurvey studies in Namibian cheetahs (Acinonyx juabuts revealed higher exposure to viral pathogens in individuals from north-central than east-central regions. Here we examined whether the observed differences in exposure to viruses influence the patterns of genetic variation and differentiation at MHC loci in 88 free-ranging Namibian cheetahs.Genetic variation at MHC I and II loci was assessed through single-stranded conformation polymorphism (SSCP analysis and sequencing. While the overall allelic diversity did not differ, we observed a high genetic differentiation at MHC class I loci between cheetahs from north-central and east-central Namibia. No such differentiation in MHC class II and neutral markers were found.Our results suggest that MHC class I variation mirrors the variation in selection pressure imposed by viruses in free-ranging cheetahs across Namibian farmland. This is of high significance for future management and conservation programs of this species.

The rumen microbiome as a reservoir of antimicrobial resistance and pathogenicity genes is directly affected by diet in beef cattle.

Science.gov (United States)

Auffret, Marc D; Dewhurst, Richard J; Duthie, Carol-Anne; Rooke, John A; John Wallace, R; Freeman, Tom C; Stewart, Robert; Watson, Mick; Roehe, Rainer

2017-12-11

The emergence and spread of antimicrobial resistance is the most urgent current threat to human and animal health. An improved understanding of the abundance of antimicrobial resistance genes and genes associated with microbial colonisation and pathogenicity in the animal gut will have a major role in reducing the contribution of animal production to this problem. Here, the influence of diet on the ruminal resistome and abundance of pathogenicity genes was assessed in ruminal digesta samples taken from 50 antibiotic-free beef cattle, comprising four cattle breeds receiving two diets containing different proportions of concentrate. Two hundred and four genes associated with antimicrobial resistance (AMR), colonisation, communication or pathogenicity functions were identified from 4966 metagenomic genes using KEGG identification. Both the diversity and abundance of these genes were higher in concentrate-fed animals. Chloramphenicol and microcin resistance genes were dominant in samples from forage-fed animals (P resistances were enriched in concentrate-fed animals. The concentrate-based diet also increased the relative abundance of Proteobacteria, which includes many animal and zoonotic pathogens. A high ratio of Proteobacteria to (Firmicutes + Bacteroidetes) was confirmed as a good indicator for rumen dysbiosis, with eight cases all from concentrate-fed animals. Finally, network analysis demonstrated that the resistance/pathogenicity genes are potentially useful as biomarkers for health risk assessment of the ruminal microbiome. Diet has important effects on the complement of AMR genes in the rumen microbial community, with potential implications for human and animal health.

Specific genetic modifications of domestic animals by gene targeting and animal cloning

Directory of Open Access Journals (Sweden)

Zhou Jiangfeng

2003-11-01

Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.

Serosurveillance for livestock pathogens in free-ranging mule deer (Odocoileus hemionus.

Directory of Open Access Journals (Sweden)

Annette Roug

Full Text Available Routine disease surveillance has been conducted for decades in mule deer (Odocoileus hemionus in California for pathogens shared between wildlife and domestic ruminants that may have implications for the animal production industry and wildlife health. Deer sampled from 1990 to 2007 (n = 2,619 were tested for exposure to six pathogens: bluetongue virus (BTV, epizootic hemorrhagic disease virus (EHDV, bovine viral diarrhea virus (BVDV, Leptospira spp., Anaplasma spp. and Brucella spp. We evaluated the relationship between exposure to these pathogens and demographic risk factors to identify broad patterns in seroprevalence across a large temporal and spatial scale. The overall seroprevalence for the entire study period was 13.4% for BTV, 16.8% for EHDV, 17.1% for BVDV, 6.5% for Leptospira spp., 0.2% for Brucella spp., and 17% for Anaplasma spp. Antibodies against BTV and EHDV were most prevalent in the deer populations of southern California. Antibodies against Leptospira spp. and Anaplasma spp. were most prevalent in coastal and central northern California whereas antibodies against BVDV were most prevalent in central-eastern and northeastern California. The overall seroprevalence for Anaplasma spp. was slightly lower than detected in previous studies. North and central eastern California contains large tracts of federal land grazed by livestock; therefore, possible contact between deer and livestock could explain the high BVDV seroprevalence found in these areas. Findings from this study will help to establish baseline values for future comparisons of pathogen exposure in deer, inform on long-term trends in deer population health and provide relevant information on the distribution of diseases that are shared between wildlife and livestock.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

Science.gov (United States)

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Exploiting amoeboid and non-vertebrate animal model systems to study the virulence of human pathogenic fungi.

Directory of Open Access Journals (Sweden)

Eleftherios Mylonakis

2007-07-01

Full Text Available Experiments with insects, protozoa, nematodes, and slime molds have recently come to the forefront in the study of host-fungal interactions. Many of the virulence factors required for pathogenicity in mammals are also important for fungal survival during interactions with non-vertebrate hosts, suggesting that fungal virulence may have evolved, and been maintained, as a countermeasure to environmental predation by amoebae and nematodes and other small non-vertebrates that feed on microorganisms. Host innate immune responses are also broadly conserved across many phyla. The study of the interaction between invertebrate model hosts and pathogenic fungi therefore provides insights into the mechanisms underlying pathogen virulence and host immunity, and complements the use of mammalian models by enabling whole-animal high throughput infection assays. This review aims to assist researchers in identifying appropriate invertebrate systems for the study of particular aspects of fungal pathogenesis.

Microbial Indicators, Pathogens, and Antibiotic Resistance in Groundwater Impacted by Animal Farming: Field Scale to Basin Scale

Science.gov (United States)

Harter, T.; Li, X.; Atwill, E. R.; Packman, A. I.

2015-12-01

Several surveys of microbial indicators and pathogens were conducted to determine the impact of confined animal farming operations (CAFOs) on shallow, local, and regional groundwater quality in the Central Valley aquifer system, California. The aquifer system consists of highly heterogeneous, alluvial, unconsolidated coarse- to fine-grained sediments and is among the largest aquifers in the U.S.. Overlying landuse includes 3 million ha of irrigated agriculture and 1.7 million mature dairy cows in nearly 1,500 CAFOs. A multi-scale survey of water-borne indicator pathogens (Enterococcus spp. and generic E. coli) and of three water-borne pathogens (Campylobacter, Salmonella, and E. coli O157:H7) was conducted at five different spatial scales, increasing with distance from animal sources of these enteric microbial organisms: moist surfaces within individual CAFO sub-systems (calf-hutches, heifer corrals, mature cow stalls, hospital barn etc.), first encountered (shallow) groundwater immediately below these sub-systems, production aquifer below CAFOs, production aquifer near CAFOs, and production aquifer away from CAFOs. Where found, indicator pathogens were tested for antibiotic resistance. Hundreds of samples were collected at each scale: continuously during irrigation events and seasonally over a multi-year period at the three smaller site-scales; and in a one-time survey at the two larger, regional scales. All three pathogens were frequently detected in moist surface samples across CAFO sub-systems, albeit at concentrations several orders of magnitude lower than enteric indicators. Two of the three pathogens (but not Campylobacter) were also detected in first encountered groundwater, at 3-9 m below ground surface, in 1% of samples. No pathogens were found at the production aquifer scales. Generic E. coli was detected in ¼ of first encountered groundwater samples, and in 4% of production aquifer samples, while Enterococcus spp. was ubiquitously present across the

Incidence of acquisition of methicillin-resistant Staphylococcus aureus, Clostridium difficile, and other health-care-associated pathogens by dogs that participate in animal-assisted interventions.

Science.gov (United States)

Lefebvre, Sandra L; Reid-Smith, Richard J; Waltner-Toews, David; Weese, J Scott

2009-06-01

To determine whether dogs that visited human health-care facilities were at greater risk of acquiring certain health-care-associated pathogens, compared with dogs performing animal-assisted interventions in other settings, and to identify specific behaviors of dogs associated with an increased risk of acquiring these pathogens. Prospective cohort and nested case-control studies. 96 dogs that visited human health-care facilities and 98 dogs involved in other animal-assisted interventions. Fecal samples and nasal swab specimens were collected from dogs at the time of recruitment and every 2 months for 1 year and were tested for methicillin-resistant Staphylococcus aureus (MRSA), Clostridium difficile, and other selected bacteria. Information was also obtained on facilities visited during animal-assisted interventions, dog diet, dog illnesses, and antimicrobial use within the home. At the end of the study, dog handlers were asked about the behavior of their dogs during visits to health-care facilities. Rates of acquisition of MRSA and C difficile were 4.7 and 2.4 times as high, respectively, among dogs that visited human health-care facilities, compared with rates among dogs involved in other animal-assisted interventions. Among dogs that visited human health-care facilities, those that licked patients or accepted treats during visits were more likely to be positive for MRSA and C difficile than were dogs that did not lick patients or accept treats. Results suggested that dogs that visited human health-care facilities were at risk of acquiring MRSA and C difficile, particularly when they licked patients or accepted treats during visits.

Escherichia coli O157:H7 - An Emerging Pathogen in foods of Animal Origin

Directory of Open Access Journals (Sweden)

Ch. Bindu Kiranmayi

Full Text Available Escherichia coli O157:H7 is an emerging public health concern in most countries of the world. E. coli O157:H7 was known to be a human pathogen for nearly 24 years. EHEC O157 infection is estimated to be the fourth most costly food borne disease in Canada and USA, not counting the cost of possible litigation. E. coli O157:H7 and Salmonella are the leading causes of produce related outbreaks, accounting for 20 and 30% respectively. The authority of the Federal Meat Inspection Act, FSIS (Food Safety and Inspection Service declared Escherichia coli O157:H7, an adulterant in raw ground beef and enforced “zero tolerance” (USDA-FSIS, 17 December 1998. Because of the severity of these illnesses and the apparent low infective dose (less than 10 cells, Escherichia coli O157:H7 is considered one of the most serious of known food borne pathogens. Escherichia coli O157:H7 is mainly pathogenic to human but in cattle and other animals, it did not induce any clinical disease except diarrhea. So, these animals act as carriers to Escherichia coli O157:H7. The majority transmission is through eating of undercooked contaminated ground meat and consumption of raw milk, raw vegetables, fruits contaminated by water, cheese, curd and also through consumption of sprouts, lettuce and juice. The conventional isolation procedure includes growth in enrichment broth like modified EC (E. coli broth or modified tryptic soy broth (mTSB Since the infection primarily occurs via faeco-oral route, the preventive measures include food hygiene measures like proper cooking of meat, consumption of pasteurized milk, washing fruits and vegetables especially those to be eaten raw and drinking chlorine treated water and personnel hygiene measures like washing hands after toilet visits. [Veterinary World 2010; 3(8.000: 382-389

The role of the World Organisation for Animal Health (OIE) to facilitate the international trade in animals and animal products.

Science.gov (United States)

Brückner, G K

2009-03-01

The international trade in animals and animal products has become a sensitive issue for both developed and developing countries by posing an important risk for the international spread of animal and human pathogens whilst at the same time being an essential activity to ensure world-wide food security and food safety. The OIE has since its founding in 1924, applied a democratic and transparent decision-making process to continuously develop and review international standards for animal health and zoonoses to facilitate trade in animals and animal products. The role of the OIE is also mandated by the World Trade Organization (WTO) as international reference point for standards related to animal health. In support of its overall objective of promoting animal health world-wide, the OIE has also launched several other initiatives such as the improvement of the governance of veterinary services within its member countries and territories and to enhance the availability of diagnostic and scientific expertise on a more even global geographical distribution. Several trade facilitating concepts such as country, zonal and compartment freedom from disease as well the trade in disease free commodities has been introduced to enhance the trade in animals and animal products for all its members including those from developing and transitional countries who are still in the process of enhancing to full compliance with international sanitary standards.

Risk ranking of pathogens in ready-to-eat unprocessed foods of non-animal origin (FoNAO) in the EU: Initial evaluation using outbreak data (2007-2011)

DEFF Research Database (Denmark)

Da Silva Felício, M. T.; Hald, Tine; Liebana, E.

2015-01-01

Foods of non-animal origin (FoNAO) are consumed in a variety of forms, being a major component of almost all meals. These food types have the potential to be associated with large outbreaks as seen in 2011 associated with VTEC O104. In order to identify and rank specific food/pathogen combination...... processed, stored and prepared as part of the above data collection exercises....... most often linked to human cases originating from FoNAO in the EU, a semi-quantitative model was developed using seven criteria: strength of associations between food and pathogen based on the foodborne outbreak data from EU Zoonoses Monitoring (2007-2011), incidence of illness, burden of disease, dose......NAO in the EU. Efforts to collect additional data even in the absence of reported outbreaks as well as to enhance the quality of the EU-specific data, which was used as input for all the model criteria, will allow the improvement of the model outputs. Furthermore, it is recommended that harmonised terminology...

Protective effects of indigenous Escherichia coli against a pathogenic E. coli challenge strain in pigs.

Science.gov (United States)

Vahjen, W; Cuisiniere, T; Zentek, J

2017-10-13

To investigate the inhibitory effect of indigenous enterobacteria on pathogenic Escherichia coli, a challenge trial with postweaning pigs was conducted. A pathogenic E. coli strain was administered to all animals and their health was closely monitored thereafter. Faecal samples were taken from three healthy and three diarrhoeic animals. Samples were cultivated on MacConkey agar and isolates were subcultured. A soft agar overlay assay was used to determine the inhibitory activity of the isolates. A total of 1,173 enterobacterial isolates were screened for their ability to inhibit the E. coli challenge strain. Colony forming units of enterobacteria on MacConkey agar were not different between healthy and diarrhoeic animals in the original samples. Furthermore, numbers of isolates per animal were also not significantly different between healthy (482 isolates) and diarrhoeic animals (691 isolates). A total of 43 isolates (3.7%) with inhibitory activity against the pathogenic E. coli challenge strain were detected. All inhibitory isolates were identified as E. coli via MALDI-TOF. The isolates belonged to the phylotypes A, C and E. Many isolates (67.4%) were commensal E. coli without relevant porcine pathogenic factors, but toxin- and fimbrial genes (stx2e, fae, estIb, elt1a, fas, fan) were detected in 14 inhibitory isolates. Healthy animals showed significantly (P=0.003) more inhibitory isolates (36 of 482 isolates; 7.5%) than diseased animals (7 of 691 isolates; 1.0%). There were no significant correlations regarding phylotype or pathogenic factors between healthy and diseased animals. This study has shown that a small proportion of indigenous E. coli is able to inhibit in vitro growth of a pathogenic E. coli strain in pigs. Furthermore, healthy animals possess significantly more inhibitory E. coli strains than diarrhoeic animals. The inhibition of pathogenic E. coli by specific indigenous E. coli strains may be an underlying principle for the containment of pathogenic

Immunity to intestinal pathogens: lessons learned from Salmonella

Science.gov (United States)

McSorley, Stephen J.

2014-01-01

Summary Salmonella are a common source of food or water-borne infection and cause a wide range of clinical disease in human and animal hosts. Salmonella are relatively easy to culture and manipulate in a laboratory setting, and the infection of laboratory animals induces robust innate and adaptive immune responses. Thus, immunologists have frequently turned to Salmonella infection models to expand understanding of immunity to intestinal pathogens. In this review, I summarize current knowledge of innate and adaptive immunity to Salmonella and highlight features of this response that have emerged from recent studies. These include the heterogeneity of the antigen-specific T-cell response to intestinal infection, the prominence of microbial mechanisms to impede T and B-cell responses, and the contribution of non-cognate pathways for elicitation of T-cell effector functions. Together, these different issues challenge an overly simplistic view of host-pathogen interaction during mucosal infection but also allow deeper insight into the real-world dynamic of protective immunity to intestinal pathogens. PMID:24942689

Comparative proteome analysis reveals pathogen specific outer membrane proteins of Leptospira.

Science.gov (United States)

Dhandapani, Gunasekaran; Sikha, Thoduvayil; Rana, Aarti; Brahma, Rahul; Akhter, Yusuf; Gopalakrishnan Madanan, Madathiparambil

2018-04-10

Proteomes of pathogenic Leptospira interrogans and L. borgpetersenii and the saprophytic L. biflexa were filtered through computational tools to identify Outer Membrane Proteins (OMPs) that satisfy the required biophysical parameters for their presence on the outer membrane. A total of 133, 130, and 144 OMPs were identified in L. interrogans, L. borgpetersenii, and L. biflexa, respectively, which forms approximately 4% of proteomes. A holistic analysis of transporting and pathogenic characteristics of OMPs together with Clusters of Orthologous Groups (COGs) among the OMPs and their distribution across 3 species was made and put forward a set of 21 candidate OMPs specific to pathogenic leptospires. It is also found that proteins homologous to the candidate OMPs were also present in other pathogenic species of leptospires. Six OMPs from L. interrogans and 2 from L. borgpetersenii observed to have similar COGs while those were not found in any intermediate or saprophytic forms. These OMPs appears to have role in infection and pathogenesis and useful for anti-leptospiral strategies. © 2018 Wiley Periodicals, Inc.

Characterization of Low Pathogenic Avian Influenza Virus Subtype H9N2 Isolated from Free-Living Mynah Birds (Acridotheres tristis) in the Sultanate of Oman.

Science.gov (United States)

Body, Mohammad H; Alrarawahi, Abdulmajeed H; Alhubsy, Saif S; Saravanan, Nirmala; Rajmony, Sunil; Mansoor, Muhammad Khalid

2015-06-01

A low pathogenic avian influenza virus was identified from free-living birds (mynah, Acridotheres tristis) of the starling family. Virus was isolated by inoculation of homogenized suspension from lung, tracheal, spleen, and cloacal swabs into the allantoic cavity of embryonated chicken eggs. Subtype of the isolate was characterized as H9N2 by hemagglutination inhibition test using monospecific chicken antisera to a wide range of influenza reference strain. Pathogenicity of the isolate was determined by intravenous pathogenicity index. The virus was reisolated from experimentally infected chicken. Additionally, the isolate was subjected to reverse transcriptase PCR using partial hemagglutinin (HA) gene-specific primers and yielded an amplicon of 487 bp. HA gene sequence analysis revealed 99% sequence homology among mynah and chicken isolates from Oman. On phylogenetic analysis, isolates from mynah (A/mynnah/Oman/AIVS6/2005) and chicken (A/chicken/Oman/AIVS3/2006; A/chicken/Oman/AIVS7/2006) clustered together tightly, indicating these free-flying birds may be a source of introduction of H9N2 subtype in poultry bird in Oman. Moreover, the HA gene of H9N2 isolates from Oman resembled those of viruses of the G1-like lineage and were very similar to those from United Arab Emirates.

Body-on-a-chip systems for animal-free toxicity testing.

Science.gov (United States)

Mahler, Gretchen J; Esch, Mandy B; Stokol, Tracy; Hickman, James J; Shuler, Michael L

2016-10-01

Body-on-a-chip systems replicate the size relationships of organs, blood distribution and blood flow, in accordance with human physiology. When operated with tissues derived from human cell sources, these systems are capable of simulating human metabolism, including the conversion of a prodrug to its effective metabolite, as well as its subsequent therapeutic actions and toxic side-effects. The system also permits the measurement of human tissue electrical and mechanical reactions, which provide a measure of functional response. Since these devices can be operated with human tissue samples or with in vitro tissues derived from induced pluripotent stem cells (iPS), they can play a significant role in determining the success of new pharmaceuticals, without resorting to the use of animals. By providing a platform for testing in the context of human metabolism, as opposed to animal models, the systems have the potential to eliminate the use of animals in preclinical trials. This article will review progress made and work achieved as a direct result of the 2015 Lush Science Prize in support of animal-free testing. 2016 FRAME.

Advanced biosensors for detection of pathogens related to livestock and poultry.

Science.gov (United States)

Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole

2017-02-21

Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.

Inflammation: friend or foe for animal production?

Science.gov (United States)

Broom, Leon J; Kogut, Michael H

2018-02-01

Inflammation is an essential immune response that seeks to contain microbial infection and repair damaged tissue. Increased pro-inflammatory mediators have been associated with enhanced resistance to a range of important poultry and pig pathogens. However, inflammation may also have undesirable consequences, including potentially exacerbating tissue damage and diverting nutrients away from productive purposes. The negative effects of inflammation have led to the active pursuit of anti-inflammatory feed additives and/or strategies. These approaches may, however, impair the ability of an animal to respond appropriately and effectively to the array of pathogens that are likely to be encountered in commercial production, and specifically young animals who may be particularly reliant on innate immune responses. Thus, promoting an animal's capacity to mount a rapid, acute inflammatory response to control and contain the infection and the timely transition to anti-inflammatory, tissue repair processes, and a homeostatic state are suggested as the optimum scenario to maintain an animal's resistance to pathogens and minimize non-productive nutrient losses. Important future studies will help to unravel the trade-offs, and relevant metabolic pathways, between robust immune defense and optimum productive performance, and thus provide real insight into methods to appropriately influence this relationship. © 2017 Poultry Science Association Inc.

Facile Fabrication of Animal-Specific Positioning Molds For Multi-modality Molecular Imaging

International Nuclear Information System (INIS)

Park, Jeong Chan; Oh, Ji Eun; Woo, Seung Tae

2008-01-01

Recently multi-modal imaging system has become widely adopted in molecular imaging. We tried to fabricate animal-specific positioning molds for PET/MR fusion imaging using easily available molding clay and rapid foam. The animal-specific positioning molds provide immobilization and reproducible positioning of small animal. Herein, we have compared fiber-based molding clay with rapid foam in fabricating the molds of experimental animal. The round bottomed-acrylic frame, which fitted into microPET gantry, was prepared at first. The experimental mice was anesthetized and placed on the mold for positioning. Rapid foam and fiber-based clay were used to fabricate the mold. In case of both rapid foam and the clay, the experimental animal needs to be pushed down smoothly into the mold for positioning. However, after the mouse was removed, the fabricated clay needed to be dried completely at 60 .deg. C in oven overnight for hardening. Four sealed pipe tips containing [ 18 F]FDG solution were used as fiduciary markers. After injection of [ 18 F]FDG via tail vein, microPET scanning was performed. Successively, MRI scanning was followed in the same animal. Animal-specific positioning molds were fabricated using rapid foam and fiber-based molding clay for multimodality imaging. Functional and anatomical images were obtained with microPET and MRI, respectively. The fused PET/MR images were obtained using freely available AMIDE program. Animal-specific molds were successfully prepared using easily available rapid foam, molding clay and disposable pipet tips. Thanks to animal-specific molds, fusion images of PET and MR were co-registered with negligible misalignment

Pathogen-specific effects of quantitative trait loci affecting clinical mastitis and somatic cell count in danish holstein cattle

DEFF Research Database (Denmark)

Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, J.R.

2008-01-01

The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... pathogen specificity of QTL affecting treatments of mastitis in first parity (CM1), second parity (CM2), and third parity (CM3), and QTL affecting SCS. The 5 most common mastitis pathogens in the Danish dairy population were analyzed: Streptococcus dysgalactiae, Escherichia coli, coagulase...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

Substrate-specific gene expression in Batrachochytrium dendrobatidis, the chytrid pathogen of amphibians.

Directory of Open Access Journals (Sweden)

Erica Bree Rosenblum

Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.

Complement-dependent pathogenicity of brain-specific antibodies in cerebrospinal fluid

DEFF Research Database (Denmark)

Asgari, Nasrin; Khorooshi, Reza; Lillevang, Søren T

2013-01-01

The specificity and potential pathogenicity of autoantibodies vary between neurological diseases. It is often unclear whether their detection in cerebrospinal fluid (CSF) is a consequence or a cause of pathology. The goal was to test whether administration of brain-specific antibodies into CSF...... would be sufficient for pathology. Purified immunoglobulin G from a neuromyelitis optica patient was injected intrathecally with complement to naive mice. Histopathological analysis at 7 days revealed damage to the ependyma, disruption of the CSF parenchymal barrier and pathologic lesions, distant from...

Identification of membrane-associated proteins with pathogenic potential expressed by Corynebacterium pseudotuberculosis grown in animal serum.

Science.gov (United States)

Raynal, José Tadeu; Bastos, Bruno Lopes; Vilas-Boas, Priscilla Carolinne Bagano; Sousa, Thiago de Jesus; Costa-Silva, Marcos; de Sá, Maria da Conceição Aquino; Portela, Ricardo Wagner; Moura-Costa, Lília Ferreira; Azevedo, Vasco; Meyer, Roberto

2018-01-25

Previous works defining antigens that might be used as vaccine targets against Corynebacterium pseudotuberculosis, which is the causative agent of sheep and goat caseous lymphadenitis, have focused on secreted proteins produced in a chemically defined culture media. Considering that such antigens might not reflect the repertoire of proteins expressed during infection conditions, this experiment aimed to investigate the membrane-associated proteins with pathogenic potential expressed by C. pseudotuberculosis grown directly in animal serum. Its membrane-associated proteins have been extracted using an organic solvent enrichment methodology, followed by LC-MS/MS and bioinformatics analysis for protein identification and classification. The results revealed 22 membrane-associated proteins characterized as potentially pathogenic. An interaction network analysis indicated that the four potentially pathogenic proteins ciuA, fagA, OppA4 and OppCD were biologically connected within two distinct network pathways, which were both associated with the ABC Transporters KEGG pathway. These results suggest that C. pseudotuberculosis pathogenesis might be associated with the transport and uptake of nutrients; other seven identified potentially pathogenic membrane proteins also suggest that pathogenesis might involve events of bacterial resistance and adhesion. The proteins herein reported potentially reflect part of the protein repertoire expressed during real infection conditions and might be tested as vaccine antigens.

Efficacy of Massachusetts and 793B Vaccines Against Infectious Bronchitis Moroccan-Italy 02 Virus in Specific-Pathogen-Free Chickens and Commercial Broilers.

Science.gov (United States)

Belkasmi, Sakhia F Z; Fellahi, Siham; Umar, Sajid; Delpont, Mattias; Delverdier, Maxence; Lucas, Marie-Noëlle; Bleuart, Céline; Kichou, Faouzi; Nassik, Saâdia; Guerin, Jean-Luc; Fihri, Ouafaa Fassi; Ducatez, Mariette F; El Houadfi, Mohammed

2017-12-01

The ability of commercial vaccines H120 and 4/91 to protect against Moroccan-Italy 02 infectious bronchitis virus (Mor-It02) was investigated in specific-pathogen-free (SPF) chickens and commercial broiler chickens. Commercial broiler chicks (Experiment 1) were vaccinated at the hatchery with H120 vaccine at Day 1, and challenged at Day 21 with 10 4 50% egg-infective dose (EID 50 ) of Mor-It02. All chicks were observed daily for clinical signs attributable to Mor-It02 infection during the 10 days postchallenge (pc). At 5 and 10 days pc, chicks were humanely sacrificed for necropsy examination, and tissues were collected for histopathology evaluation. To better understand the findings on commercial broilers, day-old SPF chicks were divided into five groups in a second experiment: Group Mass/4-91, vaccinated with H120 and 4/91 respectively at Days 1 and 15 of age; Group Mass/Mass, vaccinated by H120 at Days 1 and 15; Group Mass, vaccinated with H120 at Day 1; Group NV, kept unvaccinated; and Group NC, kept as a negative control (unchallenged). At Day 24 of age, Groups Mass/4-91, Mass/Mass, Mass, and NV were challenged with 10 4 EID 50 of Mor-It02. In both experiments, blood samples were collected at different periods for serologic analyses. Oropharyngeal swabs were collected for virus detection by reverse-transcription PCR. In Experiments 1 and 2, respiratory signs started as early as 24 hr pc and maximum severity was observed on Days 3 and 4 pc. The viral shedding rate was significantly lower in Group Mass/4-91 compared to other challenged groups. Serologic analysis in both experiments showed that the sera of challenged group exhibited significantly higher antibody titers than sera collected before challenge. Histopathologic investigations in SPF birds showed deciliation and hyperplasia in Group NV and less-pronounced lesions in Groups Mass/Mass and Mass. In commercial broilers vaccinated with H120 alone, hyperplasia and deciliation were observed in 90% of the

Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry

International Nuclear Information System (INIS)

Neffling, Milla-Riina; Lance, Emilie; Meriluoto, Jussi

2010-01-01

Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration. - The study concerns method development for the LC-MS-MS analysis of both free and protein-bound microcystin in tissue materials.

Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry

Energy Technology Data Exchange (ETDEWEB)

Neffling, Milla-Riina, E-mail: mneffling@gmail.co [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6 A, Biocity 3rd floor, FI-20520, Turku (Finland); Lance, Emilie [UMR CNRS Ecobio 6553, University of Rennes 1, Avenue du General Leclerc, 35042, Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6 A, Biocity 3rd floor, FI-20520, Turku (Finland)

2010-03-15

Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration. - The study concerns method development for the LC-MS-MS analysis of both free and protein-bound microcystin in tissue materials.

Processes for managing pathogens.

Science.gov (United States)

Godfree, Alan; Farrell, Joseph

2005-01-01

Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.

Three pathogens in sympatric populations of pumas, bobcats, and domestic cats: implications for infectious disease transmission.

Directory of Open Access Journals (Sweden)

Sarah N Bevins

Full Text Available Anthropogenic landscape change can lead to increased opportunities for pathogen transmission between domestic and non-domestic animals. Pumas, bobcats, and domestic cats are sympatric in many areas of North America and share many of the same pathogens, some of which are zoonotic. We analyzed bobcat, puma, and feral domestic cat samples collected from targeted geographic areas. We examined exposure to three pathogens that are taxonomically diverse (bacterial, protozoal, viral, that incorporate multiple transmission strategies (vector-borne, environmental exposure/ingestion, and direct contact, and that vary in species-specificity. Bartonella spp., Feline Immunodeficiency Virus (FIV, and Toxoplasma gondii IgG were detected in all three species with mean respective prevalence as follows: puma 16%, 41% and 75%; bobcat 31%, 22% and 43%; domestic cat 45%, 10% and 1%. Bartonella spp. were highly prevalent among domestic cats in Southern California compared to other cohort groups. Feline Immunodeficiency Virus exposure was primarily associated with species and age, and was not influenced by geographic location. Pumas were more likely to be infected with FIV than bobcats, with domestic cats having the lowest infection rate. Toxoplasma gondii seroprevalence was high in both pumas and bobcats across all sites; in contrast, few domestic cats were seropositive, despite the fact that feral, free ranging domestic cats were targeted in this study. Interestingly, a directly transmitted species-specific disease (FIV was not associated with geographic location, while exposure to indirectly transmitted diseases--vector-borne for Bartonella spp. and ingestion of oocysts via infected prey or environmental exposure for T. gondii--varied significantly by site. Pathogens transmitted by direct contact may be more dependent upon individual behaviors and intra-specific encounters. Future studies will integrate host density, as well as landscape features, to better

Development of an Extracorporeal Perfusion Device for Small Animal Free Flaps.

Directory of Open Access Journals (Sweden)

Andreas M Fichter

Full Text Available Extracorporeal perfusion (ECP might prolong the vital storage capabilities of composite free flaps, potentially opening a wide range of clinical applications. Aim of the study was the development a validated low-cost extracorporeal perfusion model for further research in small animal free flaps.After establishing optimal perfusion settings, a specially designed extracorporeal perfusion system was evaluated during 8-hour perfusion of rat epigastric flaps followed by microvascular free flap transfer. Controls comprised sham-operation, ischemia and in vivo perfusion. Flaps and perfusate (diluted blood were closely monitored by blood gas analysis, combined laser Doppler flowmetry and remission spectroscopy and Indocyanine-Green angiography. Evaluations were complemented by assessment of necrotic area and light microscopy at day 7.ECP was established and maintained for 8 hours with constant potassium and pH levels. Subsequent flap transfer was successful. Notably, the rate of necrosis of extracorporeally perfused flaps (27% was even lower than after in vivo perfusion (49%, although not statistically significant (P = 0,083. After sham-operation, only 6% of the total flap area became necrotic, while 8-hour ischemia led to total flap loss (98%. Angiographic and histological findings confirmed these observations.Vital storage capabilities of microvascular flaps can be prolonged by temporary ECP. Our study provides important insights on the pathophysiological processes during extracorporeal tissue perfusion and provides a validated small animal perfusion model for further studies.

Dose imprecision and resistance: free-choice medicated feeds in industrial food animal production in the United States.

Science.gov (United States)

Love, David C; Davis, Meghan F; Bassett, Anna; Gunther, Andrew; Nachman, Keeve E

2011-03-01

Industrial food animal production employs many of the same antibiotics or classes of antibiotics that are used in human medicine. These drugs can be administered to food animals in the form of free-choice medicated feeds (FCMF), where animals choose how much feed to consume. Routine administration of these drugs to livestock selects for microorganisms that are resistant to medications critical to the treatment of clinical infections in humans. In this commentary, we discuss the history of medicated feeds, the nature of FCMF use with regard to dose delivery, and U.S. policies that address antimicrobial drug use in food animals. FCMF makes delivering a predictable, accurate, and intended dose difficult. Overdosing can lead to animal toxicity; underdosing or inconsistent dosing can result in a failure to resolve animal diseases and in the development of antimicrobial-resistant microorganisms. The delivery of antibiotics to food animals for reasons other than the treatment of clinically diagnosed disease, especially via free-choice feeding methods, should be reconsidered.

Irradiation of laboratory animal diets

International Nuclear Information System (INIS)

Adamiker, D.

1976-01-01

The increasing demand for well-defined, standardized laboratory animals fr use in experimental research has led to the development of many new methods aimed at keeping the animals free of pathogenic micro-organisms. In this respect the problem of contaminated feeds has become more and more widely recognized. Chemial treatments and heat-treatments, which are the methods most commonly used at present, do have many disadvantages and this has led to an increasing interest in the application of irradiation for sterilizing animal feeds. The author reviews in some detail the various feeding studies which have been performed to date to establish whether or not irradiated feeds are safe for consumption. Much attention is now being given to feed irradiation throughout the world; it is estimated, for example, that approximately 700 tons of feed are already being irradiated per year and that this amount is likely to increase steadily in the future. These activities and recent developments are also briefly reviewed. (author)

Paramecium species ingest and kill the cells of the human pathogenic fungus Cryptococcus neoformans.

Science.gov (United States)

Frager, Shalom Z; Chrisman, Cara J; Shakked, Rachel; Casadevall, Arturo

2010-08-01

A fundamental question in the field of medical mycology is the origin of virulence in those fungal pathogens acquired directly from the environment. In recent years, it was proposed that the virulence of certain environmental animal-pathogenic microbes, such as Cryptococcus neoformans, originated from selection pressures caused by species-specific predation. In this study, we analyzed the interaction of C. neoformans with three Paramecium spp., all of which are ciliated mobile protists. In contrast to the interaction with amoebae, some Paramecium spp. rapidly ingested C. neoformans and killed the fungus. This study establishes yet another type of protist-fungal interaction supporting the notion that animal-pathogenic fungi in the environment are under constant selection by predation.

Structural and biophysical properties of metal-free pathogenic SOD1 mutants A4V and G93A

Energy Technology Data Exchange (ETDEWEB)

Galaleldeen, Ahmad; Strange, Richard W.; Whitson, Lisa J.; Antonyuk, Svetlana V.; Narayana, Narendra; Taylor, Alexander B.; Schuermann, Jonathan P.; Holloway, Stephen P.; Hasnain, S.Samar; Hart, P. John; (Texas-HSC); (Liverpool)

2010-07-19

Amyotrophic lateral sclerosis (ALS) is a fatal, progressive neurodegenerative disease characterized by the destruction of motor neurons in the spinal cord and brain. A subset of ALS cases are linked to dominant mutations in copper-zinc superoxide dismutase (SOD1). The pathogenic SOD1 variants A4V and G93A have been the foci of multiple studies aimed at understanding the molecular basis for SOD1-linked ALS. The A4V variant is responsible for the majority of familial ALS cases in North America, causing rapidly progressing paralysis once symptoms begin and the G93A SOD1 variant is overexpressed in often studied murine models of the disease. Here we report the three-dimensional structures of metal-free A4V and of metal-bound and metal-free G93A SOD1. In the metal-free structures, the metal-binding loop elements are observed to be severely disordered, suggesting that these variants may share mechanisms of aggregation proposed previously for other pathogenic SOD1 proteins.

Occurrence of white spot syndrome virus in shrimp culturing waters and its brunt in specific pathogen free Litopenaeus vannamei with particular allusion to molecular verdicts

Directory of Open Access Journals (Sweden)

MA Badhul Haq

2012-12-01

Full Text Available Objective: To detect the water samples and shrimp samples in white spot syndrome virus (WSSV affecting and non-affecting zone. Methods: A total of 12 samples specific pathogen free Litopenaeus vannamei (L. vannamei; adult shrimp and larvae were randomly collected. Their genomic DNA was isolated and subjected to PCR. Histopathological identifications were carried out, and the hematopoietic tissues with basophilic intranuclear inclusion bodies characteristic were observed in moderate WSSV infected L. vannamei. Results: The PCR analysis showed the appearance of a prominent band from the PCR amplified product of WSSV-DNA at internal control band 848 bp at non-infected areas. Although low infection positive bands (20 copies were shown at 296 bp continued from initial stage of the infection region. On a moderate and ascetic level were observed as 650 bp and 910 bp (200 and 2 000 copies, during the severe out break periods. The gill epithelial cells were edematous and nuclei were hypertrophied with basophilic inclusions, but no pathological changes or hypertrophied nuclei were observed in any of L.vannamei tissues in WSSV uninfected region. The Intranuclear inclusion bodies characteristics of high level of WSSV infection presented in the gill region. Conclusions: The present study is significant, which investigated the level of WSSV transmission from the infected tiger prawn P.monodon to SPFL. vannamei in the WSSV impact region of Tamil Nadu coastal waters.

Comparative genomics and the evolution of pathogenicity in human pathogenic fungi.

LENUS (Irish Health Repository)

Moran, Gary P

2011-01-01

Because most fungi have evolved to be free-living in the environment and because the infections they cause are usually opportunistic in nature, it is often difficult to identify specific traits that contribute to fungal pathogenesis. In recent years, there has been a surge in the number of sequenced genomes of human fungal pathogens, and comparison of these sequences has proved to be an excellent resource for exploring commonalities and differences in how these species interact with their hosts. In order to survive in the human body, fungi must be able to adapt to new nutrient sources and environmental stresses. Therefore, genes involved in carbohydrate and amino acid metabolism and transport and genes encoding secondary metabolites tend to be overrepresented in pathogenic species (e.g., Aspergillus fumigatus). However, it is clear that human commensal yeast species such as Candida albicans have also evolved a range of specific factors that facilitate direct interaction with host tissues. The evolution of virulence across the human pathogenic fungi has occurred largely through very similar mechanisms. One of the most important mechanisms is gene duplication and the expansion of gene families, particularly in subtelomeric regions. Unlike the case for prokaryotic pathogens, horizontal transfer of genes between species and other genera does not seem to have played a significant role in the evolution of fungal virulence. New sequencing technologies promise the prospect of even greater numbers of genome sequences, facilitating the sequencing of multiple genomes and transcriptomes within individual species, and will undoubtedly contribute to a deeper insight into fungal pathogenesis.

Serological evidence of hepatitis E virus infection in zoo animals and identification of a rodent-borne strain in a Syrian brown bear.

Science.gov (United States)

Spahr, Carina; Ryll, René; Knauf-Witzens, Tobias; Vahlenkamp, Thomas W; Ulrich, Rainer G; Johne, Reimar

2017-12-01

Hepatitis E virus (HEV) is the causative agent of hepatitis E, an emerging infectious disease of humans. HEV infections have also been described in various animal species. Whereas domestic pigs and wild boars are well-known animal reservoirs for HEV, the knowledge on natural HEV infection in zoo animals is scarce so far. Here, we analysed 244 sera from 66 mammal species derived from three zoos in Germany using a commercial double antigen sandwich ELISA. HEV-specific antibodies were detected in 16 animal species, with the highest detection rates in suids (33.3%) and carnivores (27.0%). However, RNA of the human pathogenic HEV genotypes 1-4 was not detected in the serum samples from suids or carnivores. Using a broad spectrum RT-PCR, a ratHEV-related sequence was identified in a sample of a female Syrian brown bear (Ursus arctos syriacus). Subsequent serum samples within a period of five years confirmed a HEV seroconversion in this animal. No symptoms of hepatitis were recorded. In a follow-up investigation at the same location, closely related ratHEV sequences were identified in free-living Norway rats (Rattus norvegicus), whereas feeder rats (Rattus norvegicus forma domestica) were negative for HEV-specific antibodies and RNA. Therefore, a spillover infection of ratHEV from free-living Norway rats is most likely. The results indicate that a wide range of zoo animals can be naturally infected with HEV or HEV-related viruses. Their distinct role as possible reservoir animals for HEV and sources of HEV infection for humans and other animals remains to be investigated. Copyright © 2017 Elsevier B.V. All rights reserved.

ClinGen Pathogenicity Calculator: a configurable system for assessing pathogenicity of genetic variants.

Science.gov (United States)

Patel, Ronak Y; Shah, Neethu; Jackson, Andrew R; Ghosh, Rajarshi; Pawliczek, Piotr; Paithankar, Sameer; Baker, Aaron; Riehle, Kevin; Chen, Hailin; Milosavljevic, Sofia; Bizon, Chris; Rynearson, Shawn; Nelson, Tristan; Jarvik, Gail P; Rehm, Heidi L; Harrison, Steven M; Azzariti, Danielle; Powell, Bradford; Babb, Larry; Plon, Sharon E; Milosavljevic, Aleksandar

2017-01-12

The success of the clinical use of sequencing based tests (from single gene to genomes) depends on the accuracy and consistency of variant interpretation. Aiming to improve the interpretation process through practice guidelines, the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) have published standards and guidelines for the interpretation of sequence variants. However, manual application of the guidelines is tedious and prone to human error. Web-based tools and software systems may not only address this problem but also document reasoning and supporting evidence, thus enabling transparency of evidence-based reasoning and resolution of discordant interpretations. In this report, we describe the design, implementation, and initial testing of the Clinical Genome Resource (ClinGen) Pathogenicity Calculator, a configurable system and web service for the assessment of pathogenicity of Mendelian germline sequence variants. The system allows users to enter the applicable ACMG/AMP-style evidence tags for a specific allele with links to supporting data for each tag and generate guideline-based pathogenicity assessment for the allele. Through automation and comprehensive documentation of evidence codes, the system facilitates more accurate application of the ACMG/AMP guidelines, improves standardization in variant classification, and facilitates collaborative resolution of discordances. The rules of reasoning are configurable with gene-specific or disease-specific guideline variations (e.g. cardiomyopathy-specific frequency thresholds and functional assays). The software is modular, equipped with robust application program interfaces (APIs), and available under a free open source license and as a cloud-hosted web service, thus facilitating both stand-alone use and integration with existing variant curation and interpretation systems. The Pathogenicity Calculator is accessible at http

Practical experiences with irradiation of laboratory animals' feed

International Nuclear Information System (INIS)

Adamiker, D.

1979-01-01

The increasing need for well-defined, standardized experimental animals for research has led to the development of many new methods of keeping the animals free from pathogenic microorganisms. In this connection the problem of contaminated food has taken on ever greater significance. The methods most commonly used today, namely chemical treatment and heat treatment of the fodder, have many disadvantages and interest in the use of radiation sterilization has accordingly increased. The author discusses the various aspects of this method in relation to SPF animals and reports on the three years' experience of the Research Institute for Experimental Animal Breeding (University of Vienna) in Himberg with the use of exclusively radiation-treated diets in the rearing of rats and mice. The ease of handling irradiated fodder, the reliability of the method from the microbiological point of view and the excellent breeding results already obtained make this process - despite its somewhat higher cost - the best possible method of pasteurizing the feed of experimental animals. (author)

Health Status of Male Adult Wistar Rats from Two Experimental Animal Houses of UFMG: Leukocyte Counts, Feces and Lung Histological Exams

Directory of Open Access Journals (Sweden)

Andrade Bruno Horta

2002-01-01

Full Text Available A study was conducted to compare health status of male adult Wistar rats from two Experimental Animal Houses of UFMG with literature data of SPF (free from specific pathogens and conventional rats. The animals were divided into two groups: Group I (n=10, rats from the experimental animal houses of FAFICH and Group II (n=10 from ICB and following aspects were studied: a evident clinical signs (behavior modification, hair loss (alopecia, b leukocyte counts, c feces exam and d histological study of the lungs. The rats did not show clinical signs. However, when compared with SPF and conventional rats, both the groups showed a significant increase (p<0,05 of leukocyte count. On feces exam we detected some parasites and on lung histological exam we observed fungus (Group I and bacteria (Group II. These results showed that the health status of the rats was not satisfactory and required improvements in the conditions of the animal houses.

Economic values and expected effect of selection index for pathogen-specific mastitis under Danish conditions

DEFF Research Database (Denmark)

Sørensen, Lars Peter; Mark, Thomas; Sørensen, M.K.

2010-01-01

The objectives of this study were 1) to estimate costs related to 5 different pathogen-specific mastitis traits (susceptibility to different pathogens causing mastitis in dairy cattle) and unspecific mastitis, and 2) to compare selection differentials for an udder health index consisting of 5...... different pathogen-specific mastitis traits and lactation average somatic cell count from 5 to 170 d after first calving (LASCC170) with another index consisting of 1 unspecific mastitis trait and LASCC170. Economic values were estimated for mastitis caused by Staphylococcus aureus, Streptococcus...... dysgalactiae, Escherichia coli, coagulase-negative staphylococci, and Streptococcus uberis using a stochastic simulation model (SimHerd IV). Mastitis incidences for SimHerd IV were from incidences of mastitis treatments in primiparous Danish Holstein cows calving in 2007. Estimated costs ranged from 149 euro...

Pathogenic agents in freshwater resources

Science.gov (United States)

Geldreich, Edwin E.

1996-02-01

Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.

Construction of an infectious cDNA clone of avian hepatitis E virus (avian HEV) recovered from a clinically healthy chicken in the United States and characterization of its pathogenicity in specific-pathogen-free chickens.

Science.gov (United States)

Kwon, Hyuk Moo; LeRoith, Tanya; Pudupakam, R S; Pierson, F William; Huang, Yao-Wei; Dryman, Barbara A; Meng, Xiang-Jin

2011-01-27

A genetically distinct strain of avian hepatitis E virus (avian HEV-VA strain) was isolated from a healthy chicken in Virginia, and thus it is important to characterize and compare its pathogenicity with the prototype strain (avian HEV-prototype) isolated from a diseased chicken. Here we first constructed an infectious clone of the avian HEV-VA strain. Capped RNA transcripts from the avian HEV-VA clone were replication-competent after transfection of LMH chicken liver cells. Chickens inoculated intrahepatically with RNA transcripts of avian HEV-VA clone developed active infection as evidenced by fecal virus shedding, viremia, and seroconversion. To characterize the pathogenicity, RNA transcripts of both avian HEV-VA and avian HEV-prototype clones were intrahepatically inoculated into the livers of chickens. Avian HEV RNA was detected in feces, serum and bile samples from 10/10 avian HEV-VA-inoculated and 9/9 avian HEV-prototype-inoculated chickens although seroconversion occurred only in some chickens during the experimental period. The histopathological lesion scores were lower for avian HEV-VA group than avian HEV-prototype group in the liver at 3 and 5 weeks post-inoculation (wpi) and in the spleen at 3 wpi, although the differences were not statistically significant. The liver/body weight ratio, indicative of liver enlargement, of both avian HEV-VA and avian HEV-prototype groups were significantly higher than that of the control group at 5 wpi. Overall, the avian HEV-VA strain still induces histological liver lesions even though it was isolated from a healthy chicken. The results also showed that intrahepatic inoculation of chickens with RNA transcripts of avian HEV infectious clone may serve as an alternative for live virus in animal pathogenicity studies. Copyright © 2010 Elsevier B.V. All rights reserved.

A strategy for synthesis of pathogenic human immunoglobulin free light chains in E. coli.

Directory of Open Access Journals (Sweden)

Paola Rognoni

Full Text Available Monoclonal immunoglobulin light chains are normally synthesized in excess compared to the heavy chain partners and can be detected in serum and urine ("free" LC. Occasionally free LC are per se cause of organ toxicity, as in free LC-related disorders. In AL amyloidosis, the most common of these conditions, free LC with peculiar biophysical properties related to their primary structure damage target organs and organize in amyloid fibrils. Unlimited availability of well-characterized free LC is instrumental to investigate the toxic effect of these proteins and to study their interactions with targets. We present a straightforward strategy to obtain recombinant monoclonal free LC by using a bacterial system. These proteins, expressed as inclusion bodies, were subjected to solubilization and refolding procedures to recover them in native form. To minimize differences from the circulating natural LC, full-length recombinant LC were expressed, i.e. complete of variable and constant regions, with the original amino acid sequence along the entire protein, and with no purification tags. The strategy was exploited to generate free LC from three AL amyloidosis patients. After purification, recombinant proteins were biochemically characterized and compared to the natural Bence Jones protein isolated from one of the patients. Results showed that the recombinant free LC were properly folded and formed homodimers in solution, similar to the natural Bence Jones protein used for comparison. Furthermore, as proof of pathogenicity, recombinant proteins formed amyloid fibrils in vitro. We believe that the present strategy represents a valuable tool to speed research in free LC-related disorders.

Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry.

Science.gov (United States)

Neffling, Milla-Riina; Lance, Emilie; Meriluoto, Jussi

2010-03-01

Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

Specific recognition of fungal pathogens by plants

International Nuclear Information System (INIS)

Knogge, W.; Gierlich, A.; Max-Planck-Institute for Plant Breeding,; Van't Slot, K.A.E.; Papavoine, T.

2001-01-01

Full text: Induction of plant defence reactions and, hence, genotype-specific disease resistance results from the interaction of highly specific plant resistance (R) genes with matching pathogen avirulence (Avr) genes (gene-for-gene interactions). More than thirty R genes acting against different types of pathogens (viruses, bacteria, fungi, oomycetes, nematodes) have been isolated from various plants species. However, with few exceptions it remains to be shown how their products recognise the complementary Avr gene products. To date, Avr genes and their products have been characterised from only three fungal species. These include the NIP1 gene from Rhynchosporium secalis, the causal agent of barley leaf scald. It encodes a small, secreted protein, NIP1, that triggers defence reactions exclusively in barley cultivars expressing the R gene Rrs1. NIP1 also non-specifically stimulates the H + -ATPase activity in barley plasma membranes, suggesting that the host recognition system targets a putative fungal virulence factor. Virulent fungal strains lack the gene or carry an allele encoding a non-functional product. Four NIP1 iso-forms have been characterised; NIP1-I and NIP1-II although both elicitor-active display different levels of activity, whereas the isoforms NIP1-III and NIP1-IV are inactive. After establishing a heterologous expression system, the single amino acids specifying NIP1-III and NIP1-IV were integrated into the NIP1-I sequence and yielded the inactive mutant proteins NIP1-III* and NIP1-IV*. The elicitor-inactive isoforms were also unable to stimulate the H + -ATPase, suggesting that both functions of NIP1 are mediated by a single plant receptor. The 3D structure of NIP1-I has been elucidated by 1 H- and 15 N-NMR spectroscopy. Binding studies using 125 I-NIP1-I revealed a single class of high-affinity binding sites on membranes from both Rrs1- and rrs1-cultivars, suggesting that NIP1-binding is not sufficient for defence triggering and that an

Non-specific myiases of domestic animals in Czech and Slovac Republics

Czech Academy of Sciences Publication Activity Database

Minář, Jan

2004-01-01

Roč. 12, č. 1 (2004), s. 107-109 ISSN 1336-300X Institutional research plan: CEZ:AV0Z5007907 Keywords : non-specific myiasis * domestic animals * Lucilia sericata Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine

Summary of taxa-specific research: 2. pathogens

Science.gov (United States)

Ned Klopfenstein; Brian Geils

2009-01-01

Damage caused by invasive forest pathogens is widely viewed as more severe, long-term, widespread, and difficult to restore than that caused by any other biological disturbance agent. In the last century, pathogens introduced into our native forests have threatened extinction of native tree species and critically degraded many different ecosystems across North America...

Where to next with animal health in Latin America? The transition from endemic to disease-free status.

Science.gov (United States)

Rojas, H; Romero, J R

2017-04-01

The Latin American and Caribbean region (LAC) is a leading global producer and exporter of animal products. Its livestock production systems are diverse, ranging from large-scale commercial enterprises to family farms. Countries in this region have sought to improve their animal health status through both public and private efforts. Despite significant advances in eradicating such diseases as foot and mouth disease and classical swine fever, other animal health challenges remain; constraining exports, causing negative economic impacts and threatening food security. Obtaining certification of disease-free status is only the first step towards gaining benefits from improvements in animal health. Increasing international trade means that countries must manage the sustainability of their disease-free status in conjunction with trade partners and must comply with additional food safety and animal welfare standards. This paper comments on the challenges created by this new scenario in relation to the epidemiology and economics of animal health, when seeking to improve decisionmaking for animal health management. The authors characterise the current LAC livestock landscape and animal health situation, describing transitions in disease control and the use of economics in improving animal health. They conclude with remarks on the challenges presented by decision-making, economic rationality, sources of benefits, distribution and incentives.

Microbiological Standardization in Small Laboratory Animals and Recommendations for the Monitoring

Directory of Open Access Journals (Sweden)

Meral Karaman

2014-03-01

Full Text Available Microbiological standardization in laboratory animal breeding is based on the classification according to the microorganisms that the animals host and consequently their upbringing environment, as well as the certification of their microbiological status and the protection of their properties. Although there are many different classifications for microbiological standardization of laboratory animals, they can be basically classified as; gnotobiotic animals, animals bred with a complete barrier system (Germ free, GF, with Colonization-Resistant Flora; CRF, animals bred with a partial barrier system (Specified Pathogen Free, SPF, and animals bred by conventional methods in units without barriers (Conventional; CV. Monitoring of microbiological standardization is carried out in two ways. One is controlling barrier systems (process control and the other is controlling laboratory animals (product control. In controlling barrier systems samples are taken routinely from ambient air, surfaces, base plate materials of animals, foods and waters, and microbiological tests are carried out. FELASA guidelines are frequently used in monitoring laboratory animals. These guidelines where the monitoring frequency, sample size, micro-organisms to be tested, vary according to the microbiological quality of the animals, and test methods and are frequently updated by FELASA and shared in their web pages. In our country, in general, laboratory animals used for experimental studies present no microbiological standardization, and follow-up protocols are not implemented. Therefore, construction of facilities for the production of microbiologically standard animals and establishment of backup laboratories testing microbiological quality should be established.

Rapid production of antigen-specific monoclonal antibodies from a variety of animals

Directory of Open Access Journals (Sweden)

Kurosawa Nobuyuki

2012-09-01

Full Text Available Abstract Background Although a variety of animals have been used to produce polyclonal antibodies against antigens, the production of antigen-specific monoclonal antibodies from animals remains challenging. Results We propose a simple and rapid strategy to produce monoclonal antibodies from a variety of animals. By staining lymph node cells with an antibody against immunoglobulin and a fluorescent dye specific for the endoplasmic reticulum, plasma/plasmablast cells were identified without using a series of antibodies against lineage markers. By using a fluorescently labeled antigen as a tag for a complementary cell surface immunoglobulin, antigen-specific plasma/plasmablast cells were sorted from the rest of the cell population by fluorescence-activated cell sorting. Amplification of cognate pairs of immunoglobulin heavy and light chain genes followed by DNA transfection into 293FT cells resulted in the highly efficient production of antigen-specific monoclonal antibodies from a variety of immunized animals. Conclusions Our technology eliminates the need for both cell propagation and screening processes, offering a significant advantage over hybridoma and display strategies.

Scale-free animal movement patterns: Levy walks outperform fractional Brownian motions and fractional Levy motions in random search scenarios

International Nuclear Information System (INIS)

Reynolds, A M

2009-01-01

The movement patterns of a diverse range of animals have scale-free characteristics. These characteristics provide necessary but not sufficient conditions for the presence of movement patterns that can be approximated by Levy walks. Nevertheless, it has been widely assumed that the occurrence of scale-free animal movements can indeed be attributed to the presence of Levy walks. This is, in part, because it is known that the super-diffusive properties of Levy walks can be advantageous in random search scenarios when searchers have little or no prior knowledge of target locations. However, fractional Brownian motions (fBms) and fractional Levy motions (fLms) are both scale-free and super-diffusive, and so it is possible that these motions rather than Levy walks underlie some or all occurrences of scale-free animal movement patterns. Here this possibility is examined in numerical simulations through a determination of the searching efficiencies of fBm and fLm searches. It is shown that these searches are less efficient than Levy walk searches. This finding does not rule out the possibility that some animals with scale-free movement patterns are executing fBm and fLm searches, but it does make Levy walk searches the more likely possibility.

Seroprevalence of Toxoplasma gondii in free-living Amazon river dolphins (Inia geoffrensis) from central Amazon, Brazil

Science.gov (United States)

Toxoplasma gondii is an important pathogen in aquatic mammals and its presence in these animals may indicate water contamination of aquatic environment by oocysts. Serum samples from 95 dolphins from free-living Amazon River dolphins (Inia geoffrensis) from Sustainable Development Reserve Mamirauá (...

Captive and free-living urban pigeons (Columba livia) from Brazil as carriers of multidrug-resistant pathogenic Escherichia coli.

Science.gov (United States)

Borges, Clarissa A; Maluta, Renato P; Beraldo, Lívia G; Cardozo, Marita V; Guastalli, Elisabete A L; Kariyawasam, Subhashinie; DebRoy, Chitrita; Ávila, Fernando A

2017-01-01

Thirty Escherichia coli isolates from captive and free-living pigeons in Brazil were characterised. Virulence-associated genes identified in pigeons included those which occur relatively frequently in avian pathogenic E. coli (APEC) from commercial poultry worldwide. Eleven of 30 E. coli isolates from pigeons, belonging mainly to B1 and B2 phylogenetic groups, had high or intermediate pathogenicity for 1-day-old chicks. The frequency of multi-drug resistant (MDR) E. coli in captive pigeons was relatively high and included one isolate positive for the extended-spectrum β-lactamase (ESBL) gene bla CTX-M-8 . Pulsed field gel electrophoresis (PFGE) showed high heterogeneity among isolates. There is potential for pigeons to transmit antibiotic resistant pathogenic E. coli to other species through environmental contamination or direct contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

Impressions and purchasing intentions of Japanese consumers regarding pork produced by 'Ecofeed,' a trademark of food-waste or food co-product animal feed certified by the Japanese government.

Science.gov (United States)

Sasaki, Keisuke; Aizaki, Hideo; Motoyama, Michiyo; Ohmori, Hideyuki; Kawashima, Tomoyuki

2011-02-01

Impressions and purchasing intentions of Japanese consumers regarding pork produced by 'Ecofeed', a trademark of food-waste or co-product animal feeds certified by the Japanese government, were investigated by a questionnaire on the Internet. 'Ecofeed' did not elicit specific impressions as compared to domestic, imported, Kurobuta (in Japan), and specific pathogen-free (SPF) pork. Purchasing intent for 'Ecofeed' pork was the second lowest of the five pork products. Knowledge and purchasing experience regarding 'Ecofeed' pork was the lowest of the five pork products. Respondents were classified into four categories according to their impressions of 'Ecofeed' pork. The largest category of respondents did not have any specific impression of 'Ecofeed' pork and had little knowledge of pork farming. A category that had a positive impression for 'Ecofeed' pork had high knowledge of the pork farming system. In order to establish 'Ecofeed' pork in Japan, our results suggest that information disclosure and education about 'Ecofeed', its certification system, environmental benefits and the current self-efficiency ratio of animal feed, are needed. © 2010 The Authors. Journal compilation © 2010 Japanese Society of Animal Science.

Light pollution disrupts sleep in free-living animals.

Science.gov (United States)

Raap, Thomas; Pinxten, Rianne; Eens, Marcel

2015-09-04

Artificial lighting can alter individual behaviour, with often drastic and potentially negative effects on biological rhythms, daily activity and reproduction. Whether this is caused by a disruption of sleep, an important widespread behaviour enabling animals to recover from daily stress, is unclear. We tested the hypothesis that light pollution disrupts sleep by recording individual sleep behaviour of great tits, Parus major, that were roosting in dark nest-boxes and were exposed to light-emitting diode light the following night. Their behaviour was compared to that of control birds sleeping in dark nest-boxes on both nights. Artificial lighting caused experimental birds to wake up earlier, sleep less (-5%) and spent less time in the nest-box as they left their nest-box earlier in the morning. Experimental birds did not enter the nest-box or fall asleep later than controls. Although individuals in lit nest-boxes did not wake up more often nor decreased the length of their sleep bouts, females spent a greater proportion of the night awake. Our study provides the first direct proof that light pollution has a significant impact on sleep in free-living animals, in particular in the morning, and highlights a mechanism for potential effects of light pollution on fitness.

Colonization by non-pathogenic bacteria alters mRNA expression of cytochromes P450 in originally germ-free mice.

Science.gov (United States)

Jourová, L; Anzenbacher, P; Lišková, B; Matušková, Z; Hermanová, P; Hudcovic, T; Kozáková, H; Hrnčířová, L; Anzenbacherová, E

2017-11-01

Gut microbiota provides a wide range of beneficial function for the host and has an immense effect on the host's health state. It has also been shown that gut microbiome is often involved in the biotransformation of xenobiotics; however, the molecular mechanisms of the interaction between the gut bacteria and the metabolism of drugs by the host are still unclear. To investigate the effect of microbial colonization on messenger RNA (mRNA) expression of liver cytochromes P450 (CYPs), the main drug-metabolizing enzymes, we used germ-free (GF) mice, lacking the intestinal flora and mice monocolonized by non-pathogenic bacteria Lactobacillus plantarum NIZO2877 or probiotic bacteria Escherichia coli Nissle 1917 compared to specific pathogen-free (SPF) mice. Our results show that the mRNA expression of Cyp1a2 and Cyp2e1 was significantly increased, while the expression of Cyp3a11 mRNA was decreased under GF conditions compared to the SPF mice. The both bacteria L. plantarum NIZO2877 and E. coli Nissle 1917 given to the GF mice decreased the level of Cyp1a2 mRNA and normalized it to the control level. On the other hand, the colonization by these bacteria had no effect on the expression of Cyp3a11 mRNA in the liver of the GF mice (which remained decreased). Surprisingly, monocolonization with chosen bacterial strains has shown a different effect on the expression of Cyp2e1 mRNA in GF mice. Increased level of Cyp2e1 expression observed in the GF mice was found also in mice colonized by L. plantarum NIZO2877 ; however, the colonization with probiotic E. coli Nissle 1917 caused a decrease in Cyp2e1 expression and partially restored the SPF mice conditions.

Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

Science.gov (United States)

Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

2014-01-01

Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

A New Family of Capsule Polymerases Generates Teichoic Acid-Like Capsule Polymers in Gram-Negative Pathogens.

Science.gov (United States)

Litschko, Christa; Oldrini, Davide; Budde, Insa; Berger, Monika; Meens, Jochen; Gerardy-Schahn, Rita; Berti, Francesco; Schubert, Mario; Fiebig, Timm

2018-05-29

Group 2 capsule polymers represent crucial virulence factors of Gram-negative pathogenic bacteria. They are synthesized by enzymes called capsule polymerases. In this report, we describe a new family of polymerases that combine glycosyltransferase and hexose- and polyol-phosphate transferase activity to generate complex poly(oligosaccharide phosphate) and poly(glycosylpolyol phosphate) polymers, the latter of which display similarity to wall teichoic acid (WTA), a cell wall component of Gram-positive bacteria. Using modeling and multiple-sequence alignment, we showed homology between the predicted polymerase domains and WTA type I biosynthesis enzymes, creating a link between Gram-negative and Gram-positive cell wall biosynthesis processes. The polymerases of the new family are highly abundant and found in a variety of capsule-expressing pathogens such as Neisseria meningitidis , Actinobacillus pleuropneumoniae , Haemophilus influenzae , Bibersteinia trehalosi , and Escherichia coli with both human and animal hosts. Five representative candidates were purified, their activities were confirmed using nuclear magnetic resonance (NMR) spectroscopy, and their predicted folds were validated by site-directed mutagenesis. IMPORTANCE Bacterial capsules play an important role in the interaction between a pathogen and the immune system of its host. During the last decade, capsule polymerases have become attractive tools for the production of capsule polymers applied as antigens in glycoconjugate vaccine formulations. Conventional production of glycoconjugate vaccines requires the cultivation of the pathogen and thus the highest biosafety standards, leading to tremendous costs. With regard to animal husbandry, where vaccines could avoid the extensive use of antibiotics, conventional production is not sufficiently cost-effective. In contrast, enzymatic synthesis of capsule polymers is pathogen-free and fast, offers high stereo- and regioselectivity, and works with high efficacy

Comparative pathogenesis in specific-pathogen-free chickens of two strains of avian hepatitis E virus recovered from a chicken with Hepatitis-Splenomegaly syndrome and from a clinically healthy chicken.

Science.gov (United States)

Billam, P; LeRoith, T; Pudupakam, R S; Pierson, F W; Duncan, R B; Meng, X J

2009-11-18

Avian hepatitis E virus (avian HEV) is the primary causative agent of Hepatitis-Splenomegaly (HS) syndrome in chickens. Recently, a genetically unique strain of avian HEV, designated avian HEV-VA, was recovered from healthy chickens in Virginia. The objective of this study was to experimentally compare the pathogenicity of the prototype strain recovered from a chicken with HS syndrome and the avian HEV-VA strain in specific-pathogen-free chickens. An infectious stock of the avian HEV-VA strain was first generated and its infectivity titer determined in chickens. For the comparative pathogenesis study, 54 chickens of 6-week-old were assigned to 3 groups of 18 chickens each. The group 1 chickens were each intravenously inoculated with 5x10(2.5) 50% chicken infectious dose of the prototype strain. The group 2 received the same dose of the avian HEV-VA strain, and the group 3 served as negative controls. Six chickens from each group were necropsied at 2, 3 and 4 weeks post-inoculation (wpi). Most chickens in both inoculated groups seroconverted by 3wpi, and the mean anti-avian HEV antibody titers were higher for the prototype strain group than the avian HEV-VA strain group. There was no significant difference in the patterns of viremia and fecal virus shedding. Blood analyte profiles did not differ between treatment groups except for serum creatine phosphokinase levels which were higher for prototype avian HEV group than avian HEV-VA group. The hepatic lesion score was higher for the prototype strain group than the other two groups. The results indicated that the avian HEV-VA strain is only slightly attenuated compared to the prototype strain, suggesting that the full spectrum of HS syndrome is likely associated with other co-factors.

Species and tissues specific differentiation of processed animal proteins in aquafeeds using proteomics tools.

Science.gov (United States)

Rasinger, J D; Marbaix, H; Dieu, M; Fumière, O; Mauro, S; Palmblad, M; Raes, M; Berntssen, M H G

2016-09-16

The rapidly growing aquaculture industry drives the search for sustainable protein sources in fish feed. In the European Union (EU) since 2013 non-ruminant processed animal proteins (PAP) are again permitted to be used in aquafeeds. To ensure that commercial fish feeds do not contain PAP from prohibited species, EU reference methods were established. However, due to the heterogeneous and complex nature of PAP complementary methods are required to guarantee the safe use of this fish feed ingredient. In addition, there is a need for tissue specific PAP detection to identify the sources (i.e. bovine carcass, blood, or meat) of illegal PAP use. In the present study, we investigated and compared different protein extraction, solubilisation and digestion protocols on different proteomics platforms for the detection and differentiation of prohibited PAP. In addition, we assessed if tissue specific PAP detection was feasible using proteomics tools. All work was performed independently in two different laboratories. We found that irrespective of sample preparation gel-based proteomics tools were inappropriate when working with PAP. Gel-free shotgun proteomics approaches in combination with direct spectral comparison were able to provide quality species and tissue specific data to complement and refine current methods of PAP detection and identification. To guarantee the safe use of processed animal protein (PAP) in aquafeeds efficient PAP detection and monitoring tools are required. The present study investigated and compared various proteomics workflows and shows that the application of shotgun proteomics in combination with direct comparison of spectral libraries provides for the desired species and tissue specific classification of this heat sterilized and pressure treated (≥133°C, at 3bar for 20min) protein feed ingredient. Copyright © 2016 Elsevier B.V. All rights reserved.

Control of highly pathogenic avian influenza in Quang Tri province, Vietnam: voices from the human-animal interface.

Science.gov (United States)

Farrell, Penny C; Hunter, Cynthia; Truong, Bui; Bunning, Michel

2015-01-01

Highly pathogenic avian influenza (HPAI) is caused by the haemagglutinin 5, neuraminidase 1 (H5N1) influenza A virus. Around 80% of households in rural Vietnam raise poultry, which provides food security and nutrition to their households and beyond. Of these, around 15-20% are semi-commercial producers, producing at least 28% of the country's chicken. Through learning the experiences of these semi-commercial farmers, this study aimed to explore the local understandings and sociocultural aspects of HPAI's impact, particularly the aetiology, diagnosis, and the prevention and control methods in one Vietnamese rural province. This study was conducted in Quang Tri province, Vietnam. Quang Tri province has eight districts. Five of these districts were at high risk of HPAI during the study period, of which three were selected for the present study. Within these three districts, six communes were randomly selected for the study from the list of intervention communes in Quang Tri province. Six out of the 26 intervention communes in Quang Tri were therefore selected. Participants were randomly selected and recruited from lists of semi-commercial farmers, village animal health workers, village human health workers and local authorities so that the study population (representative population) included an amount of variability similar to that of the wider population. A key benefit of this village-level control program was the residential proximity of animal and human health professionals. Participants were well aware of the typical clinical signs for avian influenza and of the reporting process for suspect cases. However there was extensive room for improvement in Quang Tri province regarding access to the HPAI vaccine, essential medical equipment for animal use, and available financial support. This qualitative research study provided an important insight for in-country policy makers and international stakeholders. It is vital that there are continued efforts to prevent and

Scabies Mites Alter the Skin Microbiome and Promote Growth of Opportunistic Pathogens in a Porcine Model

Science.gov (United States)

Swe, Pearl M.; Zakrzewski, Martha; Kelly, Andrew; Krause, Lutz; Fischer, Katja

2014-01-01

Background The resident skin microbiota plays an important role in restricting pathogenic bacteria, thereby protecting the host. Scabies mites (Sarcoptes scabiei) are thought to promote bacterial infections by breaching the skin barrier and excreting molecules that inhibit host innate immune responses. Epidemiological studies in humans confirm increased incidence of impetigo, generally caused by Staphylococcus aureus and Streptococcus pyogenes, secondary to the epidermal infestation with the parasitic mite. It is therefore possible that mite infestation could alter the healthy skin microbiota making way for the opportunistic pathogens. A longitudinal study to test this hypothesis in humans is near impossible due to ethical reasons. In a porcine model we generated scabies infestations closely resembling the disease manifestation in humans and investigated the scabies associated changes in the skin microbiota over the course of a mite infestation. Methodology/Principal Findings In a 21 week trial, skin scrapings were collected from pigs infected with S. scabies var. suis and scabies-free control animals. A total of 96 skin scrapings were collected before, during infection and after acaricide treatment, and analyzed by bacterial 16S rDNA tag-encoded FLX-titanium amplicon pyrosequencing. We found significant changes in the epidermal microbiota, in particular a dramatic increase in Staphylococcus correlating with the onset of mite infestation in animals challenged with scabies mites. This increase persisted beyond treatment from mite infection and healing of skin. Furthermore, the staphylococci population shifted from the commensal S. hominis on the healthy skin prior to scabies mite challenge to S. chromogenes, which is increasingly recognized as being pathogenic, coinciding with scabies infection in pigs. In contrast, all animals in the scabies-free cohort remained relatively free of Staphylococcus throughout the trial. Conclusions/Significance This is the first

Scabies mites alter the skin microbiome and promote growth of opportunistic pathogens in a porcine model.

Directory of Open Access Journals (Sweden)

Pearl M Swe

Full Text Available BACKGROUND: The resident skin microbiota plays an important role in restricting pathogenic bacteria, thereby protecting the host. Scabies mites (Sarcoptes scabiei are thought to promote bacterial infections by breaching the skin barrier and excreting molecules that inhibit host innate immune responses. Epidemiological studies in humans confirm increased incidence of impetigo, generally caused by Staphylococcus aureus and Streptococcus pyogenes, secondary to the epidermal infestation with the parasitic mite. It is therefore possible that mite infestation could alter the healthy skin microbiota making way for the opportunistic pathogens. A longitudinal study to test this hypothesis in humans is near impossible due to ethical reasons. In a porcine model we generated scabies infestations closely resembling the disease manifestation in humans and investigated the scabies associated changes in the skin microbiota over the course of a mite infestation. METHODOLOGY/PRINCIPAL FINDINGS: In a 21 week trial, skin scrapings were collected from pigs infected with S. scabies var. suis and scabies-free control animals. A total of 96 skin scrapings were collected before, during infection and after acaricide treatment, and analyzed by bacterial 16S rDNA tag-encoded FLX-titanium amplicon pyrosequencing. We found significant changes in the epidermal microbiota, in particular a dramatic increase in Staphylococcus correlating with the onset of mite infestation in animals challenged with scabies mites. This increase persisted beyond treatment from mite infection and healing of skin. Furthermore, the staphylococci population shifted from the commensal S. hominis on the healthy skin prior to scabies mite challenge to S. chromogenes, which is increasingly recognized as being pathogenic, coinciding with scabies infection in pigs. In contrast, all animals in the scabies-free cohort remained relatively free of Staphylococcus throughout the trial. CONCLUSIONS

9 CFR 145.15 - Diagnostic surveillance program for low pathogenic avian influenza.

Science.gov (United States)

2010-01-01

... low pathogenic avian influenza. 145.15 Section 145.15 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...

Three pathogens in sympatric populations of pumas, bobcats, and domestic cats: Implications for infections disease transmission

Science.gov (United States)

Bevins, Sarah N.; Carver, Scott; Boydston, Erin E.; Lyren, Lisa M.; Alldredge, Mat; Logan, Kenneth A.; Riley, Seth P.D.; Fisher, Robert N.; Vickers, T. Winston; Boyce, Walter; Salman, Mo; Lappin, Michael R.; Crooks, Kevin R.; VandeWoude, Sue

2012-01-01

Anthropogenic landscape change can lead to increased opportunities for pathogen transmission between domestic and non-domestic animals. Pumas, bobcats, and domestic cats are sympatric in many areas of North America and share many of the same pathogens, some of which are zoonotic. We analyzed bobcat, puma, and feral domestic cat samples collected from targeted geographic areas. We examined exposure to three pathogens that are taxonomically diverse (bacterial, protozoal, viral), that incorporate multiple transmission strategies (vector-borne, environmental exposure/ingestion, and direct contact), and that vary in species-specificity. Bartonella spp., Feline Immunodeficiency Virus (FIV), and Toxoplasma gondii IgG were detected in all three species with mean respective prevalence as follows: puma 16%, 41% and 75%; bobcat 31%, 22% and 43%; domestic cat 45%, 10% and 1%. Bartonella spp. were highly prevalent among domestic cats in Southern California compared to other cohort groups. Feline Immunodeficiency Virus exposure was primarily associated with species and age, and was not influenced by geographic location. Pumas were more likely to be infected with FIV than bobcats, with domestic cats having the lowest infection rate. Toxoplasma gondii seroprevalence was high in both pumas and bobcats across all sites; in contrast, few domestic cats were seropositive, despite the fact that feral, free ranging domestic cats were targeted in this study. Interestingly, a directly transmitted species-specific disease (FIV) was not associated with geographic location, while exposure to indirectly transmitted diseases – vector-borne for Bartonella spp. and ingestion of oocysts via infected prey or environmental exposure for T. gondii – varied significantly by site. Pathogens transmitted by direct contact may be more dependent upon individual behaviors and intra-specific encounters. Future studies will integrate host density, as well as landscape features, to better

Distinct lipid a moieties contribute to pathogen-induced site-specific vascular inflammation.

Directory of Open Access Journals (Sweden)

Connie Slocum

2014-07-01

detection at TLR4 facilitating chronic inflammation in the vasculature. These studies support the emerging concept that pathogen-mediated chronic inflammatory disorders result from specific pathogen-mediated evasion strategies resulting in low-grade chronic inflammation.

The Pathology of Avian Influenza in Birds and Animals: An Analytical Review

International Nuclear Information System (INIS)

Ryabchikova, E. I.; Getmanova, T. N.

2007-01-01

Influenza virus remains enigmatic despite of long extensive studies. Avian influenza virus (H5N1) is able to infect a large spectrum of animal and bird species. Highly pathogenic avian influenza virus represents a serious problem both for a human and birds, particularly for chicks. Many studies have been performed in order to show differences between highly and low pathogenic avian influenza H5N1 viruses, and examine their biological properties. Many separate pathological and microscopic descriptions are interspersed in numerous published articles. The aim of our study was to analyze data published in international scientific journals, and to attempt a generalized view of avian influenza pathology in various animal and bird hosts. We summarized and systematized data describing pathological changes caused by both highly and low pathogenic types of avian influenza virus (H5N1) in animals and birds, and developed generalized descriptions with accent at the type of virus. We also tried to show up species specific features of pathological changes in birds and animals infected with avian influenza virus (H5N1). The results of this analytical work may be useful for pathological studies of a new avian influenza virus isolates, and for understanding of avian influenza pathogenesis in birds and animals. (author)

The effects of demographic, social, and environmental characteristics on pathogen prevalence in wild felids across a gradient of urbanization.

Directory of Open Access Journals (Sweden)

Jesse S Lewis

Full Text Available Transmission of pathogens among animals is influenced by demographic, social, and environmental factors. Anthropogenic alteration of landscapes can impact patterns of disease dynamics in wildlife populations, increasing the potential for spillover and spread of emerging infectious diseases in wildlife, human, and domestic animal populations. We evaluated the effects of multiple ecological mechanisms on patterns of pathogen exposure in animal populations. Specifically, we evaluated how ecological factors affected the prevalence of Toxoplasma gondii (Toxoplasma, Bartonella spp. (Bartonella, feline immunodeficiency virus (FIV, and feline calicivirus (FCV in bobcat and puma populations across wildland-urban interface (WUI, low-density exurban development, and wildland habitat on the Western Slope (WS and Front Range (FR of Colorado during 2009-2011. Samples were collected from 37 bobcats and 29 pumas on the WS and FR. As predicted, age appeared to be positively related to the exposure to pathogens that are both environmentally transmitted (Toxoplasma and directly transmitted between animals (FIV. In addition, WS bobcats appeared more likely to be exposed to Toxoplasma with increasing intraspecific space-use overlap. However, counter to our predictions, exposure to directly-transmitted pathogens (FCV and FIV was more likely with decreasing space-use overlap (FCV: WS bobcats and potential intraspecific contacts (FIV: FR pumas. Environmental factors, including urbanization and landscape covariates, were generally unsupported in our models. This study is an approximation of how pathogens can be evaluated in relation to demographic, social, and environmental factors to understand pathogen exposure in wild animal populations.

Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen

Science.gov (United States)

Bouwer, H. G. Archie; Alberti-Segui, Christine; Montfort, Megan J.; Berkowitz, Nathan D.; Higgins, Darren E.

2006-03-01

We have developed a vaccine strategy for generating an attenuated strain of an intracellular bacterial pathogen that, after uptake by professional antigen-presenting cells, does not replicate intracellularly and is readily killed. However, after degradation of the vaccine strain within the phagolysosome, target antigens are released into the cytosol for endogenous processing and presentation for stimulation of CD8+ effector T cells. Applying this strategy to the model intracellular pathogen Listeria monocytogenes, we show that an intracellular replication-deficient vaccine strain is cleared rapidly in normal and immunocompromised animals, yet antigen-specific CD8+ effector T cells are stimulated after immunization. Furthermore, animals immunized with the intracellular replication-deficient vaccine strain are resistant to lethal challenge with a virulent WT strain of L. monocytogenes. These studies suggest a general strategy for developing safe and effective, attenuated intracellular replication-deficient vaccine strains for stimulation of protective immune responses against intracellular bacterial pathogens. CD8+ T cell | replication-deficient | Listeria monocytogenes

Mapping the Teaching of Laboratory Animal Science and Medicine in the European Union and European Free Trade Area.

Science.gov (United States)

Iatridou, Despoina; Nagy, Zsuzsanna; De Briyne, Nancy; Saunders, Jimmy; Bravo, Ana

2018-06-13

Developing a common market and allowing free movement of goods, services, and people is one of the main objectives of the European Union (EU) and the European Free Trade Area. In the field of scientific research, Directive 2010/63/EU on the protection of animals used for scientific purposes aims to improve the welfare of laboratory animals by following the principle of the 3Rs (replacement, reduction, and refinement). Each breeder, supplier, and user must appoint a designated veterinarian to advise on the well-being and treatment of the animals. In our report we investigate how the undergraduate veterinary curriculum prepares future veterinarians for the role of designated veterinarian, by analyzing data from 77 European veterinary education establishments. Over 80% of them provide training in laboratory animal science and medicine in their curriculum. All countries in the EU and the European Free Trade Area, having national veterinary schools, include such training in the curriculum of at least one of their establishments. Laboratory animal science and medicine courses can be obligatory or elective and are often part of more than one subject in the veterinary curricula. Post-graduate courses or programs are available at more than 50% of those veterinary schools. Most authorities in the European region consider graduate veterinarians ready to seek the role as designated veterinarian immediately after graduation.

Animal salmonelloses: a brief review of “host adaptation and host specificity” of Salmonella spp.

Directory of Open Access Journals (Sweden)

Grammato Evangelopoulou

2013-07-01

Full Text Available Salmonella enterica, the most pathogenic species of the genusSalmonella, includes more than 2,500 serovars, many of which are of great veterinary and medical significance. The emergence of food-borne pathogens, such as Salmonella spp., has increased knowledge about the mechanisms helping microorganisms to persist and spread within new host populations. It has also increased information about the properties they acquire for adapting in the biological environment of a new host. Thedifferences observed between serovars in their host preference and clinical manifestations are referred to as “serovar-host specificity” or “serovar-host adaptation”. The genus Salmonella, highly adaptive to vertebrate hosts, has many pathogenic serovars showing host specificity. Serovar Salmonella Typhi, causing disease to man and higher primates, is a good example of host specificity. Thus, understanding the mechanisms that Salmonella serovars use to overcome animal species' barriers or adapt to new hosts is also important for understanding the origins of any other infectious diseases or the emergence of new pathogens. In addition, molecular methods used to study the virulence determinants of Salmonella serovars, could also be used to model ways of studying the virulence determinants used by bacteria in general, when causing disease to a specific animal species

Pathogen-Reactive T Helper Cell Analysis in the Pig

Directory of Open Access Journals (Sweden)

Friederike Ebner

2017-05-01

Full Text Available There is growing interest in studying host–pathogen interactions in human-relevant large animal models such as the pig. Despite the progress in developing immunological reagents for porcine T cell research, there is an urgent need to directly assess pathogen-specific T cells—an extremely rare population of cells, but of upmost importance in orchestrating the host immune response to a given pathogen. Here, we established that the activation marker CD154 (CD40L, known from human and mouse studies, identifies also porcine antigen-reactive CD4+ T lymphocytes. CD154 expression was upregulated early after antigen encounter and CD4+CD154+ antigen-reactive T cells coexpressed cytokines. Antigen-induced expansion and autologous restimulation enabled a time- and dose-resolved analysis of CD154 regulation and a significantly increased resolution in phenotypic profiling of antigen-responsive cells. CD154 expression identified T cells responding to staphylococcal Enterotoxin B superantigen stimulation as well as T cells responding to the fungus Candida albicans and T cells specific for a highly prevalent intestinal parasite, the nematode Ascaris suum during acute and trickle infection. Antigen-reactive T cells were further detected after immunization of pigs with a single recombinant bacterial antigen of Streptococcus suis only. Thus, our study offers new ways to study antigen-specific T lymphocytes in the pig and their contribution to host–pathogen interactions.

In Ovo Vaccination with Turkey Herpesvirus Hastens Maturation of Chicken Embryo Immune Responses in Specific-Pathogen-Free Chickens.

Science.gov (United States)

Gimeno, Isabel M; Faiz, Nik M; Cortes, Aneg L; Barbosa, Taylor; Villalobos, Tarsicio; Pandiri, Arun R

2015-09-01

Administration of Marek's disease (MD) vaccines in ovo has become a common practice for the poultry industry. Efficacy of MD vaccines is very high, even though they are administered to chicken embryos that are immunologically immature. We have recently demonstrated that in ovo vaccination with turkey herpesvirus (HVT) results in increased activation of T cells at hatch. Our previous results suggested that in ovo vaccination with HVT might have a positive impact not only on MD protection but also on the overall maturity of the developing immune system of the chicken (Gallus gallus domesticus). The objective of this study was to evaluate the effect of administration of HVT at 18 days of embryonation (ED) on the maturation of the embryo immune system. Four experiments were conducted in Specific-Pathogen-Free Avian Supplies (SPAFAS) chickens to evaluate the effect of administration of HVT at 18 ED on the splenic cell phenotypes at day of age (experiment 1) and on the ability of 1-day-old chickens to respond to various antigens compared with older birds (experiments 2 and 3). In addition, a fourth experiment was conducted to elucidate whether administration of other serotype's MD vaccines (CVI988 and SB-1) at 18 ED had the same effect as HVT on the spleen cell phenotypes at day of age. Our results demonstrated that 1-day-old chickens that had received HVT in ovo (1-day HVT) had higher percentages of CD45+, MHC-I+, CD45+MHC-I+, CD3+, MHC-II+, CD3+MHC-II+, CD4+, CD8+, and CD4+CD8+ cells in the spleen than 1-day-old sham-inoculated chickens (1-day sham). Moreover, spleens of 1-day HVT chickens had greater percentages of CD45+MHC-I+ cells and equal or greater numbers of CD4+CD8- and CD4-CD8+ cells than older unvaccinated chickens. In addition, administration of HVT at 18 ED rendered chicks at hatch more responsive to unrelated antigens such as concavalin A, phytohemagglutinin-L, and keyhole limpet hemocyanin. Administration of MD vaccines of other serotypes had an effect

Porcine semen as a vector for transmission of viral pathogens.

Science.gov (United States)

Maes, Dominiek; Van Soom, Ann; Appeltant, Ruth; Arsenakis, Ioannis; Nauwynck, Hans

2016-01-01

Different viruses have been detected in porcine semen. Some of them are on the list of the World Organization for Animal Health (OIE), and consequently, these pathogens are of socioeconomic and/or public health importance and are of major importance in the international trade of animals and animal products. Artificial insemination (AI) is one of the most commonly used assisted reproductive technologies in pig production worldwide. This extensive use has enabled pig producers to benefit from superior genetics at a lower cost compared to natural breeding. However, the broad distribution of processed semen doses for field AI has increased the risk of widespread transmission of swine viral pathogens. Contamination of semen can be due to infections of the boar or can occur during semen collection, processing, and storage. It can result in reduced semen quality, embryonic mortality, endometritis, and systemic infection and/or disease in the recipient female. The presence of viral pathogens in semen can be assessed by demonstration of viable virus, nucleic acid of virus, or indirectly by measuring serum antibodies in the boar. The best way to prevent disease transmission via the semen is to assure that the boars in AI centers are free from the disease, to enforce very strict biosecurity protocols, and to perform routine health monitoring of boars. Prevention of viral semen contamination should be the primary focus because it is easier to prevent contamination than to eliminate viruses once present in semen. Nevertheless, research and development of novel semen processing treatments such as single-layer centrifugation is ongoing and may allow in the future to decontaminate semen. Copyright © 2016 Elsevier Inc. All rights reserved.

A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

Science.gov (United States)

Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

2015-04-24

Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic

Antibacterial Activity of Garlic Extract Against some Pathogenic Animal Bacteria

Directory of Open Access Journals (Sweden)

M. Safithri

2011-12-01

Full Text Available The antimicrobial activity of garlic extract against Gram-positive and Gram-negative bacterial isolates was well studied. However, reports on antibacterial activity of garlic extract against some pathogenic bacteria in animals in Indonesia, are still limited. Therefore, the aim of this study was to evaluate the antibacterial activity of water and ethanol extracts of garlic against Salmonella typhimurium in chickens, and Streptococcus agalactie, Escherichia coli, and Staphylococcus aureus causing mastitis in dairy cows in Indonesia. A filtrate of fresh garlic was used to determine the antibacterial activity against S. typhimurium at concentrations of 5%, 10%, 20%, 30%, and 40% w/v, whereas, the antibacterial activity of water and ethanol extracts was determined against S. agalactie, E. coli, and S. aureus at concentrations of 5%, 10%, 15%, 20%, and 25% w/v. Results showed that antibacterial activity of 30% garlic filtrate was equivalent to 10% tetracycline. Meanwhile, antibacterial activity of garlic aqueous extract on mastitis bacteria was better than that of the garlic ethanol extract. Aqueous extract of garlic at 20% had the same antibacterial activity as 0.01% ampicillin on mastitis bacteria. Filtrates of fresh garlic can be used to inhibit growth of S. typhimurium and mastitis bacteria.

The Tick Microbiome: Why Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission

Directory of Open Access Journals (Sweden)

Sarah I. Bonnet

2017-06-01

Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.

Formal specification and animation of a water level monitoring system

International Nuclear Information System (INIS)

Jackson, P.S.; Stokes, P.A.

1993-03-01

This report describes the Vienna Development Method (VDM), which is a formal method for software specification and development. VDM evolved out of attempts to use mathematics in programming language specifications in order to avoid ambiguities in specifications written in natural language. This report also describes the use of VDM for a real-time application, where it is used to formally specify the requirements of a water level monitoring system. The procedures and techniques used to produce an executable form (animation) of the specification are covered. (Author)

Potentially pathogenic free-living amoebae in some flood-affected areas during 2011 Chiang Mai flood.

Science.gov (United States)

Wannasan, Anchalee; Uparanukraw, Pichart; Songsangchun, Apichart; Morakote, Nimit

2013-01-01

The survey was carried out to investigate the presence of potentially pathogenic free-living amoebae (FLA) during flood in Chiang Mai, Thailand in 2011. From different crisis flood areas, seven water samples were collected and tested for the presence of amoebae using culture and molecular methods. By monoxenic culture, FLA were detected from all samples at 37 °C incubation. The FLA growing at 37 °C were morphologically identified as Acanthamoeba spp., Naegleria spp. and some unidentified amoebae. Only three samples (42.8%), defined as thermotolerant FLA, continued to grow at 42 °C. By molecular methods, two non-thermotolerant FlA were shown to have 99% identity to Acanthamoeba sp. and 98% identity to Hartmannella vermiformis while the two thermotolerant FLA were identified as Echinamoeba exundans (100% identity) and Hartmannella sp. (99% identity). This first report of the occurrence of FLA in water during the flood disaster will provide information to the public to be aware of potentially pathogenic FLA.

Porcine circovirus type 2 associated reproductive failure in a specific pathogen free (SPF piglet producing herd in Norway: a case report

Directory of Open Access Journals (Sweden)

M. Oropeza-Moe

2017-10-01

Full Text Available Abstract Background Since 1999, scientists have published evidence of transplacental infection by porcine circovirus type 2 (PCV2 and reproductive failure in pigs. Affected herds have frequently been start-up herds, either naïve or with a high proportion of PCV2 susceptible gilts. Here, delayed farrowing in non-vaccinated gilts was observed in a commercial specific pathogen free (SPF herd. Mummified fetuses and stillborn piglets recovered from these gilts were PCV2 positive. Case presentation The case herd was a self-recruiting, piglet producing unit of 240 sows. After detecting livestock associated methicillin resistant Staphylococcus aureus (LA-MRSA, CC398, stamping out was imposed by the authorities. An SPF herd was re-established and all dams were vaccinated against PCV2 until the farmer decided to exclude this vaccine. The first non-vaccinated batch consisted of 76% gilts. Here, one gilt showed signs of impending farrowing. This gilt was slaughtered three to four weeks after the expected farrowing date without having expelled any uterine contents. In the subsequent batch consisting of 79% gilts, three gilts showed similar clinical signs. Delayed farrowing was observed in two of these gilts and the uterine contents from the third gilt were recovered at the abattoir. Mummified fetuses and stillborn piglets were recovered from all three gilts. High levels of PCV2 DNA (>107 viral genomic copies/ 500 ng tissue were found in myocardial samples by real-time PCR analysis. One myocardial sample submitted for immunohistochemical (IHC analysis showed moderate amounts of PCV2 antigen. In the subsequent batch consisting of 77% gilts, several weak-born piglets were seen across different litters. Conclusions This case report describes an apparent link between in utero PCV2 infection, pre partum nest-building behaviour, mammary development and delayed farrowing. To date, no reports have described imminent signs of farrowing and delayed farrowing as

CEACAM3-mediated phagocytosis of human-specific bacterial pathogens involves the adaptor molecule Nck

OpenAIRE

Peterson, Lisa

2010-01-01

Carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) are exploited by human-specific pathogens to anchor themselves to or invade host cells. Interestingly, human granulocytes express a specific isoform, CEACAM3, that can direct efficient, opsonin-independent phagocytosis of CEACAM-binding Neisseria, Moraxella and Haemophilus species. As opsonin-independent phagocytosis of CEACAM-binding Neisseria depends on Src-family protein tyrosine kinase (PTK) phosphorylation of the CEACAM3 ...

76 FR 24793 - Highly Pathogenic Avian Influenza

Science.gov (United States)

2011-05-03

.... APHIS-2006-0074] RIN 0579-AC36 Highly Pathogenic Avian Influenza AGENCY: Animal and Plant Health... any subtype of highly pathogenic avian influenza is considered to exist. The interim rule also imposed... avian influenza, or that have moved through regions where any subtype of highly pathogenic avian...

Prefrontal spatial working memory network predicts animal's decision making in a free choice saccade task

Science.gov (United States)

Mochizuki, Kei

2015-01-01

While neurons in the lateral prefrontal cortex (PFC) encode spatial information during the performance of working memory tasks, they are also known to participate in subjective behavior such as spatial attention and action selection. In the present study, we analyzed the activity of primate PFC neurons during the performance of a free choice memory-guided saccade task in which the monkeys needed to choose a saccade direction by themselves. In trials when the receptive field location was subsequently chosen by the animal, PFC neurons with spatially selective visual response started to show greater activation before cue onset. This result suggests that the fluctuation of firing before cue presentation prematurely biased the representation of a certain spatial location and eventually encouraged the subsequent choice of that location. In addition, modulation of the activity by the animal's choice was observed only in neurons with high sustainability of activation and was also dependent on the spatial configuration of the visual cues. These findings were consistent with known characteristics of PFC neurons in information maintenance in spatial working memory function. These results suggest that precue fluctuation of spatial representation was shared and enhanced through the working memory network in the PFC and could finally influence the animal's free choice of saccade direction. The present study revealed that the PFC plays an important role in decision making in a free choice condition and that the dynamics of decision making are constrained by the network architecture embedded in this cortical area. PMID:26490287

Extracting histones for the specific purpose of label-free MS.

Science.gov (United States)

Govaert, Elisabeth; Van Steendam, Katleen; Scheerlinck, Ellen; Vossaert, Liesbeth; Meert, Paulien; Stella, Martina; Willems, Sander; De Clerck, Laura; Dhaenens, Maarten; Deforce, Dieter

2016-12-01

Extracting histones from cells is the first step in studies that aim to characterize histones and their post-translational modifications (hPTMs) with MS. In the last decade, label-free quantification is more frequently being used for MS-based histone characterization. However, many histone extraction protocols were not specifically designed for label-free MS. While label-free quantification has its advantages, it is also very susceptible to technical variation. Here, we adjust an established histone extraction protocol according to general label-free MS guidelines with a specific focus on minimizing sample handling. These protocols are first evaluated using SDS-PAGE. Hereafter, a selection of extraction protocols was used in a complete histone workflow for label-free MS. All protocols display nearly identical relative quantification of hPTMs. We thus show that, depending on the cell type under investigation and at the cost of some additional contaminating proteins, minimizing sample handling can be done during histone isolation. This allows analyzing bigger sample batches, leads to reduced technical variation and minimizes the chance of in vitro alterations to the hPTM snapshot. Overall, these results allow researchers to determine the best protocol depending on the resources and goal of their specific study. Data are available via ProteomeXchange with identifier PXD002885. © 2016 The Authors. Proteomics Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

CRN13 candidate effectors from plant and animal eukaryotic pathogens are DNA-binding proteins which trigger host DNA damage response.

Science.gov (United States)

Ramirez-Garcés, Diana; Camborde, Laurent; Pel, Michiel J C; Jauneau, Alain; Martinez, Yves; Néant, Isabelle; Leclerc, Catherine; Moreau, Marc; Dumas, Bernard; Gaulin, Elodie

2016-04-01

To successfully colonize their host, pathogens produce effectors that can interfere with host cellular processes. Here we investigated the function of CRN13 candidate effectors produced by plant pathogenic oomycetes and detected in the genome of the amphibian pathogenic chytrid fungus Batrachochytrium dendrobatidis (BdCRN13). When expressed in Nicotiana, AeCRN13, from the legume root pathogen Aphanomyces euteiches, increases the susceptibility of the leaves to the oomycete Phytophthora capsici. When transiently expressed in amphibians or plant cells, AeCRN13 and BdCRN13 localize to the cell nuclei, triggering aberrant cell development and eventually causing cell death. Using Förster resonance energy transfer experiments in plant cells, we showed that both CRN13s interact with nuclear DNA and trigger plant DNA damage response (DDR). Mutating key amino acid residues in a predicted HNH-like endonuclease motif abolished the interaction of AeCRN13 with DNA, the induction of DDR and the enhancement of Nicotiana susceptibility to P. capsici. Finally, H2AX phosphorylation, a marker of DNA damage, and enhanced expression of genes involved in the DDR were observed in A. euteiches-infected Medicago truncatula roots. These results show that CRN13 from plant and animal eukaryotic pathogens promotes host susceptibility by targeting nuclear DNA and inducing DDR. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Studying the elimination of pathogenic agents in laboratory animals feed by use of nuclear technique

International Nuclear Information System (INIS)

Shahhosseini, G.; Raisali, G.

2002-01-01

Laboratory animals are being used all around the world for different kinds of experiments in biological and medical sciences and related fields for the purposes such as prevention, control, diagnosis and treatment of various diseases in livestock, poultry, human, reproduction, breeding, etc. This is very important to keep in the breeding and reproduction environment of laboratory animals, pathogenic microorganisms as low as possible or completely remove them. The most prevailing and important way of such contamination is through feeding laboratory animals. In this research work, it is tried to use gamma radiation as a useful nuclear technique for decrease or resolve the problem. Two kinds of standard forms of diets consumed by rabbit and guinea pig in the form of small pellets and by mouse, rat and hamster in the form of big pellets (with different feed formula) and also two kinds of additive food i.e. dry milk and vitamin C have been examined. Un-irradiated samples have been used for control. Total of 226 samples were irradiated, among which optimum doses were found 25 kilo Gray for both small and big pellets, 18 kilo Gray for dry milk. Since there was not any contamination in vitamin C un-irradiated sample, irradiation was done only to observe the effect of gamma radiation on vitamin C compounds. (Author)

Pathogen Security-Help or Hindrance?

Directory of Open Access Journals (Sweden)

Stephen Allen Morse

2015-01-01

Full Text Available Events over the past 15 years have resulted in the promulgation of regulations in the United States to enhance biosecurity by restricting the access of pathogens and toxins (i.e., biological select agents and toxins [BSAT], which pose a severe threat to human, animal or plant health or to animal or plant products, to qualified institutions, laboratories, and scientists. These regulations also reduce biosafety concerns by imposing specific requirements on laboratories working with BSATs. Furthermore, they provide a legal framework for prosecuting someone who possesses a BSAT illegally. With the implementation of these regulations has come a discussion in the scientific community about the potential of these regulations to affect the cost of doing BSAT research and international collaborations, or whether it would stop someone with a microbiological background from isolating many of the select agents from nature.

Pathogen security-help or hindrance?

Science.gov (United States)

Morse, Stephen A

2014-01-01

Events over the past 15 years have resulted in the promulgation of regulations in the United States to enhance biosecurity by restricting the access to pathogens and toxins (i.e., biological select agents and toxins [BSATs]), which pose a severe threat to human being, animal, or plant health or to animal or plant products, to qualified institutions, laboratories, and scientists. These regulations also reduce biosafety concerns by imposing specific requirements on laboratories working with BSATs. Furthermore, they provide a legal framework for prosecuting someone who possesses a BSAT illegally. With the implementation of these regulations has come discussion in the scientific community about the potential of these regulations to affect the cost of doing BSAT research, hamper research and international collaborations, or whether it would stop someone with a microbiological background from isolating many of the select agents from nature.

Evaluation of three 5' exonuclease-based real-time polymerase chain reaction assays for detection of pathogenic Leptospira species in canine urine.

Science.gov (United States)

Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh

2015-03-01

Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).

Histopathological changes induced in an animal model by potentially pathogenic Enterococcus faecalis strains recovered from ready-to-eat food outlets in Osun State, Nigeria.

Science.gov (United States)

Olawale, Adetunji Kola; David, Oluwole Moses; Oluyege, Adekemi Olubukunola; Osuntoyinbo, Richard Temitope; Laleye, Solomon Anjuwon; Famurewa, Oladiran

2015-01-01

Enterococci have been implicated as an emerging important cause of several diseases and multiple antibiotic resistance. However, there is little information about the prevalence of pathogenic and/or antibiotic-resistant Enterococcus faecalis in ready-to-eat foods in Nigeria. Here we report the pathogenic potential of three selected antibiotic-resistant E. faecalis strains isolated from food canteens and food outlets with different virulence determinant genes, including EFC 12 (with gel (+), esp (+), cylA (+), and asa1 (+)), EFT 148 (with gel (+), ace (+), and asa1 (+)), and EFS 18 (with esp (+) and cylA (+)) in an animal model. Enterococcemia, hematological parameters, and histopathological changes in organ tissues were examined in experimental animals. The results showed differences in enterococcemia and hematological parameters between the control group and experimental animal group. Enterococcemia was observed for 7 days, and the animal group infected with EFC 12 showed the highest growth rate, followed by EFT 148, with the lowest growth rate seen in the EFS 18-infected group. White blood cell count, packed cell volume, and platelets were significantly reduced (Pfood canteens and food outlets; hence, there is a need for strict adherence to good hygiene practices in the study area owing to the epidemiological significance of foods.

Gut microbiomes of free-ranging and captive Namibian cheetahs: Diversity, putative functions and occurrence of potential pathogens.

Science.gov (United States)

Wasimuddin; Menke, Sebastian; Melzheimer, Jörg; Thalwitzer, Susanne; Heinrich, Sonja; Wachter, Bettina; Sommer, Simone

2017-10-01

Although the significance of the gut microbiome for host health is well acknowledged, the impact of host traits and environmental factors on the interindividual variation of gut microbiomes of wildlife species is not well understood. Such information is essential; however, as changes in the composition of these microbial communities beyond the natural range might cause dysbiosis leading to increased susceptibility to infections. We examined the potential influence of sex, age, genetic relatedness, spatial tactics and the environment on the natural range of the gut microbiome diversity in free-ranging Namibian cheetahs (Acinonyx jubatus). We further explored the impact of an altered diet and frequent contact with roaming dogs and cats on the occurrence of potential bacterial pathogens by comparing free-ranging and captive individuals living under the same climatic conditions. Abundance patterns of particular bacterial genera differed between the sexes, and bacterial diversity and richness were higher in older (>3.5 years) than in younger individuals. In contrast, male spatial tactics, which probably influence host exposure to environmental bacteria, had no discernible effect on the gut microbiome. The profound resemblance of the gut microbiome of kin in contrast to nonkin suggests a predominant role of genetics in shaping bacterial community characteristics and functional similarities. We also detected various Operational Taxonomic Units (OTUs) assigned to potential pathogenic bacteria known to cause diseases in humans and wildlife species, such as Helicobacter spp., and Clostridium perfringens. Captive individuals did not differ in their microbial alpha diversity but exhibited higher abundances of OTUs related to potential pathogenic bacteria and shifts in disease-associated functional pathways. Our study emphasizes the need to integrate ecological, genetic and pathogenic aspects to improve our comprehension of the main drivers of natural variation and shifts in

The Animal Pathogen-Like Type III Secretion System is Required for the Intracellular Survival of Burkholderia mallei within J774.2 Macrophages

Science.gov (United States)

2006-03-30

for B. mallei are horses, donkeys, and mules (solipeds), but other animals, including mice, hamsters, guinea pigs, monkeys , lions, and dogs, are...Spa/Prg and Shigella Ipa/Mxi/Spa TTS networks, are important for in vitro and in vivo survival of these pathogenic Burkholderia species (9–12, 14, 15

Clinical pathology and assessment of pathogen exposure in southern and Alaskan sea otters

Science.gov (United States)

Hanni, K.D.; Mazet, J.A.K.; Gulland, F.M.D.; Estes, James A.; Staedler, M.; Murray, M.J.; Miller, M.; Jessup, David A.

2003-01-01

The southern sea otter (Enhydra lutris nereis) population in California (USA) and the Alaskan sea otter (E. lutris kenyoni) population in the Aleutian Islands (USA) chain have recently declined. In order to evaluate disease as a contributing factor to the declines, health assessments of these two sea otter populations were conducted by evaluating hematologic and/or serum biochemical values and exposure to six marine and terrestrial pathogens using blood collected during ongoing studies from 1995 through 2000. Samples from 72 free-ranging Alaskan, 78 free-ranging southern, and (for pathogen exposure only) 41 debilitated southern sea otters in rehabilitation facilities were evaluated and compared to investigate regional differences. Serum chemistry and hematology values did not indicate a specific disease process as a cause for the declines. Statistically significant differences were found between free-ranging adult southern and Alaskan population mean serum levels of creatinine kinase, alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, calcium, cholesterol, creatinine, glucose, phosphorous, total bilirubin, blood urea nitrogen, and sodium. These were likely due to varying parasite loads, contaminant exposures, and physiologic or nutrition statuses. No free-ranging sea otters had signs of disease at capture, and prevalences of exposure to calicivirus, Brucella spp., and Leptospira spp. were low. The high prevalence (35%) of antibodies to Toxoplasma gondii in free-ranging southern sea otters, lack of antibodies to this parasite in Alaskan sea otters, and the pathogen's propensity to cause mortality in southern sea otters suggests that this parasite may be important to sea otter population dynamics in California but not in Alaska. The evidence for exposure to pathogens of public health importance (e.g., Leptospira spp., T. gondii) in the southern sea otter population, and the naïveté of both populations to other pathogens (e.g., morbillivirus

Clinical pathology and assessment of pathogen exposure in southern and Alaskan sea otters.

Science.gov (United States)

Hanni, Krista D; Mazet, Jonna A K; Gulland, Frances M D; Estes, James; Staedler, Michelle; Murray, Michael J; Miller, Melissa; Jessup, David A

2003-10-01

The southern sea otter (Enhydra lutris nereis) population in California (USA) and the Alaskan sea otter (E. lutris kenyoni) population in the Aleutian Islands (USA) chain have recently declined. In order to evaluate disease as a contributing factor to the declines, health assessments of these two sea otter populations were conducted by evaluating hematologic and/or serum biochemical values and exposure to six marine and terrestrial pathogens using blood collected during ongoing studies from 1995 through 2000. Samples from 72 free-ranging Alaskan, 78 free-ranging southern, and (for pathogen exposure only) 41 debilitated southern sea otters in rehabilitation facilities were evaluated and compared to investigate regional differences. Serum chemistry and hematology values did not indicate a specific disease process as a cause for the declines. Statistically significant differences were found between free-ranging adult southern and Alaskan population mean serum levels of creatinine kinase, alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, calcium, cholesterol, creatinine, glucose, phosphorous, total bilirubin, blood urea nitrogen, and sodium. These were likely due to varying parasite loads, contaminant exposures, and physiologic or nutrition statuses. No free-ranging sea otters had signs of disease at capture, and prevalences of exposure to calicivirus, Brucella spp., and Leptospira spp. were low. The high prevalence (35%) of antibodies to Toxoplasma gondii in free-ranging southern sea otters, lack of antibodies to this parasite in Alaskan sea otters, and the pathogen's propensity to cause mortality in southern sea otters suggests that this parasite may be important to sea otter population dynamics in California but not in Alaska. The evidence for exposure to pathogens of public health importance (e.g., Leptospira spp., T. gondii) in the southern sea otter population, and the naïveté of both populations to other pathogens (e.g., morbillivirus

Isolation and characterization of highly pathogenic avian influenza virus subtype H5N1 from donkeys

Science.gov (United States)

2010-01-01

Background The highly pathogenic H5N1 is a major avian pathogen that crosses species barriers and seriously affects humans as well as some mammals. It mutates in an intensified manner and is considered a potential candidate for the possible next pandemic with all the catastrophic consequences. Methods Nasal swabs were collected from donkeys suffered from respiratory distress. The virus was isolated from the pooled nasal swabs in specific pathogen free embryonated chicken eggs (SPF-ECE). Reverse transcriptase polymerase chain reaction (RT-PCR) and sequencing of both haemagglutingin and neuraminidase were performed. H5 seroconversion was screened using haemagglutination inhibition (HI) assay on 105 donkey serum samples. Results We demonstrated that H5N1 jumped from poultry to another mammalian host; donkeys. Phylogenetic analysis showed that the virus clustered within the lineage of H5N1 from Egypt, closely related to 2009 isolates. It harboured few genetic changes compared to the closely related viruses from avian and humans. The neuraminidase lacks oseltamivir resistant mutations. Interestingly, HI screening for antibodies to H5 haemagglutinins in donkeys revealed high exposure rate. Conclusions These findings extend the host range of the H5N1 influenza virus, possess implications for influenza virus epidemiology and highlight the need for the systematic surveillance of H5N1 in animals in the vicinity of backyard poultry units especially in endemic areas. PMID:20398268

Histopathological changes induced in an animal model by potentially pathogenic Enterococcus faecalis strains recovered from ready-to-eat food outlets in Osun State, Nigeria

Directory of Open Access Journals (Sweden)

Olawale AK

2015-06-01

Full Text Available Adetunji Kola Olawale,1,2 Oluwole Moses David,2,3 Adekemi Olubukunola Oluyege,2 Richard Temitope Osuntoyinbo,4 Solomon Anjuwon Laleye,5 Oladiran Famurewa,21Department of Applied Sciences, Osun State Polytechnic, Iree, 2Department of Microbiology, University of Ado-Ekiti, Ado-Ekiti, Nigeria; 3Phytomedicine Research Centre, Department of Botany, University of Fort Hare, Alice, South Africa; 4Department of Microbiology, Waterford Regional Hospital, Waterford, Republic of Ireland; 5Department of Microbiology, Adekunle Ajasin University, Akungba-Akoko, NigeriaAbstract: Enterococci have been implicated as an emerging important cause of several diseases and multiple antibiotic resistance. However, there is little information about the prevalence of pathogenic and/or antibiotic-resistant Enterococcus faecalis in ready-to-eat foods in Nigeria. Here we report the pathogenic potential of three selected antibiotic-resistant E. faecalis strains isolated from food canteens and food outlets with different virulence determinant genes, including EFC 12 (with gel+, esp+, cylA+, and asa1+, EFT 148 (with gel+, ace+, and asa1+, and EFS 18 (with esp+ and cylA+ in an animal model. Enterococcemia, hematological parameters, and histopathological changes in organ tissues were examined in experimental animals. The results showed differences in enterococcemia and hematological parameters between the control group and experimental animal group. Enterococcemia was observed for 7 days, and the animal group infected with EFC 12 showed the highest growth rate, followed by EFT 148, with the lowest growth rate seen in the EFS 18-infected group. White blood cell count, packed cell volume, and platelets were significantly reduced (P<0.05 in the experimental animals compared with the controls. White blood cells decreased drastically during the study period in rats challenged with EFC 12 (from 7,800 to 6,120 per mm3 but levels remained higher in the control group (from 9,228 to 9

Use of isotopes as model substances to elucidate the mode of transmission of pathogens to animals and plants by arthropod vectors

International Nuclear Information System (INIS)

Kloft, W.J.; Kloft, E.S.

1980-01-01

Experimental work was begun with J.F. Butler and L.A. DuBose on the biting flies Stomoxys calcitrans (L.) and Haematobia irritans (L.), which are important ectoparasites of livestock. Several possible mechanisms for the transmission of pathogenic materials to animals were defined, using radioisotopes: (1) mechanical transmission from contaminated mouthparts; (2) transfer through regurgitation; (3) transfer via saliva; (4) transfer through the alimentary tract. A generalized scheme was developed for the paths of uptake and excretion of radioisotopes through the organism of insects. First, experiments applied this model to blood-feeding arthropods such as the stable fly and hornfly, tsetse flies, sheep keds (Melophagus ovinus L.), mosquitoes (Culex sp., Aedes sp.), Triatoma infestans Klug (Hemiptera, Triatomidae), and the tick Ornithodorus moubata Murray. Very similar principles and possibilities for the transfer of pathogens also appear to apply to plant-sucking aphids (vectors of virus diseases in plants) as to blood-feeding arthropods. Regurgitation found in biting flies, appears in ticks as well as in Triatomidae and tsetse flies (in the last two only under stress conditions) and could even be observed in aphids. Thus, aphids and certain biting arthropods can immediately transfer pathogens after feeding on an infected host plant or animal, on migrating to another host, findings mainly possible through using radioisotopes. The results on aphids include discussion of the ingestion-egestion hypothesis of noncirculative virus transmission, described by Harris in 1977

Intracellular, genetic or congenital immunisation--transgenic approaches to increase disease resistance of farm animals.

Science.gov (United States)

Müller, M; Brem, G

1996-01-26

Novel approaches to modify disease resistance or susceptibility in livestock are justified not only by economical reasons and with respect to animal welfare but also by recent advancements in molecular genetics. The control or elimination of infectious pathogens in farm animals is historically achieved by the use of vaccines and drugs and by quarantine safeguards and eradication. Currently, research on the improvement of disease resistance based on nucleic acid technology focuses on two main issues: additive gene transfer and the development of nucleic acid vaccines. The strategies aim at the stable or transient expression of components known to influence non-specific or specific host defence mechanisms against infectious pathogens. Thus, candidates for gene transfer experiments include all genes inducing or conferring innate and acquired immunity as well as specific disease resistance genes. Referring to the site and mode of action and the source of the effective agent the strategies are termed 'intracellular', 'genetic' and 'congenital' immunisation. The targeted disruption (deletive gene transfer) of disease susceptibility genes awaits the establishment of totipotential embryonic cell lineages in farm animals. The cytokine network regulates cellular viability, growth and differentiation in physiological and pathophysiological states. The identification of the JAK-STAT pathway used by many cytokines for their intracellular signal propagation has provided not only new target molecules for modulating the immune response but will also permit the further elucidation of host-pathogen interactions and resistance mechanisms.

Proteome Analysis of the Plant Pathogenic Fungus Monilinia laxa Showing Host Specificity

Directory of Open Access Journals (Sweden)

Olja Bregar

2012-01-01

Full Text Available Brown rot fungus Monilinia laxa (Aderh. & Ruhl. Honey is an important plant pathogen in stone and pome fruits in Europe. We applied a proteomic approach in a study of M. laxa isolates obtained from apples and apricots in order to show the host specifity of the isolates and to analyse differentially expressed proteins in terms of host specifity, fungal pathogenicity and identification of candidate proteins for diagnostic marker development. Extracted mycelium proteins were separated by 2-D electrophoresis (2-DE and visualized by Coomassie staining in a non-linear pH range of 3–11 and Mr of 14–116 kDa. We set up a 2-DE reference map of M. laxa, resolving up to 800 protein spots, and used it for image analysis. The average technical coefficient of variance (13 % demonstrated a high reproducibility of protein extraction and 2-D polyacrylamide gel electrophoresis (2-DE PAGE, and the average biological coefficient of variance (23 % enabled differential proteomic analysis of the isolates. Multivariate statistical analysis (principal component analysis discriminated isolates from two different hosts, providing new data that support the existence of a M. laxa specialized form f. sp. mali, which infects only apples. A total of 50 differentially expressed proteins were further analyzed by LC-MS/MS, yielding 41 positive identifications. The identified mycelial proteins were functionally classified into 6 groups: amino acid and protein metabolism, energy production, carbohydrate metabolism, stress response, fatty acid metabolism and other proteins. Some proteins expressed only in apple isolates have been described as virulence factors in other fungi. The acetolactate synthase was almost 11-fold more abundant in apple-specific isolates than in apricot isolates and it might be implicated in M. laxa host specificity. Ten proteins identified only in apple isolates are potential candidates for the development of M. laxa host-specific diagnostic markers.

Genomic Tools and Animal Health.

Science.gov (United States)

Zanella, Ricardo

2016-09-07

Animals have been selected to improve their productivity in order to increase the profitability to the producer. In this scenario, not much attention was given to health traits. As a consequence of that, selection was made for animals with higher production and a shortened productive life. In addition to that, the intense production system used in livestock has forced animals to be exposed to higher pathogen loads, therefore predisposing them to infections. Infectious diseases are known to be caused by micro-organisms that are able to infect and colonize the host, affecting their physiological functions and causing problems in their production and on animal welfare. Even with the best management practices, diseases are still the most important cause of economic losses in the animal industry. In this review article we have addressed the new tools that could be used to select animals to better cope with diseases and pathogens.

Prefrontal spatial working memory network predicts animal's decision making in a free choice saccade task.

Science.gov (United States)

Mochizuki, Kei; Funahashi, Shintaro

2016-01-01

While neurons in the lateral prefrontal cortex (PFC) encode spatial information during the performance of working memory tasks, they are also known to participate in subjective behavior such as spatial attention and action selection. In the present study, we analyzed the activity of primate PFC neurons during the performance of a free choice memory-guided saccade task in which the monkeys needed to choose a saccade direction by themselves. In trials when the receptive field location was subsequently chosen by the animal, PFC neurons with spatially selective visual response started to show greater activation before cue onset. This result suggests that the fluctuation of firing before cue presentation prematurely biased the representation of a certain spatial location and eventually encouraged the subsequent choice of that location. In addition, modulation of the activity by the animal's choice was observed only in neurons with high sustainability of activation and was also dependent on the spatial configuration of the visual cues. These findings were consistent with known characteristics of PFC neurons in information maintenance in spatial working memory function. These results suggest that precue fluctuation of spatial representation was shared and enhanced through the working memory network in the PFC and could finally influence the animal's free choice of saccade direction. The present study revealed that the PFC plays an important role in decision making in a free choice condition and that the dynamics of decision making are constrained by the network architecture embedded in this cortical area. Copyright © 2016 the American Physiological Society.

Bacteriophages for detection of bacterial pathogens

International Nuclear Information System (INIS)

Kutateladze, M.

2009-01-01

The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

Pure animal phobia is more specific than other specific phobias: epidemiological evidence from the Zurich Study, the ZInEP and the PsyCoLaus.

Science.gov (United States)

Ajdacic-Gross, Vladeta; Rodgers, Stephanie; Müller, Mario; Hengartner, Michael P; Aleksandrowicz, Aleksandra; Kawohl, Wolfram; Heekeren, Karsten; Rössler, Wulf; Angst, Jules; Castelao, Enrique; Vandeleur, Caroline; Preisig, Martin

2016-09-01

Interest in subtypes of mental disorders is growing in parallel with continuing research progress in psychiatry. The aim of this study was to examine pure animal phobia in contrast to other specific phobias and a mixed subtype. Data from three representative Swiss community samples were analysed: PsyCoLaus (n = 3720), the ZInEP Epidemiology Survey (n = 1500) and the Zurich Study (n = 591). Pure animal phobia and mixed animal/other specific phobias consistently displayed a low age at onset of first symptoms (8-12 years) and clear preponderance of females (OR > 3). Meanwhile, other specific phobias started up to 10 years later and displayed almost a balanced sex ratio. Pure animal phobia showed no associations with any included risk factors and comorbid disorders, in contrast to numerous associations found in the mixed subtype and in other specific phobias. Across the whole range of epidemiological parameters examined in three different samples, pure animal phobia seems to represent a different entity compared to other specific phobias. The etiopathogenetic mechanisms and risk factors associated with pure animal phobias appear less clear than ever.

Comparative genomic analysis of human fungal pathogens causing paracoccidioidomycosis.

Directory of Open Access Journals (Sweden)

Christopher A Desjardins

2011-10-01

Full Text Available Paracoccidioides is a fungal pathogen and the cause of paracoccidioidomycosis, a health-threatening human systemic mycosis endemic to Latin America. Infection by Paracoccidioides, a dimorphic fungus in the order Onygenales, is coupled with a thermally regulated transition from a soil-dwelling filamentous form to a yeast-like pathogenic form. To better understand the genetic basis of growth and pathogenicity in Paracoccidioides, we sequenced the genomes of two strains of Paracoccidioides brasiliensis (Pb03 and Pb18 and one strain of Paracoccidioides lutzii (Pb01. These genomes range in size from 29.1 Mb to 32.9 Mb and encode 7,610 to 8,130 genes. To enable genetic studies, we mapped 94% of the P. brasiliensis Pb18 assembly onto five chromosomes. We characterized gene family content across Onygenales and related fungi, and within Paracoccidioides we found expansions of the fungal-specific kinase family FunK1. Additionally, the Onygenales have lost many genes involved in carbohydrate metabolism and fewer genes involved in protein metabolism, resulting in a higher ratio of proteases to carbohydrate active enzymes in the Onygenales than their relatives. To determine if gene content correlated with growth on different substrates, we screened the non-pathogenic onygenale Uncinocarpus reesii, which has orthologs for 91% of Paracoccidioides metabolic genes, for growth on 190 carbon sources. U. reesii showed growth on a limited range of carbohydrates, primarily basic plant sugars and cell wall components; this suggests that Onygenales, including dimorphic fungi, can degrade cellulosic plant material in the soil. In addition, U. reesii grew on gelatin and a wide range of dipeptides and amino acids, indicating a preference for proteinaceous growth substrates over carbohydrates, which may enable these fungi to also degrade animal biomass. These capabilities for degrading plant and animal substrates suggest a duality in lifestyle that could enable pathogenic

Issues and special features of animal health research

Directory of Open Access Journals (Sweden)

Ducrot Christian

2011-08-01

Full Text Available Abstract In the rapidly changing context of research on animal health, INRA launched a collective discussion on the challenges facing the field, its distinguishing features, and synergies with biomedical research. As has been declared forcibly by the heads of WHO, FAO and OIE, the challenges facing animal health, beyond diseases transmissible to humans, are critically important and involve food security, agriculture economics, and the ensemble of economic activities associated with agriculture. There are in addition issues related to public health (zoonoses, xenobiotics, antimicrobial resistance, the environment, and animal welfare. Animal health research is distinguished by particular methodologies and scientific questions that stem from the specific biological features of domestic species and from animal husbandry practices. It generally does not explore the same scientific questions as research on human biology, even when the same pathogens are being studied, and the discipline is rooted in a very specific agricultural and economic context. Generic and methodological synergies nevertheless exist with biomedical research, particularly with regard to tools and biological models. Certain domestic species furthermore present more functional similarities with humans than laboratory rodents. The singularity of animal health research in relation to biomedical research should be taken into account in the organization, evaluation, and funding of the field through a policy that clearly recognizes the specific issues at stake. At the same time, the One Health approach should facilitate closer collaboration between biomedical and animal health research at the level of research teams and programmes.

Issues and special features of animal health research.

Science.gov (United States)

Ducrot, Christian; Bed'hom, Bertrand; Béringue, Vincent; Coulon, Jean-Baptiste; Fourichon, Christine; Guérin, Jean-Luc; Krebs, Stéphane; Rainard, Pascal; Schwartz-Cornil, Isabelle; Torny, Didier; Vayssier-Taussat, Muriel; Zientara, Stephan; Zundel, Etienne; Pineau, Thierry

2011-08-24

In the rapidly changing context of research on animal health, INRA launched a collective discussion on the challenges facing the field, its distinguishing features, and synergies with biomedical research. As has been declared forcibly by the heads of WHO, FAO and OIE, the challenges facing animal health, beyond diseases transmissible to humans, are critically important and involve food security, agriculture economics, and the ensemble of economic activities associated with agriculture. There are in addition issues related to public health (zoonoses, xenobiotics, antimicrobial resistance), the environment, and animal welfare.Animal health research is distinguished by particular methodologies and scientific questions that stem from the specific biological features of domestic species and from animal husbandry practices. It generally does not explore the same scientific questions as research on human biology, even when the same pathogens are being studied, and the discipline is rooted in a very specific agricultural and economic context.Generic and methodological synergies nevertheless exist with biomedical research, particularly with regard to tools and biological models. Certain domestic species furthermore present more functional similarities with humans than laboratory rodents.The singularity of animal health research in relation to biomedical research should be taken into account in the organization, evaluation, and funding of the field through a policy that clearly recognizes the specific issues at stake. At the same time, the One Health approach should facilitate closer collaboration between biomedical and animal health research at the level of research teams and programmes.

COXIELLA BURNETII PATHOGENICITY MOLECULAR BASIS

Directory of Open Access Journals (Sweden)

Yu. A. Panferova

2016-01-01

Full Text Available Coxiella burnetii is an obligate intracellular gram-negative bacterial pathogen, an ethiological agent of Q-fever, a zoonotic disease, elapsing as an acute (mostly atypical pneumonia or a chronic (mostly endocarditis form. The host range is represented by wide range of mammal, avian and arthropod species, but the main source of human infection are farm animals. The main route of infection is aerosolic. In case of contact with organism pathogen binds with phagocytal monocytic-macrophagal cell line. C. burnetii promotes maturation of specific phagolysosome-like compartment in host cell, called coxiella-containing vacuole, within this vacuole pathogen becames metabolically activated and actively replicates. Coxiella persists as metabolically inactive spore-like form in environment. Internalisation of C. burnetii occurs using actin-mediated phagocytosis and zipper mechanism. After internalization of bacteria maturation of phagolysosome-like compartment and large coxiella-containing vacuole formation occure, and vacuole can occupy nearly the whole cytoplasm of the host cell. Survivance of infected cells is important for chronic infection with C. burnetii. C. burnetii elongate the viability of host cell by two ways: it actively inhibits apoptotic signal cascades and induce pro-survival factors. Exceptthat C. burnetii involves autophagic pathway during coxiella-containing vacuole formation, and induction of autophagy promotes pathogen replication. During infection C. burnetii translocates effector substrates from bacterial cytosole to euca ryotic host cell cytosole using type IV secretion system, where effectors modulate host cell proteins. Overall approximately 130 secreted effectors of type IV transport system, but function of most of them remains unknown to date. Specific sec reted proteins for variety of strains and isolates were identified, confirmed that certain pathotypes of C. burnetii can exist. Identification and

Validation of qPCR Methods for the Detection of Mycobacterium in New World Animal Reservoirs.

Directory of Open Access Journals (Sweden)

Genevieve Housman

2015-11-01

Full Text Available Zoonotic pathogens that cause leprosy (Mycobacterium leprae and tuberculosis (Mycobacterium tuberculosis complex, MTBC continue to impact modern human populations. Therefore, methods able to survey mycobacterial infection in potential animal hosts are necessary for proper evaluation of human exposure threats. Here we tested for mycobacterial-specific single- and multi-copy loci using qPCR. In a trial study in which armadillos were artificially infected with M. leprae, these techniques were specific and sensitive to pathogen detection, while more traditional ELISAs were only specific. These assays were then employed in a case study to detect M. leprae as well as MTBC in wild marmosets. All marmosets were negative for M. leprae DNA, but 14 were positive for the mycobacterial rpoB gene assay. Targeted capture and sequencing of rpoB and other MTBC genes validated the presence of mycobacterial DNA in these samples and revealed that qPCR is useful for identifying mycobacterial-infected animal hosts.

Multiple infections of rodents with zoonotic pathogens in Austria.

Science.gov (United States)

Schmidt, Sabrina; Essbauer, Sandra S; Mayer-Scholl, Anne; Poppert, Sven; Schmidt-Chanasit, Jonas; Klempa, Boris; Henning, Klaus; Schares, Gereon; Groschup, Martin H; Spitzenberger, Friederike; Richter, Dania; Heckel, Gerald; Ulrich, Rainer G

2014-07-01

Rodents are important reservoirs for a large number of zoonotic pathogens. We examined the occurrence of 11 viral, bacterial, and parasitic agents in rodent populations in Austria, including three different hantaviruses, lymphocytic choriomeningitis virus, orthopox virus, Leptospira spp., Borrelia spp., Rickettsia spp., Bartonella spp., Coxiella burnetii, and Toxoplasma gondii. In 2008, 110 rodents of four species (40 Clethrionomys glareolus, 29 Apodemus flavicollis, 26 Apodemus sylvaticus, and 15 Microtus arvalis) were trapped at two rural sites in Lower Austria. Chest cavity fluid and samples of lung, spleen, kidney, liver, brain, and ear pinna skin were collected. We screened selected tissue samples for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, Leptospira, Borrelia, Rickettsia, Bartonella spp., C. burnetii, and T. gondii by RT-PCR/PCR and detected nucleic acids of Tula hantavirus, Leptospira spp., Borrelia afzelii, Rickettsia spp., and different Bartonella species. Serological investigations were performed for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, and Rickettsia spp. Here, Dobrava-Belgrade hantavirus-, Tula hantavirus-, lymphocytic choriomeningitis virus-, orthopox virus-, and rickettsia-specific antibodies were demonstrated. Puumala hantavirus, C. burnetii, and T. gondii were neither detected by RT-PCR/PCR nor by serological methods. In addition, multiple infections with up to three pathogens were shown in nine animals of three rodent species from different trapping sites. In conclusion, these results show that rodents in Austria may host multiple zoonotic pathogens. Our observation raises important questions regarding the interactions of different pathogens in the host, the countermeasures of the host's immune system, the impact of the host-pathogen interaction on the fitness of the host, and the spread of infectious agents among wild rodents and from those to other animals or humans.

Trade patterns facilitating highly pathogenic avian influenza virus dissemination in the free-grazing layer duck system in Vietnam.

Science.gov (United States)

Meyer, A; Dinh, T X; Han, T A; Do, D V; Nhu, T V; Pham, L T; Nguyen, T T T; Newman, S; Häsler, B; Pfeiffer, D U; Vergne, T

2018-04-01

Highly pathogenic avian influenza (HPAI) viruses continue to threaten smallholder poultry producers in several South-east Asian countries, including Vietnam. In particular, the free-grazing duck system has been repeatedly highlighted as a major risk factor for HPAI outbreaks. Free-grazing ducks, which scavenge on rice paddies after the harvest, account for a large proportion of the duck population in Vietnam and the wider South-east Asian region. However, the structure and dynamics of the free-grazing duck production from farm to consumption has not been described for Vietnam. In this study, we used a value chain approach to provide a complete picture of the actors involved in the production and marketing of free-grazing duck eggs and spent layer ducks, as well as to investigate the governance structure of this food system. Group interviews and key informant interviews were conducted in two provinces located in the Mekong River Delta (MRD) and the Red River Delta (RRD). The results presented here highlight similarities and differences in farming and trade practices between the two provinces. The trade of spent layer ducks involved large volumes of live ducks being sent to China and Cambodia for consumption, generating a substantial risk of transboundary spread of pathogens, including HPAI viruses. We describe the major role of "duck yards", which act as hubs in the northbound trade of spent layer ducks. These yards should be considered as essential links in the value chain of spent layer ducks when considering HPAI surveillance and control. The veterinary authorities are only marginally involved in the value chain activities, and their influence could be strengthened by increasing surveillance activities for instance in duck yards. Last, we discuss the dynamics of the duck value chain and further implications for future HPAI management policies. © 2017 The Authors. Transboundary and Emerging Diseases Published by Blackwell Verlag GmbH.

Global impact of Torque teno virus infection in wild and domesticated animals.

Science.gov (United States)

Manzin, Aldo; Mallus, Francesca; Macera, Lisa; Maggi, Fabrizio; Blois, Sylvain

2015-07-04

Infection with Torque teno viruses (TTVs) is not restricted to humans. Different domestic and wild animal species are naturally infected with species-specific TTVs worldwide. Due to the global spread of the infection, it is likely that essentially all animals are naturally infected with species-specific TTVs, and that co-evolution of TTVs with their hosts probably occurred. Although TTVs are potentially related to many diseases, the evidence of the widespread infection in healthy human and nonhuman hosts raised doubts about their pathogenic potential. Nonetheless, their role as superimposed agents of other diseases or as triggers for impairment of immune surveillance is currently under debate. The possible contribution of animal TT viruses to interspecies transmission and their role as zoonotic agents are currently topics of discussion.

The use of drugs in food animals: benefits and risks

National Research Council Canada - National Science Library

.... The volume discusses the prevalence of human pathogens in foods of animal origin. It also addresses the transfer of resistance in animal microbes to human pathogens and the resulting risk of human disease...

The prevalence and impact of Babesia canis and Theileria sp. in free-ranging grey wolf (Canis lupus) populations in Croatia.

Science.gov (United States)

Beck, Ana; Huber, Doroteja; Polkinghorne, Adam; Kurilj, Andrea Gudan; Benko, Valerija; Mrljak, Vladimir; Reljić, Slaven; Kusak, Josip; Reil, Irena; Beck, Relja

2017-04-04

Babesia spp. and Theileria spp. are important emerging causes of disease in dogs. Alongside these domesticated hosts, there is increasing recognition that these piroplasms can also be found in a range of wild animals with isolated reports describing the presence of these pathogen in foxes (Vulpes vulpes) and captive grey wolves (Canis lupus). The prevalence and impact of these infections in free-ranging populations of canids are unknown. To gain a better insight into the epidemiology and pathogenesis of piroplasm infections in free-ranging grey wolves, pathological and molecular investigations into captive and free-ranging grey wolves in Croatia were performed. The carcasses of 107 free-ranging wolves and one captive wolf were the subjects of post-mortem investigations and sampling for molecular studies. A blood sample from one live captured wolf for telemetric tracking was also used for molecular analysis. PCR amplification targeting the 18S RNA gene revealed that 21 of 108 free-ranging wolves and one captive animal were positive for Theileria/Babesia DNA. Subsequent sequencing of a fragment of the 18S RNA gene revealed that 7/22 animals were positive for Babesia canis while the other amplified sequence were found to be identical with corresponding 18S rDNA sequences of Theileria capreoli isolated from wild deer (15/22). Haematological and cytological analysis revealed the presence of signet-ring shaped or pear-shaped piroplasms in several animals with the overall parasite burden in all positive animals assessed to be very low. Pathological investigation of the captive animal revealed fatal septicemia as a likely outcome of hemolytic anaemia. There was little or no evidence of hemolytic disease consistent with babesiosis in other animals. Importantly, the presence of B. canis in free-ranging grey wolves has not been described before but has been reported in a single fox and domestic dogs only. That B. canis infections cause disease in dogs but have little impact

Process Review for Development of Quantitative Risk Analyses for Transboundary Animal Disease to Pathogen-Free Territories

Directory of Open Access Journals (Sweden)

Jonathan Miller

2017-10-01

Full Text Available Outbreaks of transboundary animal diseases (TADs have the potential to cause significant detriment to animal, human, and environmental health; severe economic implications; and national security. Challenges concerning data sharing, model development, decision support, and disease emergence science have recently been promoted. These challenges and recommendations have been recognized and advocated in the disciplines intersecting with outbreak prediction and forecast modeling regarding infectious diseases. To advance the effective application of computation and risk communication, analytical products ought to follow a collaboratively agreed common plan for implementation. Research articles should seek to inform and assist prioritization of national and international strategies in developing established criteria to identify and follow best practice standards to assess risk model attributes and performance. A well-defined framework to help eliminate gaps in policy, process, and planning knowledge areas would help alleviate the intense need for the formation of a comprehensive strategy for countering TAD outbreak risks. A quantitative assessment that accurately captures the risk of introduction of a TAD through various pathways can be a powerful tool in guiding where government, academic, and industry resources ought to be allocated, whether implementation of additional risk management solutions is merited, and where research efforts should be directed to minimize risk. This review outlines a part of a process for the development of quantitative risk analysis to collect, analyze, and communicate this knowledge. A more comprehensive and unabridged manual was also developed. The framework used in supporting the application of aligning computational tools for readiness continues our approach to apply a preparedness mindset to challenges concerning threats to global biosecurity, secure food systems, and risk-mitigated agricultural economies.

Multiplex identification of sepsis-causing Gram-negative pathogens from the plasma of infected blood.

Science.gov (United States)

Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung

2018-02-01

Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Methicillin-resistant Staphylococcus aureus associated with animals and its relevance to human health

Directory of Open Access Journals (Sweden)

Annalisa ePantosti

2012-04-01

Full Text Available Staphylococcus aureus is a typical human pathogen. Some animal S. aureus lineages have derived from human strains following profound genetic adaptation determining a change in host specificity. Due to the close relationship of animals with the environmental microbioma and resistoma, animal staphylococcal strains also represent a source of resistance determinants. Methicillin-resistant S. aureus (MRSA emerged fifty years ago as a nosocomial pathogen but in the last decade it has also become a frequent cause of infections in the community. The recent finding that MRSA frequently colonizes animals, especially livestock, has been a reason for concern, as it has revealed an expanded reservoir of MRSA. While MRSA strains recovered from companion animals are generally similar to human nosocomial MRSA, MRSA strains recovered from food animals appear to be specific animal-adapted clones. Since 2005, MRSA belonging to ST398 was recognized as a colonizer of pigs and human subjects professionally exposed to pig farming. The pig MRSA was also found to colonize other species of farmed animals, including horses, cattle and poultry and was therefore designated livestock-associated (LA-MRSA. LA-MRSA ST398 can cause infections in humans in contact with animals, and can infect hospitalized people, although at the moment this occurrence is relatively rare. Other animal-adapted MRSA clones have been detected in livestock, such as ST1 and ST9. Recently, ST130 MRSA isolated from bovine mastitis has been found to carry a novel mecA gene that eludes detection by conventional PCR tests. Similar ST130 strains have been isolated from human infections in UK, Denmark and Germany at low frequency. It is plausible that the increased attention to animal MRSA will reveal other strains with peculiar characteristics that can pose a risk to human health.

Animal Production and Health Newsletter, No. 60, July 2014

Energy Technology Data Exchange (ETDEWEB)

NONE

2014-07-15

This year, the Animal Production and Health Section is 50 years old. The Animal Production and Health Section identifies new areas of interest based on the Member States' needs to improve efficiencies and to control threats to animal production and health. To this effect, several platforms, assays, diagnostic kits and technical procedures have been developed, adapted and transferred to Member States, supported by R&D, expert technical backstopping and guidance from our Animal Production and Health Laboratory. In addition, several nuclear based technologies (such as reproduction and disease related technologies (such as reproduction and disease related radioimmunoassay have been adapted to other types of chemistries (e.g. chemiluminescence instead of isotopes) to be used at the farm level. Stable isotopes and radioisotopes, however, still play an important and niche role to achieve the levels of sensitivity and specificity needed by the livestock community in ensuring secure and safe food, to follow and measure feed and nutritional conversion into usable energy in the animal, to improve animal breeding traits towards more and of better quality animals, to monitor migratory animals and their associated pathogens, to generate safe and protective animal vaccines through the irradiation of pathogens and to develop and transfer early and rapid diagnostic platforms. Looking back at the activities of the past six months, we had several workshops, training courses, research co-ordination meetings (RCMs) and consultants meetings. Activities scheduled for the next half-year include project review meetings, RCMs, inter-regional training courses and regional workshops. Both past and future activities are discussed in further detail in this newsletter and are also further accessible at our website.

Animal Production and Health Newsletter, No. 60, July 2014

International Nuclear Information System (INIS)

2014-07-01

This year, the Animal Production and Health Section is 50 years old. The Animal Production and Health Section identifies new areas of interest based on the Member States' needs to improve efficiencies and to control threats to animal production and health. To this effect, several platforms, assays, diagnostic kits and technical procedures have been developed, adapted and transferred to Member States, supported by R&D, expert technical backstopping and guidance from our Animal Production and Health Laboratory. In addition, several nuclear based technologies (such as reproduction and disease related technologies (such as reproduction and disease related radioimmunoassay have been adapted to other types of chemistries (e.g. chemiluminescence instead of isotopes) to be used at the farm level. Stable isotopes and radioisotopes, however, still play an important and niche role to achieve the levels of sensitivity and specificity needed by the livestock community in ensuring secure and safe food, to follow and measure feed and nutritional conversion into usable energy in the animal, to improve animal breeding traits towards more and of better quality animals, to monitor migratory animals and their associated pathogens, to generate safe and protective animal vaccines through the irradiation of pathogens and to develop and transfer early and rapid diagnostic platforms. Looking back at the activities of the past six months, we had several workshops, training courses, research co-ordination meetings (RCMs) and consultants meetings. Activities scheduled for the next half-year include project review meetings, RCMs, inter-regional training courses and regional workshops. Both past and future activities are discussed in further detail in this newsletter and are also further accessible at our website

Prioritization of Companion Animal Transmissible Diseases for Policy Intervention in Europe.

Science.gov (United States)

Cito, F; Rijks, J; Rantsios, A T; Cunningham, A A; Baneth, G; Guardabassi, L; Kuiken, T; Giovannini, A

2016-07-01

A number of papers have been published on the prioritization of transmissible diseases in farm animals and wildlife, based either on semiquantitative or truly quantitative methods, but there is no published literature on the prioritization of transmissible diseases in companion animals. In this study, available epidemiological data for diseases transmissible from companion animals to man were analysed with the aim of developing a procedure suitable for their prioritization within a European framework. A new method and its associated questionnaire and scoring system were designed based on methods described by the World Organisation for Animal Health (OIE). Modifications were applied to allow for the paucity of specific information on companion animal transmissible diseases. The OIE method was also adapted to the subject and to the regional scope of the interprofessional network addressing zoonotic diseases transmitted via companion animals in Europe: the Companion Animals multisectoriaL interprofessionaL Interdisciplinary Strategic Think tank On zoonoses (CALLISTO). Adaptations were made based on information collected from expert groups on viral, bacterial and parasitic diseases using a structured questionnaire, in which all questions were closed-ended. The expert groups were asked to select the most appropriate answer for each question taking into account the relevance and reliability of the data available in the scientific literature. Subsequently, the scoring of the answers obtained for each disease covered by the questionnaire was analysed to obtain two final overall scores, one for human health impact and one for agricultural economic impact. The adapted method was then applied to select the 15 most important pathogens (five for each pathogen group: viral, bacterial and parasitic) on the basis of their overall impact on public health and agriculture. The result of the prioritization exercise was a joint priority list (available at www.callistoproject.eu) of

The trans-kingdom identification of negative regulators of pathogen hypervirulence.

Science.gov (United States)

Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E

2016-01-01

Modern society and global ecosystems are increasingly under threat from pathogens, which cause a plethora of human, animal, invertebrate and plant diseases. Of increasing concern is the trans-kingdom tendency for increased pathogen virulence that is beginning to emerge in natural, clinical and agricultural settings. The study of pathogenicity has revealed multiple examples of convergently evolved virulence mechanisms. Originally described as rare, but increasingly common, are interactions where a single gene deletion in a pathogenic species causes hypervirulence. This review utilised the pathogen-host interaction database (www.PHI-base.org) to identify 112 hypervirulent mutations from 37 pathogen species, and subsequently interrogates the trans-kingdom, conserved, molecular, biochemical and cellular themes that cause hypervirulence. This study investigates 22 animal and 15 plant pathogens including 17 bacterial and 17 fungal species. Finally, the evolutionary significance and trans-kingdom requirement for negative regulators of hypervirulence and the implication of pathogen hypervirulence and emerging infectious diseases on society are discussed. © FEMS 2015.

Genetic associations for pathogen-specific clinical mastitis and patterns of peaks in somatic cell count

NARCIS (Netherlands)

Haas, de Y.; Barkema, H.W.; Schukken, Y.H.; Veerkamp, R.F.

2003-01-01

Genetic associations were estimated between pathogen-specific cases of clinical mastitis (CM), lactational average somatic cell score (LACSCS), and patterns of peaks in somatic cell count (SCC) which were based on deviations from the typical lactation curve for SCC. The dataset contained test-day

The influence of feeding GMO-peas on growth of animal models

Directory of Open Access Journals (Sweden)

Petr Mares

2014-02-01

Full Text Available Introduction of genetically modified (GM food or feed into the commercial sale represents a very complicated process. One of the most important steps in approval process is the evaluation of all risks on the health status of people and animal models. Within our project the genetically modified peas was breeded that showed significant resistance against Pea seed-borne mosaic virus and Pea enation mosaic virus. Preclinical studies have been conducted to found out the effect of GMO peas on animals - rats of outbreeding line Wistar. In a total, 24 male, specific pathogen free Wistar rats were used in the experiment. At the beginning of the experiment, the animals were 28 days old. The three experimental groups with 8 individuals were created. The first group of rats was fed with GMO peas, the second group of rats consumed mix of pea cultivar Raman and the third group was control without pea addition (wheat and soya were used instead of pea. In the present study we focused our attention on health, growth and utility features of rats fed with GM pea. All characteristic were observed during the experiment lasting 35 days. Consumed feed was weighted daily and the weight of the animals was measured every seven days. The average values were compared within the groups. The aim of the experiment was to verify if resistant lines of pea influence the weight growth of animal models. The results of our experiment showed that even a high concentration (30% of GM pea did not influence growth rate of rats to compare with both rats fed with pea of Raman cultivar and control group. We did not observe any health problems of animal models during the experiment.

Viral pathogen discovery

Science.gov (United States)

Chiu, Charles Y

2015-01-01

Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672

Using the Pathogen-Host Interactions database (PHI-base to investigate plant pathogen genomes and genes implicated in virulence

Directory of Open Access Journals (Sweden)

Martin eUrban

2015-08-01

Full Text Available New pathogen-host interaction mechanisms can be revealed by integrating mutant phenotype data with genetic information. PHI-base is a multi-species manually curated database combining peer-reviewed published phenotype data from plant and animal pathogens and gene/protein information in a single database.

9 CFR 146.14 - Diagnostic surveillance program for H5/H7 low pathogenic avian influenza.

Science.gov (United States)

2010-01-01

.../H7 low pathogenic avian influenza. 146.14 Section 146.14 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...

Isolation and characterization of highly pathogenic avian influenza virus subtype H5N1 from donkeys

Directory of Open Access Journals (Sweden)

Abdel-Ghany Ahmad E

2010-04-01

Full Text Available Abstract Background The highly pathogenic H5N1 is a major avian pathogen that crosses species barriers and seriously affects humans as well as some mammals. It mutates in an intensified manner and is considered a potential candidate for the possible next pandemic with all the catastrophic consequences. Methods Nasal swabs were collected from donkeys suffered from respiratory distress. The virus was isolated from the pooled nasal swabs in specific pathogen free embryonated chicken eggs (SPF-ECE. Reverse transcriptase polymerase chain reaction (RT-PCR and sequencing of both haemagglutingin and neuraminidase were performed. H5 seroconversion was screened using haemagglutination inhibition (HI assay on 105 donkey serum samples. Results We demonstrated that H5N1 jumped from poultry to another mammalian host; donkeys. Phylogenetic analysis showed that the virus clustered within the lineage of H5N1 from Egypt, closely related to 2009 isolates. It harboured few genetic changes compared to the closely related viruses from avian and humans. The neuraminidase lacks oseltamivir resistant mutations. Interestingly, HI screening for antibodies to H5 haemagglutinins in donkeys revealed high exposure rate. Conclusions These findings extend the host range of the H5N1 influenza virus, possess implications for influenza virus epidemiology and highlight the need for the systematic surveillance of H5N1 in animals in the vicinity of backyard poultry units especially in endemic areas.

Pathogen and biological contamination management in plant tissue culture: phytopathogens, vitro pathogens, and vitro pests.

Science.gov (United States)

Cassells, Alan C

2012-01-01

The ability to establish and grow plant cell, organ, and tissue cultures has been widely exploited for basic and applied research, and for the commercial production of plants (micro-propagation). Regardless of whether the application is for research or commerce, it is essential that the cultures be established in vitro free of biological contamination and be maintained as aseptic cultures during manipulation, growth, and storage. The risks from microbial contamination are spurious experimental results due to the effects of latent contaminants or losses of valuable experimental or commercial cultures. Much of the emphasis in culture contamination management historically focussed on the elimination of phytopathogens and the maintenance of cultures free from laboratory contamination by environmental bacteria, fungi (collectively referred to as "vitro pathogens", i.e. pathogens or environmental micro-organisms which cause culture losses), and micro-arthropods ("vitro pests"). Microbial contamination of plant tissue cultures is due to the high nutrient availability in the almost universally used Murashige and Skoog (Physiol Plant 15:473-497, 1962) basal medium or variants of it. In recent years, it has been shown that many plants, especially perennials, are at least locally endophytically colonized intercellularly by bacteria. The latter, and intracellular pathogenic bacteria and viruses/viroids, may pass latently into culture and be spread horizontally and vertically in cultures. Growth of some potentially cultivable endophytes may be suppressed by the high salt and sugar content of the Murashige and Skoog basal medium and suboptimal temperatures for their growth in plant tissue growth rooms. The management of contamination in tissue culture involves three stages: disease screening (syn. disease indexing) of the stock plants with disease and endophyte elimination where detected; establishment and pathogen and contaminant screening of established initial cultures

Combined production of free-range pigs and energy crops – animal behaviour and crop damages

DEFF Research Database (Denmark)

Horsted, Klaus; Kongsted, Anne Grete; Jørgensen, Uffe

2012-01-01

Intensive free-range pig production on open grasslands has disadvantages in that it creates nutrient hotspots and little opportunity for pigs to seek shelter from the sun. Combining a perennial energy crop and pig production might benefit the environment and animal welfare because perennial energy...... crops like willow (Salix sp.) and Miscanthus offer the pigs protection from the sun while reducing nutrient leaching from pig excrements due to their deep rooting system. The objectives of this study were to evaluate how season and stocking density of pigs in a free-range system with zones of willow...

High-risk febrile neutropenia in Auckland 2003-2004: the influence of the microbiology laboratory on patient treatment and the use of pathogen-specific therapy.

Science.gov (United States)

Ritchie, S; Palmer, S; Ellis-Pegler, R

2007-01-01

International guidelines recommend routine microbiological assessment of patients with febrile neutropenia, but do not recommend a change from broad-spectrum antibiotic therapy to pathogen-specific therapy when a clinically relevant organism has been isolated. The aim of the study was to determine the aetiology of febrile neutropenia in adult haematology patients at Auckland City Hospital, to document the changes in treatment made following isolation of a clinically relevant organism and to assess adverse outcomes in any patient who received pathogen-specific therapy after a positive culture result. The results of all microbiological tests together with antibiotic therapy were recorded from consecutive patients with fever and a neutrophil count cultures in 40 episodes: Gram-positive cocci accounted for 46% of isolates and Gram-negative bacilli for 35%. Isolation of a pathogen from blood cultures resulted in a change of treatment in 25 of 40 (62.5%, 95%CI 46-77%) episodes. In 12 of these episodes, antibiotic therapy was optimized to a single pathogen-specific agent. No adverse events or subsequent changes in antibiotic therapy occurred in any of these 12 patients. Isolation of a pathogen from specimens other than blood seldom led to a change in therapy. Isolation of a pathogen from blood cultures often allows antibiotic therapy to be simplified to a pathogen-specific regimen. Further study of this approach is warranted.

Participatory methods for the assessment of the ownership status of free-roaming dogs in Bali, Indonesia, for disease control and animal welfare.

Science.gov (United States)

Morters, M K; Bharadwaj, S; Whay, H R; Cleaveland, S; Damriyasa, I Md; Wood, J L N

2014-09-01

The existence of unowned, free-roaming dogs capable of maintaining adequate body condition without direct human oversight has serious implications for disease control and animal welfare, including reducing effective vaccination coverage against rabies through limiting access for vaccination, and absolving humans from the responsibility of providing adequate care for a domesticated species. Mark-recapture methods previously used to estimate the fraction of unowned dogs in free-roaming populations have limitations, particularly when most of the dogs are owned. We used participatory methods, described as Participatory Rural Appraisal (PRA), as a novel alternative to mark-recapture methods in two villages in Bali, Indonesia. PRA was implemented at the banjar (or sub-village)-level to obtain consensus on the food sources of the free-roaming dogs. Specific methods included semi-structured discussion, visualisation tools and ranking. The PRA results agreed with the preceding household surveys and direct observations, designed to evaluate the same variables, and confirmed that a population of unowned, free-roaming dogs in sufficiently good condition to be sustained independently of direct human support was unlikely to exist. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Changes in leptospirosis etiology in animals and humans.

Science.gov (United States)

Vasylieva, Natalia; Andreychyn, Mykhaylo; Kravchuk, Yulia; Chervinska, Оlena; Iosyk, Iaryna

2017-12-23

Leptospirosis is endemic in Ternopil region. In Ukraine, the disease is registered in almost all regions, including the Ternopil region. The aim of the research is to study the regularities of epidemic and epizootic processes of leptospirosis, and the circulation of its pathogens among different sources (small mammals, animals) and humans. Etiologic spectrum of leptospirosis registered in Ternopil region in 1972-2016 among small mammals, farm animals and sick people was studied. Due to the analysis of pathogens circulation among different sources (small mammals, animals), as well as the annual morbidity in humans, it was proved that new leptospira serovars are endemic and brought into the regions mostly by farm animals. Farm animals introduce the infection to humans through the environment, sometimes within 3-5-years. The spread was observed of pathogen serovars, which are new in certain areas, among all types of mouse-like small mammals and rats. It was established that livestock and small mammals are parallel reservoirs. In the regions with endemic species, the structural modification in the etiology of leptospirosis in humans is caused by additional reservoirs among animals, as well as the circulation of other pathogen serovars that were absent in the main natural reservoir, i.e. mouse-like small mammals and rats. The constant monitoring of the population, contamination and carrier state of mouse-like small mammals, rats and farm animals, is required In order to predict the future epidemiological situation on leptospirosis among the population and to improve leptospirosis diagnosis.

Malagasy bats shelter a considerable genetic diversity of pathogenic Leptospira suggesting notable host-specificity patterns.

Science.gov (United States)

Gomard, Yann; Dietrich, Muriel; Wieseke, Nicolas; Ramasindrazana, Beza; Lagadec, Erwan; Goodman, Steven M; Dellagi, Koussay; Tortosa, Pablo

2016-04-01

Pathogenic Leptospira are the causative agents of leptospirosis, a disease of global concern with major impact in tropical regions. Despite the importance of this zoonosis for human health, the evolutionary and ecological drivers shaping bacterial communities in host reservoirs remain poorly investigated. Here, we describe Leptospira communities hosted by Malagasy bats, composed of mostly endemic species, in order to characterize host-pathogen associations and investigate their evolutionary histories. We screened 947 individual bats (representing 31 species, 18 genera and seven families) for Leptospira infection and subsequently genotyped positive samples using three different bacterial loci. Molecular identification showed that these Leptospira are notably diverse and include several distinct lineages mostly belonging to Leptospira borgpetersenii and L. kirschneri. The exploration of the most probable host-pathogen evolutionary scenarios suggests that bacterial genetic diversity results from a combination of events related to the ecology and the evolutionary history of their hosts. Importantly, based on the data set presented herein, the notable host-specificity we have uncovered, together with a lack of geographical structuration of bacterial genetic diversity, indicates that the Leptospira community at a given site depends on the co-occurring bat species assemblage. The implications of such tight host-specificity on the epidemiology of leptospirosis are discussed. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Label-Free Virus Capture and Release by a Microfluidic Device Integrated with Porous Silicon Nanowire Forest.

Science.gov (United States)

Xia, Yiqiu; Tang, Yi; Yu, Xu; Wan, Yuan; Chen, Yizhu; Lu, Huaguang; Zheng, Si-Yang

2017-02-01

Viral diseases are perpetual threats to human and animal health. Detection and characterization of viral pathogens require accurate, sensitive, and rapid diagnostic assays. For field and clinical samples, the sample preparation procedures limit the ultimate performance and utility of the overall virus diagnostic protocols. This study presents the development of a microfluidic device embedded with porous silicon nanowire (pSiNW) forest for label-free size-based point-of-care virus capture in a continuous curved flow design. The pSiNW forests with specific interwire spacing are synthesized in situ on both bottom and sidewalls of the microchannels in a batch process. With the enhancement effect of Dean flow, this study demonstrates that about 50% H5N2 avian influenza viruses are physically trapped without device clogging. A unique feature of the device is that captured viruses can be released by inducing self-degradation of the pSiNWs in physiological aqueous environment. About 60% of captured viruses can be released within 24 h for virus culture, subsequent molecular diagnosis, and other virus characterization and analyses. This device performs viable, unbiased, and label-free virus isolation and release. It has great potentials for virus discovery, virus isolation and culture, functional studies of virus pathogenicity, transmission, drug screening, and vaccine development. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

PsAAT3, an oomycete-specific aspartate aminotransferase, is required for full pathogenicity of the oomycete pathogen Phytophthora sojae.

Science.gov (United States)

Wang, Rongbo; Zhang, Meixiang; Liu, Hong; Xu, Jing; Yu, Jia; He, Feng; Zhang, Xiong; Dong, Suomeng; Dou, Daolong

2016-04-01

Pathogen nutrient acquisition and metabolism are critical for successful infection and colonization. However, the nutrient requirements and metabolic pathways related to pathogenesis in oomycete pathogens are unknown. In this study, we bioinformatically identified Phytophthora sojae aspartate aminotransferases (AATs), which are key enzymes that coordinate carbon and nitrogen metabolism. We demonstrated that P. sojae encodes more AATs than the analysed fungi. Some of the AATs contained additional prephenate dehydratase and/or prephenate dehydrogenase domains in their N-termini, which are unique to oomycetes. Silencing of PsAAT3, an infection-inducible expression gene, reduced P. sojae pathogenicity on soybean plants and affected the growth under N-starving condition, suggesting that PsAAT3 is involved in pathogen pathogenicity and nitrogen utilisation during infection. Our results suggest that P. sojae and other oomycete pathogens may have distinct amino acid metabolism pathways and that PsAAT3 is important for its full pathogenicity. Copyright © 2016 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Widespread distribution of a tet W determinant among tetracycline-resistant isolates of the animal pathogen Arcanobacterium pyogenes.

Science.gov (United States)

Billington, Stephen J; Songer, J Glenn; Jost, B Helen

2002-05-01

Tetracycline resistance is common among isolates of the animal commensal and opportunistic pathogen Arcanobacterium pyogenes. The tetracycline resistance determinant cloned from two bovine isolates of A. pyogenes was highly similar at the DNA level (92% identity) to the tet(W) gene, encoding a ribosomal protection tetracycline resistance protein, from the rumen bacterium Butyrivibrio fibrisolvens. The tet(W) gene was found in all 20 tetracycline-resistant isolates tested, indicating that it is a widely distributed determinant of tetracycline resistance in this organism. In 25% of tetracycline-resistant isolates, the tet(W) gene was associated with a mob gene, encoding a functional mobilization protein, and an origin of transfer, suggesting that the determinant may be transferable to other bacteria. In fact, low-frequency transfer of tet(W) was detected from mob+ A. pyogenes isolates to a tetracycline-sensitive A. pyogenes recipient. The mobile nature of this determinant and the presence of A. pyogenes in the gastrointestinal tract of cattle and pigs suggest that A. pyogenes may have inherited this determinant within the gastrointestinal tracts of these animals.

Currently important animal disease management issues in sub-Saharan Africa.

Science.gov (United States)

Thomson, G R

2009-03-01

The present international approach to management of transboundary animal diseases (TADs) is based on the assumption that most can be eradicated; consequently, that is the usual objective adopted by international organizations concerned with animal health. However, for sub-Saharan Africa and southern Africa more particularly, eradication of most TADs is impossible for the foreseeable future for a variety of technical, financial and logistical reasons. Compounding this, the present basis for access to international markets for products derived from animals requires that the area of origin (country or zone) is free from trade-influencing TADs. The ongoing development of transfrontier conservation areas (TFCAs), extending across huge areas of southern Africa, therefore presents a development conundrum because it makes creation of geographic areas free from TADs more difficult and brings development based on wildlife conservation on the one hand and that based on livestock production on the other into sharp conflict. Sub-Saharan Africa is consequently confronted by a complex problem that contributes significantly to retarded rural development which, in turn, impedes poverty alleviation. In southern Africa specifically, foot-and-mouth disease (FMD) presents the greatest problem in relation to access to international markets for animal products. However, it is argued that this problem could be overcome by a combination between (1) implementation of a commodity-based approach to trade in products derived from animals and (2) amendment of the international standards for FMD specifically (i.e. the FMD chapter in the Terrestrial Animal Health Code of the World Organisation for Animal Health [OIE]) so that occurrence of SAT serotype viruses in free-living African buffalo need not necessarily mean exclusion of areas where buffalo occur from international markets for animal products. This would overcome a presently intractable constraint to market access for southern African

Antimicrobial resistance of mastitis pathogens.

Science.gov (United States)

Oliver, Stephen P; Murinda, Shelton E

2012-07-01

Antibiotics are used extensively in the dairy industry to combat disease and to improve animal performance. Antibiotics such as penicillin, cephalosporin, streptomycin, and tetracycline are used for the treatment and prevention of diseases affecting dairy cows caused by a variety of gram-positive and gram-negative bacteria. Antibiotics are often administrated routinely to entire herds to prevent mastitis during the dry period. An increase in the incidence of disease in a herd generally results in increased use of antimicrobials, which in turn increases the potential for antibiotic residues in milk and the potential for increased bacterial resistance to antimicrobials. Continued use of antibiotics in the treatment and prevention of diseases of dairy cows will continue to be scrutinized. It is clear that strategies employing the prudent use of antimicrobials are needed. This clearly illustrates the importance of effective herd disease prevention and control programs. Based on studies published to date, scientific evidence does not support widespread, emerging resistance among mastitis pathogens to antibacterial drugs even though many of these antibiotics have been used in the dairy industry for treatment and prevention of disease for several decades. However, it is clear that use of antibiotics in dairy cows can contribute to increased antimicrobial resistance. While antimicrobial resistance does occur, we are of the opinion that the advantages of using antibiotics for the treatment of mastitis far outweigh the disadvantages. The clinical consequences of antimicrobial resistance of dairy pathogens affecting humans appear small. Antimicrobial resistance among dairy pathogens, particularly those found in milk, is likely not a human health concern as long as the milk is pasteurized. However, there are an increasing number of people who choose to consume raw milk. Transmission of an antimicrobial-resistant mastitis pathogen and/or foodborne pathogen to humans could occur

77 FR 22327 - Draft Guidance for Industry on New Animal Drugs and New Animal Drug Combination Products...

Science.gov (United States)

2012-04-13

... resistance in human and animal bacterial pathogens when medically important antimicrobial drugs are used in... Judicious Use of Medically Important Antimicrobial Drugs in Food-Producing Animals'' and to set timelines... Judicious Use of Medically Important Antimicrobial Drugs in Food-Producing Animals'' (GFI 209) and (2) the...

Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.

Science.gov (United States)

Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea

2014-01-01

Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.

Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

Science.gov (United States)

Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

2016-03-15

During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.

Corynebacterium diphtheriae in a free-roaming red fox: case report and historical review on diphtheria in animals.

Science.gov (United States)

Sing, Andreas; Konrad, Regina; Meinel, Dominik M; Mauder, Norman; Schwabe, Ingo; Sting, Reinhard

2016-08-01

Corynebacterium diphtheriae, the classical causative agent of diphtheria, is considered to be nearly restricted to humans. Here we report the first finding of a non-toxigenic C. diphtheriae biovar belfanti strain in a free-roaming wild animal. The strain obtained from the subcutis and mammary gland of a dead red fox (Vulpes vulpes) was characterized by biochemical and molecular methods including MALDI-TOF and Multi Locus Sequence Typing. Since C. diphtheriae infections of animals, usually with close contact to humans, are reported only very rarely, an intense review comprising also scientific literature from the beginning of the 20th century was performed. Besides the present case, only 11 previously reported C. diphtheriae animal infections could be verified using current scientific criteria. Our report is the first on the isolation of C. diphtheriae from a wildlife animal without any previous human contact. In contrast, the very few unambiguous publications on C. diphtheriae in animals referred to livestock or pet animals with close human contact. C. diphtheriae carriage in animals has to be considered as an exceptionally rare event.

Effect of tulathromycin on the carrier status of Actinobacillus pleuropneumoniae serotype 2 in the tonsils of pigs

DEFF Research Database (Denmark)

Angen, Øystein; Andreasen, M.; Nielsen, E.O.

2008-01-01

The effect of a single or double dose of tulathromycin was evaluated in pigs carrying Actinobacillus pleuropneumoniae serotype 2 in their tonsils. Twenty-nine pigs from a reinfected specific pathogen-free-herd were selected from animals testing positive in an A pleuropneumoniae serotype 2-specific...

Phaeohyphomycoses, Emerging Opportunistic Diseases in Animals

NARCIS (Netherlands)

Seyedmousavi, S.; Guillot, J.; de Hoog, G.S.

2013-01-01

Emerging fungal diseases due to black yeasts and relatives in domestic or wild animals and in invertebrates or cold- and warm-blooded vertebrates are continually being reported, either as novel pathogens or as familiar pathogens affecting new species of hosts. Different epidemiological situations

Phaeohyphomycoses, emerging opportunistic diseases in animals

NARCIS (Netherlands)

Seyedmousavi, S.; Guillot, J.; de Hoog, G.S.

2013-01-01

Emerging fungal diseases due to black yeasts and relatives in domestic or wild animals and in invertebrates or cold- and warm-blooded vertebrates are continually being reported, either as novel pathogens or as familiar pathogens affecting new species of hosts. Different epidemiological situations

Application of the EPR technique to examine free radical qualities reducing infection of spring wheat grain with pathogenic fungi by He-Ne laser irradiation

International Nuclear Information System (INIS)

Gagoś, M.; Koper, R.; Sujak, A.; Misiak, L.E.; Kowalczuk, E.

2000-01-01

Samples of spring wheat grain, Jasna cv., infected with pathogenic fungi (Aspergillus niger, Penicillium sp., Fusarium, Mucor) were examined using an EPR technique. Considering the quantity of generated free radicals the fungi belonged to most toxine generating. Their toxicity was connected with the number of free radicals generated in examined grain. Grain was irradiated with He-Ne laser at known wavelength, power density and time of exposure what gave the mycostatic effect appearing in decrease of free radicals in grain samples. However, this process was not stable as the increase of free radicals was observed again with the regrowth of fungi after some days

Thermoradiation treatment of sewage sludge to eliminate pathogens for safe use as fertilizer and animal feed supplement

International Nuclear Information System (INIS)

Sivinski, H.D.; Whitfield, W.J.

1975-01-01

This paper describes a research program titled ''Waste Resources Utilization'' using a new technique called thermoradiation to destroy pathogenic organisms in sewage sludge. The thermoradiated sewage sludge will be used to study the feasibility of use for safe land application as fertilizer and soil conditioner and use as a feed supplement for ruminant animals. Experiments to date have shown good results for sludge disinfection of resistant bacteria, viruses, and parasites. Thermoradiation experiments are being carried out at a temperature of 65 0 C combined with 160 krad gamma dose for a total of 2000 pounds of dried treated sludge. The sludge will be shipped to New Mexico State University for the feeding studies and land application studies. (auth)

Pathogenic Leptospira spp. in bats: Molecular investigation in Southern Brazil.

Science.gov (United States)

Mayer, Fabiana Quoos; Dos Reis, Emily Marques; Bezerra, André Vinícius Andrade; Cerva, Cristine; Rosa, Júlio; Cibulski, Samuel Paulo; Lima, Francisco Esmaile Sales; Pacheco, Susi Missel; Rodrigues, Rogério Oliveira

2017-06-01

The present study aimed to investigate the frequency of pathogenic Leptospira spp. in Brazilian bats and to determine possible risk factors associated to it. Ninety two bats of 12 species were evaluated. Whole genomic DNA from kidneys was extracted and real-time PCR specific to pathogenic Leptospira spp. was applied. Association between the frequency of specimens positive for Leptospira spp. and sex, age, bat species or family, season of collection, geographic localization and feeding habits was evaluated. The results showed that 39.13% of analyzed bats were found positive for Leptospira spp. Nine bat species had at least one positive result. There was no association among the evaluated variables and frequency of pathogenic Leptospira spp. Although the limitations due to lack of Leptospira spp. isolation, leptospiral carriage was demonstrated in bats of different species from southern Brazil, which reinforces the need for surveillance of infectious agents in wild animals. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cytogenetics in animal production

Directory of Open Access Journals (Sweden)

L. Iannuzzi

2010-04-01

Full Text Available Cytogenetics applied to domestic animals is a useful biotechnology to be applied in the genetic improvement of livestock. Indeed, it can be used to select reproducers free chromosome abnormalities which are responsible for abnormal body conformation (aneuploidy, lower fertility (balanced chromosome abnormalities or sterility (sex chromosome abnormalities. Cytogenetics may also be applied to assess environmental pollution by studying animals living in hazardous areas and using them as biological indicators (sentinels. Chromosomes also represent optimal biological structures to study the evolution among related (bovids and unrelated (bovidshumans species, especially using comparative FISH-mapping which is one of the most powerful tools to establish the correct order of loci along chromosomes. These comparisons allow us to transfer useful information from richer genomes (human to those of domestic animals. Moreover, the use of specific molecular markers and the FISH-technique on both mitotic and extended (fiber-FISH chromosomes, has heralded a new era of cytogenetics, allowing swift extension of genetic physical maps, better anchoring of both linkage and RH-maps to specific chromosome regions, and use in a variety of applications (clinical cases, embryo and sperm analyses, evolution. In this study a brief review of these fields of the animal cytogenetics is presented.

77 FR 34783 - Highly Pathogenic Avian Influenza

Science.gov (United States)

2012-06-12

... [Docket No. APHIS-2006-0074] RIN 0579-AC36 Highly Pathogenic Avian Influenza AGENCY: Animal and Plant... regions where any subtype of highly pathogenic avian influenza (HPAI) is considered to exist. The interim... avian influenza (HPAI). On January 24, 2011, we published in the Federal Register (76 FR 4046-4056...

Animating Domain-Specific Complex Knowledge : An Analysis of Organic Food Communication

DEFF Research Database (Denmark)

Kastberg, Peter

2014-01-01

The pivotal point of this paper is an analysis and a discussion of the animated film “MultiTrust”. The film is a result a research project dealing with the “Multicriteria assessment and communication of effects of organic food systems”. A primary intention of this project was to help consumers make...... informed choices when it comes to purchasing organic foods. The animation presents a novel way of communicating domain-specific knowledge of organic food products to consumers. In order to analyze “MultiTrust”, a model of analysis is presented, which is framed by the research field communication...

Quantifying type-specific reproduction numbers for nosocomial pathogens: evidence for heightened transmission of an Asian sequence type 239 MRSA clone.

Directory of Open Access Journals (Sweden)

Ben S Cooper

Full Text Available An important determinant of a pathogen's success is the rate at which it is transmitted from infected to susceptible hosts. Although there are anecdotal reports that methicillin-resistant Staphylococcus aureus (MRSA clones vary in their transmissibility in hospital settings, attempts to quantify such variation are lacking for common subtypes, as are methods for addressing this question using routinely-collected MRSA screening data in endemic settings. Here we present a method to quantify the time-varying transmissibility of different subtypes of common bacterial nosocomial pathogens using routine surveillance data. The method adapts approaches for estimating reproduction numbers based on the probabilistic reconstruction of epidemic trees, but uses relative hazards rather than serial intervals to assign probabilities to different sources for observed transmission events. The method is applied to data collected as part of a retrospective observational study of a concurrent MRSA outbreak in the United Kingdom with dominant endemic MRSA clones (ST22 and ST36 and an Asian ST239 MRSA strain (ST239-TW in two linked adult intensive care units, and compared with an approach based on a fully parametric transmission model. The results provide support for the hypothesis that the clones responded differently to an infection control measure based on the use of topical antiseptics, which was more effective at reducing transmission of endemic clones. They also suggest that in one of the two ICUs patients colonized or infected with the ST239-TW MRSA clone had consistently higher risks of transmitting MRSA to patients free of MRSA. These findings represent some of the first quantitative evidence of enhanced transmissibility of a pandemic MRSA lineage, and highlight the potential value of tailoring hospital infection control measures to specific pathogen subtypes.

Meat Science and Muscle Biology Symposium: Ecological and dietary impactors of foodborne pathogens and methods to reduce fecal shedding in cattle.

Science.gov (United States)

Callaway, T R; Edrington, T S; Nisbet, D J

2014-04-01

Pathogenic bacteria can live asymptomatically within and on cattle and can enter the food chain but also can be transmitted to humans by fecal or direct animal contact. Reducing pathogenic bacterial incidence and populations within live cattle represents an important step in improving food safety. A broad range of preslaughter intervention strategies are being developed, which can be loosely classified as 1) directly antipathogen strategies, 2) competitive enhancement strategies (that use the microbiome's competitive nature against pathogens), and 3) animal management strategies. Included within these broad categories are such diverse methods as vaccination against foodborne pathogens, probiotics and prebiotics, bacterial viruses (i.e., bacteriophages), sodium chlorate feeding, and dietary and management changes that specifically alter the microbiome. The simultaneous application of 1 or more preharvest strategies has the potential to reduce human foodborne illnesses by erecting multiple hurdles preventing entry into humans. However, economic factors that govern producer profitability must be kept in mind while improving food safety.

Airborne pathogens from dairy manure aerial irrigation and the human health risk

Science.gov (United States)

Borchardt, Mark A.; Burch, Tucker R

2016-01-01

Dairy manure, like the fecal excrement from any domesticated or wild animal, can contain pathogens capable of infecting humans and causing illness or even death. Pathogens in dairy manure can be broadly divided into categories of taxonomy or infectiousness. Dividing by taxonomy there are three pathogen groups in dairy manure: viruses (e.g., bovine rotavirus), bacteria (e.g., Salmonella species), and protozoa (e.g., Cryptosporidium parvum). There are two categories of infectiousness for pathogens found in animals: those that are zoonotic and those that are not. A zoonotic pathogen is one that can infect both human and animal hosts. Some zoonotic pathogens found in dairy manure cause illness in both hosts (e.g., Salmonella) while other zoonotic pathogens, like Escherichia coli O157:H7, (enterohemorrhagic E. coli (EHEC)) cause illness only in humans. As a general rule, the gastrointestinal viruses found in dairy manure are not zoonotic. While there are exceptions (e.g., rare reports of bovine rotavirus infecting children), for the most part the viruses in dairy manure are not a human health concern. The primary concerns are the zoonotic bacteria and protozoa in dairy manure.

Targeted Treatment for Bacterial Infections: Prospects for Pathogen-Specific Antibiotics Coupled with Rapid Diagnostics

OpenAIRE

Maxson, Tucker; Mitchell, Douglas A.

2015-01-01

Antibiotics are a cornerstone of modern medicine and have significantly reduced the burden of infectious diseases. However, commonly used broad-spectrum antibiotics can cause major collateral damage to the human microbiome, causing complications ranging from antibiotic-associated colitis to the rapid spread of resistance. Employing narrower spectrum antibiotics targeting specific pathogens may alleviate this predicament as well as provide additional tools to expand an antibiotic repertoire th...

Reverse genetics with animal viruses. NSV reverse genetics

International Nuclear Information System (INIS)

Mebatsion, T.

2005-01-01

New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)

Seroprevalences to viral pathogens in free-ranging and captive cheetahs (Acinonyx jubatus) on Namibian Farmland.

Science.gov (United States)

Thalwitzer, Susanne; Wachter, Bettina; Robert, Nadia; Wibbelt, Gudrun; Müller, Thomas; Lonzer, Johann; Meli, Marina L; Bay, Gert; Hofer, Heribert; Lutz, Hans

2010-02-01

Cheetah populations are diminishing rapidly in their natural habitat. One reason for their decline is thought to be a high susceptibility to (infectious) diseases because cheetahs in zoos suffer from high disease-induced mortality. Data on the health status of free-ranging cheetahs are scarce, and little is known about their exposure and susceptibility to infectious diseases. We determined seroprevalences to nine key viruses (feline herpesvirus 1, feline calicivirus, feline parvovirus, feline coronavirus, canine distemper virus, feline immunodeficiency virus [FIV], puma lentivirus, feline leukemia virus, and rabies virus) in 68 free-ranging cheetahs on east-central Namibian farmland, 24 nonvaccinated Namibian captive cheetahs, and several other wild carnivore species and conducted necropsies of cheetahs and other wild carnivores. Eight of 11 other wild carnivores were seropositive for at least one of the viruses, including the first record of an FIV-like infection in a wild felid west of the Kalahari, the caracal (Felis caracal). Seroprevalences of the free-ranging cheetahs were below 5% for all nine viruses, which is significantly lower than seroprevalences in nonvaccinated captive cheetahs and those for five of seven viruses in previously studied free-ranging cheetahs from north-central Namibia (L. Munson, L. Marker, E. Dubovi, J. A. Spencer, J. F. Evermann, and S. J. O'Brien, J. Wildl. Dis. 40:23-31, 2004). There was no clinical or pathological evidence of infectious diseases in living or dead cheetahs. The results suggest that while free-ranging wild carnivores may be a source of pathogens, the distribution of seroprevalences across studies mirrored local human population density and factors associated with human habitation, probably reflecting contact opportunities with (nonvaccinated) domestic and feral cats and dogs. They also suggest that Namibian cheetahs respond effectively to viral challenges, encouraging consistent and sustainable conservation efforts.

Seroprevalences to Viral Pathogens in Free-Ranging and Captive Cheetahs (Acinonyx jubatus) on Namibian Farmland▿

Science.gov (United States)

Thalwitzer, Susanne; Wachter, Bettina; Robert, Nadia; Wibbelt, Gudrun; Müller, Thomas; Lonzer, Johann; Meli, Marina L.; Bay, Gert; Hofer, Heribert; Lutz, Hans

2010-01-01

Cheetah populations are diminishing rapidly in their natural habitat. One reason for their decline is thought to be a high susceptibility to (infectious) diseases because cheetahs in zoos suffer from high disease-induced mortality. Data on the health status of free-ranging cheetahs are scarce, and little is known about their exposure and susceptibility to infectious diseases. We determined seroprevalences to nine key viruses (feline herpesvirus 1, feline calicivirus, feline parvovirus, feline coronavirus, canine distemper virus, feline immunodeficiency virus [FIV], puma lentivirus, feline leukemia virus, and rabies virus) in 68 free-ranging cheetahs on east-central Namibian farmland, 24 nonvaccinated Namibian captive cheetahs, and several other wild carnivore species and conducted necropsies of cheetahs and other wild carnivores. Eight of 11 other wild carnivores were seropositive for at least one of the viruses, including the first record of an FIV-like infection in a wild felid west of the Kalahari, the caracal (Felis caracal). Seroprevalences of the free-ranging cheetahs were below 5% for all nine viruses, which is significantly lower than seroprevalences in nonvaccinated captive cheetahs and those for five of seven viruses in previously studied free-ranging cheetahs from north-central Namibia (L. Munson, L. Marker, E. Dubovi, J. A. Spencer, J. F. Evermann, and S. J. O'Brien, J. Wildl. Dis. 40:23-31, 2004). There was no clinical or pathological evidence of infectious diseases in living or dead cheetahs. The results suggest that while free-ranging wild carnivores may be a source of pathogens, the distribution of seroprevalences across studies mirrored local human population density and factors associated with human habitation, probably reflecting contact opportunities with (nonvaccinated) domestic and feral cats and dogs. They also suggest that Namibian cheetahs respond effectively to viral challenges, encouraging consistent and sustainable conservation efforts

Protozoan Cysts Act as a Survival Niche and Protective Shelter for Foodborne Pathogenic Bacteria

Science.gov (United States)

Lambrecht, Ellen; Baré, Julie; Chavatte, Natascha; Bert, Wim; Sabbe, Koen

2015-01-01

The production of cysts, an integral part of the life cycle of many free-living protozoa, allows these organisms to survive adverse environmental conditions. Given the prevalence of free-living protozoa in food-related environments, it is hypothesized that these organisms play an important yet currently underinvestigated role in the epidemiology of foodborne pathogenic bacteria. Intracystic bacterial survival is highly relevant, as this would allow bacteria to survive the stringent cleaning and disinfection measures applied in food-related environments. The present study shows that strains of widespread and important foodborne bacteria (Salmonella enterica, Escherichia coli, Yersinia enterocolitica, and Listeria monocytogenes) survive inside cysts of the ubiquitous amoeba Acanthamoeba castellanii, even when exposed to either antibiotic treatment (100 μg/ml gentamicin) or highly acidic conditions (pH 0.2) and resume active growth in broth media following excystment. Strain- and species-specific differences in survival periods were observed, with Salmonella enterica surviving up to 3 weeks inside amoebal cysts. Up to 53% of the cysts were infected with pathogenic bacteria, which were located in the cyst cytosol. Our study suggests that the role of free-living protozoa and especially their cysts in the persistence and epidemiology of foodborne bacterial pathogens in food-related environments may be much more important than hitherto assumed. PMID:26070667

The multifaceted resources and microevolution of the successful human and animal pathogen methicillin-resistant Staphylococcus aureus

Directory of Open Access Journals (Sweden)

Agnes Marie Sá Figueiredo

2014-06-01

Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA is one of the most important bacterial pathogens based on its incidence and the severity of its associated infections. In addition, severe MRSA infections can occur in hospitalised patients or healthy individuals from the community. Studies have shown the infiltration of MRSA isolates of community origin into hospitals and variants of hospital-associated MRSA have caused infections in the community. These rapid epidemiological changes represent a challenge for the molecular characterisation of such bacteria as a hospital or community-acquired pathogen. To efficiently control the spread of MRSA, it is important to promptly detect the mecA gene, which is the determinant of methicillin resistance, using a polymerase chain reaction-based test or other rapidly and accurate methods that detect the mecA product penicillin-binding protein (PBP2a or PBP2’. The recent emergence of MRSA isolates that harbour a mecA allotype, i.e., the mecC gene, infecting animals and humans has raised an additional and significant issue regarding MRSA laboratory detection. Antimicrobial drugs for MRSA therapy are becoming depleted and vancomycin is still the main choice in many cases. In this review, we present an overview of MRSA infections in community and healthcare settings with focus on recent changes in the global epidemiology, with special reference to the MRSA picture in Brazil.

The multifaceted resources and microevolution of the successful human and animal pathogen methicillin-resistant Staphylococcus aureus

Science.gov (United States)

Figueiredo, Agnes Marie Sá; Ferreira, Fabienne Antunes

2014-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most important bacterial pathogens based on its incidence and the severity of its associated infections. In addition, severe MRSA infections can occur in hospitalised patients or healthy individuals from the community. Studies have shown the infiltration of MRSA isolates of community origin into hospitals and variants of hospital-associated MRSA have caused infections in the community. These rapid epidemiological changes represent a challenge for the molecular characterisation of such bacteria as a hospital or community-acquired pathogen. To efficiently control the spread of MRSA, it is important to promptly detect the mecA gene, which is the determinant of methicillin resistance, using a polymerase chain reaction-based test or other rapidly and accurate methods that detect the mecA product penicillin-binding protein (PBP)2a or PBP2’. The recent emergence of MRSA isolates that harbour a mecA allotype, i.e., the mecC gene, infecting animals and humans has raised an additional and significant issue regarding MRSA laboratory detection. Antimicrobial drugs for MRSA therapy are becoming depleted and vancomycin is still the main choice in many cases. In this review, we present an overview of MRSA infections in community and healthcare settings with focus on recent changes in the global epidemiology, with special reference to the MRSA picture in Brazil. PMID:24789555

Ecological theory as a foundation to control pathogenic invasion in aquaculture

Science.gov (United States)

De Schryver, Peter; Vadstein, Olav

2014-01-01

Detrimental host–pathogen interactions are a normal phenomenon in aquaculture animal production, and have been counteracted by prophylactic use of antibiotics. Especially, the youngest life stages of cultivated aquatic animals are susceptible to pathogen invasion, resulting in disease and mortality. To establish a more sustainable aquatic food production, there is a need for new microbial management strategies that focus on ‘join them' and not the traditional ‘beat them' approaches. We argue that ecological theory could serve as a foundation for developing sustainable microbial management methods that prevent pathogenic disease in larviculture. Management of the water microbiota in aquaculture systems according to ecological selection principles has been shown to decrease opportunistic pathogen pressure and to result in an improved performance of the cultured animals. We hypothesize that manipulation of the biodiversity of the gut microbiota can increase the host's resistance against pathogenic invasion and infection. However, substantial barriers need to be overcome before active management of the intestinal microbiota can effectively be applied in larviculture. PMID:24892581

InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

Science.gov (United States)

Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

2011-10-21

Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...

AquaResp® — free open-source software for measuring oxygen consumption of resting aquatic animals

DEFF Research Database (Denmark)

Svendsen, Morten Bo S.; Skov, Peter Vilhelm; Bushnell, Peter G.

AquaResp® is a free open-source software program developed to measure the oxygen consumption of aquatic animals using intermittent flow techniques. This free program is based on Microsoft Excel, and uses the MCC Universal Library and a data acquisition board to acquire analogue readings from up...... to four input ports and output control via two digital and two analogue ports. In addition AquaResp can read one COM-port if the oxygen analyser has a RS-232 output signal. The present version of the program has options for parsing data strings generated by two major fibre optic oxygen electrode...

Can stress in farm animals increase food safety risk?

Science.gov (United States)

Rostagno, Marcos H

2009-09-01

All farm animals will experience some level of stress during their lives. Stress reduces the fitness of an animal, which can be expressed through failure to achieve production performance standards, or through disease and death. Stress in farm animals can also have detrimental effects on the quality of food products. However, although a common assumption of a potential effect of stress on food safety exists, little is actually known about how this interaction may occur. The aim of this review was to examine the current knowledge of the potential impact of stress in farm animals on food safety risk. Colonization of farm animals by enteric pathogens such as Escherichia coli O157:H7, Salmonella, and Campylobacter, and their subsequent dissemination into the human food chain are a major public health and economic concern for the food industries. This review shows that there is increasing evidence to demonstrate that stress can have a significant deleterious effect on food safety through a variety of potential mechanisms. However, as the impact of stress is difficult to precisely determine, it is imperative that the issue receives more research attention in the interests of optimizing animal welfare and minimizing losses in product yield and quality, as well as to food safety risks to consumers. While there is some evidence linking stress with pathogen carriage and shedding in farm animals, the mechanisms underlying this effect have not been fully elucidated. Understanding when pathogen loads on the farm are the highest or when animals are most susceptible to infection will help identifying times when intervention strategies for pathogen control may be most effective, and consequently, increase the safety of food of animal origin.

Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

Science.gov (United States)

Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

2016-10-15

Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author

The use of animals as a surveillance tool for monitoring environmental health hazards, human health hazards and bioterrorism.

Science.gov (United States)

Neo, Jacqueline Pei Shan; Tan, Boon Huan

2017-05-01

This review discusses the utilization of wild or domestic animals as surveillance tools for monitoring naturally occurring environmental and human health hazards. Besides providing early warning to natural hazards, animals can also provide early warning to societal hazards like bioterrorism. Animals are ideal surveillance tools to humans because they share the same environment as humans and spend more time outdoors than humans, increasing their exposure risk. Furthermore, the biologically compressed lifespans of some animals may allow them to develop clinical signs more rapidly after exposure to specific pathogens. Animals are an excellent channel for monitoring novel and known pathogens with outbreak potential given that more than 60 % of emerging infectious diseases in humans originate as zoonoses. This review attempts to highlight animal illnesses, deaths, biomarkers or sentinel events, to remind human and veterinary public health programs that animal health can be used to discover, monitor or predict environmental health hazards, human health hazards, or bioterrorism. Lastly, we hope that this review will encourage the implementation of animals as a surveillance tool by clinicians, veterinarians, ecosystem health professionals, researchers and governments. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Free the animals? Investigating attitudes toward animal testing in Britain and the United States.

Science.gov (United States)

Swami, Viren; Furnham, Adrian; Christopher, Andrew N

2008-06-01

In this study, 185 British and 143 American undergraduates completed a battery of tests that measured attitudes toward animal testing and various individual difference variables. Attitudes toward animal testing factored into two interpretable factors: general attitudes toward animal testing, and animal welfare and conditions of testing. Overall, there was support for animal testing under the right conditions, although there was also concern for the welfare of animals and the conditions under which testing takes place. There were small but significant national difference on both factors (with Americans more positive about testing and less positive about animal welfare), and a significant sex difference on the first factor (women were more negative about testing). Correlation and regression analyses showed that there were few significant individual difference predictors of both factors. These results are discussed in relation to past and future work on attitudes toward animal testing.

Evaluation of pathogen-specific biomarkers for the diagnosis of tuberculosis in white-tailed deer (Odocoileus virginianus)

Science.gov (United States)

Objective - To develop a noninvasive biomarker based Mycobacterium bovis specific detection system to track infection in domestic and wild animals. Design – Experimental longitudinal study for discovery and cross sectional design for validation Animals - Yearling white-tailed deer fawns (n=8) were ...

Animal lectins: potential receptors for ginseng polysaccharides

Directory of Open Access Journals (Sweden)

So Hee Loh

2017-01-01

Full Text Available Panax ginseng Meyer, belonging to the genus Panax of the family Araliaceae, is known for its human immune system-related effects, such as immune-boosting effects. Ginseng polysaccharides (GPs are the responsible ingredient of ginseng in immunomodulation, and are classified as acidic and neutral GPs. Although GPs participate in various immune reactions including the stimulation of immune cells and production of cytokines, the precise function of GPs together with its potential receptor(s and their signal transduction pathways have remained largely unknown. Animal lectins are carbohydrate-binding proteins that are highly specific for sugar moieties. Among many different biological functions in vivo, animal lectins especially play important roles in the immune system by recognizing carbohydrates that are found exclusively on pathogens or that are inaccessible on host cells. This review summarizes the immunological activities of GPs and the diverse roles of animal lectins in the immune system, suggesting the possibility of animal lectins as the potential receptor candidates of GPs and giving insights into the development of GPs as therapeutic biomaterials for many immunological diseases.

Coregulation of host-adapted metabolism and virulence by pathogenic yersiniae

Science.gov (United States)

Heroven, Ann Kathrin; Dersch, Petra

2014-01-01

Deciphering the principles how pathogenic bacteria adapt their metabolism to a specific host microenvironment is critical for understanding bacterial pathogenesis. The enteric pathogenic Yersinia species Yersinia pseudotuberculosis and Yersinia enterocolitica and the causative agent of plague, Yersinia pestis, are able to survive in a large variety of environmental reservoirs (e.g., soil, plants, insects) as well as warm-blooded animals (e.g., rodents, pigs, humans) with a particular preference for lymphatic tissues. In order to manage rapidly changing environmental conditions and interbacterial competition, Yersinia senses the nutritional composition during the course of an infection by special molecular devices, integrates this information and adapts its metabolism accordingly. In addition, nutrient availability has an impact on expression of virulence genes in response to C-sources, demonstrating a tight link between the pathogenicity of yersiniae and utilization of nutrients. Recent studies revealed that global regulatory factors such as the cAMP receptor protein (Crp) and the carbon storage regulator (Csr) system are part of a large network of transcriptional and posttranscriptional control strategies adjusting metabolic changes and virulence in response to temperature, ion and nutrient availability. Gained knowledge about the specific metabolic requirements and the correlation between metabolic and virulence gene expression that enable efficient host colonization led to the identification of new potential antimicrobial targets. PMID:25368845

Pathogen-group specific association between CXCR1 polymorphisms and subclinical mastitis in dairy heifers.

Science.gov (United States)

Verbeke, Joren; Piepers, Sofie; Peelman, Luc; Van Poucke, Mario; De Vliegher, Sarne

2012-08-01

The chemokine (C-X-C motif) receptor 1 (CXCR1) gene encodes the homonymous receptor for interleukin 8 (IL8) on polymorphonuclear neutrophilic leucocytes (PMNL). Binding causes migration from blood to milk, activation and prolonged survival of PMNL, a crucial process in the innate immune defence of the bovine mammary gland against invading mastitis-causing pathogens. The main objective of this study was to screen the entire coding region of the CXCR1 gene for polymorphisms and to analyse their association with udder health of dairy heifers. One-hundred-and-forty Belgian Holstein heifers originating from 20 commercial dairy farms were genotyped by DNA sequencing. Detailed phenotypic data on udder health was available including quarter bacteriological culture results and somatic cell count (SCC) in early lactation and composite milk SCC during first lactation. In total, 16 polymorphisms (including 8 missense mutations) were detected. Polymorphism c.980A>G was associated with pathogen-group specific IMI: heifers with genotype AG were less likely to have an IMI due to major mastitis pathogens compared with heifers with genotype GG but did not have less IMI by coagulase-negative staphylococci, so-called minor pathogens. CXCR1 genotype was neither associated with quarter SCC in early lactation nor with composite SCC during lactation. Although mastitis susceptibility is influenced by many factors, some genetic polymorphisms potentially have major effects on udder health of heifers, as was shown here. These results trigger us to further study the relationship between CXCR1 polymorphisms and mastitis susceptibility in both observational and experimental trials.

The Pathogen-Host Interactions database (PHI-base): additions and future developments.

Science.gov (United States)

Urban, Martin; Pant, Rashmi; Raghunath, Arathi; Irvine, Alistair G; Pedro, Helder; Hammond-Kosack, Kim E

2015-01-01

Rapidly evolving pathogens cause a diverse array of diseases and epidemics that threaten crop yield, food security as well as human, animal and ecosystem health. To combat infection greater comparative knowledge is required on the pathogenic process in multiple species. The Pathogen-Host Interactions database (PHI-base) catalogues experimentally verified pathogenicity, virulence and effector genes from bacterial, fungal and protist pathogens. Mutant phenotypes are associated with gene information. The included pathogens infect a wide range of hosts including humans, animals, plants, insects, fish and other fungi. The current version, PHI-base 3.6, available at http://www.phi-base.org, stores information on 2875 genes, 4102 interactions, 110 host species, 160 pathogenic species (103 plant, 3 fungal and 54 animal infecting species) and 181 diseases drawn from 1243 references. Phenotypic and gene function information has been obtained by manual curation of the peer-reviewed literature. A controlled vocabulary consisting of nine high-level phenotype terms permits comparisons and data analysis across the taxonomic space. PHI-base phenotypes were mapped via their associated gene information to reference genomes available in Ensembl Genomes. Virulence genes and hotspots can be visualized directly in genome browsers. Future plans for PHI-base include development of tools facilitating community-led curation and inclusion of the corresponding host target(s). © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Use of molecular hydrogen as an energy substrate by human pathogenic bacteria.

Science.gov (United States)

Maier, R J

2005-02-01

Molecular hydrogen is produced as a fermentation by-product in the large intestine of animals and its production can be correlated with the digestibility of the carbohydrates consumed. Pathogenic Helicobacter species (Helicobacter pylori and H. hepaticus) have the ability to use H(2) through a respiratory hydrogenase, and it was demonstrated that the gas is present in the tissues colonized by these pathogens (the stomach and the liver respectively of live animals). Mutant strains of H. pylori unable to use H(2) are deficient in colonizing mice compared with the parent strain. On the basis of available annotated gene sequence information, the enteric pathogen Salmonella, like other enteric bacteria, contains three putative membrane-associated H(2)-using hydrogenase enzymes. From the analysis of gene-targeted mutants it is concluded that each of the three membrane-bound hydrogenases of Salmonella enterica serovar Typhimurium are coupled with an H(2)-oxidizing respiratory pathway. From microelectrode probe measurements on live mice, H(2) could be detected at approx. 50 muM levels within the tissues (liver and spleen), which are colonized by Salmonella. The half-saturation affinity of whole cells of these pathogens for H(2) is much less than this, so it is expected that the (H(2)-utilizing) hydrogenase enzymes be saturated with the reducing substrate in vivo. All three enteric NiFe hydrogenase enzymes contribute to virulence of the bacterium in a typhoid fever-mouse model, and the combined removal of all three hydrogenases resulted in a strain that is avirulent and (in contrast with the parent strain) one that is not able to pass the intestinal tract to invade liver or spleen tissue. It is proposed that H(2) utilization and specifically its oxidation, coupled with a respiratory pathway, is required for energy production to permit growth and maintain efficient virulence of a number of pathogenic bacteria during infection of animals. These would be expected to include

Classic and New Animal Models of Parkinson's Disease

Directory of Open Access Journals (Sweden)

Javier Blesa

2012-01-01

Full Text Available Neurological disorders can be modeled in animals so as to recreate specific pathogenic events and behavioral outcomes. Parkinson’s Disease (PD is the second most common neurodegenerative disease of an aging population, and although there have been several significant findings about the PD disease process, much of this process still remains a mystery. Breakthroughs in the last two decades using animal models have offered insights into the understanding of the PD disease process, its etiology, pathology, and molecular mechanisms. Furthermore, while cellular models have helped to identify specific events, animal models, both toxic and genetic, have replicated almost all of the hallmarks of PD and are useful for testing new neuroprotective or neurorestorative strategies. Moreover, significant advances in the modeling of additional PD features have come to light in both classic and newer models. In this review, we try to provide an updated summary of the main characteristics of these models as well as the strengths and weaknesses of what we believe to be the most popular PD animal models. These models include those produced by 6-hydroxydopamine (6-OHDA, 1-methyl-1,2,3,6-tetrahydropiridine (MPTP, rotenone, and paraquat, as well as several genetic models like those related to alpha-synuclein, PINK1, Parkin and LRRK2 alterations.

Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum enables it to infect caterpillars.

Directory of Open Access Journals (Sweden)

Sibao Wang

2011-06-01

Full Text Available An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta cuticle, M. robertsii up-regulates a gene (Mest1 that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta, while virulence to grasshoppers (Melanoplus femurrubrum was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

Microbiological diagnosis and antimicrobial sensitivity profiles in diseased free-living raptors.

Science.gov (United States)

Vidal, Anna; Baldomà, Laia; Molina-López, Rafael A; Martin, Marga; Darwich, Laila

2017-08-01

Free-living raptors (birds of prey) can act as reservoirs of potentially zoonotic agents, but they also can be affected by microorganisms as target hosts. In this retrospective study, microbiological results (n = 663) and antibiotic sensitivity profiles (n = 108) of bacterial isolates were analysed from diseased free-living raptors. Sixty-nine percent of cases (n = 457) yielded bacteria: 58% were in pure culture and 42% were of different species. Remarkably, samples from necropsies (47%) had higher percentage of pure isolations than those obtained from clinical (31%) samples (P raptors (P 3 antimicrobials. Detection in wildlife of antimicrobial-resistant pathogens that might be significant at the animal-human-ecosystem interface is of great relevance under the 'One Health' approach.

Isolation and characterization of virus of highly pathogenic avian influenza H5 subtype of chicken from outbreaks in Indonesia

Directory of Open Access Journals (Sweden)

Agus Wiyono

2004-03-01

Full Text Available A study on the isolation and characterization of Highly Pathogenic Avian Influenza of chicken from outbreaks in Indonesia was conducted at Indonesian Research Institute for Veterinary Science. Outbreaks of avian disease had been reported in Indonesia since August 2003 affecting commercial layer, broiler, quail, and ostrich and also native chicken with showing clinical signs such as cyanosis of wattle and comb, nasal discharges and hypersalivation, subcutaneous ptechiae on foot and leg, diarre and sudden high mortality. The aim of this study is to isolate and characterize the causal agent of the disease. Samples of serum, feather follicle, tracheal swab, as well as organs of proventriculus, intestine, caecal tonsil, trachea and lungs were collected from infected animals. Serum samples were tested haemaglutination/haemaglutination inhibition to Newcastle Disease and Egg Drop Syndrome viruses. Isolation of virus of the causal agent of the outbreak was conducted from samples of feather follicle, tracheal swab, and organs using 11 days old specific pathogen free (SPF embryonated eggs. The isolated viruses were then characterised by agar gel precipitation test using swine influenza reference antisera, by haemaglutination inhibition using H1 to H15 reference antisera, and by electron microscope examination. The pathogenicity of the viruses was confirmed by intravenous pathogenicity index test and its culture in Chicken Embryo Fibroblast primary cell culture without addition of trypsin. The study revealed that the causative agent of the outbreaks of avian disease in Indonesia was avian influenza H5 subtype virus based upon serological tests, virus isolation and characterization using swine influenza reference antisera, and electron microscope examination. While subtyping of the viruses using H1 to H15 reference antisera suggested that the virus is very likely to be an avian influenza H5N1 subtype virus. The pathogenicity test confirmed that the viruses

Common and emerging infectious diseases in the animal shelter.

Science.gov (United States)

Pesavento, P A; Murphy, B G

2014-03-01

The beneficial role that animal shelters play is unquestionable. An estimated 3 to 4 million animals are cared for or placed in homes each year, and most shelters promote public health and support responsible pet ownership. It is, nonetheless, inevitable that shelters are prime examples of anthropogenic biological instability: even well-run shelters often house transient, displaced, and mixed populations of animals. Many of these animals have received minimal to no prior health care, and some have a history of scavenging or predation to survive. Overcrowding and poor shelter conditions further magnify these inherent risks to create individual, intraspecies, and interspecies stress and provide an environment conducive to exposure to numerous potentially collaborative pathogens. All of these factors can contribute to the evolution and emergence of new pathogens or to alterations in virulence of endemic pathogens. While it is not possible to effectively anticipate the timing or the pathogen type in emergence events, their sites of origin are less enigmatic, and pathologists and diagnosticians who work with sheltered animal populations have recognized several such events in the past decade. This article first considers the contribution of the shelter environment to canine and feline disease. This is followed by summaries of recent research on the pathogenesis of common shelter pathogens, as well as research that has led to the discovery of novel or emerging diseases and the methods that are used for their diagnosis and discovery. For the infectious agents that commonly affect sheltered dogs and cats, including canine distemper virus, canine influenza virus, Streptococcus spp, parvoviruses, feline herpesvirus, feline caliciviruses, and feline infectious peritonitis virus, we present familiar as well as newly recognized lesions associated with infection. Preliminary studies on recently discovered viruses like canine circovirus, canine bocavirus, and feline norovirus

Challenges of influenza A viruses in humans and animals and current animal vaccines as an effective control measure

Science.gov (United States)

2018-01-01

Influenza A viruses (IAVs) are genetically diverse and variable pathogens that share various hosts including human, swine, and domestic poultry. Interspecies and intercontinental viral spreads make the ecology of IAV more complex. Beside endemic IAV infections, human has been exposed to pandemic and zoonotic threats from avian and swine influenza viruses. Animal health also has been threatened by high pathogenic avian influenza viruses (in domestic poultry) and reverse zoonosis (in swine). Considering its dynamic interplay between species, prevention and control against IAV should be conducted effectively in both humans and animal sectors. Vaccination is one of the most efficient tools against IAV. Numerous vaccines against animal IAVs have been developed by a variety of vaccine technologies and some of them are currently commercially available. We summarize several challenges in control of IAVs faced by human and animals and discuss IAV vaccines for animal use with those application in susceptible populations. PMID:29399575

Highly pathogenic avian influenza virus (H5N1) in experimentally infected adult mute swans.

Science.gov (United States)

Kalthoff, Donata; Breithaupt, Angele; Teifke, Jens P; Globig, Anja; Harder, Timm; Mettenleiter, Thomas C; Beer, Martin

2008-08-01

Adult, healthy mute swans were experimentally infected with highly pathogenic avian influenza virus A/Cygnus cygnus/Germany/R65/2006 subtype H5N1. Immunologically naive birds died, whereas animals with preexisting, naturally acquired avian influenza virus-specific antibodies became infected asymptomatically and shed virus. Adult mute swans are highly susceptible, excrete virus, and can be clinically protected by preexposure immunity.

Luciferase-Specific Coelenterazine Analogues for Optical Contamination-Free Bioassays.

Science.gov (United States)

Nishihara, Ryo; Abe, Masahiro; Nishiyama, Shigeru; Citterio, Daniel; Suzuki, Koji; Kim, Sung Bae

2017-04-19

Spectral overlaps among the multiple optical readouts commonly cause optical contamination in fluorescence and bioluminescence. To tackle this issue, we created five-different lineages of coelenterazine (CTZ) analogues designed to selectively illuminate a specific luciferase with unique luciferase selectivity. In the attempt, we found that CTZ analogues with ethynyl or styryl groups display dramatically biased bioluminescence to specific luciferases and pHs by modifying the functional groups at the C-2 and C-6 positions of the imidazopyradinone backbone of CTZ. The optical contamination-free feature was exemplified with the luciferase-specific CTZ analogues, which illuminated anti-estrogenic and rapamycin activities in a mixture of optical probes. This unique bioluminescence platform has great potential for specific and high throughput imaging of multiple optical readouts in bioassays without optical contamination.

Pathogen inactivation in liquid dairy manure during anaerobic and aerobic digestions

Science.gov (United States)

Biswas, S.; Pandey, P.; Castillo, A. R.; Vaddella, V. K.

2014-12-01

Controlling manure-borne pathogens such as E. coli O157:H7, Salmonella spp. and Listeria monocytogenes are crucial for protecting surface and ground water as well as mitigating risks to human health. In California dairy farms, flushing of dairy manure (mainly animal feces and urine) from freestall barns and subsequent liquid-solid manure separation is a common practice for handling animal waste. The liquid manure fraction is generally pumped into the settling ponds and it goes into aerobic and/or anaerobic lagoons for extended period of time. Considering the importance of controlling pathogens in animal waste, the objective of the study was to understand the effects of anaerobic and aerobic digestions on the survival of three human pathogens in animal waste. The pathogen inactivation was assessed at four temperatures (30, 35, 42, and 50 °C), and the relationships between temperature and pathogen decay were estimated. Results showed a steady decrease of E. coli levels in aerobic and anaerobic digestion processes over the time; however, the decay rates varied with pathogens. The effect of temperature on Salmonella spp. and Listeria monocytogenes survival was different than the E. coli survival. In thermophilic temperatures (42 and 50 °C), decay rate was considerable greater compared to the mesophilic temperatures (30 and 35°C). The E. coli log reductions at 50 °C were 2.1 in both aerobic and anaerobic digestions after 13 days of incubation. The Salmonella spp. log reductions at 50 °C were 5.5 in aerobic digestion, and 5.9 in anaerobic digestion. The Listeria monocytogenes log reductions at 50 °C were 5.0 in aerobic digestion, and 5.6 in anaerobic digestion. The log reduction of E. coli, Salmonella spp., and Listeria monocytogens at 30 °C in aerobic environment were 0.1, 4.7, and 5.6, respectively. In anaerobic environment, the corresponding reductions were 0.4, 4.3, and 5.6, respectively. We anticipate that the outcomes of the study will help improving the

Animal health risk of legally imported exotic animals into the Netherlands in the period 2013-2014

NARCIS (Netherlands)

Vos-de Jong, de Clazien; Swanenburg, Manon; Tafro, Nedzib; Roon, van Annika; Stenvers, Olaf F.J.; Elbers, Armin R.W.

2017-01-01

The worldwide trade in exotic animals is a potential moderator for the global dispersion of infectious disease agents. Better insight into the pathogens that could be introduced by these trade flows can help to target surveillance efforts. The aim of this study was to evaluate the animal health risk

9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...

Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

Science.gov (United States)

2014-01-01

Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

The need for a holistic view on disease problems in free-range chickens

International Nuclear Information System (INIS)

Permin, A.; Pedersen, G.

2002-01-01

In contrast to modern poultry production, village-based poultry production is often characterised by a range of diseases occurring at the same time. Most often free-range poultry have sub-clinical infections with a high number of endo- and ecto-parasites. The significance of these infections is not known in detail, but there are some indications that parasites have an immuno-suppressive effect on the animals thus enhancing the pathogenicity of other diseases. Further, it is postulated that other diseases than Newcastle disease (ND) are present in free-range poultry production systems and that a successful development of this production system is only achieved when the exact causes of death and the effect of concurrent diseases are known. (author)

RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

Directory of Open Access Journals (Sweden)

A. Y. Prosekov

2016-01-01

Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

Potential human pathogenic bacteria in a mixed urban watershed as revealed by pyrosequencing.

Directory of Open Access Journals (Sweden)

A Mark Ibekwe

Full Text Available Current microbial source tracking (MST methods for water depend on testing for fecal indicator bacterial counts or specific marker gene sequences to identify fecal contamination where potential human pathogenic bacteria could be present. In this study, we applied 454 high-throughput pyrosequencing to identify bacterial pathogen DNA sequences, including those not traditionally monitored by MST and correlated their abundances to specific sources of contamination such as urban runoff and agricultural runoff from concentrated animal feeding operations (CAFOs, recreation park area, waste-water treatment plants, and natural sites with little or no human activities. Samples for pyrosequencing were surface water, and sediment collected from 19 sites. A total of 12,959 16S rRNA gene sequences with average length of ≤400 bp were obtained, and were assigned to corresponding taxonomic ranks using ribosomal database project (RDP, Classifier and Greengenes databases. The percent of total potential pathogens were highest in urban runoff water (7.94%, agricultural runoff sediment (6.52%, and Prado Park sediment (6.00%, respectively. Although the numbers of DNA sequence tags from pyrosequencing were very high for the natural site, corresponding percent potential pathogens were very low (3.78-4.08%. Most of the potential pathogenic bacterial sequences identified were from three major phyla, namely, Proteobacteria, Bacteroidetes, and Firmicutes. The use of deep sequencing may provide improved and faster methods for the identification of pathogen sources in most watersheds so that better risk assessment methods may be developed to enhance public health.

Electrochemical Methodologies for the Detection of Pathogens.

Science.gov (United States)

Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

2018-05-25

Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current

Parasites and pathogens of ticks ( Rhipicephalus species Acari ...

African Journals Online (AJOL)

The interaction of ticks with its environment as well as its natural hosts predisposes it to acquiring pathogens that could pose animal and human health risks. Identifying these pathogens could alert dog owners and others to reassess the predisposing factors and ensure control. The aim of the study was to identify the species ...

Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Rajeswaran Radhakrishnan

2017-12-01

Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

Elucidation of biocontrol mechanisms of Trichoderma harzianum against different plant fungal pathogens: Universal yet host specific response.

Science.gov (United States)

Sharma, Vivek; Salwan, Richa; Sharma, Prem N; Kanwar, S S

2017-02-01

In the present study, different transcripts of Trichoderma harzianum ThHP-3 were evaluated for their response against four fungal pathogens Fusarium oxysporum, Colletotrichum capsici, Colletotrichum truncatum and Gloesercospora sorghi using RT-qPCR. The time course study of T. harzianum transcripts related to signal transduction, lytic enzymes, secondary metabolites and various transporters revealed variation in expression against four fungal pathogens. In a broader term, the transcripts were upregulated at various time intervals but the optimum expression of cyp3, abc, nrp, tga1, pmk, ech42 and glh20 varied with respect to host fungi. Additionally, the expression of transcripts related to transporters/cytochromes was also observed against Fusarium oxysporum after 96h whereas transcripts related to secondary metabolites and lytic enzymes showed significant difference in expression against Colletotrichum spp. from 72 to 96h. This is first study on transcriptomic response of T. harzianum against pathogenic fungi which shows their host specific response. Copyright © 2016 Elsevier B.V. All rights reserved.

Consensus report on the future of animal-free systemic toxicity testing.

Science.gov (United States)

Leist, Marcel; Hasiwa, Nina; Rovida, Costanza; Daneshian, Mardas; Basketter, David; Kimber, Ian; Clewell, Harvey; Gocht, Tilman; Goldberg, Alan; Busquet, Francois; Rossi, Anna-Maria; Schwarz, Michael; Stephens, Martin; Taalman, Rob; Knudsen, Thomas B; McKim, James; Harris, Georgina; Pamies, David; Hartung, Thomas

2014-01-01

Since March 2013, animal use for cosmetics testing for the European market has been banned. This requires a renewed view on risk assessment in this field. However, in other fields as well, traditional animal experimentation does not always satisfy requirements in safety testing, as the need for human-relevant information is ever increasing. A general strategy for animal-free test approaches was outlined by the US National Research Council`s vision document for Toxicity Testing in the 21st Century in 2007. It is now possible to provide a more defined roadmap on how to implement this vision for the four principal areas of systemic toxicity evaluation: repeat dose organ toxicity, carcinogenicity, reproductive toxicity and allergy induction (skin sensitization), as well as for the evaluation of toxicant metabolism (toxicokinetics) (Fig. 1). CAAT-Europe assembled experts from Europe, America and Asia to design a scientific roadmap for future risk assessment approaches and the outcome was then further discussed and refined in two consensus meetings with over 200 stakeholders. The key recommendations include: focusing on improving existing methods rather than favoring de novo design; combining hazard testing with toxicokinetics predictions; developing integrated test strategies; incorporating new high content endpoints to classical assays; evolving test validation procedures; promoting collaboration and data-sharing of different industrial sectors; integrating new disciplines, such as systems biology and high throughput screening; and involving regulators early on in the test development process. A focus on data quality, combined with increased attention to the scientific background of a test method, will be important drivers. Information from each test system should be mapped along adverse outcome pathways. Finally, quantitative information on all factors and key events will be fed into systems biology models that allow a probabilistic risk assessment with flexible

Pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status

OpenAIRE

O. Skyba

2017-01-01

Exploring the mechanisms of vegetative regulation in children and adolescents of different somatotypes has a prognostic value in regard to the character of adaptive reactions of the organism, as it facilitates the identification of the risk factors of pathological processes and states of vegetative systems, which may cause chronic illness in adulthood. The author defines the pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status....

The gut microbiome restores intrinsic and extrinsic nerve function in germ-free mice accompanied by changes in calbindin.

Science.gov (United States)

McVey Neufeld, K A; Perez-Burgos, A; Mao, Y K; Bienenstock, J; Kunze, W A

2015-05-01

The microbiome is essential for normal myenteric intrinsic primary afferent neuron (IPAN) excitability. These neurons control gut motility and modulate gut-brain signaling by exciting extrinsic afferent fibers innervating the enteric nervous system via an IPAN to extrinsic fiber sensory synapse. We investigated effects of germ-free (GF) status and conventionalization on extrinsic sensory fiber discharge in the mesenteric nerve bundle and IPAN electrophysiology, and compared these findings with those from specific pathogen-free (SPF) mice. As we have previously shown that the IPAN calcium-dependent slow afterhyperpolarization (sAHP) is enhanced in GF mice, we also examined the expression of the calcium-binding protein calbindin in these neurons in these different animal groups. IPAN sAHP and mesenteric nerve multiunit discharge were recorded using ex vivo jejunal gut segments from SPF, GF, or conventionalized (CONV) mice. IPANs were excited by adding 5 μM TRAM-34 to the serosal superfusate. We probed for calbindin expression using immunohistochemical techniques. SPF mice had a 21% increase in mesenteric nerve multiunit firing rate and CONV mice a 41% increase when IPANs were excited by TRAM-34. For GF mice, this increase was barely detectable (2%). TRAM-34 changed sAHP area under the curve by -77 for SPF, +3 for GF, or -54% for CONV animals. Calbindin-immunopositive neurons per myenteric ganglion were 36% in SPF, 24% in GF, and 52% in CONV animals. The intact microbiome is essential for normal intrinsic and extrinsic nerve function and gut-brain signaling. © 2015 John Wiley & Sons Ltd.

Yeast pro- and paraprobiotics have the capability to bind pathogenic bacteria associated with animal disease

Science.gov (United States)

Live yeast probiotics and yeast cell wall components (paraprobiotics) may serve as an alternative to the use of antibiotics in prevention and treatment of infections caused by pathogenic bacteria. Probiotics and paraprobiotics can bind directly to pathogens, which limits binding of the pathogens to ...

Time series modeling of pathogen-specific disease probabilities with subsampled data.

Science.gov (United States)

Fisher, Leigh; Wakefield, Jon; Bauer, Cici; Self, Steve

2017-03-01

Many diseases arise due to exposure to one of multiple possible pathogens. We consider the situation in which disease counts are available over time from a study region, along with a measure of clinical disease severity, for example, mild or severe. In addition, we suppose a subset of the cases are lab tested in order to determine the pathogen responsible for disease. In such a context, we focus interest on modeling the probabilities of disease incidence given pathogen type. The time course of these probabilities is of great interest as is the association with time-varying covariates such as meteorological variables. In this set up, a natural Bayesian approach would be based on imputation of the unsampled pathogen information using Markov Chain Monte Carlo but this is computationally challenging. We describe a practical approach to inference that is easy to implement. We use an empirical Bayes procedure in a first step to estimate summary statistics. We then treat these summary statistics as the observed data and develop a Bayesian generalized additive model. We analyze data on hand, foot, and mouth disease (HFMD) in China in which there are two pathogens of primary interest, enterovirus 71 (EV71) and Coxackie A16 (CA16). We find that both EV71 and CA16 are associated with temperature, relative humidity, and wind speed, with reasonably similar functional forms for both pathogens. The important issue of confounding by time is modeled using a penalized B-spline model with a random effects representation. The level of smoothing is addressed by a careful choice of the prior on the tuning variance. © 2016, The International Biometric Society.

Coregulation of host-adapted metabolism and virulence by pathogenic yersiniae

Directory of Open Access Journals (Sweden)

Ann Kathrin eHeroven

2014-10-01

Full Text Available Deciphering the principles how pathogenic bacteria adapt their metabolism to a specific host microenvironment is critical for understanding bacterial pathogenesis. The enteric pathogenic Yersinia species Y. pseudotuberculosis and Y. enterocolitica and the causative agent of plague, Y. pestis, are able to survive in a large variety of environmental reservoirs (e.g. soil, plants, insects as well as warm-blooded animals (e.g. rodents, pigs, humans with a particular preference for lymphatic tissues. In order to manage rapidly changing environmental conditions and inter-bacterial competition, Yersinia senses the nutritional composition during the course of an infection by special molecular devices, integrates this information and adapts its metabolism accordingly. In addition, nutrient availability has an impact on expression of virulence genes in response to C-sources, demonstrating a tight link between the pathogenicity of yersiniae and utilization of nutrients. Recent studies revealed that global regulatory factors such as the cAMP receptor protein (Crp and the carbon storage regulator (Csr system are part of a large network of transcriptional and posttranscriptional control strategies adjusting metabolic changes and virulence in response to temperature, ion and nutrient availability. Gained knowledge about the specific metabolic requirements and the correlation between metabolic and virulence gene expression that enable efficient host colonization led to the identification of new potential antimicrobial targets.

77 FR 58021 - New Animal Drugs for Use in Animal Feeds; Monensin

Science.gov (United States)

2012-09-19

... [Docket No. FDA-2012-N-0002] New Animal Drugs for Use in Animal Feeds; Monensin AGENCY: Food and Drug... amending the animal drug regulations to remove a warning for growing cattle on pasture or in dry lot and to... . SUPPLEMENTARY INFORMATION: FDA has noticed that the animal drug regulations for certain monensin free-choice...

Animal welfare: an animal science approach.

Science.gov (United States)

Koknaroglu, H; Akunal, T

2013-12-01

Increasing world population and demand for animal-derived protein puts pressure on animal production to meet this demand. For this purpose animal breeding efforts were conducted to obtain the maximum yield that the genetic makeup of the animals permits. Under the influence of economics which is the driving force behind animal production, animal farming became more concentrated and controlled which resulted in rearing animals under confinement. Since more attention was given on economics and yield per animal, animal welfare and behavior were neglected. Animal welfare which can be defined as providing environmental conditions in which animals can display all their natural behaviors in nature started gaining importance in recent years. This does not necessarily mean that animals provided with good management practices would have better welfare conditions as some animals may be distressed even though they are in good environmental conditions. Consumers are willing to pay more for welfare-friendly products (e.g.: free range vs caged egg) and this will change the animal production practices in the future. Thus animal scientists will have to adapt themselves for the changing animal welfare rules and regulations that differ for farm animal species and countries. In this review paper, animal welfare is discussed from an animal science standpoint. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Campylobacteriosis, Salmonellosis, Yersiniosis, and Listeriosis as Zoonotic Foodborne Pathogens: A Review

Directory of Open Access Journals (Sweden)

Agnieszka Chlebicz

2018-04-01

Full Text Available Zoonoses are diseases transmitted from animals to humans, posing a great threat to the health and life of people all over the world. According to WHO estimations, 600 million cases of diseases caused by contaminated food were noted in 2010, including almost 350 million caused by pathogenic bacteria. Campylobacter, Salmonella, as well as Yersinia enterocolitica and Listeria monocytogenes may dwell in livestock (poultry, cattle, and swine but are also found in wild animals, pets, fish, and rodents. Animals, often being asymptomatic carriers of pathogens, excrete them with faeces, thus delivering them to the environment. Therefore, pathogens may invade new individuals, as well as reside on vegetables and fruits. Pathogenic bacteria also penetrate food production areas and may remain there in the form of a biofilm covering the surfaces of machines and equipment. A common occurrence of microbes in food products, as well as their improper or careless processing, leads to common poisonings. Symptoms of foodborne infections may be mild, sometimes flu-like, but they also may be accompanied by severe complications, some even fatal. The aim of the paper is to summarize and provide information on campylobacteriosis, salmonellosis, yersiniosis, and listeriosis and the aetiological factors of those diseases, along with the general characteristics of pathogens, virulence factors, and reservoirs.

Post-translational modification of host proteins in pathogen-triggered defence signalling in plants

NARCIS (Netherlands)

Stulemeijer, I.J.E.; Joosten, M.H.A.J.

2008-01-01

Microbial plant pathogens impose a continuous threat to global food production. Similar to animals, an innate immune system allows plants to recognize pathogens and swiftly activate defence. To activate a rapid response, receptor-mediated pathogen perception and subsequent downstream signalling

FishPathogens.eu a new database in the research of aquatic animal diseases

DEFF Research Database (Denmark)

Jonstrup, Søren Peter; Gray, T.; Olesen, Niels Jørgen

Virus (KHV). The database design is based on freeware and could easily be implemented to include pathogens relevant for other species than fish. We present the database using the data on the different fish pathogens as example. However if some are interested in the platform we are happy to cooperate...... and share the database structure with other Epizone members....

Reagent-free bacterial identification using multivariate analysis of transmission spectra

Science.gov (United States)

Smith, Jennifer M.; Huffman, Debra E.; Acosta, Dayanis; Serebrennikova, Yulia; García-Rubio, Luis; Leparc, German F.

2012-10-01

The identification of bacterial pathogens from culture is critical to the proper administration of antibiotics and patient treatment. Many of the tests currently used in the clinical microbiology laboratory for bacterial identification today can be highly sensitive and specific; however, they have the additional burdens of complexity, cost, and the need for specialized reagents. We present an innovative, reagent-free method for the identification of pathogens from culture. A clinical study has been initiated to evaluate the sensitivity and specificity of this approach. Multiwavelength transmission spectra were generated from a set of clinical isolates including Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus. Spectra of an initial training set of these target organisms were used to create identification models representing the spectral variability of each species using multivariate statistical techniques. Next, the spectra of the blinded isolates of targeted species were identified using the model achieving >94% sensitivity and >98% specificity, with 100% accuracy for P. aeruginosa and S. aureus. The results from this on-going clinical study indicate this approach is a powerful and exciting technique for identification of pathogens. The menu of models is being expanded to include other bacterial genera and species of clinical significance.

Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

Science.gov (United States)

Fernández-Alarcón, Claudia; Singer, Randall S; Johnson, Timothy J

2011-01-01

Incompatibility group A/C (IncA/C) plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR) phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2) gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2) plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

Directory of Open Access Journals (Sweden)

Claudia Fernández-Alarcón

Full Text Available Incompatibility group A/C (IncA/C plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2 gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2 plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

Free-zone electrophoresis of animal cells. 1: Experiments on cell-cell interactions

Science.gov (United States)

Todd, P. W.; Hjerten, S.

1985-01-01

The electrophoretically migrating zones wasa monitored. The absence of fluid flows in the direction of migration permits direct measurement of electrophoretic velocities of any material. Sedimentation is orthogonal to electrokinetic motion and the effects of particle-particle interaction on electrophoretic mobility is studied by free zone electrophoresis. Fixed erythrocytes at high concentrations, mixtures of fixed erythrocytes from different animal species, and mixtures of cultured human cells were studied in low ionic strength buffers. The electrophoretic velocity of fixed erythrocytes was not altered by increasing cell concentration or by the mixing of erythrocytes from different species. When zones containing cultured human glial cells and neuroblastoma cells are permitted to interact during electrophoresis, altered migration patterns occur. It is found that cell-cell interactions depends upon cell type.

Nucleic-acid testing, new platforms and nanotechnology for point-of-decision diagnosis of animal pathogens.

Science.gov (United States)

Teles, Fernando; Fonseca, Luís

2015-01-01

Accurate disease diagnosis in animals is crucial for animal well-being but also for preventing zoonosis transmission to humans. In particular, livestock diseases may constitute severe threats to humans due to the particularly high physical contact and exposure and, also, be the cause of important economic losses, even in non-endemic countries, where they often arise in the form of rapid and devastating epidemics. Rapid diagnostic tests have been used for a long time in field situations, particularly during outbreaks. However, they mostly rely on serological approaches, which may confirm the exposure to a particular pathogen but may be inappropriate for point-of-decision (point-of-care) settings when emergency responses supported on early and accurate diagnosis are required. Moreover, they often exhibit modest sensitivity and hence significantly depend on later result confirmation in central or reference laboratories. The impressive advances observed in recent years in materials sciences and in nanotechnology, as well as in nucleic-acid synthesis and engineering, have led to an outburst of new in-the-bench and prototype tests for nucleic-acid testing towards point-of-care diagnosis of genetic and infectious diseases. Manufacturing, commercial, regulatory, and technical nature issues for field applicability more likely have hindered their wider entrance into veterinary medicine and practice than have fundamental science gaps. This chapter begins by outlining the current situation, requirements, difficulties, and perspectives of point-of-care tests for diagnosing diseases of veterinary interest. Nucleic-acid testing, particularly for the point of care, is addressed subsequently. A range of valuable signal transduction mechanisms commonly employed in proof-of-concept schemes and techniques born on the analytical chemistry laboratories are also described. As the essential core of this chapter, sections dedicated to the principles and applications of microfluidics, lab

Free-grazing ducks and highly pathogenic avian influenza, Thailand

NARCIS (Netherlands)

Gilbert, Marius; Chaitaweesup, P.; Parakamawongsa, T.; Premashthira, S.; Tiensin, T.; Kalpravidh, W.; Wagner, H.; Slingenbergh, J.

Thailand has recently had 3 epidemic waves of highly pathogenic avian influenza (HPAI); virus was again detected in July 2005. Risk factors need to be identified to better understand disease ecology and assist HPAI surveillance and detection. This study analyzed the spatial distribution of HPAI

Influence of indigenous microbiota on experimental toxoplasmosis in conventional and germ-free mice.

Science.gov (United States)

Nascimento, Bruna B; Cartelle, Christiane T; Noviello, Maria de L; Pinheiro, Breno V; de Almeida Vitor, Ricardo W; Souza, Danielle da G; de Vasconcelos Generoso, Simone; Cardoso, Valbert N; Martins, Flaviano Dos S; Nicoli, Jacques R; Arantes, Rosa M E

2017-08-01

Toxoplasmosis represents one of the most common zoonoses worldwide. Its agent, Toxoplasma gondii, causes a severe innate pro-inflammatory response. The indigenous intestinal microbiota promotes host animal homoeostasis and may protect the host against pathogens. Germ-free (GF) animals provide an important tool for the study of interactions between host and microbiota. In this study, we assessed the role of indigenous microorganisms in disease development utilizing a murine toxoplasmosis model, which includes conventional (CV) and GF NIH Swiss mice. CV and GF mice orally inoculated with T. gondii had similar survival curves. However, disease developed differently in the two animal groups. In CV mice, intestinal permeability increased and levels of intestinal pro-inflammatory cytokines were altered. In GF animals, there were discrete epithelial degenerative changes and mucosal oedema, but the liver and lungs displayed significant lesions. We conclude that, despite similar survival curves, CV animals succumb to an exaggerated inflammatory response, whereas GF mice fail to produce an adequate systemic response. © 2017 The Authors. International Journal of Experimental Pathology © 2017 International Journal of Experimental Pathology.

Potatoes, pathogens and pests

NARCIS (Netherlands)

Lazebnik, Jenny

2017-01-01

Currently, fungicides are necessary to protect potato crops against late blight, Phytophthora infestans, one of the world’s most damaging crop pathogens. The introgression of plant resistance genes from wild potato species targeted specifically to the late blight pathogen into

Vancomycin resistant enterococci in farm animals – occurrence and importance

Directory of Open Access Journals (Sweden)

Oskar Nilsson

2012-04-01

Full Text Available The view on enterococci has over the years shifted from harmless commensals to opportunistic but important pathogens mainly causing nosocomial infections. One important part of this development is the emergence of vancomycin resistance enterococci (VRE. The term VRE includes several combinations of bacterial species and resistance genes of which the most clinically important is Enterococcus faecium with vanA type vancomycin resistance. This variant is also the most common VRE among farm animals. The reason for VRE being present among farm animals is selection by extensive use of the vancomycin analog avoparcin for growth promotion. Once the use of avoparcin was discontinued, the prevalence of VRE among farm animals decreased. However, VRE are still present among farm animals and by spread via food products they could potentially have a negative impact on public health. This review is based on the PhD thesis Vancomycin Resistant Enterococci in Swedish Broilers – Emergence, Epidemiology and Elimination and makes a short summary of VRE in humans and food producing animals. The specific situation regarding VRE in Swedish broiler production is also mentioned.

Rhodococcus equi: the many facets of a pathogenic actinomycete.

Science.gov (United States)

Vázquez-Boland, José A; Giguère, Steeve; Hapeshi, Alexia; MacArthur, Iain; Anastasi, Elisa; Valero-Rello, Ana

2013-11-29

Rhodococcus equi is a soil-dwelling pathogenic actinomycete that causes pulmonary and extrapulmonary pyogranulomatous infections in a variety of animal species and people. Young foals are particularly susceptible and develop a life-threatening pneumonic disease that is endemic at many horse-breeding farms worldwide. R. equi is a facultative intracellular parasite of macrophages that replicates within a modified phagocytic vacuole. Its pathogenicity depends on a virulence plasmid that promotes intracellular survival by preventing phagosome-lysosome fusion. Species-specific tropism of R. equi for horses, pigs and cattle appears to be determined by host-adapted virulence plasmid types. Molecular epidemiological studies of these plasmids suggest that human R. equi infection is zoonotic. Analysis of the recently determined R. equi genome sequence has identified additional virulence determinants on the bacterial chromosome. This review summarizes our current understanding of the clinical aspects, biology, pathogenesis and immunity of this fascinating microbe with plasmid-governed infectivity. Copyright © 2013 Elsevier B.V. All rights reserved.

A rapid and specific detection of pathogenic serovar Salmonella typhimurium by loop-mediated isothermal amplification method (LAMP

Directory of Open Access Journals (Sweden)

Hadi Ravan

2017-09-01

Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.

Identification of Acinetobacter baumannii of Human and Animal Origins by a Gene-Specific PCR.

Science.gov (United States)

Hamouda, Ahmed

2017-09-01

Acinetobacter baumannii is a notorious nosocomial pathogen known for its ability to cause severe infections, especially in intensive care units. The identification of a conserved gene encoding a hypothetical protein in A. baumannii isolates but not in other Acinetobacter species during a comparative genomic analysis was reported. For the purpose of this study, we call this gene, A.b_hyp gene. The aim of this study was to report the results of screening for the presence of the A.b_hyp gene in a worldwide collection of well-characterized A. baumannii collected from clinical and animal specimens. A total of 83 clinical, animal, and type strains were used. These comprised 73 A. baumannii isolates of clinical (n = 60) and animal origin (n = 13), and ten type strains, including a positive control strain, A. baumannii ATCC 19606. All isolates were examined by PCR amplification of the A.b_hyp gene. The A.b_hyp gene was detected in 72 isolates (99%) of A. baumannii but one clinical isolate failed to produce an amplicon. The control strain, A. baumannii ATCC 19606, was also positive for this gene. No bands were detected in non-A. baumannii species and therefore the isolates are thought to be negative for the gene. No bands were detected in non-A. baumannii isolates and therefore they are thought to be negative for the gene. The PCR A.b_ hyp method provides evidence that detection of this gene can be used as a reliable, easy, and low-cost biomarker for A. baumannii identification.

77 FR 44107 - Information From Foreign Regions Applying for Recognition of Animal Health Status

Science.gov (United States)

2012-07-27

...We are amending the regulations that govern the importation of animals and animal products by consolidating the list of factors APHIS considers when evaluating the animal health status of a foreign region and by setting out new factors APHIS will consider when evaluating a region as historically free of a specific disease. These changes will make clearer the types of information APHIS needs from a requesting region in order to conduct an evaluation.

Exposure to selected Pathogens in to selected pathogens in Geoffroy's cats and domestic carnivores from central Argentina.

Science.gov (United States)

Uhart, Marcela M; Rago, M Virginia; Marull, Carolina A; Ferreyra, Hebe del Valle; Pereira, Javier A

2012-10-01

Wild carnivores share a high percentage of parasites and viruses with closely related domestic carnivores. Because of increased overlap and potential contact with domestic species, we conducted a retrospective serosurvey for 11 common carnivore pathogens in 40 Geoffroy's cats (Leopardus geoffroyi) sampled between 2000 and 2008 within or near two protected areas in central Argentina (Lihué Calel National Park, La Pampa, and Campos del Tuyú National Park, Buenos Aires), as well as five domestic cats and 11 domestic dogs from catde ranches adjacent to Lihué Calel Park. Geoffroy's cats had detectable antibody to canine distemper virus (CDV), feline calicivirus (FCV), feline coronavirus, feline panleukopenia virus (FPV), Toxoplasma gondii, Leptospira interrogans (serovars Ictero/Icter and Ballum), and Dirofilaria immitis. None of the wild cats had antibodies to feline herpesvirus, feline immunodeficiency virus (FIV), feline leukemia virus, or rabies virus. Domestic dogs had antibodies to CDV, canine adenovirus, canine herpesvirus, and canine parvovirus. Antibodies to FPV, FCV, FIV, and T. gondii were found in domestic cats. We provide the first data on exposure of free-ranging Geoffroy's cats to pathogens at two sites within the core area of the species distribution range, including the first report of antibodies to CDV in this species. We encourage continued monitoring for diseases in wild and domestic carnivores as well as preventive health care for domestic animals, particularly in park buffer zones where overlap is greatest.

RAPD-based genotyping of Malassezia pachydermatis from Domestic and wild animals

Directory of Open Access Journals (Sweden)

Franciele Cristina Kagueyama

2016-10-01

Full Text Available Malassezia pachydermatis (M. pachydermatis is a fungus of importance in human and veterinary medicine. Although a part of the normal microbiota, it can sometimes be present in its pathogenic form, particularly causing otitis and dermatitis in animals. Among human beings, it mainly affects immune compromised patients and newborns, causing simple pustulosis, seborrheic dermatitis, tinea versicolor or fungemia. This study aimed to analyze the genomic polymorphism in M. pachydermatis samples isolated from Canis familiaris (domestic dog, Felis catus (domestic cat, and Myrmecophaga tridactyla (giant anteater. Two hundred and fourteen samples were collected and cultured in Sabouraud agar with chloranphenicol (100mg L-1 and incubated at 37 °C for a period of 7 to 10 days. One hundred and sixty six samples that appeared morphologically comparable to yeast cultures were processed for DNA extraction and PCR was performed for a specific region in the Internal Transcribed Spacer (ITS of M. pachydermatis. Among these, seven (4.21% were negative and 159 (95.79% were positive. Of the 159 positive samples, 102 (64.15% were from animals with clinical signs and 57 (35.85% without clinical signs. Fifty-seven samples were selected at random for RAPD-PCR based genotyping and distributed into four genetic groups. Types I and II were more frequent in animals with clinical signs while type III was frequent in healthy animals. Type IV occurred evenly across animals with or without clinical signs. These results indicate differences in pathogenicity of the fungus based on the genotype.

CAD or MAD? Anger (not disgust) as the predominant response to pathogen-free violations of the divinity code.

Science.gov (United States)

Royzman, Edward; Atanasov, Pavel; Landy, Justin F; Parks, Amanda; Gepty, Andrew

2014-10-01

The CAD triad hypothesis (Rozin, Lowery, Imada, & Haidt, 1999) stipulates that, cross-culturally, people feel anger for violations of autonomy, contempt for violations of community, and disgust for violations of divinity. Although the disgust-divinity link has received some measure of empirical support, the results have been difficult to interpret in light of several conceptual and design flaws. Taking a revised methodological approach, including use of newly validated (Study 1), pathogen-free violations of the divinity code, we found (Study 2) little evidence of disgust-related phenomenology (nausea, gagging, loss of appetite) or action tendency (desire to move away), but much evidence of anger-linked desire to retaliate, as a major component of individuals' projected response to "pure" (pathogen-free) violations of the divinity code. Study 3 replicated these results using faces in lieu of words as a dependent measure. Concordant findings emerged from an archival study (Study 4) examining the aftermath of a real-life sacred violation-the burning of Korans by U.S. military personnel. Study 5 further corroborated these results using continuous measures based on everyday emotion terms and new variants of the divinity-pure scenarios featuring sacrilegious acts committed by a theologically irreverent member of one's own group rather than an ideologically opposed member of another group. Finally, a supplemental study found the anger-dominant attribution pattern to remain intact when the impious act being judged was the judge's own. Based on these and related results, we posit anger to be the principal emotional response to moral transgressions irrespective of the normative content involved. PsycINFO Database Record (c) 2014 APA, all rights reserved.

Molecular detection of pathogens in water--the pros and cons of molecular techniques.

Science.gov (United States)

Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia

2010-08-01

Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.

Rapid detection, characterization, and enumeration of foodborne pathogens.

Science.gov (United States)

Hoorfar, J

2011-11-01

As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

Multidrug-resistant pathogens in the food supply.

Science.gov (United States)

Doyle, Marjorie E

2015-04-01

Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

Pathogen Causing Disease of Diagnosis PCR Tecnology

OpenAIRE

SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

2013-01-01

Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

Climate Change, Foodborne Pathogens and Illness in Higher-Income Countries.

Science.gov (United States)

Lake, I R; Barker, G C

2018-03-01

We present a review of the likely consequences of climate change for foodborne pathogens and associated human illness in higher-income countries. The relationships between climate and food are complex and hence the impacts of climate change uncertain. This makes it difficult to know which foodborne pathogens will be most affected, what the specific effects will be, and on what timescales changes might occur. Hence, a focus upon current capacity and adaptation potential against foodborne pathogens is essential. We highlight a number of developments that may enhance preparedness for climate change. These include the following: Adoption of novel surveillance methods, such as syndromic methods, to speed up detection and increase the fidelity of intervention in foodborne outbreaks Genotype-based approaches to surveillance of food pathogens to enhance spatiotemporal resolution in tracing and tracking of illness Ever increasing integration of plant, animal and human surveillance systems, One Health, to maximise potential for identifying threats Increased commitment to cross-border (global) information initiatives (including big data) Improved clarity regarding the governance of complex societal issues such as the conflict between food safety and food waste Strong user-centric (social) communications strategies to engage diverse stakeholder groups The impact of climate change upon foodborne pathogens and associated illness is uncertain. This emphasises the need to enhance current capacity and adaptation potential against foodborne illness. A range of developments are explored in this paper to enhance preparedness.

Animal-specific C-terminal domain links myeloblastosis oncoprotein (Myb) to an ancient repressor complex

Science.gov (United States)

Andrejka, Laura; Wen, Hong; Ashton, Jonathan; Grant, Megan; Iori, Kevin; Wang, Amy; Manak, J. Robert; Lipsick, Joseph S.

2011-01-01

Members of the Myb oncoprotein and E2F-Rb tumor suppressor protein families are present within the same highly conserved multiprotein transcriptional repressor complex, named either as Myb and synthetic multivuval class B (Myb-MuvB) or as Drosophila Rb E2F and Myb-interacting proteins (dREAM). We now report that the animal-specific C terminus of Drosophila Myb but not the more highly conserved N-terminal DNA-binding domain is necessary and sufficient for (i) adult viability, (ii) proper localization to chromosomes in vivo, (iii) regulation of gene expression in vivo, and (iv) interaction with the highly conserved core of the MuvB/dREAM transcriptional repressor complex. In addition, we have identified a conserved peptide motif that is required for this interaction. Our results imply that an ancient function of Myb in regulating G2/M genes in both plants and animals appears to have been transferred from the DNA-binding domain to the animal-specific C-terminal domain. Increased expression of B-MYB/MYBL2, the human ortholog of Drosophila Myb, correlates with poor prognosis in human patients with breast cancer. Therefore, our results imply that the specific interaction of the C terminus of Myb with the MuvB/dREAM core complex may provide an attractive target for the development of cancer therapeutics. PMID:21969598

Alignment-free genome tree inference by learning group-specific distance metrics.

Science.gov (United States)

Patil, Kaustubh R; McHardy, Alice C

2013-01-01

Understanding the evolutionary relationships between organisms is vital for their in-depth study. Gene-based methods are often used to infer such relationships, which are not without drawbacks. One can now attempt to use genome-scale information, because of the ever increasing number of genomes available. This opportunity also presents a challenge in terms of computational efficiency. Two fundamentally different methods are often employed for sequence comparisons, namely alignment-based and alignment-free methods. Alignment-free methods rely on the genome signature concept and provide a computationally efficient way that is also applicable to nonhomologous sequences. The genome signature contains evolutionary signal as it is more similar for closely related organisms than for distantly related ones. We used genome-scale sequence information to infer taxonomic distances between organisms without additional information such as gene annotations. We propose a method to improve genome tree inference by learning specific distance metrics over the genome signature for groups of organisms with similar phylogenetic, genomic, or ecological properties. Specifically, our method learns a Mahalanobis metric for a set of genomes and a reference taxonomy to guide the learning process. By applying this method to more than a thousand prokaryotic genomes, we showed that, indeed, better distance metrics could be learned for most of the 18 groups of organisms tested here. Once a group-specific metric is available, it can be used to estimate the taxonomic distances for other sequenced organisms from the group. This study also presents a large scale comparison between 10 methods--9 alignment-free and 1 alignment-based.

Jump-starting urban rat research: Conspecific pheromones recruit wild rats into a behavioral and pathogen-monitoring assay

Directory of Open Access Journals (Sweden)

Michael H Parsons

2015-12-01

Full Text Available Wild rats, Rattus spp, have adapted so well to urbanization that humans may be obligatory to their survival. Consequently, rats foul human food sources, predate threatened fauna and serve as reservoirs for disease, costing the US economy $19 billion in losses year -1. Urban rat ecology however, remains vastly unexplored because these animals are cryptic, crepuscular, difficult to identify, and hazardous to handle. Additionally, the high-rise buildings that block satellite link-ups, underground sewers and subway tunnels, and rebar enforced concrete covered landscape make it difficult—if not impossible— to track urban animals using traditional radio telemetry. Consequently, there are few ecological studies with free-ranging urban rats. Therefore, we set out to monitor the behaviors and health of free-ranging rats in metropolitan New York. Recognizing that wild rats are attracted to live laboratory-reared conspecifics and that they are sensitive to pheromones, we used soiled rat bedding to repeatedly attract animals to a Remote Frequency Identification (RFID- based antenna with camera-trap and load cell (scale for collecting weights. We captured and micro-chipped 13 rats within 50, 30 and 10 m from our antenna and followed their movements. Seven of the 8 animals released within 10 m of the antenna, visited the RFID antenna lure 398 times over 41 standardized days. Males (2.7 visits day-1 visited the antenna at the same frequency as females (2.7 visits day-1; P>0.5, and both sexes spent similar time dwelling at the pheromones (M, 2.9±0.9 sec; F, 2.4.±0.4 sec; P>0.05. The passive integrated transponder (PIT-tag worked free on the lone individual that did not participate. Within our population, female activity peaked between 6am and 7pm, while males visited throughout the day. Our results demonstrate the potential to safely overcome the primary barriers that have impeded urban rat ecological studies. We used pheromone-based lures to attract

Evolution of glycosaminoglycans and their glycosyltransferases: Implications for the extracellular matrices of animals and the capsules of pathogenic bacteria.

Science.gov (United States)

DeAngelis, Paul L

2002-11-01

Glycosaminoglycans (linear polysaccharides with a repeating disaccharide backbone containing an amino sugar) are essential components of extracellular matrices of animals. These complex molecules play important structural, adhesion, and signaling roles in mammals. Direct detection of glycosaminoglycans has been reported in a variety of organisms, but perhaps more definitive tests for the glycosyltransferase genes should be utilized to clarify the distribution of glycosaminoglycans in metazoans. Recently, glycosyltransferases that form the hyaluronan, heparin/heparan, or chondroitin backbone were identified at the molecular level. The three types of glycosyltransferases appear to have evolved independently based on sequence comparisons and other characteristics. All metazoans appear to possess heparin/heparan. Chondroitin is found in some worms, arthropods, and higher animals. Hyaluronan is found only in two of the three main branches of chordates. The presence of several types of glycosaminoglycans in the body allows multiple communication channels and adhesion systems to operate simultaneously. Certain pathogenic bacteria produce extracellular coatings, called capsules, which are composed of glycosaminoglycans that increase their virulence during infection. The capsule helps shield the microbe from the host defenses and/or modulates host physiology. The bacterial and animal polysaccharides are chemically identical or at least very similar. Therefore, no immune response is generated, in contrast to the vast majority of capsular polymers from other bacteria. In microbial systems, it appears that in most cases functional convergent evolution of glycosaminoglycan glycosyltransferases occurred, rather than direct horizontal gene transfer from their vertebrate hosts. Copyright 2002 Wiley-Liss, Inc.

[Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

Science.gov (United States)

Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

2010-12-01

The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (Pvitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

Metabolomics Analysis Reveals Specific Novel Tetrapeptide and Potential Anti-Inflammatory Metabolites in Pathogenic Aspergillus species.

Science.gov (United States)

Lee, Kim-Chung; Tam, Emily W T; Lo, Ka-Ching; Tsang, Alan K L; Lau, Candy C Y; To, Kelvin K W; Chan, Jasper F W; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y

2015-06-17

Infections related to Aspergillus species have emerged to become an important focus in infectious diseases, as a result of the increasing use of immunosuppressive agents and high fatality associated with invasive aspergillosis. However, laboratory diagnosis of Aspergillus infections remains difficult. In this study, by comparing the metabolomic profiles of the culture supernatants of 30 strains of six pathogenic Aspergillus species (A. fumigatus, A. flavus, A. niger, A. terreus, A. nomius and A. tamarii) and 31 strains of 10 non-Aspergillus fungi, eight compounds present in all strains of the six Aspergillus species but not in any strain of the non-Aspergillus fungi were observed. One of the eight compounds, Leu-Glu-Leu-Glu, is a novel tetrapeptide and represents the first linear tetrapeptide observed in Aspergillus species, which we propose to be named aspergitide. Two other closely related Aspergillus-specific compounds, hydroxy-(sulfooxy)benzoic acid and (sulfooxy)benzoic acid, may possess anti-inflammatory properties, as 2-(sulfooxy)benzoic acid possesses a structure similar to those of aspirin [2-(acetoxy)benzoic acid] and salicylic acid (2-hydroxybenzoic acid). Further studies to examine the potentials of these Aspergillus-specific compounds for laboratory diagnosis of aspergillosis are warranted and further experiments will reveal whether Leu-Glu-Leu-Glu, hydroxy-(sulfooxy)benzoic acid and (sulfooxy)benzoic acid are virulent factors of the pathogenic Aspergillus species.

Animal venoms as antimicrobial agents.

Science.gov (United States)

Perumal Samy, Ramar; Stiles, Bradley G; Franco, Octavio L; Sethi, Gautam; Lim, Lina H K

2017-06-15

Hospitals are breeding grounds for many life-threatening bacteria worldwide. Clinically associated gram-positive bacteria such as Staphylococcus aureus/methicillin-resistant S. aureus and many others increase the risk of severe mortality and morbidity. The failure of antibiotics to kill various pathogens due to bacterial resistance highlights the urgent need to develop novel, potent, and less toxic agents from natural sources against various infectious agents. Currently, several promising classes of natural molecules from snake (terrestrial and sea), scorpion, spider, honey bee and wasp venoms hold promise as rich sources of chemotherapeutics against infectious pathogens. Interestingly, snake venom-derived synthetic peptide/snake cathelicidin not only has potent antimicrobial and wound-repair activity but is highly stable and safe. Such molecules are promising candidates for novel venom-based drugs against S. aureus infections. The structure of animal venom proteins/peptides (cysteine rich) consists of hydrophobic α-helices or β-sheets that produce lethal pores and membrane-damaging effects on bacteria. All these antimicrobial peptides are under early experimental or pre-clinical stages of development. It is therefore important to employ novel tools for the design and the development of new antibiotics from the untapped animal venoms of snake, scorpion, and spider for treating resistant pathogens. To date, snail venom toxins have shown little antibiotic potency against human pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

Porphyromonas gulae Has Virulence and Immunological Characteristics Similar to Those of the Human Periodontal Pathogen Porphyromonas gingivalis.

Science.gov (United States)

Lenzo, Jason C; O'Brien-Simpson, Neil M; Orth, Rebecca K; Mitchell, Helen L; Dashper, Stuart G; Reynolds, Eric C

2016-09-01

Periodontitis is a significant problem in companion animals, and yet little is known about the disease-associated microbiota. A major virulence factor for the human periodontal pathogen Porphyromonas gingivalis is the lysyl- and arginyl-specific proteolytic activity of the gingipains. We screened several Porphyromonas species isolated from companion animals-P. asaccharolytica, P. circumdentaria, P. endodontalis, P. levii, P. gulae, P. macacae, P. catoniae, and P. salivosa-for Lys- and Arg-specific proteolytic activity and compared the epithelial and macrophage responses and induction of alveolar bone resorption of the protease active species to that of Porphyromonas gingivalis Only P. gulae exhibited Lys-and Arg-specific proteolytic activity. The genes encoding the gingipains (RgpA/B and Kgp) were identified in the P. gulae strain ATCC 51700 and all publicly available 12 draft genomes of P. gulae strains. P. gulae ATCC 51700 induced levels of alveolar bone resorption in an animal model of periodontitis similar to those in P. gingivalis W50 and exhibited a higher capacity for autoaggregation and binding to oral epithelial cells with induction of apoptosis. Macrophages (RAW 264.7) were found to phagocytose P. gulae ATCC 51700 and the fimbriated P. gingivalis ATCC 33277 at similar levels. In response to P. gulae ATCC 51700, macrophages secreted higher levels of cytokines than those induced by P. gingivalis ATCC 33277 but lower than those induced by P. gingivalis W50, except for the interleukin-6 response. Our results indicate that P. gulae exhibits virulence characteristics similar to those of the human periodontal pathogen P. gingivalis and therefore may play a key role in the development of periodontitis in companion animals. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Modeling the intracellular pathogen-immune interaction with cure rate

Science.gov (United States)

Dubey, Balram; Dubey, Preeti; Dubey, Uma S.

2016-09-01

Many common and emergent infectious diseases like Influenza, SARS, Hepatitis, Ebola etc. are caused by viral pathogens. These infections can be controlled or prevented by understanding the dynamics of pathogen-immune interaction in vivo. In this paper, interaction of pathogens with uninfected and infected cells in presence or absence of immune response are considered in four different cases. In the first case, the model considers the saturated nonlinear infection rate and linear cure rate without absorption of pathogens into uninfected cells and without immune response. The next model considers the effect of absorption of pathogens into uninfected cells while all other terms are same as in the first case. The third model incorporates innate immune response, humoral immune response and Cytotoxic T lymphocytes (CTL) mediated immune response with cure rate and without absorption of pathogens into uninfected cells. The last model is an extension of the third model in which the effect of absorption of pathogens into uninfected cells has been considered. Positivity and boundedness of solutions are established to ensure the well-posedness of the problem. It has been found that all the four models have two equilibria, namely, pathogen-free equilibrium point and pathogen-present equilibrium point. In each case, stability analysis of each equilibrium point is investigated. Pathogen-free equilibrium is globally asymptotically stable when basic reproduction number is less or equal to unity. This implies that control or prevention of infection is independent of initial concentration of uninfected cells, infected cells, pathogens and immune responses in the body. The proposed models show that introduction of immune response and cure rate strongly affects the stability behavior of the system. Further, on computing basic reproduction number, it has been found to be minimum for the fourth model vis-a-vis other models. The analytical findings of each model have been exemplified by

The wild life of tick-borne pathogens

OpenAIRE

Hofmeester, Tim R.

2016-01-01

Diseases that are transmitted by arthropod vectors from animal hosts to humans – so called zoonotic vector-borne diseases – have increased in incidence in the last decades. In North America and Europe, tick-borne pathogens cause the majority of vector-borne diseases, including Lyme borreliosis and tick-borne encephalitis. The pathogens causing these diseases are transmitted by tick species within the Ixodes ricinus complex. These are generalist ticks that have a multi-year lifecycle with thre...

Interrelationships of food safety and plant pathology: the life cycle of human pathogens on plants.

Science.gov (United States)

Barak, Jeri D; Schroeder, Brenda K

2012-01-01

Bacterial food-borne pathogens use plants as vectors between animal hosts, all the while following the life cycle script of plant-associated bacteria. Similar to phytobacteria, Salmonella, pathogenic Escherichia coli, and cross-domain pathogens have a foothold in agricultural production areas. The commonality of environmental contamination translates to contact with plants. Because of the chronic absence of kill steps against human pathogens for fresh produce, arrival on plants leads to persistence and the risk of human illness. Significant research progress is revealing mechanisms used by human pathogens to colonize plants and important biological interactions between and among bacteria in planta. These findings articulate the difficulty of eliminating or reducing the pathogen from plants. The plant itself may be an untapped key to clean produce. This review highlights the life of human pathogens outside an animal host, focusing on the role of plants, and illustrates areas that are ripe for future investigation.

Meeting report: batch-to-batch variability in estrogenic activity in commercial animal diets--importance and approaches for laboratory animal research.

Science.gov (United States)

Heindel, Jerrold J; vom Saal, Frederick S

2008-03-01

We report information from two workshops sponsored by the National Institutes of Health that were held to a) assess whether dietary estrogens could significantly impact end points in experimental animals, and b) involve program participants and feed manufacturers to address the problems associated with measuring and eliminating batch-to-batch variability in rodent diets that may lead to conflicting findings in animal experiments within and between laboratories. Data were presented at the workshops showing that there is significant batch-to-batch variability in estrogenic content of commercial animal diets, and that this variability results in differences in experimental outcomes. A combination of methods were proposed to determine levels of total estrogenic activity and levels of specific estrogenic constituents in soy-containing, casein-containing, and other soy-free rodent diets. Workshop participants recommended that researchers pay greater attention to the type of diet being used in animal studies and choose a diet whose estrogenic activity (or lack thereof) is appropriate for the experimental model and end points of interest. Information about levels of specific phytoestrogens, as well as estrogenic activity caused by other contaminants and measured by bioassay, should be disclosed in scientific publications. This will require laboratory animal diet manufacturers to provide investigators with information regarding the phytoestrogen content and other estrogenic compounds in commercial diets used in animal research.

Effects of pathogen-specific clinical mastitis on probability of conception in Holstein dairy cows.

Science.gov (United States)

Hertl, J A; Schukken, Y H; Welcome, F L; Tauer, L W; Gröhn, Y T

2014-11-01

The objective of this study was to estimate the effects of pathogen-specific clinical mastitis (CM), occurring in different weekly intervals before or after artificial insemination (AI), on the probability of conception in Holstein cows. Clinical mastitis occurring in weekly intervals from 6 wk before until 6 wk after AI was modeled. The first 4 AI in a cow's lactation were included. The following categories of pathogens were studied: Streptococcus spp. (comprising Streptococcus dysgalactiae, Streptococcus uberis, and other Streptococcus spp.); Staphylococcus aureus; coagulase-negative staphylococci (CNS); Escherichia coli; Klebsiella spp.; cases with CM signs but no bacterial growth (above the level that can be detected from our microbiological procedures) observed in the culture sample and cases with contamination (≥ 3 pathogens in the sample); and other pathogens [including Citrobacter, yeasts, Trueperella pyogenes, gram-negative bacilli (i.e., gram-negative organisms other than E. coli, Klebsiella spp., Enterobacter, and Citrobacter), Corynebacterium bovis, Corynebacterium spp., Pasteurella, Enterococcus, Pseudomonas, Mycoplasma, Prototheca, and others]. Other factors included in the model were parity (1, 2, 3, 4 and higher), season of AI (winter, spring, summer, autumn), day in lactation of first AI, farm, and other non-CM diseases (retained placenta, metritis, ketosis, displaced abomasum). Data from 90,271 AI in 39,361 lactations in 20,328 cows collected from 2003/2004 to 2011 from 5 New York State dairy farms were analyzed in a generalized linear mixed model with a Poisson distribution. The largest reductions in probability of conception were associated with CM occurring in the week before AI or in the 2 wk following AI. Escherichia coli and Klebsiella spp. had the greatest adverse effects on probability of conception. The probability of conception for a cow with any combination of characteristics may be calculated based on the parameter estimates. These

Pathogen-specific effects on milk yield in repeated clinical mastitis episodes in Holstein dairy cows.

Science.gov (United States)

Hertl, J A; Schukken, Y H; Welcome, F L; Tauer, L W; Gröhn, Y T

2014-03-01

The objective of this study was to estimate the effects of clinical mastitis (CM) cases due to different pathogens on milk yield in Holstein cows. The first 3 CM cases in a cow's lactation were modeled. Eight categories of pathogens were included: Streptococcus spp.; Staphylococcus aureus; coagulase-negative staphylococci (CNS); Escherichia coli; Klebsiella spp.; cases with CM signs but no bacterial growth (above the level detectable by our microbiological procedures) observed in the culture sample, and cases with contamination (≥ 3 pathogens in the sample); other pathogens that may be treated with antibiotics (included Citrobacter, Corynebacterium bovis, Enterobacter, Enterococcus, Pasteurella, Pseudomonas; "other treatable"); and other pathogens not successfully treated with antibiotics (Trueperella pyogenes, Mycoplasma, Prototheca, yeasts; "other not treatable"). Data from 38,276 lactations in cows from 5 New York State dairy herds, collected from 2003-2004 until 2011, were analyzed. Mixed models with an autoregressive correlation structure (to account for correlation among the repeated measures of milk yield within a lactation) were estimated. Primiparous (lactation 1) and multiparous (lactations 2 and 3) cows were analyzed separately, as the shapes of their lactation curves differed. Primiparas were followed for up to 48 wk of lactation and multiparas for up to 44 wk. Fixed effects included parity, calving season, week of lactation, CM (type, case number, and timing of CM in relation to milk production cycle), and other diseases (milk fever, retained placenta, metritis, ketosis, displaced abomasum). Herd was modeled as a random effect. Clinical mastitis was more common in multiparas than in primiparas. In primiparas, Streptococcus spp. occurred most frequently as the first case. In multiparas, E. coli was most common as the first case. In subsequent cases, CM cases with no specific growth or contamination were most common in both parity groups. The hazard of

Worldwide risks of animal diseases: introduction.

Science.gov (United States)

Pearson, J E

2006-01-01

Animal diseases impact food supplies, trade and commerce, and human health and well-being in every part of the world. Outbreaks draw the attention of those in agriculture, regulatory agencies, and government, as well as the general public. This was demonstrated by the 2000-2001 foot and mouth disease (FMD) outbreaks that occurred in Europe, South America, Asia and Africa and by the recent increased occurrence of emerging diseases transmitted from animals to humans. Examples of these emerging zoonotic diseases are highly pathogenic avian influenza, bovine spongiform encephalopathy, West Nile virus and severe acute respiratory syndrome. There is also the risk of well-known and preventable zoonotic diseases, such as rabies, brucellosis, leishmaniasis, and echinococcosis/hydatidosis, in certain countries; these diseases have a high morbidity with the potential for a very high mortality. Animal agriculturalists should have a global disease awareness of disease risks and develop plans of action to deal with them; in order to better respond to these diseases, they should develop the skills and competencies in politics, media interactions, and community engagement. This issue of Veterinaria Italiana presents information on the risk of animal diseases; their impact on animals and humans at the international, national, industry, and societal levels; and the responses to them. In addition, specific information is provided on national and international disease monitoring, surveillance and reporting, the risk of spread of disease by bioterrorism and on import risk analysis.

Gluten-free diet increases beta-cell volume and improves glucose tolerance in an animal model of type 2 diabetes

DEFF Research Database (Denmark)

Haupt-Jørgensen, Martin; Buschard, Karsten; Hansen, Axel Kornerup

2016-01-01

Background Gluten-free (GF) diet alleviates type 1 diabetes in animal models and possibly in humans. We recently showed that fatty acid-induced insulin secretion is enhanced by enzymatically digested gluten (gliadin) stimulation in INS-1E insulinoma cells. We therefore hypothesized that GF diet...... would induce beta-cell rest and ameliorate type 2 diabetes. Methods C57BL/6JBomTac (B6) mice were fed a high-fat (HF), gluten-free high-fat (GF–HF), standard (STD) or gluten-free (GF) diet for 42 weeks. Results Short-term (6–24 weeks) GF–HF versus HF feeding impaired glucose tolerance and increased...... capacity controls pancreas volume. Thus, long-term GF diets may be beneficial for obese type 2 diabetes patients and trials should be performed....

Pathogens in Dairy Farming: Source Characterization and Groundwater Impacts

Science.gov (United States)

Atwill, E. R.; Watanabe, N.; Li, X.; Hou, L.; Harter, T.; Bergamaschi, B.

2007-12-01

Intense animal husbandry is of growing concern as a potential contamination source of enteric pathogens as well as antibiotics. To assess the public health risk from pathogens and their hydrologic pathways, we hypothesize that the animal farm is not a homogeneous diffuse source, but that pathogen loading to the soil and, therefore, to groundwater varies significantly between the various management units of a farm. A dairy farm, for example, may include an area with calf hutches, corrals for heifers of various ages, freestalls and exercise yards for milking cows, separate freestalls for dry cows, a hospital barn, a yard for collection of solid manure, a liquid manure storage lagoon, and fields receiving various amounts of liquid and solid manure. Pathogen shedding and, hence, therapeutic and preventive pharmaceutical treatments vary between these management units. We are implementing a field reconnaissance program to determine the occurrence of three different pathogens ( E. coli, Salmonella, Campylobacter) and one indicator organism ( Enterococcus) at the ground-surface and in shallow groundwater of seven different management units on each of two farms, and in each of four seasons (spring/dry season, summer/irrigation season, fall/dry season, winter/rainy season). Initial results indicate that significant differences exist in the occurrence of these pathogens between management units and between organisms. These differences are weakly reflected in their occurrence in groundwater, despite the similarity of the shallow geologic environment across these sites. Our results indicate the importance of differentiating sources within a dairy farm and the importance of understanding subsurface transport processes for these pathogens.

The general transcriptional repressor Tup1 is required for dimorphism and virulence in a fungal plant pathogen.

Directory of Open Access Journals (Sweden)

Alberto Elías-Villalobos

2011-09-01

Full Text Available A critical step in the life cycle of many fungal pathogens is the transition between yeast-like growth and the formation of filamentous structures, a process known as dimorphism. This morphological shift, typically triggered by multiple environmental signals, is tightly controlled by complex genetic pathways to ensure successful pathogenic development. In animal pathogenic fungi, one of the best known regulators of dimorphism is the general transcriptional repressor, Tup1. However, the role of Tup1 in fungal dimorphism is completely unknown in plant pathogens. Here we show that Tup1 plays a key role in orchestrating the yeast to hypha transition in the maize pathogen Ustilago maydis. Deletion of the tup1 gene causes a drastic reduction in the mating and filamentation capacity of the fungus, in turn leading to a reduced virulence phenotype. In U. maydis, these processes are controlled by the a and b mating-type loci, whose expression depends on the Prf1 transcription factor. Interestingly, Δtup1 strains show a critical reduction in the expression of prf1 and that of Prf1 target genes at both loci. Moreover, we observed that Tup1 appears to regulate Prf1 activity by controlling the expression of the prf1 transcriptional activators, rop1 and hap2. Additionally, we describe a putative novel prf1 repressor, named Pac2, which seems to be an important target of Tup1 in the control of dimorphism and virulence. Furthermore, we show that Tup1 is required for full pathogenic development since tup1 deletion mutants are unable to complete the sexual cycle. Our findings establish Tup1 as a key factor coordinating dimorphism in the phytopathogen U. maydis and support a conserved role for Tup1 in the control of hypha-specific genes among animal and plant fungal pathogens.

Vaccination with an Attenuated Mutant of Ehrlichia chaffeensis Induces Pathogen-Specific CD4+ T Cell Immunity and Protection from Tick-Transmitted Wild-Type Challenge in the Canine Host.

Directory of Open Access Journals (Sweden)

Jodi L McGill

Full Text Available Ehrlichia chaffeensis is a tick-borne rickettsial pathogen and the causative agent of human monocytic ehrlichiosis. Transmitted by the Amblyomma americanum tick, E. chaffeensis also causes disease in several other vertebrate species including white-tailed deer and dogs. We have recently described the generation of an attenuated mutant strain of E. chaffeensis, with a mutation in the Ech_0660 gene, which is able to confer protection from secondary, intravenous-administered, wild-type E. chaffeensis infection in dogs. Here, we extend our previous results, demonstrating that vaccination with the Ech_0660 mutant protects dogs from physiologic, tick-transmitted, secondary challenge with wild-type E. chaffeensis; and describing, for the first time, the cellular and humoral immune responses induced by Ech_0660 mutant vaccination and wild-type E. chaffeensis infection in the canine host. Both vaccination and infection induced a rise in E. chaffeensis-specific antibody titers and a significant Th1 response in peripheral blood as measured by E. chaffeensis antigen-dependent CD4+ T cell proliferation and IFNγ production. Further, we describe for the first time significant IL-17 production by peripheral blood leukocytes from both Ech_0660 mutant vaccinated animals and control animals infected with wild-type E. chaffeensis, suggesting a previously unrecognized role for IL-17 and Th17 cells in the immune response to rickettsial pathogens. Our results are a critical first step towards defining the role of the immune system in vaccine-induced protection from E. chaffeensis infection in an incidental host; and confirm the potential of the attenuated mutant clone, Ech_0660, to be used as a vaccine candidate for protection against tick-transmitted E. chaffeensis infection.

Production of cross-kingdom oxylipins by pathogenic fungi: An update on their role in development and pathogenicity.

Science.gov (United States)

Fischer, Gregory J; Keller, Nancy P

2016-03-01

Oxylipins are a class of molecules derived from the incorporation of oxygen into polyunsaturated fatty acid substrates through the action of oxygenases. While extensively investigated in the context of mammalian immune responses, over the last decade it has become apparent that oxylipins are a common means of communication among and between plants, animals, and fungi to control development and alter host-microbe interactions. In fungi, some oxylipins are derived nonenzymatically while others are produced by lipoxygenases, cyclooxygenases, and monooxygenases with homology to plant and human enzymes. Recent investigations of numerous plant and human fungal pathogens have revealed oxylipins to be involved in the establishment and progression of disease. This review highlights oxylipin production by pathogenic fungi and their role in fungal development and pathogen/host interactions.

Diet and environment shape fecal bacterial microbiota composition and enteric pathogen load of grizzly bears.

Directory of Open Access Journals (Sweden)

Clarissa Schwab

Full Text Available BACKGROUND: Diet and environment impact the composition of mammalian intestinal microbiota; dietary or health disturbances trigger alterations in intestinal microbiota composition and render the host susceptible to enteric pathogens. To date no long term monitoring data exist on the fecal microbiota and pathogen load of carnivores either in natural environments or in captivity. This study investigates fecal microbiota composition and the presence of pathogenic Escherichia coli and toxigenic clostridia in wild and captive grizzly bears (Ursus arctos and relates these to food resources consumed by bears. METHODOLOGY/PRINCIPAL FINDINGS: Feces were obtained from animals of two wild populations and from two captive animals during an active bear season. Wild animals consumed a diverse diet composed of plant material, animal prey and insects. Captive animals were fed a regular granulated diet with a supplement of fruits and vegetables. Bacterial populations were analyzed using quantitative PCR. Fecal microbiota composition fluctuated in wild and in captive animals. The abundance of Clostridium clusters I and XI, and of C. perfringens correlated to regular diet protein intake. Enteroaggregative E. coli were consistently present in all populations. The C. sordellii phospholipase C was identified in three samples of wild animals and for the first time in Ursids. CONCLUSION: This is the first longitudinal study monitoring the fecal microbiota of wild carnivores and comparing it to that of captive individuals of the same species. Location and diet affected fecal bacterial populations as well as the presence of enteric pathogens.

Diet and environment shape fecal bacterial microbiota composition and enteric pathogen load of grizzly bears.

Science.gov (United States)

Schwab, Clarissa; Cristescu, Bogdan; Northrup, Joseph M; Stenhouse, Gordon B; Gänzle, Michael

2011-01-01

Diet and environment impact the composition of mammalian intestinal microbiota; dietary or health disturbances trigger alterations in intestinal microbiota composition and render the host susceptible to enteric pathogens. To date no long term monitoring data exist on the fecal microbiota and pathogen load of carnivores either in natural environments or in captivity. This study investigates fecal microbiota composition and the presence of pathogenic Escherichia coli and toxigenic clostridia in wild and captive grizzly bears (Ursus arctos) and relates these to food resources consumed by bears. Feces were obtained from animals of two wild populations and from two captive animals during an active bear season. Wild animals consumed a diverse diet composed of plant material, animal prey and insects. Captive animals were fed a regular granulated diet with a supplement of fruits and vegetables. Bacterial populations were analyzed using quantitative PCR. Fecal microbiota composition fluctuated in wild and in captive animals. The abundance of Clostridium clusters I and XI, and of C. perfringens correlated to regular diet protein intake. Enteroaggregative E. coli were consistently present in all populations. The C. sordellii phospholipase C was identified in three samples of wild animals and for the first time in Ursids. This is the first longitudinal study monitoring the fecal microbiota of wild carnivores and comparing it to that of captive individuals of the same species. Location and diet affected fecal bacterial populations as well as the presence of enteric pathogens.

Animal-related factors associated with moderate-to-severe diarrhea in children younger than five years in western Kenya: A matched case-control study.

Science.gov (United States)

Conan, Anne; O'Reilly, Ciara E; Ogola, Eric; Ochieng, J Benjamin; Blackstock, Anna J; Omore, Richard; Ochieng, Linus; Moke, Fenny; Parsons, Michele B; Xiao, Lihua; Roellig, Dawn; Farag, Tamer H; Nataro, James P; Kotloff, Karen L; Levine, Myron M; Mintz, Eric D; Breiman, Robert F; Cleaveland, Sarah; Knobel, Darryn L

2017-08-01

Diarrheal disease remains among the leading causes of global mortality in children younger than 5 years. Exposure to domestic animals may be a risk factor for diarrheal disease. The objectives of this study were to identify animal-related exposures associated with cases of moderate-to-severe diarrhea (MSD) in children in rural western Kenya, and to identify the major zoonotic enteric pathogens present in domestic animals residing in the homesteads of case and control children. We characterized animal-related exposures in a subset of case and control children (n = 73 pairs matched on age, sex and location) with reported animal presence at home enrolled in the Global Enteric Multicenter Study in western Kenya, and analysed these for an association with MSD. We identified potentially zoonotic enteric pathogens in pooled fecal specimens collected from domestic animals resident at children's homesteads. Variables that were associated with decreased risk of MSD were washing hands after animal contact (matched odds ratio [MOR] = 0.2; 95% CI 0.08-0.7), and presence of adult sheep that were not confined in a pen overnight (MOR = 0.1; 0.02-0.5). Variables that were associated with increased risk of MSD were increasing number of sheep owned (MOR = 1.2; 1.0-1.5), frequent observation of fresh rodent excreta (feces/urine) outside the house (MOR = 7.5; 1.5-37.2), and participation of the child in providing water to chickens (MOR = 3.8; 1.2-12.2). Of 691 pooled specimens collected from 2,174 domestic animals, 159 pools (23%) tested positive for one or more potentially zoonotic enteric pathogens (Campylobacter jejuni, C. coli, non-typhoidal Salmonella, diarrheagenic E. coli, Giardia, Cryptosporidium, or rotavirus). We did not find any association between the presence of particular pathogens in household animals, and MSD in children. Public health agencies should continue to promote frequent hand washing, including after animal contact, to reduce the risk of MSD. Future studies

Animal-related factors associated with moderate-to-severe diarrhea in children younger than five years in western Kenya: A matched case-control study.

Directory of Open Access Journals (Sweden)

Anne Conan

2017-08-01

Full Text Available Diarrheal disease remains among the leading causes of global mortality in children younger than 5 years. Exposure to domestic animals may be a risk factor for diarrheal disease. The objectives of this study were to identify animal-related exposures associated with cases of moderate-to-severe diarrhea (MSD in children in rural western Kenya, and to identify the major zoonotic enteric pathogens present in domestic animals residing in the homesteads of case and control children.We characterized animal-related exposures in a subset of case and control children (n = 73 pairs matched on age, sex and location with reported animal presence at home enrolled in the Global Enteric Multicenter Study in western Kenya, and analysed these for an association with MSD. We identified potentially zoonotic enteric pathogens in pooled fecal specimens collected from domestic animals resident at children's homesteads. Variables that were associated with decreased risk of MSD were washing hands after animal contact (matched odds ratio [MOR] = 0.2; 95% CI 0.08-0.7, and presence of adult sheep that were not confined in a pen overnight (MOR = 0.1; 0.02-0.5. Variables that were associated with increased risk of MSD were increasing number of sheep owned (MOR = 1.2; 1.0-1.5, frequent observation of fresh rodent excreta (feces/urine outside the house (MOR = 7.5; 1.5-37.2, and participation of the child in providing water to chickens (MOR = 3.8; 1.2-12.2. Of 691 pooled specimens collected from 2,174 domestic animals, 159 pools (23% tested positive for one or more potentially zoonotic enteric pathogens (Campylobacter jejuni, C. coli, non-typhoidal Salmonella, diarrheagenic E. coli, Giardia, Cryptosporidium, or rotavirus. We did not find any association between the presence of particular pathogens in household animals, and MSD in children.Public health agencies should continue to promote frequent hand washing, including after animal contact, to reduce the risk of MSD. Future

The Effect of Probiotics on Animal Health

Directory of Open Access Journals (Sweden)

Nicolae Corcionivoschi

2010-05-01

Full Text Available The mechanisms of action of probiotic bacteria and their effect in combating digestive disorders in humans and animals has been demonstrated and supported in numerous scientific studies. Probiotic bacteria are used in a wide range of nutritional techniques in order to support the host organism during physiological strain, to reduce stress due to technology and to combat diarrheal syndromes (occurring naturally or pharmacologically induced. Based on a rich bibliographic material, this paper presents the role of probiotic bacteria to equilibrate the beneficial microbial population and in bacterial turnover by stimulating the host immune response via specific secretions (eg. bacteriocins and competitive exclusion of potentially pathogenic germs in the digestive tract (Salmonella, E. coli. In the same context, this review presents the basic studies on the effect of probiotic bacteria in health maintenance for the main species of farm animals: pigs, poultry, cattle and sheep.

Clinical implications of free-to-total immunoreactive prostate-specific antigen ratios

NARCIS (Netherlands)

Wymenga, LFA; Duisterwinkel, FJ; Groenier, K; Visser-van Brummen, P; Marrink, J; Mensink, HJA

Objective: A study was performed to evaluate the free-to-total prostate-specific antigen (PSA) ratio for discriminating benign prostatic hyperplasia (BPH) or prostate cancer in the intermediate PSA range (2.0-10.0 mu g/l) in patients referred for prostate evaluation. In addition, the relationship of

Medicated early weaning to obtain pigs free from pathogens endemic in the herd of origin.

Science.gov (United States)

Alexander, T J; Thornton, K; Boon, G; Lysons, R J; Gush, A F

1980-02-09

A field trial was conducted to assess the value of medicated early weaning for obtaining pigs free from some of the pathogens endemic in their herd of origin. The trial comprised 51 sows from a closed herd, which were farrowed in an isolated farrowing house in seven separate groups. The sows in each group were bred at the same time and induced to farrow on the same day. Their thriftiest piglets were weaned at five days of age and moved to an isolated early-weaning unit. At about six weeks of age they were moved to one of three isolated grow-out units where they were held to slaughter weight. Sows in five of the groups were dosed with high levels of tiamulin and trimethoprim-sulphonamide preparations from their entry into the farrowing house until their biggest piglets were weaned. Their piglets were dosed with similar drugs from birth until 10 days of age. The first and seventh groups of sows and their litters were not medicated. Tests were carried out on pigs aged five to 11 weeks, on slaughter pigs, and on pigs which died or were killed at different ages, for Mycoplasma hyopneumoniae, Bordetella bronchiseptica and colonic treponemes, which were readily detectable in the herd of origin. No evidence could be found of mycoplasma or bordetella. Colonic treponemes were recovered from some of the pigs at slaughter, but not from younger pigs. Thirty-seven boars and gilts from the medicated groups were introduced into 11 herds thought to be free of enzootic pneumonia and 13 were introduced into three herds which had enzootic pneumonia. No subsequent signs of enzootic pneumonia were noted in 10 of the enzootic pneumonia-free herds.

21 CFR 500.35 - Animal feeds contaminated with Salmonella microorganisms.

Science.gov (United States)

2010-04-01

... bacteria, an organism pathogenic to man and animals. Contamination of these products may occur through... for animals are included within the definition of food in section 201(f) of the Federal Food, Drug...

Pathogen exposure varies widely among sympatric populations of wild and domestic felids across the United States

Science.gov (United States)

Carver, Scott; Bevins, Sarah N.; Lappin, Michael R.; Boydston, Erin E.; Lyren, Lisa M.; Alldredge, Mathew W.; Logan, Kenneth A.; Sweanor, Linda L.; Riley, Seth P.D.; Serieys, Laurel E.K.; Fisher, Robert N.; Vickers, T. Winston; Boyce, Walter M.; McBride, Roy; Cunnigham, Mark C.; Jennings, Megan; Lewis, Jesse S.; Lunn, Tamika; Crooks, Kevin R.; VandeWoude, Sue

2016-01-01

Understanding how landscape, host, and pathogen traits contribute to disease exposure requires systematic evaluations of pathogens within and among host species and geographic regions. The relative importance of these attributes is critical for management of wildlife and mitigating domestic animal and human disease, particularly given rapid ecological changes, such as urbanization. We screened >1,000 samples from sympatric populations of puma (Puma concolor), bobcat (Lynx rufus) and domestic cat (Felis catus) across urban gradients in six sites, representing three regions, in North America for exposure to a representative suite of bacterial, protozoal and viral pathogens (Bartonella sp., Toxoplasma gondii, feline herpesvirus-1, feline panleukopenea virus, feline calicivirus, feline immunodeficiency virus). We evaluated prevalence within each species, and examined host trait and land cover determinants of exposure-providing an unprecedented analysis of factors relating to potential for infections in domesticated and wild felids. Prevalence differed among host species (highest for puma and lowest for domestic cat) and was greater for indirectly transmitted pathogens. Sex was inconsistently predictive of exposure to directly transmitted pathogens only, and age infrequently predictive of both direct and indirectly transmitted pathogens. Determinants of pathogen exposure were widely divergent between the wild felid species. For puma, suburban landuse predicted increased exposure to Bartonella sp. in southern California, and FHV-1 exposure increased near urban edges in Florida. This may suggest inter-specific transmission with domestic cats via flea vectors (California) and direct contact (Florida) around urban boundaries. Bobcats captured near urban areas had increased exposure to T. gondii in Florida, suggesting an urban source of prey. Bobcats captured near urban areas in Colorado and Florida had higher FIV exposure, possibly suggesting increased intra-specific

Main Concerns of Pathogenic Microorganisms in Meat

Science.gov (United States)

Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

Directory of Open Access Journals (Sweden)

Paola eMassari

2014-08-01

Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

Models of Caenorhabditis elegans infection by bacterial and fungal pathogens.

Science.gov (United States)

Powell, Jennifer R; Ausubel, Frederick M

2008-01-01

The nematode Caenorhabditis elegans is a simple model host for studying the relationship between the animal innate immune system and a variety of bacterial and fungal pathogens. Extensive genetic and molecular tools are available in C. elegans, facilitating an in-depth analysis of host defense factors and pathogen virulence factors. Many of these factors are conserved in insects and mammals, indicating the relevance of the nematode model to the vertebrate innate immune response. Here, we describe pathogen assays for a selection of the most commonly studied bacterial and fungal pathogens using the C. elegans model system.

Bacterial genome engineering and synthetic biology: combating pathogens.

Science.gov (United States)

Krishnamurthy, Malathy; Moore, Richard T; Rajamani, Sathish; Panchal, Rekha G

2016-11-04

The emergence and prevalence of multidrug resistant (MDR) pathogenic bacteria poses a serious threat to human and animal health globally. Nosocomial infections and common ailments such as pneumonia, wound, urinary tract, and bloodstream infections are becoming more challenging to treat due to the rapid spread of MDR pathogenic bacteria. According to recent reports by the World Health Organization (WHO) and Centers for Disease Control and Prevention (CDC), there is an unprecedented increase in the occurrence of MDR infections worldwide. The rise in these infections has generated an economic strain worldwide, prompting the WHO to endorse a global action plan to improve awareness and understanding of antimicrobial resistance. This health crisis necessitates an immediate action to target the underlying mechanisms of drug resistance in bacteria. The advent of new bacterial genome engineering and synthetic biology (SB) tools is providing promising diagnostic and treatment plans to monitor and treat widespread recalcitrant bacterial infections. Key advances in genetic engineering approaches can successfully aid in targeting and editing pathogenic bacterial genomes for understanding and mitigating drug resistance mechanisms. In this review, we discuss the application of specific genome engineering and SB methods such as recombineering, clustered regularly interspaced short palindromic repeats (CRISPR), and bacterial cell-cell signaling mechanisms for pathogen targeting. The utility of these tools in developing antibacterial strategies such as novel antibiotic production, phage therapy, diagnostics and vaccine production to name a few, are also highlighted. The prevalent use of antibiotics and the spread of MDR bacteria raise the prospect of a post-antibiotic era, which underscores the need for developing novel therapeutics to target MDR pathogens. The development of enabling SB technologies offers promising solutions to deliver safe and effective antibacterial therapies.

High-throughput screen for novel antimicrobials using a whole animal infection model.

Science.gov (United States)

Moy, Terence I; Conery, Annie L; Larkins-Ford, Jonah; Wu, Gang; Mazitschek, Ralph; Casadei, Gabriele; Lewis, Kim; Carpenter, Anne E; Ausubel, Frederick M

2009-07-17

The nematode Caenorhabditis elegans is a unique whole animal model system for identifying small molecules with in vivo anti-infective properties. C. elegans can be infected with a broad range of human pathogens, including Enterococcus faecalis, an important human nosocomial pathogen. Here, we describe an automated, high-throughput screen of 37,200 compounds and natural product extracts for those that enhance survival of C. elegans infected with E. faecalis. Using a robot to dispense live, infected animals into 384-well plates and automated microscopy and image analysis, we identified 28 compounds and extracts not previously reported to have antimicrobial properties, including six structural classes that cure infected C. elegans animals but do not affect the growth of the pathogen in vitro, thus acting by a mechanism of action distinct from antibiotics currently in clinical use.

Assessing respiratory pathogen communities in bighorn sheep populations: Sampling realities, challenges, and improvements.

Directory of Open Access Journals (Sweden)

Carson J Butler

Full Text Available Respiratory disease has been a persistent problem for the recovery of bighorn sheep (Ovis canadensis, but has uncertain etiology. The disease has been attributed to several bacterial pathogens including Mycoplasma ovipneumoniae and Pasteurellaceae pathogens belonging to the Mannheimia, Bibersteinia, and Pasteurella genera. We estimated detection probability for these pathogens using protocols with diagnostic tests offered by a fee-for-service laboratory and not offered by a fee-for-service laboratory. We conducted 2861 diagnostic tests on swab samples collected from 476 bighorn sheep captured across Montana and Wyoming to gain inferences regarding detection probability, pathogen prevalence, and the power of different sampling methodologies to detect pathogens in bighorn sheep populations. Estimated detection probability using fee-for-service protocols was less than 0.50 for all Pasteurellaceae and 0.73 for Mycoplasma ovipneumoniae. Non-fee-for-service Pasteurellaceae protocols had higher detection probabilities, but no single protocol increased detection probability of all Pasteurellaceae pathogens to greater than 0.50. At least one protocol resulted in an estimated detection probability of 0.80 for each pathogen except Mannheimia haemolytica, for which the highest detection probability was 0.45. In general, the power to detect Pasteurellaceae pathogens at low prevalence in populations was low unless many animals were sampled or replicate samples were collected per animal. Imperfect detection also resulted in low precision when estimating prevalence for any pathogen. Low and variable detection probabilities for respiratory pathogens using live-sampling protocols may lead to inaccurate conclusions regarding pathogen community dynamics and causes of bighorn sheep respiratory disease epizootics. We recommend that agencies collect multiples samples per animal for Pasteurellaceae detection, and one sample for Mycoplasma ovipneumoniae detection from

Insights into Animal and Plant Lectins with Antimicrobial Activities

Directory of Open Access Journals (Sweden)

Renata de Oliveira Dias

2015-01-01

Full Text Available Lectins are multivalent proteins with the ability to recognize and bind diverse carbohydrate structures. The glyco -binding and diverse molecular structures observed in these protein classes make them a large and heterogeneous group with a wide range of biological activities in microorganisms, animals and plants. Lectins from plants and animals are commonly used in direct defense against pathogens and in immune regulation. This review focuses on sources of animal and plant lectins, describing their functional classification and tridimensional structures, relating these properties with biotechnological purposes, including antimicrobial activities. In summary, this work focuses on structural-functional elucidation of diverse lectin groups, shedding some light on host-pathogen interactions; it also examines their emergence as biotechnological tools through gene manipulation and development of new drugs.

Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

Science.gov (United States)

Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

2015-07-01

It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

Prevention of diarrhoea using pathogen specific monoclonal antibodies in an experimental enterotoxigenic E. coli infection in germfree piglets

NARCIS (Netherlands)

Geus, de B.; Harmsen, M.; Zijderveld, van F.

1998-01-01

In the present study we describe the effect of oral application of mAB specific for ETEC F4(ac) fimbriae in an experimental ETEC challenge model in neonatal germfree piglets. The results show that mAB, specific for different F4(ac) epitopes protect animals against ETEC specific pathology. Moreover,

Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiales pathogens of veterinary and public health significance.

Science.gov (United States)

Atif, Farhan Ahmad

2015-11-01

Anaplasma marginale and Anaplasma phagocytophilum are the most important tick-borne bacteria of veterinary and public health significance in the family Anaplasmataceae. The objective of current review is to provide knowledge on ecology and epidemiology of A. phagocytophilum and compare major similarities and differences of A. marginale and A. phagocytophilum. Bovine anaplasmosis is globally distributed tick-borne disease of livestock with great economic importance in cattle industry. A. phagocytophilum, a cosmopolitan zoonotic tick transmitted pathogen of wide mammalian hosts. The infection in domestic animals is generally referred as tick-borne fever. Concurrent infections exist in ticks, domestic and wild animals in same geographic area. All age groups are susceptible, but the prevalence increases with age. Movement of susceptible domestic animals from tick free non-endemic regions to disease endemic regions is the major risk factor of bovine anaplasmosis and tick-borne fever. Recreational activities or any other high-risk tick exposure habits as well as blood transfusion are important risk factors of human granulocytic anaplasmosis. After infection, individuals remain life-long carriers. Clinical anaplasmosis is usually diagnosed upon examination of stained blood smears. Generally, detection of serum antibodies followed by molecular diagnosis is usually recommended. There are problems of sensitivity and cross-reactivity with both the Anaplasma species during serological tests. Tetracyclines are the drugs of choice for treatment and elimination of anaplasmosis in animals and humans. Universal vaccine is not available for either A. marginale or A. phagocytophilum, effective against geographically diverse strains. Major control measures for bovine anaplasmosis and tick-borne fever include rearing of tick-resistant breeds, endemic stability, breeding Anaplasma-free herds, identification of regional vectors, domestic/wild reservoirs and control, habitat modification

9 CFR 78.43 - Validated brucellosis-free States.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Validated brucellosis-free States. 78.43 Section 78.43 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT... BRUCELLOSIS Designation of Brucellosis Areas § 78.43 Validated brucellosis-free States. Alabama, Alaska...

A novel challenge test incorporating irradiation (60Co) of compost sub-samples to validate thermal lethality towards pathogenic bacteria.

Science.gov (United States)

Moore, John E; Watabe, Miyuki; Stewart, Andrew; Cherie Millar, B; Rao, Juluri R

2009-01-01

required by law for composted products arising from rural industrialists producing pelleted fertilizers from re-composted animal agriculture wastes comprising pig slurry solids, poultry litter and spent mushroom compost, which carry residual food-borne pathogens with implications to the food chain including humans. Environmentally, sustainable means of recycling farm wastes require that final composted products are free of pathogens in compliance with environmental safety legislation before their release to the market. This test developed provides a science-based risk characterization tool for sustainably managing environmental safety by 'validating' thermal lethality of a given composting process or their derivatives achieved without compromising the sample integrity or ambiguity attached to microbiological validation involving steam sterilization or autoclaving procedures and helps audit the resurgent bacterial populations from surviving non-pathogenic organisms in the end-products of animal waste compost formulations.

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

Directory of Open Access Journals (Sweden)

Hansson Per

2005-11-01

Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

Molecular Diagnosis of Pathogenic Sporothrix Species.

Directory of Open Access Journals (Sweden)

Anderson Messias Rodrigues

2015-12-01

Full Text Available Sporotrichosis is a chronic (subcutaneous infection caused by thermodimorphic fungi in the order, Ophiostomatales. These fungi are characterized by major differences in routes of transmission, host predilections, species virulence, and susceptibilities to antifungals. Sporothrix species emerge in the form of outbreaks. Large zoonoses and sapronoses are ongoing in Brazil and China, respectively. Current diagnostic methods based on morphology and physiology are inaccurate due to closely related phenotypes with overlapping components between pathogenic and non-pathogenic Sporothrix. There is a critical need for new diagnostic tools that are specific, sensitive, and cost-effective.We developed a panel of novel markers, based on calmodulin (CAL gene sequences, for the large-scale diagnosis and epidemiology of clinically relevant members of the Sporothrix genus, and its relative, Ophiostoma. We identified specific PCR-based markers for S. brasiliensis, S. schenckii, S. globosa, S. mexicana, S. pallida, and O. stenoceras. We employed a murine model of disseminated sporotrichosis to optimize a PCR assay for detecting Sporothrix in clinical specimens.Primer-BLAST searches revealed candidate sequences that were conserved within a single species. Species-specific primers showed no significant homology with human, mouse, or microorganisms outside the Sporothrix genus. The detection limit was 10-100 fg of DNA in a single round of PCR for identifying S. brasiliensis, S. schenckii, S. globosa, S. mexicana, and S. pallida. A simple, direct PCR assay, with conidia as a source of DNA, was effective for rapid, low-cost genotyping. Samples from a murine model of disseminated sporotrichosis confirmed the feasibility of detecting S. brasiliensis and S. schenckii DNA in spleen, liver, lungs, heart, brain, kidney, tail, and feces of infected animals.This PCR-based method could successfully detect and identify a single species in samples from cultures and from clinical

Surveillance for early detection of low pathogenicity avian influenza in poultry

NARCIS (Netherlands)

Comin, A.

2012-01-01

Infection with low pathogenicity avian influenza (LPAI) virus is widespread and has led to outbreaks in domestic birds in many countries. Although infection does not pose a serious concern for animal heath, LPAI virus subtypes H5 and H7 can mutate into the highly pathogenic form (HPAI), which can

Spirochaetes as intestinal pathogens: Lessons from a Brachyspira genome

Directory of Open Access Journals (Sweden)

Hampson David J

2009-05-01

Full Text Available Abstract Anaerobic spirochaetes of the genus Brachyspira have long been known as important gut pathogens of pigs, but increasingly they are recognised as causing disease in birds and other animal species, including human beings. The genome sequence of the major swine pathogen Brachyspira hyodysenteriae was recently published, and this revealed extensive genome optimisation that leads to adaptation to the complex environment of the colon. The genome sequences of other pathogenic and non-pathogenic Brachyspira species are becoming available, and this data will help to reveal how these species have evolved and adapted to varied lifestyles in the large intestines of different species, and why some but not others can induce colitis and diarrhoea.

Currently important animal disease management issues in sub-Saharan Africa : policy and trade issues

Directory of Open Access Journals (Sweden)

G.R. Thomson

2009-09-01

Full Text Available The present international approach to management of transboundary animal diseases (TADs is based on the assumption that most can be eradicated ; consequently, that is the usual objective adopted by international organizations concerned with animal health. However, for sub-Saharan Africa and southern Africa more particularly, eradication of most TADs is impossible for the foreseeable future for a variety of technical, financial and logistical reasons. Compounding this, the present basis for access to international markets for products derived from animals requires that the area of origin (country or zone is free from trade-influencing TADs. The ongoing development of transfrontier conservation areas (TFCAs, extending across huge areas of southern Africa, therefore presents a development conundrum because it makes creation of geographic areas free from TADs more difficult and brings development based on wildlife conservation on the one hand and that based on livestock production on the other into sharp conflict. Sub-Saharan Africa is consequently confronted by a complex problem that contributes significantly to retarded rural development which, in turn, impedes poverty alleviation. In southern Africa specifically, foot-and-mouth disease (FMD presents the greatest problem in relation to access to international markets for animal products. However, it is argued that this problem could be overcome by a combination between (1 implementation of a commodity-based approach to trade in products derived from animals and (2 amendment of the international standards for FMD specifically (i.e. the FMD chapter in the Terrestrial Animal Health Code of the World Organisation for Animal Health [OIE] so that occurrence of SAT serotype viruses in free-living African buffalo need not necessarily mean exclusion of areas where buffalo occur from international markets for animal products. This would overcome a presently intractable constraint to market access for

Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans.

Science.gov (United States)

Zadoks, Ruth N; Middleton, John R; McDougall, Scott; Katholm, Jorgen; Schukken, Ynte H

2011-12-01

Mastitis, inflammation of the mammary gland, can be caused by a wide range of organisms, including gram-negative and gram-positive bacteria, mycoplasmas and algae. Many microbial species that are common causes of bovine mastitis, such as Escherichia coli, Klebsiella pneumoniae, Streptococcus agalactiae and Staphylococcus aureus also occur as commensals or pathogens of humans whereas other causative species, such as Streptococcus uberis, Streptococcus dysgalactiae subsp. dysgalactiae or Staphylococcus chromogenes, are almost exclusively found in animals. A wide range of molecular typing methods have been used in the past two decades to investigate the epidemiology of bovine mastitis at the subspecies level. These include comparative typing methods that are based on electrophoretic banding patterns, library typing methods that are based on the sequence of selected genes, virulence gene arrays and whole genome sequencing projects. The strain distribution of mastitis pathogens has been investigated within individual animals and across animals, herds, countries and host species, with consideration of the mammary gland, other animal or human body sites, and environmental sources. Molecular epidemiological studies have contributed considerably to our understanding of sources, transmission routes, and prognosis for many bovine mastitis pathogens and to our understanding of mechanisms of host-adaptation and disease causation. In this review, we summarize knowledge gleaned from two decades of molecular epidemiological studies of mastitis pathogens in dairy cattle and discuss aspects of comparative relevance to human medicine.

Epidemiology of Rhodotorula: An Emerging Pathogen

Science.gov (United States)

Wirth, Fernanda; Goldani, Luciano Z.

2012-01-01

This is an updated paper focusing on the general epidemiological aspects of Rhodotorula in humans, animals, and the environment. Previously considered nonpathogenic, Rhodotorula species have emerged as opportunistic pathogens that have the ability to colonise and infect susceptible patients. Rhodotorula species are ubiquitous saprophytic yeasts that can be recovered from many environmental sources. Several authors describe the isolation of this fungus from different ecosystems, including sites with unfavourable conditions. Compared to R. mucilaginosa, R. glutinis and R. minuta are less frequently isolated from natural environments. Among the few references to the pathogenicity of Rhodotorula spp. in animals, there are several reports of an outbreak of skin infections in chickens and sea animals and lung infections and otitis in sheep and cattle. Most of the cases of infection due to Rhodotorula in humans were fungemia associated with central venous catheter (CVC) use. The most common underlying diseases included solid and haematologic malignancies in patients who were receiving corticosteroids and cytotoxic drugs, the presence of CVC, and the use of broad-spectrum antibiotics. Unlike fungemia, some of the other localised infections caused by Rhodotorula, including meningeal, skin, ocular, peritoneal, and prosthetic joint infections, are not necessarily linked to the use of CVCs or immunosuppression. PMID:23091485

A fungal pathogen of amphibians, Batrachochytrium dendrobatidis, attenuates in pathogenicity with in vitro passages.

Science.gov (United States)

Langhammer, Penny F; Lips, Karen R; Burrowes, Patricia A; Tunstall, Tate; Palmer, Crystal M; Collins, James P

2013-01-01

Laboratory investigations into the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd), have accelerated recently, given the pathogen's role in causing the global decline and extinction of amphibians. Studies in which host animals were exposed to Bd have largely assumed that lab-maintained pathogen cultures retained the infective and pathogenic properties of wild isolates. Attenuated pathogenicity is common in artificially maintained cultures of other pathogenic fungi, but to date, it is unknown whether, and to what degree, Bd might change in culture. We compared zoospore production over time in two samples of a single Bd isolate having different passage histories: one maintained in artificial media for more than six years (JEL427-P39), and one recently thawed from cryopreserved stock (JEL427-P9). In a common garden experiment, we then exposed two different amphibian species, Eleutherodactylus coqui and Atelopus zeteki, to both cultures to test whether Bd attenuates in pathogenicity with in vitro passages. The culture with the shorter passage history, JEL427-P9, had significantly greater zoospore densities over time compared to JEL427-P39. This difference in zoospore production was associated with a difference in pathogenicity for a susceptible amphibian species, indicating that fecundity may be an important virulence factor for Bd. In the 130-day experiment, Atelopus zeteki frogs exposed to the JEL427-P9 culture experienced higher average infection intensity and 100% mortality, compared with 60% mortality for frogs exposed to JEL427-P39. This effect was not observed with Eleutherodactylus coqui, which was able to clear infection. We hypothesize that the differences in phenotypic performance observed with Atelopus zeteki are rooted in changes of the Bd genome. Future investigations enabled by this study will focus on the underlying mechanisms of Bd pathogenicity.

A fungal pathogen of amphibians, Batrachochytrium dendrobatidis, attenuates in pathogenicity with in vitro passages.

Directory of Open Access Journals (Sweden)

Penny F Langhammer

Full Text Available Laboratory investigations into the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd, have accelerated recently, given the pathogen's role in causing the global decline and extinction of amphibians. Studies in which host animals were exposed to Bd have largely assumed that lab-maintained pathogen cultures retained the infective and pathogenic properties of wild isolates. Attenuated pathogenicity is common in artificially maintained cultures of other pathogenic fungi, but to date, it is unknown whether, and to what degree, Bd might change in culture. We compared zoospore production over time in two samples of a single Bd isolate having different passage histories: one maintained in artificial media for more than six years (JEL427-P39, and one recently thawed from cryopreserved stock (JEL427-P9. In a common garden experiment, we then exposed two different amphibian species, Eleutherodactylus coqui and Atelopus zeteki, to both cultures to test whether Bd attenuates in pathogenicity with in vitro passages. The culture with the shorter passage history, JEL427-P9, had significantly greater zoospore densities over time compared to JEL427-P39. This difference in zoospore production was associated with a difference in pathogenicity for a susceptible amphibian species, indicating that fecundity may be an important virulence factor for Bd. In the 130-day experiment, Atelopus zeteki frogs exposed to the JEL427-P9 culture experienced higher average infection intensity and 100% mortality, compared with 60% mortality for frogs exposed to JEL427-P39. This effect was not observed with Eleutherodactylus coqui, which was able to clear infection. We hypothesize that the differences in phenotypic performance observed with Atelopus zeteki are rooted in changes of the Bd genome. Future investigations enabled by this study will focus on the underlying mechanisms of Bd pathogenicity.

Occurrence of antimicrobial resistance among bacterial pathogens

OpenAIRE

Hendriksen, Rene S.; Mevius, Dik J.; Schroeter, Andreas; Teale, Christopher; Jouy, Eric; Butaye, Patrick; Franco, Alessia; Utinane, Andra; Amado, Alice; Moreno, Miguel; Greko, Christina; Stärk, Katharina D.C.; Berghold, Christian; Myllyniemi, Anna-Liisa; Hoszowski, Andrzej

2008-01-01

Background: The project "Antibiotic resistance in bacteria of animal origin – II" (ARBAO-II) was funded by the European Union (FAIR5-QLK2-2002-01146) for the period 2003–05. The aim of this project was to establish a program for the continuous monitoring of antimicrobial susceptibility of pathogenic and indicator bacteria from food animals using validated and harmonised methodologies. In this report the first data on the occurrence of antimicrobial resistance among bacteria cau...

Enemy-free space and habitat-specific host specialization in a butterfly.

Science.gov (United States)

Wiklund, Christer; Friberg, Magne

2008-08-01

The majority of herbivorous insects have relatively specialized food habits. This suggests that specialization has some advantage(s) over generalization. Traditionally, feeding specialization has been thought to be linked to digestive or other food-related physiological advantages, but recent theory suggests that generalist natural enemies of herbivorous insects can also provide a major selective pressure for restricted host plant range. The European swallowtail butterfly Papilio machaon utilizes various plants in the Apiaceae family as hosts, but is an ecological specialist being monophagous on Angelica archangelica in southern Sweden. This perennial monocarp grows in three seaside habitat types: (1) on the barren rocky shore in the absence of any surrounding vegetation, (2) on the rocky shore with some surrounding vegetation, and (3) on species-rich meadows. The rocky shore habitat harbors few invertebrate generalist predators, whereas a number of invertebrate predators abound in the meadowland habitat. Here, we test the importance of enemy-free space for feeding specialization in Papilio machaon by assessing survival of larvae placed by hand on A. archangelica in each of the three habitat types, and by assessing the habitat-specificity of adult female egg-laying behavior by recording the distribution of eggs laid by free-flying adult females among the three habitat types. Larval survival was substantially higher in the rocky shore habitat than in the meadowland and significantly higher on host plants without surrounding vegetation on the rocky shore. Eggs laid by free-flying females were found in all three habitat types, but were significantly more frequent in the rocky shore habitat, suggesting that females prefer to lay eggs in the habitat type where offspring survival is highest. These results show that larval survivorship on the same host plant species can be strongly habitat-specific, and suggest that enemy-free space is an underlying factor that drives

Characteristics of Integrons and Associated Gene Cassettes in Antibiotic-Resistant Escherichia coli Isolated from Free-Ranging Food Animals in China.

Science.gov (United States)

Rehman, Mujeeb Ur; Zhang, Hui; Huang, Shucheng; Iqbal, Muhammad Kashif; Mehmood, Khalid; Luo, Houqiang; Li, Jiakui

2017-08-01

We investigated the occurrence of integrons in antibiotic-resistant Escherichia coli strains isolated from free-ranging food animals, including yaks, piglets, and chickens, in China, and characterized the gene cassettes harbored within the integrons. We examined 432 E. coli strains that exhibited resistance to at least one class of antibiotics. Integrase genes and associated gene cassettes were characterized by polymerase chain reaction (PCR) analysis, restriction fragment-length polymorphism, DNA sequencing, conjugation experiments, and plasmid analysis. Twenty-nine (6.7%) integrons were amplified from the 432 antimicrobial-resistant (AMR) isolates evaluated. Specifically, class 1 and 2 integrons were detected in 26 (6%) and 3 (0.7%) strains, respectively. Meanwhile, 6 different gene cassettes, dfrA1, dfr12, aadA1, aadA2, sat1, and orfF, were detected within 6 variable regions (VRs), of which the dfrA1 + aadA1 array was the most common, identified in 12 of 26 class 1 integrons (46.1%). Meanwhile, only one class 2 integron contained a cassette, and the remaining two contained undetermined VRs. Finally, a conjugation assay confirmed the transfer of 4 different types of class 1 integrons into recipient strains, with plasmid sizes ranging from 20 to 30 kb. This is the first report examining the baseline AMR characteristics of E. coli within an extensive farming system of livestock animals in China. Given that integrons were detected in >6% of resistant E. coli strains, precautionary measures are required to prevent the spread of mobile genetic resistance determinants in food animals and monitor their emergence. © 2017 Institute of Food Technologists®.

Diversity and role of cave-dwelling hematophagous insects in pathogen transmission in the Afrotropical region.

Science.gov (United States)

Obame-Nkoghe, Judicaël; Leroy, Eric-Maurice; Paupy, Christophe

2017-04-12

The progressive anthropization of caves for food resources or economic purposes increases human exposure to pathogens that naturally infect cave-dwelling animals. The presence of wild or domestic animals in the immediate surroundings of caves also may contribute to increasing the risk of emergence of such pathogens. Some zoonotic pathogens are transmitted through direct contact, but many others require arthropod vectors, such as blood-feeding insects. In Africa, hematophagous insects often play a key role in the epidemiology of many pathogens; however, their ecology in cave habitats remains poorly known. During the last decades, several investigations carried out in Afrotropical caves suggested the medical and veterinary importance particularly of insect taxa of the Diptera order. Therefore, the role of some of these insects as vectors of pathogens that infect cave-dwelling vertebrates has been studied. The present review summarizes these findings, brings insights into the diversity of cave-dwelling hematophagous Diptera and their involvement in pathogen transmission, and finally discusses new challenges and future research directions.

Host Jumps and Radiation, Not Co‐Divergence Drives Diversification of Obligate Pathogens. A Case Study in Downy Mildews and Asteraceae

Science.gov (United States)

Choi, Young-Joon; Thines, Marco

2015-01-01

Even though the microevolution of plant hosts and pathogens has been intensely studied, knowledge regarding macro-evolutionary patterns is limited. Having the highest species diversity and host-specificity among Oomycetes, downy mildews are a useful a model for investigating long-term host-pathogen coevolution. We show that phylogenies of Bremia and Asteraceae are significantly congruent. The accepted hypothesis is that pathogens have diverged contemporarily with their hosts. But maximum clade age estimation and sequence divergence comparison reveal that congruence is not due to long-term coevolution but rather due to host-shift driven speciation (pseudo-cospeciation). This pattern results from parasite radiation in related hosts, long after radiation and speciation of the hosts. As large host shifts free pathogens from hosts with effector triggered immunity subsequent radiation and diversification in related hosts with similar innate immunity may follow, resulting in a pattern mimicking true co-divergence, which is probably limited to the terminal nodes in many pathogen groups. PMID:26230508

[Evaluation of Fusarium spp. pathogenicity in plant and murine models].

Science.gov (United States)

Forero-Reyes, Consuelo M; Alvarado-Fernández, Angela M; Ceballos-Rojas, Ana M; González-Carmona, Lady C; Linares-Linares, Melva Y; Castañeda-Salazar, Rubiela; Pulido-Villamarín, Adriana; Góngora-Medina, Manuel E; Cortés-Vecino, Jesús A; Rodríguez-Bocanegra, María X

The genus Fusarium is widely recognized for its phytopathogenic capacity. However, it has been reported as an opportunistic pathogen in immunocompetent and immunocompromised patients. Thus, it can be considered a microorganism of interest in pathogenicity studies on different hosts. Therefore, this work evaluated the pathogenicity of Fusarium spp. isolates from different origins in plants and animals (murine hosts). Twelve isolates of Fusarium spp. from plants, animal superficial mycoses, and human superficial and systemic mycoses were inoculated in tomato, passion fruit and carnation plants, and in immunocompetent and immunosuppressed BALB/c mice. Pathogenicity tests in plants did not show all the symptoms associated with vascular wilt in the three plant models; however, colonization and necrosis of the vascular bundles, regardless of the species and origin of the isolates, showed the infective potential of Fusarium spp. in different plant species. Moreover, the pathogenicity tests in the murine model revealed behavioral changes. It was noteworthy that only five isolates (different origin and species) caused mortality. Additionally, it was observed that all isolates infected and colonized different organs, regardless of the species and origin of the isolates or host immune status. In contrast, the superficial inoculation test showed no evidence of epidermal injury or colonization. The observed results in plant and murine models suggest the pathogenic potential of Fusarium spp. isolates in different types of hosts. However, further studies on pathogenicity are needed to confirm the multihost capacity of this genus. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Development and evaluation of a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP) for rapid and simultaneous detection of ten pathogenic bacteria in aquatic animals.

Science.gov (United States)

Zhou, Qian-Jin; Wang, Lei; Chen, Jiong; Wang, Rui-Na; Shi, Yu-Hong; Li, Chang-Hong; Zhang, De-Min; Yan, Xiao-Jun; Zhang, Yan-Jun

2014-09-01

Rapid, low-cost, and user-friendly strategies are urgently needed for early disease diagnosis and timely treatment, particularly for on-site screening of pathogens in aquaculture. In this study, we successfully developed a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP), which was capable of simultaneously detecting 10 pathogenic bacteria in aquatic animals, i.e., Nocardia seriolae, Pseudomonas putida, Streptococcus iniae, Vibrio alginolyticus, Vibrio anguillarum, Vibrio fluvialis, Vibrio harveyi, Vibrio parahaemolyticus, Vibrio rotiferianus, and Vibrio vulnificus. The assay provided a nearly-automated approach, with only a single pipetting step per chip for sample dispensing. This technique could achieve limits of detection (LOD) ranging from 0.40 to 6.42pg per 1.414μL reaction in less than 30 min. The robust reproducibility was demonstrated by a little variation among duplications for each bacterium with the coefficient of variation (CV) for time to positive (Tp) value less than 0.10. The clinical sensitivity and specificity of this on-chip LAMP assay in detecting field samples were 96.2% and 93.8% by comparison with conventional microbiological methods. Compared with other well-known techniques, on-chip LAMP assay provides low sample and reagent consumption, ease-of-use, accelerated analysis, multiple bacteria and on-site detection, and high reproducibility, indicating that such a technique would be applicable for on-site detection and routine monitoring of multiple pathogens in aquaculture. Copyright © 2014 Elsevier B.V. All rights reserved.

Application of bacteriophages in post-harvest control of human pathogenic and food spoiling bacteria.

Science.gov (United States)

Pérez Pulido, Rubén; Grande Burgos, Maria José; Gálvez, Antonio; Lucas López, Rosario

2016-10-01

Bacteriophages have attracted great attention for application in food biopreservation. Lytic bacteriophages specific for human pathogenic bacteria can be isolated from natural sources such as animal feces or industrial wastes where the target bacteria inhabit. Lytic bacteriophages have been tested in different food systems for inactivation of main food-borne pathogens including Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Salmonella enterica, Shigella spp., Campylobacter jejuni and Cronobacter sakazkii, and also for control of spoilage bacteria. Application of lytic bacteriophages could selectively control host populations of concern without interfering with the remaining food microbiota. Bacteriophages could also be applied for inactivation of bacteria attached to food contact surfaces or grown as biofilms. Bacteriophages may receive a generally recognized as safe status based on their lack of toxicity and other detrimental effects to human health. Phage preparations specific for L. monocytogenes, E. coli O157:H7 and S. enterica serotypes have been commercialized and approved for application in foods or as part of surface decontamination protocols. Phage endolysins have a broader host specificity compared to lytic bacteriophages. Cloned endolysins could be used as natural preservatives, singly or in combination with other antimicrobials such as bacteriocins.

Diversification of an emerging pathogen in a biodiversity hotspot: Leptospira in endemic small mammals of Madagascar.

Science.gov (United States)

Dietrich, Muriel; Wilkinson, David A; Soarimalala, Voahangy; Goodman, Steven M; Dellagi, Koussay; Tortosa, Pablo

2014-06-01

Biodiversity hotspots and associated endemism are ideal systems for the study of parasite diversity within host communities. Here, we investigated the ecological and evolutionary forces acting on the diversification of an emerging bacterial pathogen, Leptospira spp., in communities of endemic Malagasy small mammals. We determined the infection rate with pathogenic Leptospira in 20 species of sympatric rodents (subfamily Nesomyinae) and tenrecids (family Tenrecidae) at two eastern humid forest localities. A multilocus genotyping analysis allowed the characterization of bacterial diversity within small mammals and gave insights into their genetic relationships with Leptospira infecting endemic Malagasy bats (family Miniopteridae and Vespertilionidae). We report for the first time the presence of pathogenic Leptospira in Malagasy endemic small mammals, with an overall prevalence of 13%. In addition, these hosts harbour species of Leptospira (L. kirschneri, L. borgpetersenii and L. borgpetersenii group B) which are different from those reported in introduced rats (L. interrogans) on Madagascar. The diversification of Leptospira on Madagascar can be traced millions of years into evolutionary history, resulting in the divergence of endemic lineages and strong host specificity. These observations are discussed in relation to the relative roles of endemic vs. introduced mammal species in the evolution and epidemiology of Leptospira on Madagascar, specifically how biodiversity and biogeographical processes can shape community ecology of an emerging pathogen and lead to its diversification within native animal communities. © 2014 John Wiley & Sons Ltd.

Farm scale electrical power production from animal waste. Volume I. Final report, 30 June 1981-30 December 1983

Energy Technology Data Exchange (ETDEWEB)

Carpenter, P.A.

1984-01-31

A 1 1/2 (dry) tons per day biodigester cogeneration plant has been designed and constructed. This project is part of a federal program to promote energy conservation and the use of non-conventional energy resources. The main purpose of the project is to demonstrate that a dairy farm can generate its own power and supply excess power to a local utility. Such a facility can produce significant energy savings to livestock farms and small communities by allowing them to get energy from raw animal and human waste. Also, an odorless by-product is produced that is nearly pathogenically free and has the possibility of several end uses such as: fertilizer and soil conditioner, protein-rich animal refeed, livestock bedding material, and aquatic food for fish farming. 53 references, 18 figures, 4 tables.

Molecular investigation of tick-borne pathogens in dogs from Luanda, Angola.

Science.gov (United States)

Cardoso, Luís; Oliveira, Ana Cristina; Granada, Sara; Nachum-Biala, Yaarit; Gilad, Matan; Lopes, Ana Patrícia; Sousa, Sérgio Ramalho; Vilhena, Hugo; Baneth, Gad

2016-05-10

No molecular data have been available on tick-borne pathogens that infect dogs from Angola. The occurrence of agents from the genera Anaplasma, Babesia, Ehrlichia and Hepatozoon was assessed in 103 domestic dogs from Luanda, by means of the polymerase chain reaction (PCR) and DNA sequence analysis. Forty-six dogs (44.7 %) were positive for at least one pathogen. Twenty-one animals (20.4 %) were found infected with Anaplasma platys, 18 (17.5 %) with Hepatozoon canis, six (5.8 %) with Ehrlichia canis, six (5.8 %) with Babesia vogeli, one (1.0 %) with Babesia gibsoni and one (1.0 %) with an unnamed Babesia sp. The molecular frequency of single infections taken together was 37.9 % and that of co-infections with several combinations of two pathogens accounted for 6.8 % of the animals. This is the first report of A. platys, B. vogeli, B. gibsoni, E. canis and H. canis infections diagnosed by PCR in domestic dogs from Angola. The present study provides evidence that dogs in Luanda are widely exposed to, and at risk of becoming infected with, tick-borne pathogens. Further investigation is needed, including a larger number of animals, canine populations from other cities and provinces of the country, as well as potential vector ticks, aiming at better characterizing and controlling canine vector-borne diseases in Angola.

Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

Science.gov (United States)

Proudhon, D; Wei, J; Briat, J; Theil, E C

1996-03-01

Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

Animal Contact Exhibits_Legal Epidemiology Research Procedure and Code Book_2016

Data.gov (United States)

U.S. Department of Health & Human Services — Animals at petting zoos and agricultural fairs can be carriers of pathogens, such as Escherichia coli. Disease outbreaks at animal contact exhibits can be prevented...

Ticks on captive and free-living wild animals in northeastern Brazil.

Science.gov (United States)

Dantas-Torres, Filipe; Ferreira, Débora R A; de Melo, Louise M; Lima, Polly-Ana C P; Siqueira, Daniel B; Rameh-de-Albuquerque, Luciana C; de Melo, Adriana V; Ramos, Janaina A C

2010-02-01

From 2005 to 2009, 147 ticks found on 32 wild animals from or referred to two zoobotanical parks (Parque Zoobotânico Arruda Câmara and Parque Estadual Dois Irmãos) located in northeastern Brazil were identified. Ticks found on two veterinarians working in one of the parks (i.e., Parque Estadual Dois Irmãos), after return from forested areas within the park's territory, were also identified. The following tick-host associations were recorded: Amblyomma fuscum Neumann on Boa constrictor L.; Amblyomma longirostre Koch on Ramphastos vitellinus ariel Vigors and Coendou prehensilis (L.); Amblyomma varium Koch on Bradypus variegates Schinz; Amblyomma rotundatum Koch on Chelonoidis carbonaria (Spix), Chelonoidis denticulata (L.), Micrurus ibiboboca (Merrem), Python molurus bivittatus Kuhl, Iguana iguana (L.) and B. variegatus; Amblyomma nodosum Neumann on Myrmecophaga tridactyla L. and Tamandua tetradactyla (L.); and Rhipicephalus sanguineus (Latreille) on Nasua nasua (L.). The ticks found on the veterinarians were identified as nine Amblyomma larvae. The presence of Am. nodosum in Pernambuco and Am. rotundatum and Am. varium in Paraíba is recorded for the first time and the occurrence of Am. longirostre in Pernambuco is confirmed. Ramphastos vitellinus ariel is a new host record for Am. longirostre whereas M. ibiboboca and B. variegatus are new host records for Am. rotundatum. Finally, the human parasitism by Amblyomma ticks is reported for the first time in Pernambuco, highlighting the potential of tick-borne pathogen transmission in this state.

RNAi suppressors encoded by pathogenic human viruses

NARCIS (Netherlands)

de Vries, Walter; Berkhout, Ben

2008-01-01

RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

In Silico Prediction of Human Pathogenicity in the gamma-Proteobacteria

DEFF Research Database (Denmark)

Andreatta, Massimo; Nielsen, Morten; Aarestrup, Frank Møller

2010-01-01

to be able to separate pathogenic organisms from non-pathogenic ones. Using traditional experimental methods for this purpose can be very costly and time-consuming, and also uncertain since animal models are not always good predictors for pathogenicity in humans. Bioinformatics-based methods are therefore...... tested. An additional validation on an independent test-set assigned correctly 22 out of 24 bacteria. Conclusions: The proposed approach was demonstrated to go beyond the species bias imposed by evolutionary relatedness, and performs better than predictors based solely on taxonomy or sequence similarity...

Dynamics of fecal indicator bacteria, bacterial pathogen genes, and organic wastewater contaminants in the Little Calumet River: Portage Burns Waterway, Indiana

Science.gov (United States)

Haack, Sheridan K.; Duris, Joseph W.

2013-01-01

Little information exists on the co-occurrence of fecal indicator bacteria (FIB), bacterial pathogens, and organic wastewater-associated chemicals (OWCs) within Great Lakes tributaries. Fifteen watershed sites and one beach site adjacent to the Little Calumet River–Portage Burns Waterway (LCRPBW) on Lake Michigan were tested on four dates for pH, dissolved oxygen, specific conductance, chloride, color, ammonia- and nitrate-nitrogen, soluble phosphorus, sulfate, turbidity, and atrazine; for concentrations of FIB; and for genes indicating the presence of human-pathogenic enterococci (ENT) and of Shiga-toxin producing Escherichia coli (EC) from various animal sources. Nineteen samples were also tested for 60 OWCs. Half of the watershed samples met EC recreational water quality standards; none met ENT standards. Human-wastewater-associated OWC detections were correlated with human-influence indicators such as population/km2, chloride concentrations, and the presence of WWTP effluents, but EC and ENT concentrations were not. Bacterial pathogen genes indicated rural human and several potential animal sources. OWCs of human or ecosystem health concern (musk fragrances AHTN and HHCB, alkylphenols, carbamazepine) and 3 bacterial pathogen genes were detected at the mouth of the LCRPBW, but no such OWCs and only 1 pathogen gene were detected at the beach. The LCRPBW has significant potential to deliver FIB, potential bacterial pathogens, and OWCs of human or ecosystem health concern to the nearshore of Lake Michigan, under conditions enhancing nearshore transport of the river plume. Nearshore mixing of lake and river water, and the lack of relationship between OWCs and FIB or pathogen genes, pose numerous challenges for watershed and nearshore assessment and remediation.

Escherichia coli Contamination of Lettuce Grown in Soils Amended with Animal Slurry

DEFF Research Database (Denmark)

Jensen, Annette Nygaard; Storm, Christina; Forslund, Anita

2013-01-01

A pilot study was conducted to assess the transfer of Escherichia coli from animal slurry fertilizer to lettuce, with E. coli serving as an indicator of fecal contamination and as an indicator for potential bacterial enteric pathogens. Animal slurry was applied as fertilizer to three Danish agric...... types between slurry, soil, and lettuce. The frequent finding of fecal-contaminated lettuce indicates that human pathogens such as Salmonella and Campylobacter can be present and represent food safety hazards.......A pilot study was conducted to assess the transfer of Escherichia coli from animal slurry fertilizer to lettuce, with E. coli serving as an indicator of fecal contamination and as an indicator for potential bacterial enteric pathogens. Animal slurry was applied as fertilizer to three Danish....... coli. A relatively higher frequency of E. coli in lettuce compared with the soil samples at harvest suggests environmental sources of fecal contamination, e.g., wildlife. The higher frequency was supported by the finding of 21 different PFGE types among the E. coli isolates, with only a few common PFGE...

Harmonizing methods for wildlife abundance estimation and pathogen detection in Europe-a questionnaire survey on three selected host-pathogen combinations

DEFF Research Database (Denmark)

Schulz, Jana; Ryser-Degiorgis, Marie-Pierre; Kuiken, Thijs

2017-01-01

Background: The need for wildlife health surveillance as part of disease control in wildlife, domestic animals and humans on the global level is widely recognized. However, the objectives, methods and intensity of existing wildlife health surveillance programs vary greatly among European countries......, resulting in a patchwork of data that are difficult to merge and compare. This survey aimed at evaluating the need and potential for data harmonization in wildlife health in Europe. The specific objective was to collect information on methods currently used to estimate host abundance and pathogen prevalence...... estimation, there is an urgent need to develop tools for the routine collection of host abundance data in a harmonized way. Wildlife health experts are encouraged to apply the harmonized APHAEA protocols in epidemiological studies in wildlife and to increase cooperation....

Discovery based and targeted Mass Spectrometry in farm animal proteomics

DEFF Research Database (Denmark)

Bendixen, Emøke

2013-01-01

for investigating farm animal biology. SRM is particularly important for validation biomarker candidates This talk will introduce the use of different mass spectrometry approaches through examples related to food quality and animal welfare, including studies of gut health in pigs, host pathogen interactions...

The wild life of tick-borne pathogens

NARCIS (Netherlands)

Hofmeester, Tim R.

2016-01-01

Diseases that are transmitted by arthropod vectors from animal hosts to humans – so called zoonotic vector-borne diseases – have increased in incidence in the last decades. In North America and Europe, tick-borne pathogens cause the majority of vector-borne diseases, including Lyme borreliosis

HybProbes-based real-time PCR assay for specific identification of Streptomyces scabies and Streptomyces europaeiscabiei, the potato common scab pathogens.

Science.gov (United States)

Xu, R; Falardeau, J; Avis, T J; Tambong, J T

2016-02-01

The aim of this study was to develop and validate a HybProbes-based real-time PCR assay targeting the trpB gene for specific identification of Streptomyces scabies and Streptomyces europaeiscabiei. Four primer pairs and a fluorescent probe were designed and evaluated for specificity in identifying S. scabies and Streptomyces europaeiscabiei, the potato common scab pathogens. The specificity of the HybProbes-based real-time PCR assay was evaluated using 46 bacterial strains, 23 Streptomyces strains and 23 non-Streptomyces bacterial species. Specific and strong fluorescence signals were detected from all nine strains of S. scabies and Streptomyces europaeiscabiei. No fluorescence signal was detected from 14 strains of other Streptomyces species and all non-Streptomyces strains. The identification was corroborated by the melting curve analysis that was performed immediately after the amplification step. Eight of the nine S. scabies and S. europaeiscabiei strains exhibited a unique melting peak, at Tm of 69·1°C while one strain, Warba-6, had a melt peak at Tm of 65·4°C. This difference in Tm peaks could be attributed to a guanine to cytosine mutation in strain Warba-6 at the region spanning the donor HybProbe. The reported HybProbes assay provides a more specific tool for accurate identification of S. scabies and S. europaeiscabiei strains. This study reports a novel assay based on HybProbes chemistry for rapid and accurate identification of the potato common scab pathogens. Since the HybProbes chemistry requires two probes for positive identification, the assay is considered to be more specific than conventional PCR or TaqMan real-time PCR. The developed assay would be a useful tool with great potential in early diagnosis and detection of common scab pathogens of potatoes in infected plants or for surveillance of potatoes grown in soil environment. © 2015 Her Majesty the Queen in Right of Canada © 2015 The Society for Applied Microbiology.

Structure-function analysis of barley NLR immune receptor MLA10 reveals its cell compartment specific activity in cell death and disease resistance.

NARCIS (Netherlands)

Bai, S.; Liu, J.; Chang, C.; Zhang, L.; Maekawa, T.; Wang, Q.; Xiao, W.; Liu, Y.; Chai, J.; Takken, F.L.W.; Schulze-Lefert, P.; Shen, Q.H.

2012-01-01

Plant intracellular immune receptors comprise a large number of multi-domain proteins resembling animal NOD-like receptors (NLRs). Plant NLRs typically recognize isolate-specific pathogen-derived effectors, encoded by avirulence (AVR) genes, and trigger defense responses often associated with

Genotype‐specific pathogenic effects in human dilated cardiomyopathy

Science.gov (United States)

Schuldt, Maike; Harakalova, Magdalena; Vink, Aryan; Asselbergs, Folkert W.; Pinto, Jose R.; Krüger, Martina; Kuster, Diederik W. D.; van der Velden, Jolanda

2017-01-01

Key points Mutations in genes encoding cardiac troponin I (TNNI3) and cardiac troponin T (TNNT2) caused altered troponin protein stoichiometry in patients with dilated cardiomyopathy. TNNI3p.98trunc resulted in haploinsufficiency, increased Ca2+‐sensitivity and reduced length‐dependent activation. TNNT2p.K217del caused increased passive tension.A mutation in the gene encoding Lamin A/C (LMNA p.R331Q) led to reduced maximal force development through secondary disease remodelling in patients suffering from dilated cardiomyopathy.Our study shows that different gene mutations induce dilated cardiomyopathy via diverse cellular pathways. Abstract Dilated cardiomyopathy (DCM) can be caused by mutations in sarcomeric and non‐sarcomeric genes. In this study we defined the pathogenic effects of three DCM‐causing mutations: the sarcomeric mutations in genes encoding cardiac troponin I (TNNI3p.98truncation) and cardiac troponin T (TNNT2p.K217deletion; also known as the p.K210del) and the non‐sarcomeric gene mutation encoding lamin A/C (LMNAp.R331Q). We assessed sarcomeric protein expression and phosphorylation and contractile behaviour in single membrane‐permeabilized cardiomyocytes in human left ventricular heart tissue. Exchange with recombinant troponin complex was used to establish the direct pathogenic effects of the mutations in TNNI3 and TNNT2. The TNNI3p.98trunc and TNNT2p.K217del mutation showed reduced expression of troponin I to 39% and 51%, troponin T to 64% and 53%, and troponin C to 73% and 97% of controls, respectively, and altered stoichiometry between the three cardiac troponin subunits. The TNNI3p.98trunc showed pure haploinsufficiency, increased Ca2+‐sensitivity and impaired length‐dependent activation. The TNNT2p.K217del mutation showed a significant increase in passive tension that was not due to changes in titin isoform composition or phosphorylation. Exchange with wild‐type troponin complex corrected troponin protein levels to 83% of

Incorporating risk communication into highly pathogenic avian influenza preparedness and response efforts.

Science.gov (United States)

Voss, Shauna J; Malladi, Sasidhar; Sampedro, Fernando; Snider, Tim; Goldsmith, Timothy; Hueston, William D; Lauer, Dale C; Halvorson, David A

2012-12-01

A highly pathogenic avian influenza (HPAI) outbreak in the United States will initiate a federal emergency response effort that will consist of disease control and eradication efforts, including quarantine and movement control measures. These movement control measures will not only apply to live animals but also to animal products. However, with current egg industry "just-in-time" production practices, limited storage is available to hold eggs. As a result, stop movement orders can have significant unintended negative consequences, including severe disruptions to the food supply chain. Because stakeholders' perceptions of risk vary, waiting to initiate communication efforts until an HPAI event occurs can hinder disease control efforts, including the willingness of producers to comply with the response, and also can affect consumers' demand for the product. A public-private-academic partnership was formed to assess actual risks involved in the movement of egg industry products during an HPAI event through product specific, proactive risk assessments. The risk analysis process engaged a broad representation of stakeholders and promoted effective risk management and communication strategies before an HPAI outbreak event. This multidisciplinary team used the risk assessments in the development of the United States Department of Agriculture, Highly Pathogenic Avian Influenza Secure Egg Supply Plan, a comprehensive response plan that strives to maintain continuity of business. The collaborative approach that was used demonstrates how a proactive risk communication strategy that involves many different stakeholders can be valuable in the development of a foreign animal disease response plan and build working relationships, trust, and understanding.

Phenotypic interactions between tree hosts and invasive forest pathogens in the light of globalization and climate change.

Science.gov (United States)

Stenlid, Jan; Oliva, Jonàs

2016-12-05

Invasive pathogens can cause considerable damage to forest ecosystems. Lack of coevolution is generally thought to enable invasive pathogens to bypass the defence and/or recognition systems in the host. Although mostly true, this argument fails to predict intermittent outcomes in space and time, underlining the need to include the roles of the environment and the phenotype in host-pathogen interactions when predicting disease impacts. We emphasize the need to consider host-tree imbalances from a phenotypic perspective, considering the lack of coevolutionary and evolutionary history with the pathogen and the environment, respectively. We describe how phenotypic plasticity and plastic responses to environmental shifts may become maladaptive when hosts are faced with novel pathogens. The lack of host-pathogen and environmental coevolution are aligned with two global processes currently driving forest damage: globalization and climate change, respectively. We suggest that globalization and climate change act synergistically, increasing the chances of both genotypic and phenotypic imbalances. Short moves on the same continent are more likely to be in balance than if the move is from another part of the world. We use Gremmeniella abietina outbreaks in Sweden to exemplify how host-pathogen phenotypic interactions can help to predict the impacts of specific invasive and emergent diseases.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Author(s).

Phenotypic interactions between tree hosts and invasive forest pathogens in the light of globalization and climate change

Science.gov (United States)

2016-01-01

Invasive pathogens can cause considerable damage to forest ecosystems. Lack of coevolution is generally thought to enable invasive pathogens to bypass the defence and/or recognition systems in the host. Although mostly true, this argument fails to predict intermittent outcomes in space and time, underlining the need to include the roles of the environment and the phenotype in host–pathogen interactions when predicting disease impacts. We emphasize the need to consider host–tree imbalances from a phenotypic perspective, considering the lack of coevolutionary and evolutionary history with the pathogen and the environment, respectively. We describe how phenotypic plasticity and plastic responses to environmental shifts may become maladaptive when hosts are faced with novel pathogens. The lack of host–pathogen and environmental coevolution are aligned with two global processes currently driving forest damage: globalization and climate change, respectively. We suggest that globalization and climate change act synergistically, increasing the chances of both genotypic and phenotypic imbalances. Short moves on the same continent are more likely to be in balance than if the move is from another part of the world. We use Gremmeniella abietina outbreaks in Sweden to exemplify how host–pathogen phenotypic interactions can help to predict the impacts of specific invasive and emergent diseases. This article is part of the themed issue ‘Tackling emerging fungal threats to animal health, food security and ecosystem resilience’. PMID:28080981

Effectiveness of the combined evaluation of KLK3 genetics and free-to-total prostate specific antigen ratio for prostate cancer diagnosis.

Science.gov (United States)

Zambon, Carlo-Federico; Prayer-Galetti, Tommaso; Basso, Daniela; Padoan, Andrea; Rossi, Elisa; Secco, Silvia; Pelloso, Michela; Fogar, Paola; Navaglia, Filippo; Moz, Stefania; Zattoni, Filiberto; Plebani, Mario

2012-10-01

Of serum prostate specific antigen variability 40% depends on inherited factors. We ascertained whether the knowledge of KLK3 genetics would enhance prostate specific antigen diagnostic performance in patients with clinical suspicion of prostate cancer. We studied 1,058 men who consecutively underwent prostate biopsy for clinical suspicion of prostate cancer. At histology prostate cancer was present in 401 cases and absent in 657. Serum total prostate specific antigen and the free-to-total prostate specific antigen ratio were determined. Four polymorphisms of the KLK3 gene (rs2569733, rs2739448, rs925013 and rs2735839) and 1 polymorphism of the SRD5A2 gene (rs523349) were studied. The influence of genetics on prostate specific antigen variability was evaluated by multivariate linear regression analysis. The performance of total prostate specific antigen and the free-to-total prostate specific antigen ratio alone or combined with a genetically based patient classification were defined by ROC curve analyses. For prostate cancer diagnosis the free-to-total prostate specific antigen ratio index alone (cutoff 11%) was superior to total prostate specific antigen (cutoff 4 ng/ml) and to free-to-total prostate specific antigen ratio reflex testing (positive predictive value 61%, 43% and 54%, respectively). Prostate specific antigen correlated with KLK3 genetics (rs2735839 polymorphism p = 0.001, and rs2569733, rs2739448 and rs925013 haplotype combination p = 0.003). In patients with different KLK3 genetics 2 optimal free-to-total prostate specific antigen ratio cutoffs (11% and 14.5%) were found. For free-to-total prostate specific antigen ratio values between 11% and 14.5% the prostate cancer probability ranged from 30.0% to 47.4% according to patient genetics. The free-to-total prostate specific antigen ratio is superior to total prostate specific antigen for prostate cancer diagnosis, independent of total prostate specific antigen results. Free-to-total prostate

Effects of Gamma Irradiation and Pasteurization on the Nutritive Composition of Commercially Available Animal Diets

Science.gov (United States)

Caulfield, Catherine D; Cassidy, Joseph P; Kelly, John P

2008-01-01

Gamma radiation is used to sterilize diets for specific pathogen-free (SPF) animals. Because a gamma-irradiated diet was linked to leukoencephalomyelopathy in SPF cats, we investigated the effects of ‘typical’ (28.9–34.3 kGy) and ‘high-end’ (38.4–48.7 kGy) doses of gamma irradiation and of pasteurization (at 107 °C for 15 min) on the amounts of fat; protein; carbohydrate (and taurine in cat diet); vitamins A, E, B1, B2, B6, and B12; and peroxide in commercially available dry cat, dog, and rodent diets. The only treatment-related changes occurred with vitamin A and peroxide. The typical and high-end doses of gamma irradiation reduced the vitamin A level of the cat diet to 42% and 30% of the untreated value, respectively—levels below recommended allowances for growth and reproduction. Only the higher irradiation dose reduced vitamin A in the rodent diet, and neither dose altered the canine diet. Pasteurization reduced the vitamin A content of the cat diet to 50% of its original level, which was within the recommended level for this species. Irradiation increased the peroxide content of all 3 animal diets: by approximately 11-fold with the typical dose and by 14- to 25-fold with the high-end dose. Therefore gamma irradiation can have profound, selective effects on the vitamin A and peroxide contents of dry diets, and caution is advised when feeding such diets long-term and exclusively to SPF animals, particularly cats. Furthermore, pasteurization (with its fewer deleterious effects) may represent an alternative method of decontaminating diets for rodents, dogs, and cats. PMID:19049256

Antigen-specific tolerance inhibits autoimmune uveitis in pre-sensitized animals by deletion and CD4+CD25+ T-regulatory cells.

Science.gov (United States)

Matta, Bharati; Jha, Purushottam; Bora, Puran S; Bora, Nalini S

2010-02-01

The objective of this study was to inhibit experimental autoimmune anterior uveitis (EAAU) by establishing antigen-specific immune tolerance in animals pre-sensitized with melanin-associated antigen (MAA). Intravenous administration of MAA on days 6, 7, 8 and 9 post-immunization induced tolerance and inhibited EAAU in all Lewis rats. The number of cells (total T cells, CD4(+) T cells and CD8(+) T cells) undergoing apoptosis dramatically increased in the popliteal lymph nodes (LNs) of the tolerized animals compared with non-tolerized animals. In addition, Fas ligand (FasL), TNF receptor 1 (TNFR1) and caspase-8 were upregulated in tolerized rats. Proliferation of total lymphocytes, CD4(+)T cells and CD8(+) T cells (harvested from the popliteal LNs) in response to antigenic stimulation was drastically reduced in the state of tolerance compared with the cells from non-tolerized animals. The level of interferon (IFN)-gamma and IL-2 decreased, whereas TGF-beta2 was elevated in the state of tolerance. Furthermore, the number of CD4(+)CD25(+)FoxP3(+) regulatory T cells (Tregs) increased in the popliteal LNs of tolerized animals compared with non-tolerized animals. In conclusion, our results suggest that deletion of antigen-specific T cells by apoptosis and active suppression mediated by Tregs has an important role in the induction of antigen specific immune tolerance in animals with an established immune response against MAA.

Controlling highly pathogenic avian influenza outbreaks : An epidemiological and economic model analysis

NARCIS (Netherlands)

Backer, J. A.; van Roermund, H. J W; Fischer, Egil; van Asseldonk, M. A P M; Bergevoet, R. H M

2015-01-01

Outbreaks of highly pathogenic avian influenza (HPAI) can cause large losses for the poultry sector and for animal disease controlling authorities, as well as risks for animal and human welfare. In the current simulation approach epidemiological and economic models are combined to compare different

Salmonella typhimurium DT104: a virulent and drug-resistant pathogen.

OpenAIRE

Poppe, C; Smart, N; Khakhria, R; Johnson, W; Spika, J; Prescott, J

1998-01-01

Salmonella typhimurium phage type (PT) or definitive type (DT) 104 is a virulent pathogen for humans and animals, particularly cattle. It has been isolated increasingly from humans and animals in the United Kingdom and several other European countries and, more recently, in the United States and Canada. Humans may acquire the infection from foods of animal origin contaminated with the infective organism. Farm families are particularly at risk of acquiring the infection by contact with infecte...

Immunogenicity and safety of a tetravalent E. coli O-antigen bioconjugate vaccine in animal models.

Science.gov (United States)

van den Dobbelsteen, Germie P J M; Faé, Kellen C; Serroyen, Jan; van den Nieuwenhof, Ingrid M; Braun, Martin; Haeuptle, Micha A; Sirena, Dominique; Schneider, Joerg; Alaimo, Cristina; Lipowsky, Gerd; Gambillara-Fonck, Veronica; Wacker, Michael; Poolman, Jan T

2016-07-29

Extra-intestinal pathogenic Escherichia coli (ExPEC) are major human pathogens; however, no protective vaccine is currently available. We assessed in animal models the immunogenicity and safety of a 4-valent E. coli conjugate vaccine (ExPEC-4V, serotypes O1, O2, O6 and O25 conjugated to Exotoxin A from Pseudomonas aeruginosa (EPA)) produced using a novel in vivo bioconjugation method. Three doses of ExPEC-4V (with or without aluminum hydroxide) were administered to rabbits (2μg or 20μg per O-antigen, subcutaneously), mice (0.2μg or 2μg per O-antigen, subcutaneously) and rats (0.4μg or 4μg per O-antigen, intramuscularly). Antibody persistence and boostability were evaluated in rats using O6-EPA monovalent conjugate (0.4μg O-antigen/dose, intramuscularly). Toxicity was assessed in rats (16μg total polysaccharide, intramuscularly). Serum IgG and IgM antibodies were measured by ELISA. Robust antigen-specific IgG responses were observed in all animal models, with increased responses in rabbits when administered with adjuvant. O antigen-specific antibody responses persisted up to 168days post-priming. Booster immunization induced a rapid recall response. Toxicity of ExPEC-4V when administered to rats was considered to be at the no observed adverse effect level. ExPEC-4V conjugate vaccine showed good immunogenicity and tolerability in animal models supporting progression to clinical evaluation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of Tskaltubo radon mineral waters on aggressive behavior of animals and distribution of free amino acids in structures of the brain

International Nuclear Information System (INIS)

Oniani, D.; Mchedluri, T.; Oniani, T.; Museliani, T.; Grebenchuk, G.; Nikolaishvili, M.

2006-01-01

The analysis of experimental results allow claiming that desamination of the amino acids by radon after treatment with Tskaltubo radon mineral water, decreases and normalizes free amino acids, which is reflected in behavior of animals - aggressive behavior is decreasing and they became more tame. (author)

PCR evaluation of selected vector-borne pathogens in dogs with pericardial effusion.

Science.gov (United States)

Tabar, M-D; Movilla, R; Serrano, L; Altet, L; Francino, O; Roura, X

2018-04-01

To investigate evidence for selected vector-borne pathogen infections in dogs with pericardial effusion living in a Mediterranean area in which several canine vector-borne diseases are endemic. Archived EDTA blood (n=68) and pericardial fluid samples (n=58) from dogs with pericardial effusion (n=68) were included. Dogs without pericardial effusion examined for other reasons were included as controls (n=60). Pericardial effusion was classified as neoplastic in 40 dogs, idiopathic in 23 dogs and of unknown aetiology in 5 dogs. Real-time PCR was performed for Leishmania infantum, Ehrlichia/Anaplasma species, Hepatozoon canis, Babesia species, Rickettsia species and Bartonella species, and sequencing of PCR products from positive samples was used to confirm species specificity. Vector-borne pathogens were found in 18 dogs: 16 of 68 dogs with pericardial effusion (23·5%) and two of 60 control dogs (3·3%). Positive dogs demonstrated DNA of Leishmania infantum (n=7), Anaplasma platys (n=2, one dog coinfected with Leishmania infantum), Babesia canis (n=5), Babesia gibsoni (n=3) and Hepatozoon canis (n=2). Vector-borne pathogens were more commonly detected among dogs with pericardial effusion than controls (P=0·001). There was no relationship between aetiology of the pericardial effusion and evidence of vector-borne pathogens (P=0·932). Vector-borne pathogens are often detected in dogs with pericardial effusion and require further investigation, especially in dogs with idiopathic pericardial effusion. PCR can provide additional information about the potential role of vector-borne pathogens in dogs with pericardial effusion living in endemic areas. © 2018 British Small Animal Veterinary Association.

Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

Directory of Open Access Journals (Sweden)

Jin Gui

2011-01-01

Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

Medication of Production Animals – Cure of Malfunctioning Animals or Production Systems?

Directory of Open Access Journals (Sweden)

Chrièl Mariann

2003-03-01

Full Text Available Medication is used in all intensive animal productions. However, the increasing problems with resistant bacteria in all animal productions and in humans are supported by a number of reports. Special attention is given to the risk for transmitting food-borne (multi resistant zoonotic agents to humans due to failure in antibiotic treatment resulting in lower cure rates or higher case fatality rates. The use of medication in humans per se is capable of selecting for resistance in human pathogens. Nevertheless, the amount of used medication/antimicrobials in treatment of Danish production animals goes far beyond the amount used for human consumption. The increase in consumption has not been followed by a similarly increased mortality, e.g. illustrated by the number of rendered animals, increased use of injection medicine for veterinary treatments of diseased animals, or increased number of remarks on the carcasses from the slaughterhouses. Medication in animal production is facing its limits and relevant economic alternatives have to be developed. The strategy for the future must concentrate on using medication only for clinically diseased animals and not as a strategic treatment of the whole herd in order to maximise growth and camouflage of suboptimal production systems and insufficient management.