Directory of Open Access Journals (Sweden)
Deanna N Edwards
Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.
Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân
2009-11-25
Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.
Seven essential questions on G-quadruplexes.
König, Sebastian L B; Evans, Amanda C; Huppert, Julian L
2010-08-01
The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.
Altered biochemical specificity of G-quadruplexes with mutated tetrads
Czech Academy of Sciences Publication Activity Database
Švehlová, Kateřina; Lawrence, M. S.; Bednárová, Lucie; Curtis, Edward A.
2016-01-01
Roč. 44, č. 22 (2016), s. 10789-10803 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : G-quadruplex * G motif GTP aptamer * peroxidase deoxyribozyme Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/44/22/10789/2333933/Altered-biochemical-specificity-of-G-quadruplexes
GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.
Directory of Open Access Journals (Sweden)
Kohal Das
Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.
Directory of Open Access Journals (Sweden)
Giovanna Sattin
Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.
Transcriptional control by G-quadruplexes: In vivo roles and perspectives for specific intervention.
Armas, Pablo; David, Aldana; Calcaterra, Nora B
2017-01-01
G-quadruplexes are non-canonical DNA secondary structures involved in several genomic and molecular processes. Here, we summarize the main G-quadruplex features and evidences proving the in vivo role on the transcriptional regulation of genes required for zebrafish embryonic development. We also discuss alternative strategies for specifically interfering G-quadruplex in vivo.
Tan, Wei; Yi, Long; Zhu, Zhentao; Zhang, Lulu; Zhou, Jiang; Yuan, Gu
2018-03-01
A guanine-rich human mature microRNA, miR-1587, was discovered to form stable intramolecular G-quadruplexes in the presence of K + , Na + and low concentration of NH 4 + (25mM) by electrospray ionization mass spectrometry (ESI-MS) combined with circular dichroism (CD) spectroscopy. Furthermore, under high concentration of NH 4 + (100mM) or molecular crowding environments, miR-1587 formed a dimeric G-quadruplex through 3'-to-3' stacking of two monomeric G-quadruplex subunits with one ammonium ion sandwiched between the interfaces. Specifically, two synthesized jatrorrhizine derivatives with terminal amine groups could also induce the dimerization of miR-1587 G-quadruplex and formed 1:1 and 2:1 complexes with the dimeric G-quadruplex. In contrast, jatrorrhizine could bind with the dimeric miR-1587 G-quadruplex, but could not induce dimerization of miR-1587 G-quadruplex. These results provide a new strategy to regulate the functions of miR-1587 through induction of G-quadruplex formation and dimerization. Copyright © 2017 Elsevier B.V. All rights reserved.
Sun, Daekyu; Hurley, Laurence H
2010-01-01
The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.
Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A
2018-06-01
Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.
Zheng, Ke-Wei; He, Yi-de; Liu, Hong-He; Li, Xin-Min; Hao, Yu-Hua; Tan, Zheng
2017-10-20
Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes in vivo. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications.
McAninch, Damian S; Heinaman, Ashley M; Lang, Cara N; Moss, Kathryn R; Bassell, Gary J; Rita Mihailescu, Mihaela; Evans, Timothy L
2017-07-25
G quadruplex structures have been predicted by bioinformatics to form in the 5'- and 3'-untranslated regions (UTRs) of several thousand mature mRNAs and are believed to play a role in translation regulation. Elucidation of these roles has primarily been focused on the 3'-UTR, with limited focus on characterizing the G quadruplex structures and functions in the 5'-UTR. Investigation of the affinity and specificity of RNA binding proteins for 5'-UTR G quadruplexes and the resulting regulatory effects have also been limited. Among the mRNAs predicted to form a G quadruplex structure within the 5'-UTR is the survival motor neuron domain containing 1 (SMNDC1) mRNA, encoding a protein that is critical to the spliceosome. Additionally, this mRNA has been identified as a potential target of the fragile X mental retardation protein (FMRP), whose loss of expression leads to fragile X syndrome. FMRP is an RNA binding protein involved in translation regulation that has been shown to bind mRNA targets that form G quadruplex structures. In this study we have used biophysical methods to investigate G quadruplex formation in the 5'-UTR of SMNDC1 mRNA and analyzed its interactions with FMRP. Our results show that SMNDC1 mRNA 5'-UTR forms an intramolecular, parallel G quadruplex structure comprised of three G quartet planes, which is bound specifically by FMRP both in vitro and in mouse brain lysates. These findings suggest a model by which FMRP might regulate the translation of a subset of its mRNA targets by recognizing the G quadruplex structure present in their 5'-UTR, and affecting their accessibility by the protein synthesis machinery.
Electrochemical and AFM Characterization of G-Quadruplex Electrochemical Biosensors and Applications
2018-01-01
Guanine-rich DNA sequences are able to form G-quadruplexes, being involved in important biological processes and representing smart self-assembling nanomaterials that are increasingly used in DNA nanotechnology and biosensor technology. G-quadruplex electrochemical biosensors have received particular attention, since the electrochemical response is particularly sensitive to the DNA structural changes from single-stranded, double-stranded, or hairpin into a G-quadruplex configuration. Furthermore, the development of an increased number of G-quadruplex aptamers that combine the G-quadruplex stiffness and self-assembling versatility with the aptamer high specificity of binding to a variety of molecular targets allowed the construction of biosensors with increased selectivity and sensitivity. This review discusses the recent advances on the electrochemical characterization, design, and applications of G-quadruplex electrochemical biosensors in the evaluation of metal ions, G-quadruplex ligands, and other small organic molecules, proteins, and cells. The electrochemical and atomic force microscopy characterization of G-quadruplexes is presented. The incubation time and cations concentration dependence in controlling the G-quadruplex folding, stability, and nanostructures formation at carbon electrodes are discussed. Different G-quadruplex electrochemical biosensors design strategies, based on the DNA folding into a G-quadruplex, the use of G-quadruplex aptamers, or the use of hemin/G-quadruplex DNAzymes, are revisited. PMID:29666699
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
Xanthene and Xanthone Derivatives as G-Quadruplex Stabilizing Ligands
Directory of Open Access Journals (Sweden)
Alessandro Altieri
2013-10-01
Full Text Available Following previous studies on anthraquinone and acridine-based G-quadruplex ligands, here we present a study of similar aromatic cores, with the specific aim of increasing G-quadruplex binding and selectivity with respect to duplex DNA. Synthesized compounds include two and three-side chain xanthone and xanthene derivatives, as well as a dimeric “bridged” form. ESI and FRET measurements suggest that all the studied molecules are good G-quadruplex ligands, both at telomeres and on G-quadruplex forming sequences of oncogene promoters. The dimeric compound and the three-side chain xanthone derivative have been shown to represent the best compounds emerging from the different series of ligands presented here, having also high selectivity for G-quadruplex structures with respect to duplex DNA. Molecular modeling simulations are in broad agreement with the experimental data.
Zheng, Ke-wei; Xiao, Shan; Liu, Jia-quan; Zhang, Jia-yu; Hao, Yu-hua; Tan, Zheng
2013-05-01
G-quadruplex formation in genomic DNA is considered to regulate transcription. Previous investigations almost exclusively focused on intramolecular G-quadruplexes formed by DNA carrying four or more G-tracts, and structure formation has rarely been studied in physiologically relevant processes. Here, we report an almost entirely neglected, but actually much more prevalent form of G-quadruplexes, DNA:RNA hybrid G-quadruplexes (HQ) that forms in transcription. HQ formation requires as few as two G-tracts instead of four on a non-template DNA strand. Potential HQ sequences (PHQS) are present in >97% of human genes, with an average of 73 PHQSs per gene. HQ modulates transcription under both in vitro and in vivo conditions. Transcriptomal analysis of human tissues implies that maximal gene expression may be limited by the number of PHQS in genes. These features suggest that HQs may play fundamental roles in transcription regulation and other transcription-mediated processes.
Wang, Ming-Qi; Ren, Gui-Ying; Zhao, Shuang; Lian, Guang-Chang; Chen, Ting-Ting; Ci, Yang; Li, Hong-Yao
2018-06-01
G-quadruplex DNAs are highly prevalent in the human genome and involved in many important biological processes. However, many aspects of their biological mechanism and significance still need to be elucidated. Therefore, the development of fluorescent probes for G-quadruplex detection is important for the basic research. We report here on the development of small molecular dyes designed on the basis of carbazole scaffold by introducing styrene-like substituents at its 9-position, for the purpose of G-quadruplex recognition. Results revealed that the side group on the carbazole scaffold was very important for their ability to selectively recognize G-quadruplex DNA structures. 1a with the pyridine side group displayed excellent fluorescence signal turn-on property for the specific discrimination of G-quadruplex DNAs against other nucleic acids. The characteristics of 1a were further investigated with UV-vis spectrophotometry, fluorescence, circular dichroism, FID assay and molecular docking to validate the selectivity, sensitivity and detailed binding mode toward G-quadruplex DNAs.
Extended molecular dynamics of a c-kit promoter quadruplex
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Krepl, Miroslav; Koča, J.; Neidle, S.; Haider, S.; Šponer, Jiří
2015-01-01
Roč. 43, č. 18 (2015), s. 8673-8693 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : TELOMERIC G-QUADRUPLEX * INTRAMOLECULAR DNA QUADRUPLEXES * GASTROINTESTINAL STROMAL TUMOR Subject RIV: BO - Biophysics Impact factor: 9.202, year: 2015
Effect of Urea on G-Quadruplex Stability.
Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V
2017-07-13
G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the
Multimerization rules for G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kolesnikova, Sofia; Hubálek, Martin; Bednárová, Lucie; Cvačka, Josef; Curtis, Edward A.
2017-01-01
Roč. 45, č. 15 (2017), s. 8684-8696 ISSN 0305-1048 Institutional support: RVO:61388963 Keywords : tetramolecular G-quadruplexes * RNA G-quadruplexes * circular dichroism Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article/45/15/8684/4002725/Multimerization-rules-for-Gquadruplexes
Guanine base stacking in G-quadruplex nucleic acids
Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2013-01-01
G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.
Directory of Open Access Journals (Sweden)
Li-Ping Bai
Full Text Available With the aim of enhancing G-quadruplex binding activity, two new glucosaminosides (16, 18 of penta-methylated epigallocatechin were synthesized by chemical glycosylation. Subsequent ESI-TOF-MS analysis demonstrated that these two glucosaminoside derivatives exhibit much stronger binding activity to human telomeric DNA and RNA G-quadruplexes than their parent structure (i.e., methylated EGC (14 as well as natural epigallocatechin (EGC, 6. The DNA G-quadruplex binding activity of 16 and 18 is even more potent than strong G-quadruplex binder quercetin, which has a more planar structure. These two synthetic compounds also showed a higher binding strength to human telomeric RNA G-quadruplex than its DNA counterpart. Analysis of the structure-activity relationship revealed that the more basic compound, 16, has a higher binding capacity with DNA and RNA G-quadruplexes than its N-acetyl derivative, 18, suggesting the importance of the basicity of the aminoglycoside for G-quadruplex binding activity. Molecular docking simulation predicted that the aromatic ring of 16 π-stacks with the aromatic ring of guanine nucleotides, with the glucosamine moiety residing in the groove of G-quadruplex. This research indicates that glycosylation of natural products with aminosugar can significantly enhance their G-quadruplex binding activities, thus is an effective way to generate small molecules targeting G-quadruplexes in nucleic acids. In addition, this is the first report that green tea catechin can bind to nucleic acid G-quadruplex structures.
Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S
2017-09-12
The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.
Directory of Open Access Journals (Sweden)
Li-Na Zhu
Full Text Available The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl-21H,23H-porphyrin (TMPyP4, interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinylethoxy]phenyl} porphyrin (TMPipEOPP, with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Directory of Open Access Journals (Sweden)
Emmanuel O Ariyo
Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.
Efficient Long-Range Hole Transport Through G-Quadruplexes.
Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei
2017-10-09
DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Design, synthesis and evaluation of 4,7-diamino-1,10-phenanthroline G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Borch, Jonas; Ulven, Trond
2009-01-01
the central ionic column. Introduction of positively charged side chains results in compounds with appreciable G-quadruplex stabilizing properties and high aqueous solubility, with the longer side chains giving more potent compounds. Ligands carrying guanidine side chains in general show higher quadruplex...... stabilizing activity and distinctly slower kinetic properties than their amino and dimethylamino analogues, possibly due to specific hydrogen bond interactions with the G-quadruplex loops....
A multi-functional guanine derivative for studying the DNA G-quadruplex structure.
Ishizuka, Takumi; Zhao, Pei-Yan; Bao, Hong-Liang; Xu, Yan
2017-10-23
In the present study, we developed a multi-functional guanine derivative, 8F G, as a G-quadruplex stabilizer, a fluorescent probe for the detection of G-quadruplex formation, and a 19 F sensor for the observation of the G-quadruplex. We demonstrate that the functional nucleoside bearing a 3,5-bis(trifluoromethyl)benzene group at the 8-position of guanine stabilizes the DNA G-quadruplex structure and fluoresces following the G-quadruplex formation. Furthermore, we show that the functional sensor can be used to directly observe DNA G-quadruplexes by 19 F-NMR in living cells. To our knowledge, this is the first study showing that the nucleoside derivative simultaneously allows for three kinds of functions at a single G-quadruplex DNA. Our results suggest that the multi-functional nucleoside derivative can be broadly used for studying the G-quadruplex structure and serves as a powerful tool for examining the molecular basis of G-quadruplex formation in vitro and in living cells.
Li, Zhe; Lech, Christopher Jacques; Phan, Anh Tuân
2014-01-01
G-quadruplex-forming oligonucleotides containing modified nucleotide chemistries have demonstrated promising pharmaceutical potential. In this work, we systematically investigate the effects of sugar-modified guanosines on the structure and stability of a (4+0) parallel and a (3+1) hybrid G-quadruplex using over 60 modified sequences containing a single-position substitution of 2′-O-4′-C-methylene-guanosine (LNAG), 2′-deoxy-2′-fluoro-riboguanosine (FG) or 2′-deoxy-2′-fluoro-arabinoguanosine (FANAG). Our results are summarized in two parts: (I) Generally, LNAG substitutions into ‘anti’ position guanines within a guanine-tetrad lead to a more stable G-quadruplex, while substitutions into ‘syn’ positions disrupt the native G-quadruplex conformation. However, some interesting exceptions to this trend are observed. We discover that a LNAG modification upstream of a short propeller loop hinders G-quadruplex formation. (II) A single substitution of either FG or FANAG into a ‘syn’ position is powerful enough to perturb the (3+1) G-quadruplex. Substitution of either FG or FANAG into any ‘anti’ position is well tolerated in the two G-quadruplex scaffolds. FANAG substitutions to ‘anti’ positions are better tolerated than their FG counterparts. In both scaffolds, FANAG substitutions to the central tetrad layer are observed to be the most stabilizing. The observations reported herein on the effects of LNAG, FG and FANAG modifications on G-quadruplex structure and stability will enable the future design of pharmaceutically relevant oligonucleotides. PMID:24371274
Dual Recognition of Human Telomeric G-quadruplex by Neomycin-anthraquinone Conjugate
Ranjan, Nihar; Davis, Erik; Xue, Liang
2013-01-01
The authors report the recognition of a G-quadruplex formed by four repeat human telomeric DNA with aminosugar intercalator conjugates. The recognition of G-quadruplex through dual binding mode ligands significantly increased the affinity of ligands for G-quadruplex. One such example is a neomycin-anthraquinone 2 which exhibited nanomolar affinity for the quadruplex, and the affinity of 2 is nearly 1000 fold higher for human telomeric G-quadruplex DNA than its constituent units, neomycin and anthraquinone. PMID:23698792
Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik
2013-03-05
Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.
G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.
Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela
2015-09-22
Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.
Experimental approaches to identify cellular G-quadruplex structures and functions.
Di Antonio, Marco; Rodriguez, Raphaël; Balasubramanian, Shankar
2012-05-01
Guanine-rich nucleic acids can fold into non-canonical DNA secondary structures called G-quadruplexes. The formation of these structures can interfere with the biology that is crucial to sustain cellular homeostases and metabolism via mechanisms that include transcription, translation, splicing, telomere maintenance and DNA recombination. Thus, due to their implication in several biological processes and possible role promoting genomic instability, G-quadruplex forming sequences have emerged as potential therapeutic targets. There has been a growing interest in the development of synthetic molecules and biomolecules for sensing G-quadruplex structures in cellular DNA. In this review, we summarise and discuss recent methods developed for cellular imaging of G-quadruplexes, and the application of experimental genomic approaches to detect G-quadruplexes throughout genomic DNA. In particular, we will discuss the use of engineered small molecules and natural proteins to enable pull-down, ChIP-Seq, ChIP-chip and fluorescence imaging of G-quadruplex structures in cellular DNA. Copyright © 2012 Elsevier Inc. All rights reserved.
Heterocyclic Dications as a New Class of Telomeric G-Quadruplex Targeting Agents
Nanjunda, Rupesh; Musetti, Caterina; Kumar, Arvind; Ismail, Mohamed A.; Farahat, Abdelbasset A.; Wang, Siming; Sissi, Claudia; Palumbo, Manlio; Boykin, David W.; Wilson, W. David
2013-01-01
Small molecules that can induce and stabilize G-quadruplex DNA structures represent a novel approach for anti-cancer and anti-parasitic therapy and extensive efforts have been directed towards discovering lead compounds that are capable of stabilizing quadruplexes. The purpose of this study is to explore conformational modifications in a series of heterocyclic dications to discover structural motifs that can selectively bind and stabilize specific G-quadruplexes, such as those present in the human telomere. The G-quadruplex has various potential recognition sites for small molecules; however, the primary interaction site of most of these ligands is the terminal tetrads. Similar to duplex-DNA groove recognition, quadruplex groove recognition by small molecules offers the potential for enhanced selectivity that can be developed into a viable therapeutic strategy. The compounds investigated were selected based on preliminary studies with DB832, a bifuryl-phenyl diamidine with a unique telomere interaction. This compound provides a paradigm that can help in understanding the optimum compound-DNA interactions that lead to quadruplex groove recognition. DNA recognition by the DB832 derivatives was investigated by biophysical experiments such as thermal melting, circular dichroism, mass spectrometry and NMR. Biological studies were also performed to complement the biophysical data. The results suggest a complex binding mechanism which involves the recognition of grooves for some ligands as well as stacking at the terminal tetrads of the human telomeric G-quadruplex for most of the ligands. These molecules represent an excellent starting point for further SAR analysis for diverse modes of quadruplex recognition and subsequent structure optimization for drug development. PMID:22380518
UvrD in Deinococcus radiodurans is optimized for processing G-quadruplex DNA
International Nuclear Information System (INIS)
Das, Anubrata; Misra, H.S.
2015-01-01
Deinococcus radiodurans R1 is a radiation resistant Gram-positive bacterium capable of tolerating very high doses of DNA-damaging agents such as gamma radiation (D10 ∼ 12kGy) desiccation (∼ 5% relative humidity), UVC radiation (D10 ∼ 800J/m 2 ) and hydrogen peroxide (40 mM). It achieves this by using a complex regulatory mechanism and novel proteins. Recently bioinformatic analysis showed several stretches of guanine runs in D.radiodurans genome, which could form G-quartets. The role of G-quartets in regulatory processes is well documented in various organisms. The presence of G -quartets in D. radiodurans means that there are regulatory or structural proteins which would bind to these elements. Several proteins are known to bind G-quartets. Finding the proteins which would bind to G4 DNA is difficult as no specific motifs are available for binding these elements. Also most of the known proteins that are shown to bind to G-quadruplex DNA are of eukaryotic nature. To overcome these challenges we defined a set of known G-quadruplex binding proteins and used a smith-waterman algorithm with our own scoring matrix to homologs of G-quadruplex binding proteins in D.radiodurans. Using bioinformatics analysis, we showed that UvrD (DR 1775) of D. radiodurans has ability to bind/translocate along G-quadruplex DNA, a novel feature in prokaryotes. The translocase activity of DR1775 is ATP specific and this ATPase activity is attenuated by ssDNA. Data supporting UvrD of D. radiodurans as a G-quadruplex DNA metabolizing proteins would be presented. (author)
DNA secondary structures: stability and function of G-quadruplex structures
Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.
2013-01-01
In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257
Monovalent cation induced structural transitions in telomeric DNAs: G-DNA folding intermediates
International Nuclear Information System (INIS)
Hardin, C.C.; Watson, T.; Henderson, E.; Prosser, J.K.
1991-01-01
Telomeric DNA consists of G- and C-rich strands that are always polarized such that the G-rich strand extends past the 3' end of the duplex to form a 12-16-base overhang. These overhanging strands can self-associate in vitro to form intramolecular structures that have several unusual physical properties and at least one common feature, the presence of non-Watson-Crick G·G base pairs. The term G-DNA was coined for this class of structures. On the basis of gel electrophoresis, imino proton NMR, and circular dichroism (CD) results, the authors find that changing the counterions from sodium to potassium specifically induces conformational transitions in the G-rich telomeric DNA from Tetrahymena, d(T 2 G 4 ) 4 (TET4), which results in a change from the intramolecular species to an apparent multistranded structure, accompanied by an increase in the melting temperature of the base pairs of >25 degree, as monitored by loss of the imino proton NMR signals. They infer that the multistranded structure is a quadruplex. The results indicate that specific differences in ionic interactions can result in a switch in telomeric DNAs between intramolecular hairpin-like or quadruplex-containing species and intermolecular quadruplex structures, all of which involve G·G base pairing interaction. They propose a model in which duplex or hairpin forms of G-DNA are folding intermediates in the formation of either 1-, 2-, or 4-stranded quadruplex structures
Yan, Yi-Yong; Tan, Jia-Heng; Lu, Yu-Jing; Yan, Siu-Cheong; Wong, Kwok-Yin; Li, Ding; Gu, Lian-Quan; Huang, Zhi-Shu
2013-10-01
G-Quadruplex is a highly polymorphic structure, and its behavior in acidic condition has not been well studied. Circular dichroism (CD) spectra were used to study the conformational change of G-quadruplex. The thermal stabilities of the G-quadruplex were measured with CD melting. Interconversion kinetics profiles were investigated by using CD kinetics. The fluorescence of the inserted 2-Aminopurine (Ap) was monitored during pH change and acrylamide quenching, indicating the status of the loop. Proton NMR was adopted to help illustrate the change of the conformation. G-Quadruplex of specific loop was found to be able to transform upon pH variation. The transformation was resulted from the loop rearrangement. After screening of a library of diverse G-quadruplex, a sequence exhibiting the best transformation property was found. A pH-driven nanoswitch with three gears was obtained based on this transition cycle. Certain G-quadruplex was found to go through conformational change at low pH. Loop was the decisive factor controlling the interconversion upon pH variation. G-Quadruplex with TT central loop could be converted in a much milder condition than the one with TTA loop. It can be used to design pH-driven nanodevices such as a nanoswitch. These results provide more insights into G-quadruplex polymorphism, and also contribute to the design of DNA-based nanomachines and logic gates. © 2013.
Selectivity in ligand recognition of G-quadruplex loops.
Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen
2009-03-03
A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Studies of G-quadruplexes formed within self-assembled DNA mini-circles.
Klejevskaja, Beata; Pyne, Alice L B; Reynolds, Matthew; Shivalingam, Arun; Thorogate, Richard; Hoogenboom, Bart W; Ying, Liming; Vilar, Ramon
2016-10-13
We have developed self-assembled DNA mini-circles that contain a G-quadruplex-forming sequence from the c-Myc oncogene promoter and demonstrate by FRET that the G-quadruplex unfolding kinetics are 10-fold slower than for the simpler 24-mer G-quadruplex that is commonly used for FRET experiments.
Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.
Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân
2016-01-04
G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Macrocyclic G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, M C; Ulven, Trond
2010-01-01
are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...
Disordering of human telomeric G-quadruplex with novel antiproliferative anthrathiophenedione.
Directory of Open Access Journals (Sweden)
Dmitry Kaluzhny
Full Text Available Linear heteroareneanthracenediones have been shown to interfere with DNA functions, thereby causing death of human tumor cells and their drug resistant counterparts. Here we report the interaction of our novel antiproliferative agent 4,11-bis[(2-{[acetimido]amino}ethylamino]anthra[2,3-b]thiophene-5,10-dione with telomeric DNA structures studied by isothermal titration calorimetry, circular dichroism and UV absorption spectroscopy. New compound demonstrated a high affinity (K(ass∼10⁶ M⁻¹ for human telomeric antiparallel quadruplex d(TTAGGG₄ and duplex d(TTAGGG₄∶d(CCCTAA₄. Importantly, a ∼100-fold higher affinity was determined for the ligand binding to an unordered oligonucleotide d(TTAGGG TTAGAG TTAGGG TTAGGG unable to form quadruplex structures. Moreover, in the presence of Na+ the compound caused dramatic conformational perturbation of the telomeric G-quadruplex, namely, almost complete disordering of G-quartets. Disorganization of a portion of G-quartets in the presence of K+ was also detected. Molecular dynamics simulations were performed to illustrate how the binding of one molecule of the ligand might disrupt the G-quartet adjacent to the diagonal loop of telomeric G-quadruplex. Our results provide evidence for a non-trivial mode of alteration of G-quadruplex structure by tentative antiproliferative drugs.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
G-quadruplexes as novel cis-elements controlling transcription during embryonic development.
David, Aldana P; Margarit, Ezequiel; Domizi, Pablo; Banchio, Claudia; Armas, Pablo; Calcaterra, Nora B
2016-05-19
G-quadruplexes are dynamic structures folded in G-rich single-stranded DNA regions. These structures have been recognized as a potential nucleic acid based mechanism for regulating multiple cellular processes such as replication, transcription and genomic maintenance. So far, their transcriptional role in vivo during vertebrate embryonic development has not yet been addressed. Here, we performed an in silico search to find conserved putative G-quadruplex sequences (PQSs) within proximal promoter regions of human, mouse and zebrafish developmental genes. Among the PQSs able to fold in vitro as G-quadruplex, those present in nog3, col2a1 and fzd5 promoters were selected for further studies. In cellulo studies revealed that the selected G-quadruplexes affected the transcription of luciferase controlled by the SV40 nonrelated promoter. G-quadruplex disruption in vivo by microinjection in zebrafish embryos of either small ligands or DNA oligonucleotides complementary to the selected PQSs resulted in lower transcription of the targeted genes. Moreover, zebrafish embryos and larvae phenotypes caused by the presence of complementary oligonucleotides fully resembled those ones reported for nog3, col2a1 and fzd5 morphants. To our knowledge, this is the first work revealing in vivo the role of conserved G-quadruplexes in the embryonic development, one of the most regulated processes of the vertebrates biology. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Simultaneous G-Quadruplex DNA Logic.
Bader, Antoine; Cockroft, Scott L
2018-04-03
A fundamental principle of digital computer operation is Boolean logic, where inputs and outputs are described by binary integer voltages. Similarly, inputs and outputs may be processed on the molecular level as exemplified by synthetic circuits that exploit the programmability of DNA base-pairing. Unlike modern computers, which execute large numbers of logic gates in parallel, most implementations of molecular logic have been limited to single computing tasks, or sensing applications. This work reports three G-quadruplex-based logic gates that operate simultaneously in a single reaction vessel. The gates respond to unique Boolean DNA inputs by undergoing topological conversion from duplex to G-quadruplex states that were resolved using a thioflavin T dye and gel electrophoresis. The modular, addressable, and label-free approach could be incorporated into DNA-based sensors, or used for resolving and debugging parallel processes in DNA computing applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Guan, Ai-Jiao; Shen, Meng-Jie; Xiang, Jun-Feng; Zhang, En-Xuan; Li, Qian; Sun, Hong-Xia; Wang, Li-Xia; Xu, Guang-Zhi; Tang, Ya-Lin; Xu, Li-Jin; Gong, Han-Yuan
2015-05-01
Nucleic acid based molecular device is a developing research field which attracts great interests in material for building machinelike nanodevices. G-quadruplex, as a new type of DNA secondary structures, can be harnessed to construct molecular device owing to its rich structural polymorphism. Herein, we developed a switching system based on G-quadruplexes and methylazacalix[6]pyridine (MACP6). The induced circular dichroism (CD) signal of MACP6 was used to monitor the switch controlled by temperature or pH value. Furthermore, the CD titration, Job-plot, variable temperature CD and 1H-NMR experiments not only confirmed the binding mode between MACP6 and G-quadruplex, but also explained the difference switching effect of MACP6 and various G-quadruplexes. The established strategy has the potential to be used as the chiral probe for specific G-quadruplex recognition.
Gilbert-Girard, Shella; Gravel, Annie; Artusi, Sara; Richter, Sara N; Wallaschek, Nina; Kaufer, Benedikt B; Flamand, Louis
2017-07-15
Human herpesviruses 6A and 6B (HHV-6A/B) can integrate their genomes into the telomeres of human chromosomes using a mechanism that remains poorly understood. To achieve a better understanding of the HHV-6A/B integration mechanism, we made use of BRACO-19, a compound that stabilizes G-quadruplex secondary structures and prevents telomere elongation by the telomerase complex. First, we analyzed the folding of telomeric sequences into G-quadruplex structures and their binding to BRACO-19 using G-quadruplex-specific antibodies and surface plasmon resonance. Circular dichroism studies indicate that BRACO-19 modifies the conformation and greatly stabilizes the G-quadruplexes formed in G-rich telomeric DNA. Subsequently we assessed the effects of BRACO-19 on the HHV-6A initial phase of infection. Our results indicate that BRACO-19 does not affect entry of HHV-6A DNA into cells. We next investigated if stabilization of G-quadruplexes by BRACO-19 affected HHV-6A's ability to integrate its genome into host chromosomes. Incubation of telomerase-expressing cells with BRACO-19, such as HeLa and MCF-7, caused a significant reduction in the HHV-6A integration frequency ( P integration frequency in U2OS cells that lack telomerase activity and elongate their telomeres through alternative lengthening mechanisms. Our data suggest that the fluidity of telomeres is important for efficient chromosomal integration of HHV-6A and that interference with telomerase activity negatively affects the generation of cellular clones containing integrated HHV-6A. IMPORTANCE HHV-6A/B can integrate their genomes into the telomeres of infected cells. Telomeres consist of repeated hexanucleotides (TTAGGG) of various lengths (up to several kilobases) and end with a single-stranded 3' extension. To avoid recognition and induce a DNA damage response, the single-stranded overhang folds back on itself and forms a telomeric loop (T-loop) or adopts a tertiary structure, referred to as a G-quadruplex. In the
Local epigenetic reprogramming induced by G-quadruplex ligands
Guilbaud, Guillaume; Murat, Pierre; Recolin, Bénédicte; Campbell, Beth C.; Maiter, Ahmed; Sale, Julian E.; Balasubramanian, Shankar
2017-11-01
DNA and histone modifications regulate transcriptional activity and thus represent valuable targets to reprogram the activity of genes. Current epigenetic therapies target the machinery that regulates these modifications, leading to global transcriptional reprogramming with the potential for extensive undesired effects. Epigenetic information can also be modified as a consequence of disrupting processive DNA replication. Here, we demonstrate that impeding replication by small-molecule-mediated stabilization of G-quadruplex nucleic acid secondary structures triggers local epigenetic plasticity. We report the use of the BU-1 locus of chicken DT40 cells to screen for small molecules able to induce G-quadruplex-dependent transcriptional reprogramming. Further characterization of the top hit compound revealed its ability to induce a dose-dependent inactivation of BU-1 expression in two steps: the loss of H3K4me3 and then subsequent DNA cytosine methylation, changes that were heritable across cell divisions even after the compound was removed. Targeting DNA secondary structures thus represents a potentially new approach for locus-specific epigenetic reprogramming.
Xanthine and 8-oxoguanine in G-quadruplexes: formation of a G·G·X·O tetrad.
Cheong, Vee Vee; Heddi, Brahim; Lech, Christopher Jacques; Phan, Anh Tuân
2015-12-02
G-quadruplexes are four-stranded structures built from stacked G-tetrads (G·G·G·G), which are planar cyclical assemblies of four guanine bases interacting through Hoogsteen hydrogen bonds. A G-quadruplex containing a single guanine analog substitution, such as 8-oxoguanine (O) or xanthine (X), would suffer from a loss of a Hoogsteen hydrogen bond within a G-tetrad and/or potential steric hindrance. We show that a proper arrangement of O and X bases can reestablish the hydrogen-bond pattern within a G·G·X·O tetrad. Rational incorporation of G·G·X·O tetrads in a (3+1) G-quadruplex demonstrated a similar folding topology and thermal stability to that of the unmodified G-quadruplex. pH titration conducted on X·O-modified G-quadruplexes indicated a protonation-deprotonation equilibrium of X with a pKa ∼6.7. The solution structure of a G-quadruplex containing a G·G·X·O tetrad was determined, displaying the same folding topology in both the protonated and deprotonated states. A G-quadruplex containing a deprotonated X·O pair was shown to exhibit a more electronegative groove compared to that of the unmodified one. These differences are likely to manifest in the electronic properties of G-quadruplexes and may have important implications for drug targeting and DNA-protein interactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhao, Min; Liao, Ni; Zhuo, Ying; Chai, Ya-Qin; Wang, Ji-Peng; Yuan, Ruo
2015-08-04
Herein, a novel "on-off" electrochemiluminescence (ECL) aptasensor for highly sensitive determination of thrombin has been constructed based on the triple quenching of the effect of hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system. First, a strong initial ECL signal was achieved by the dual amplification strategies of (i) intramolecular coreaction of a self-enhanced Ru(II)-based molecule (PTCA-PEI-Ru(II)) and (ii) intermolecular coreaction between PTCA-PEI-Ru(II) and nicotinamide adenine dinucleotide (NADH), which was named the signal-on state. Then, a novel triple quenching of the effect of multifunctional hemin/G-quadruplex DNAzymes upon the Ru(II) complex-based ECL system was designed to realize the desirable signal-off state, which was outlined as follows: (i) the hemin/G-quadruplex DNAzymes mimicked NADH oxidase to oxidize NADH and in situ generate the H2O2, consuming the coreactant of NADH; (ii) its active center of hemin could oxidize the excited state PTCA-PEI-Ru(II)* to PTCA-PEI-Ru(III), making the energy and electron transfer quench; (iii) it also acted as horseradish peroxidase (HRP) to catalyze the H2O2 for in situ producing the quencher of O2. Based on triple quenching of the effect of hemin/G-quadruplex DNAzymes, the highly sensitive "on-off" thrombin aptasensor was developed with a wide linear detection range of 1.0 × 10(-14) M to 1.0 × 10(-10) M and a detection limit down to the femtomolar level.
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
Pavan Kumar, Y; Saha, Puja; Saha, Dhurjhoti; Bessi, Irene; Schwalbe, Harald; Chowdhury, Shantanu; Dash, Jyotirmayee
2016-03-02
The four-stranded G-quadruplex present in the c-MYC P1 promoter has been shown to play a pivotal role in the regulation of c-MYC transcription. Small-molecule compounds capable of inhibiting the c-MYC promoter activity by stabilising the c-MYC G-quadruplex could potentially be used as anticancer agents. In this context, here we report the synthesis of dansyl-guanosine conjugates through one-pot modular click reactions. The dansyl-guanosine conjugates can selectively detect c-MYC G-quadruplex over other biologically relevant quadruplexes and duplex DNA and can be useful as staining reagents for selective visualisation of c-MYC G-quadruplex over duplex DNA by gel electrophoresis. NMR spectroscopic titrations revealed the preferential binding sites of these dansyl ligands to the c-MYC G-quadruplex. A dual luciferase assay and qRT-PCR revealed that a dansyl-bisguanosine ligand represses the c-MYC expression, possibly by stabilising the c-MYC G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Pradhan, Devranjan; Hansen, Lykke H; Vester, Birte
2011-01-01
G-rich nucleic acid oligomers can form G-quadruplexes built by G-tetrads stacked upon each other. Depending on the nucleotide sequence, G-quadruplexes fold mainly with two topologies: parallel, in which all G-tracts are oriented parallel to each other, or antiparallel, in which one or more G......-tracts are oriented antiparallel to the other G-tracts. In the former topology, all glycosidic bond angles conform to anti conformations, while in the latter topology they adopt both syn and anti conformations. It is of interest to understand the molecular forces that govern G-quadruplex folding. Here, we approach...... this problem by examining the impact of LNA (locked nucleic acid) modifications on the folding topology of the dimeric model system of the human telomere sequence. In solution, this DNA G-quadruplex forms a mixture of G-quadruplexes with antiparallel and parallel topologies. Using CD and NMR spectroscopies, we...
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân
2017-09-20
Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.
RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.
Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola
2018-05-25
DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.
Directory of Open Access Journals (Sweden)
Gajjela Raju
Full Text Available Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1, mixed imine-amide pyrrolobenzodiazepine dimer (PBD2 and 5,10,15,20-tetrakis(N-methyl-4-pyridylporphyrin (TMPyP4 were studied. G-rich single-stranded oligonucleotide d(5'GGGGTTGGGG3' designated as d(T(2G(8, from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD, UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T(2G(8 sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T(2G(8(2 and d(T(2G(8(4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T(2G(8 quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex.
Raju, Gajjela; Srinivas, Ragampeta; Santhosh Reddy, Vangala; Idris, Mohammed M.; Kamal, Ahmed; Nagesh, Narayana
2012-01-01
Studies on ligand interaction with quadruplex DNA, and their role in stabilizing the complex at concentration prevailing under physiological condition, has attained high interest. Electrospray ionization mass spectrometry (ESI-MS) and spectroscopic studies in solution were used to evaluate the interaction of PBD and TMPyP4 ligands, stoichiometry and selectivity to G-quadruplex DNA. Two synthetic ligands from PBD family, namely pyrene-linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid (PBD1), mixed imine-amide pyrrolobenzodiazepine dimer (PBD2) and 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin (TMPyP4) were studied. G-rich single-stranded oligonucleotide d(5′GGGGTTGGGG3′) designated as d(T2G8), from the telomeric region of Tetrahymena Glaucoma, was considered for the interaction with ligands. ESI-MS and spectroscopic methods viz., circular dichroism (CD), UV-Visible, and fluorescence were employed to investigate the G-quadruplex structures formed by d(T2G8) sequence and its interaction with PBD and TMPyP4 ligands. From ESI-MS spectra, it is evident that the majority of quadruplexes exist as d(T2G8)2 and d(T2G8)4 forms possessing two to ten cations in the centre, thereby stabilizing the complex. CD band of PBD1 and PBD2 showed hypo and hyperchromicity, on interaction with quadruplex DNA, indicating unfolding and stabilization of quadruplex DNA complex, respectively. UV-Visible and fluorescence experiments suggest that PBD1 bind externally where as PBD2 intercalate moderately and bind externally to G-quadruplex DNA. Further, melting experiments using SYBR Green indicate that PBD1 unfolds and PBD2 stabilizes the G-quadruplex complex. ITC experiments using d(T2G8) quadruplex with PBD ligands reveal that PBD1 and PBD2 prefer external/loop binding and external/intercalative binding to quadruplex DNA, respectively. From experimental results it is clear that the interaction of PBD2 and TMPyP4 impart higher stability to the quadruplex complex. PMID:22558271
Takahashi, Shuntaro; Sugimoto, Naoki
2017-12-01
DNA guanine-quadruplexes (G-quadruplexes) are unique DNA structures formed by guanine-rich sequences. The loop regions of G-quadruplexes play key roles in stability and topology of G-quadruplexes. Here, we investigated volumetric changes induced by pressure in the folding of the G-quadruplex formed by the thrombin binding aptamer (TBA) with mutations within the loop regions. The change of partial molar volume in the transition from coil to G-quadruplex, ∆V tr , of TBA with a mutation from T to A in the 5' most loop (TBA T3A) was 75.5cm 3 mol -1 , which was larger than that of TBA (54.6cm 3 mol -1 ). TBA with a G to T mutation in the central loop (TBA G8T) had thermal stability similar to TBA T3A but a smaller ∆V tr of 41.1cm 3 mol -1 . In the presence of poly(ethylene)glycol 200 (PEG200), ∆V tr values were 14.7cm 3 mol -1 for TBA T3A and 13.2cm 3 mol -1 for TBA G8T. These results suggest that the two mutations destabilize the G-quadruplex structure differently. Thus, volumetric data obtained using pressure-based thermodynamic analyses provides information about the dynamics of the loop regions and the roles of loops in the stabilities and folding of G-quadruplex structures. Copyright © 2017 Elsevier B.V. All rights reserved.
Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.
2014-01-01
Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669
Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey
2016-10-01
Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different
Energy Technology Data Exchange (ETDEWEB)
Han, Ji Hoon; Chitrapriya, Nataraj; Lee, Hyun Suk; Lee, Young Ae; Kim, Seog K. [Dept. of Chemistry, Yeungnam University, Gyeongsan (Korea, Republic of); Jung, Maeng Joon [Dept. of Chemistry, Kyungpook National University, Daegu (Korea, Republic of)
2017-02-15
In this study, circular dichroism (CD) spectrum and fluorescence techniques were used to examine the dynamic properties and microenvironment of the guanine base (G) at the central loop and at the middle of the G-stem of the G-quadruplex formed from the G{sub 3}T{sub 2}G{sub 3}TGTG{sub 3}T{sub 2}G{sub 3} sequence (G-quadruplex 1), in which the G base at the 10th and 13th position were replaced with a fluorescent G analog, 6-methyl isoxanthopterin (6MI) (G-quadruplex 2 and 3, respectively). For all G-quadruplexes, the CD spectrum revealed a positive band at 263 nm and a shoulder at 298 nm, and the thermal melting profiles were the sum of at least two sigmoidal curves. These observations indicated the presence of two conformers in the G-quadruplex. The fluorescence intensity of G-quadruplex 2 was greater than 3, as expected from the extent of stacking interaction, which is larger in the G(6MI)G sequence than the T(6MI)T sequence. The efficiency of fluorescence quenching by the polar acrylamide quencher and negatively charged I− quencher were larger for G-quadruplex 3, suggesting that 6MI in the G(6MI)G stem is exposed more to the aqueous environment compared to that in the T(6MI)T central loop. In the latter case, 6MI may direct to the center of the top G-quartet layer. The possibility of hydrogen bond formation between the carbonyl group of 6MI and the acrylamide of the G-quadruplex 3 was proposed.
G-Quadruplexes in DNA Replication: A Problem or a Necessity?
Valton, Anne-Laure; Prioleau, Marie-Noëlle
2016-11-01
DNA replication is a highly regulated process that ensures the correct duplication of the genome at each cell cycle. A precise cell type-specific temporal program controls the duplication of complex vertebrate genomes in an orderly manner. This program is based on the regulation of both replication origin firing and replication fork progression. G-quadruplexes (G4s), DNA secondary structures displaying noncanonical Watson-Crick base pairing, have recently emerged as key controllers of genome duplication. Here we discuss the various means by which G4s affect this fundamental cellular process. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Juan Hu
2013-01-01
Full Text Available With an internal transcribed spacer of 18 S, 5.8 S and 26 S nuclear ribosomal DNA (nrDNA ITS as DNA marker, we report a colorimetric approach for authentication of Pseudostellaria heterophylla (PH and its counterfeit species based on the differentiation of the nrDNA ITS sequence. The assay possesses an unlabelled G-quadruplex DNAzyme molecular beacon (MB probe, employing complementary sequence as biorecognition element and 1:1:1:1 split G-quadruplex halves as reporter. In the absence of target DNA (T-DNA, the probe can shape intermolecular G-quadruplex structures capable of binding hemin to form G-quadruplex-hemin DNAzyme and catalyze the oxidation of ABTS2− to blue-green ABTS•− by H2O2. In the presence of T-DNA, T-DNA can hybridize with the complementary sequence to form a duplex structure, hindering the formation of the G-quadruplex structure and resulting in the loss of the catalytic activity. Consequently, a UV-Vis absorption signal decrease is observed in the ABTS2−-H2O2 system. The “turn-off” assay allows the detection of T-DNA from 1.0 × 10−9 to 3.0 × 10−7 mol·L−1 (R2 = 0.9906, with a low detection limit of 3.1 × 10−10 mol·L−1. The present study provides a sensitive and selective method and may serve as a foundation of utilizing the DNAzyme MB sensor for identifying traditional Chinese medicines.
A mRNA-Responsive G-Quadruplex-Based Drug Release System
Directory of Open Access Journals (Sweden)
Hidenobu Yaku
2015-04-01
Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.
Artese, Anna; Costa, Giosuè; Distinto, Simona; Moraca, Federica; Ortuso, Francesco; Parrotta, Lucia; Alcaro, Stefano
2013-10-01
Human telomeres play a key role in protecting chromosomal ends from fusion events; they are composed of d(TTAGGG) repeats, ranging in size from 3 to 15 kb. They form G-quadruplex DNA structures, stabilized by G-quartets in the presence of cations, and are involved in several biological processes. In particular, a telomere maintenance mechanism is provided by a specialized enzyme called telomerase, a reverse transcriptase able to add multiple copies of the 5'-GGTTAG-3' motif to the end of the G-strand of the telomere and which is over-expressed in the majority of cancer cells. The central cation has a crucial role in maintaining the stability of the structure. Based on its nature, it can be associated with different topological telomeric quadruplexes, which depend also on the orientation of the DNA strands and the syn/anti conformation of the guanines. Such a polymorphism, confirmed by the different structures deposited in the Protein Data Bank (PDB), prompted us to apply a computational protocol in order to investigate the conformational properties of a set of known G-quadruplex ligands and their molecular recognition against six different experimental models of the human telomeric sequence d[AG3(T2AG3)3]. The average AutoDock correlation between theoretical and experimental data yielded an r2 value equal to 0.882 among all the studied models. Such a result was always improved with respect to those of the single folds, with the exception of the parallel structure (r2 equal to 0.886), thus suggesting a key role of this G4 conformation in the stacking interaction network. Among the studied binders, a trisubstituted acridine and a dibenzophenanthroline derivative were well recognized by the parallel and the mixed G-quadruplex structures, allowing the identification of specific key contacts with DNA and the further design of more potent or target specific G-quadruplex ligands. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes
Bon?ina, Matja?; Podlipnik, ?rtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-01-01
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolini...
Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.
Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi
2016-05-17
ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fu, Hengqing; Yang, Pengfei; Hai, Jinhui; Li, Huihui
2018-10-05
G-quadruplex DNAs are involved in a number of key biological processes, including gene expression, transcription, and apoptosis. The c-myb oncogene contains a number of GGA repeats in its promoter which forms G-quadruplex, thus it could be used as a target in cancer therapeutics. Several in-vitro studies have used Circular Dichroism (CD) spectroscopy or electrospray ionization mass spectrometry (ESI-MS) to demonstrate formation and stability of G-quadruplex DNA structure in the promoter region of human c-myb oncogene. The factors affecting the c-myb G-quadruplex structures were investigated, such as cations (i.e. K + , NH 4 + and Na + ) and co-solutes (methanol and polyethylene glycol). The results indicated that the presence of cations and co-solutes could change the G-quadruplex structural population and promote its thermodynamic stabilization as indicated by CD melting curves. It indicated that the co-solutes preferentially stabilize the c-myb G-quadruplex structure containing both homo- and hetero-stacking. In addition, protopine was demonstrated as a binder of c-myb G-quadruplex as screened from a library of natural alkaloids using ESI-MS method. CD spectra showed that it could selectively stabilize the c-myb G-quadruplex structure compared to other six G-quadruplexes from tumor-related G-rich sequences and the duplex DNAs (both long and short-chain ones). The binding of protopine could induce the change in the G-quadruplex structural populations. Therefore, protopine with its high binding specificity could be considered as a precursor for the design of drugs to target and regulate c-myb oncogene transcription. Copyright © 2018 Elsevier B.V. All rights reserved.
Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes.
Bončina, Matjaž; Podlipnik, Črtomir; Piantanida, Ivo; Eilmes, Julita; Teulade-Fichou, Marie-Paule; Vesnaver, Gorazd; Lah, Jurij
2015-12-02
Thermodynamic studies of ligand binding to human telomere (ht) DNA quadruplexes, as a rule, neglect the involvement of various ht-DNA conformations in the binding process. Therefore, the thermodynamic driving forces and the mechanisms of ht-DNA G-quadruplex-ligand recognition remain poorly understood. In this work we characterize thermodynamically and structurally binding of netropsin (Net), dibenzotetraaza[14]annulene derivatives (DP77, DP78), cationic porphyrin (TMPyP4) and two bisquinolinium ligands (Phen-DC3, 360A-Br) to the ht-DNA fragment (Tel22) AGGG(TTAGGG)3 using isothermal titration calorimetry, CD and fluorescence spectroscopy, gel electrophoresis and molecular modeling. By global thermodynamic analysis of experimental data we show that the driving forces characterized by contributions of specific interactions, changes in solvation and conformation differ significantly for binding of ligands with low quadruplex selectivity over duplexes (Net, DP77, DP78, TMPyP4; KTel22 ≈ KdsDNA). These contributions are in accordance with the observed structural features (changes) and suggest that upon binding Net, DP77, DP78 and TMPyP4 select hybrid-1 and/or hybrid-2 conformation while Phen-DC3 and 360A-Br induce the transition of hybrid-1 and hybrid-2 to the structure with characteristics of antiparallel or hybrid-3 type conformation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Unexpected Position-Dependent Effects of Ribose G-Quartets in G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Zhou, J.; Amrane, S.; Rosu, F.; Salgado, G.; Bian, Y.; Tateishi-Karimata, H.; Largy, E.; Korkut, D. N.; Bourdoncle, A.; Miyoshi, D.; Zhang, J.; Ju, H.; Wang, W.; Sugimoto, N.; Gabelica, V.; Mergny, Jean-Louis
2017-01-01
Roč. 139, č. 23 (2017), s. 7768-7779 ISSN 0002-7863 Institutional support: RVO:68081707 Keywords : human telomeric rna * electrospray mass-spectrometry * molecular crowding conditions * dna g-quadruplexes Subject RIV: BO - Biophysics OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 13.858, year: 2016
Expanding the potential of G-quadruplex structures: formation of a heterochiral TBA analogue.
Virgilio, Antonella; Varra, Michela; Scuotto, Maria; Capuozzo, Antonella; Irace, Carlo; Mayol, Luciano; Esposito, Veronica; Galeone, Aldo
2014-03-21
In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.
2014-01-01
O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506
Fujimoto, Takeshi; Nakano, Shu-ichi; Miyoshi, Daisuke; Sugimoto, Naoki
2011-01-01
Both cellular environmental factors and chemical modifications critically affect the properties of nucleic acids. However, the structure and stability of DNA containing abasic sites under cell-mimicking molecular crowding conditions remain unclear. Here, we investigated the molecular crowding effects on the structure and stability of the G-quadruplexes including a single abasic site. Structural analysis by circular dichroism showed that molecular crowding by PEG200 did not affect the topology of the G-quadruplex structure with or without an abasic site. Thermodynamic analysis further demonstrated that the degree of stabilization of the G-quadruplex by molecular crowding decreased with substitution of an abasic site for a single guanine. Notably, we found that the molecular crowding effects on the enthalpy change for G-quadruplex formation had a linear relationship with the abasic site effects depending on its position. These results are useful for predicting the structure and stability of G-quadruplexes with abasic sites in the cell-mimicking conditions. PMID:21949901
A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO
Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo
2018-02-01
As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.
Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi
2013-01-01
Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846
Effect of Monovalent Ion Parameters on Molecular Dynamics Simulations of G-Quadruplexes
Czech Academy of Sciences Publication Activity Database
Havrila, Marek; Stadlbauer, Petr; Islam, Barira; Otyepka, M.; Šponer, Jiří
2017-01-01
Roč. 13, č. 8 (2017), s. 3911-3926 ISSN 1549-9618 R&D Projects: GA MŠk EF15_003/0000477; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * amber force-field * nucleic-acid quadruplexes Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 5.245, year: 2016
Directory of Open Access Journals (Sweden)
Andrzej S Kudlicki
Full Text Available The G-quadruplex is a non-canonical DNA structure biologically significant in DNA replication, transcription and telomere stability. To date, only G4s with all guanines originating from the same strand of DNA have been considered in the context of the human nuclear genome. Here, I discuss interstrand topological configurations of G-quadruplex DNA, consisting of guanines from both strands of genomic DNA; an algorithm is presented for predicting such structures. I have identified over 550,000 non-overlapping interstrand G-quadruplex forming sequences in the human genome--significantly more than intrastrand configurations. Functional analysis of interstrand G-quadruplex sites shows strong association with transcription initiation, the results are consistent with the XPB and XPD transcriptional helicases binding only to G-quadruplex DNA with interstrand topology. Interstrand quadruplexes are also enriched in origin of replication sites. Several topology classes of interstrand quadruplex-forming sequences are possible, and different topologies are enriched in different types of structural elements. The list of interstrand quadruplex forming sequences, and the computer program used for their prediction are available at the web address http://moment.utmb.edu/allquads.
Li, Yijun; Wang, Cheng; Zhu, Yibo; Zhou, Xiaohong; Xiang, Yu; He, Miao; Zeng, Siyu
2017-03-15
This work presents a fully integrated graphene field-effect transistor (GFET) biosensor for the label-free detection of lead ions (Pb 2+ ) in aqueous-media, which first implements the G-quadruplex structure-switching biosensing principle in graphene nanoelectronics. We experimentally illustrate the biomolecular interplay that G-rich DNA single-strands with one-end confined on graphene surface can specifically interact with Pb 2+ ions and switch into G-quadruplex structures. Since the structure-switching of electrically charged DNA strands can disrupt the charge distribution in the vicinity of graphene surface, the carrier equilibrium in graphene sheet might be altered, and manifested by the conductivity variation of GFET. The experimental data and theoretical analysis show that our devices are capable of the label-free and specific quantification of Pb 2+ with a detection limit down to 163.7ng/L. These results first verify the signaling principle competency of G-quadruplex structure-switching in graphene electronic biosensors. Combining with the advantages of the compact device structure and convenient electrical signal, a label-free GFET biosensor for Pb 2+ monitoring is enabled with promising application potential. Copyright © 2016 Elsevier B.V. All rights reserved.
Mms1 is an assistant for regulating G-quadruplex DNA structures.
Schwindt, Eike; Paeschke, Katrin
2017-11-02
The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.
Directory of Open Access Journals (Sweden)
Rosalba Perrone
Full Text Available G-quadruplexes are tetraplex structures of nucleic acids that can form in G-rich sequences. Their presence and functional role have been established in telomeres, oncogene promoters and coding regions of the human chromosome. In particular, they have been proposed to be directly involved in gene regulation at the level of transcription. Because the HIV-1 Nef protein is a fundamental factor for efficient viral replication, infectivity and pathogenesis in vitro and in vivo, we investigated G-quadruplex formation in the HIV-1 nef gene to assess the potential for viral inhibition through G-quadruplex stabilization. A comprehensive computational analysis of the nef coding region of available strains showed the presence of three conserved sequences that were uniquely clustered. Biophysical testing proved that G-quadruplex conformations were efficiently stabilized or induced by G-quadruplex ligands in all three sequences. Upon incubation with a G-quadruplex ligand, Nef expression was reduced in a reporter gene assay and Nef-dependent enhancement of HIV-1 infectivity was significantly repressed in an antiviral assay. These data constitute the first evidence of the possibility to regulate HIV-1 gene expression and infectivity through G-quadruplex targeting and therefore open a new avenue for viral treatment.
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2017-01-01
Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....
Intermolecular G-quadruplex structure-based fluorescent DNA detection system.
Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin
2013-03-15
Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.
Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong
2017-12-21
An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
Zhang, Zhanxia; Sharon, Etery; Freeman, Ronit; Liu, Xiaoqing; Willner, Itamar
2012-06-05
The zinc(II)-protoporphyrin IX (ZnPPIX) fluorophore binds to G-quadruplexes, and this results in the enhanced fluorescence of the fluorophore. This property enabled the development of DNA sensors, aptasensors, and a sensor following telomerase activity. The DNA sensor is based on the design of a hairpin structure that includes a "caged" inactive G-quadruplex sequence. Upon opening the hairpin by the analyte DNA, the resulting fluorescence of the ZnPPIX/G-quadruplex provides the readout signal for the sensing event (detection limit 5 nM). Addition of Exonuclease III to the system allows the recycling of the analyte and its amplified analysis (detection limit, 200 pM). The association of the ZnPPIX to G-quadruplex aptamer-substrate complexes allowed the detection of adenosine-5'-triphosphate (ATP, detection limit 10 μM). Finally, the association of ZnPPIX to the G-quadruplex repeat units of telomers allowed the detection of telomerase activity originating from 380 ± 20 cancer 293T cell extract.
Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N
2018-06-01
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
Directory of Open Access Journals (Sweden)
Aishwarya Prakash
2011-01-01
Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.
Directory of Open Access Journals (Sweden)
Natalia Rizeq
2017-12-01
Full Text Available Oligomeric compounds, constituted of consecutive N,O-heteroaromatic rings, introduce useful and tunable properties as alternative ligands for biomolecular recognition. In this study, we have explored a synthetic scheme relying on Van Leusen oxazole formation, in conjunction with C–H activation of the formed oxazoles and their subsequent C–C cross-coupling to 2-bromopyridines in order to assemble a library of variable-length, ‘head-to-tail’-connected, pyridyl-oxazole ligands. Through investigation of the interaction of the three longer ligands (5-mer, 6-mer, 7-mer with cancer-relevant G-quadruplex structures (human telomeric/22AG and c-Myc oncogene promoter/Myc2345-Pu22, the asymmetric pyridyl-oxazole motif has been demonstrated to be a prominent recognition element for G-quadruplexes. Fluorescence titrations reveal excellent binding affinities of the 7-mer and 6-mer for a Na+-induced antiparallel 22AG G-quadruplex (KD = 0.6 × 10−7 M−1 and 0.8 × 10−7 M−1, respectively, and satisfactory (albeit lower affinities for the 22AG/K+ and Myc2345-Pu22/K+ G-quadruplexes. All ligands tested exhibit substantial selectivity for G-quadruplex versus duplex (ds26 DNA, as evidenced by competitive Förster resonance energy transfer (FRET melting assays. Additionally, the 7-mer and 6-mer are capable of promoting a sharp morphology transition of 22AG/K+ G-quadruplex.
Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.
2018-05-01
Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression
Directory of Open Access Journals (Sweden)
Charikleia Papadopoulou
2015-12-01
Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Quinone methides tethered to naphthalene diimides as selective G-quadruplex alkylating agents.
Di Antonio, Marco; Doria, Filippo; Richter, Sara N; Bertipaglia, Carolina; Mella, Mariella; Sissi, Claudia; Palumbo, Manlio; Freccero, Mauro
2009-09-16
We have developed novel G-quadruplex (G-4) ligand/alkylating hybrid structures, tethering the naphthalene diimide moiety to quaternary ammonium salts of Mannich bases, as quinone-methide precursors, activatable by mild thermal digestion (40 degrees C). The bis-substituted naphthalene diimides were efficiently synthesized, and their reactivity as activatable bis-alkylating agents was investigated in the presence of thiols and amines in aqueous buffered solutions. The electrophilic intermediate, quinone-methide, involved in the alkylation process was trapped, in the presence of ethyl vinyl ether, in a hetero Diels-Alder [4 + 2] cycloaddition reaction, yielding a substituted 2-ethoxychroman. The DNA recognition and alkylation properties of these new derivatives were investigated by gel electrophoresis, circular dichroism, and enzymatic assays. The alkylation process occurred preferentially on the G-4 structure in comparison to other DNA conformations. By dissecting reversible recognition and alkylation events, we found that the reversible process is a prerequisite to DNA alkylation, which in turn reinforces the G-quadruplex structural rearrangement.
Guo, Yahui; Cheng, Junjie; Wang, Jine; Zhou, Xiaodong; Hu, Jiming; Pei, Renjun
2014-09-01
A simple, versatile, and label-free DNA computing strategy was designed by using toehold-mediated strand displacement and stem-loop probes. A full set of logic gates (YES, NOT, OR, NAND, AND, INHIBIT, NOR, XOR, XNOR) and a two-layer logic cascade were constructed. The probes contain a G-quadruplex domain, which was blocked or unfolded through inputs initiating strand displacement and the obviously distinguishable light-up fluorescent signal of G-quadruplex/NMM complex was used as the output readout. The inputs are the disease-specific nucleotide sequences with potential for clinic diagnosis. The developed versatile computing system based on our label-free and modular strategy might be adapted in multi-target diagnosis through DNA hybridization and aptamer-target interaction. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Laguerre, Aurélien; Stefan, Loic; Larrouy, Manuel; Genest, David; Novotna, Jana; Pirrotta, Marc; Monchaud, David
2014-09-03
Recent and unambiguous evidences of the formation of DNA and RNA G-quadruplexes in cells has provided solid support for these structures to be considered as valuable targets in oncology. Beyond this, they have lent further credence to the anticancer strategies relying on small molecules that selectively target these higher-order DNA/RNA architectures, referred to as G-quadruplex ligands. They have also shed bright light on the necessity of designing multitasking ligands, displaying not only enticing quadruplex interacting properties (affinity, structural selectivity) but also additional features that make them usable for detecting quadruplexes in living cells, notably for determining whether, when, and where these structures fold and unfold during the cell cycle and also for better assessing the consequences of their stabilization by external agents. Herein, we report a brand new design of such multitasking ligands, whose structure experiences a quadruplex-promoted conformational switch that triggers not only its quadruplex affinity (i.e., smart ligands, which display high affinity and selectivity for DNA/RNA quadruplexes) but also its fluorescence (i.e., smart probes, which behave as selective light-up fluorescent reporters on the basis of a fluorogenic electron redistribution). The first prototype of such multifunctional ligands, termed PyroTASQ, represents a brand new generation of quadruplex ligands that can be referred to as "twice-as-smart" quadruplex ligands.
G-Quadruplexes influence pri-microRNA processing.
Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre
2018-02-01
RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance.
Yadav, Vikas; Hemansi; Kim, Nayun; Tuteja, Narendra; Yadav, Puja
2017-01-01
G quadruplexes (G4) are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
G Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance
Directory of Open Access Journals (Sweden)
Vikas Yadav
2017-07-01
Full Text Available G quadruplexes (G4 are higher-order DNA and RNA secondary structures formed by G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential G4 quadruplex sequences have been identified in G-rich eukaryotic non-telomeric and telomeric genomic regions. Upon function, G4 formation is known to involve in chromatin remodeling, gene regulation and has been associated with genomic instability, genetic diseases and cancer progression. The natural role and biological validation of G4 structures is starting to be explored, and is of particular interest for the therapeutic interventions for human diseases. However, the existence and physiological role of G4 DNA and G4 RNA in plants species have not been much investigated yet and therefore, is of great interest for the development of improved crop varieties for sustainable agriculture. In this context, several recent studies suggests that these highly diverse G4 structures in plants can be employed to regulate expression of genes involved in several pathophysiological conditions including stress response to biotic and abiotic stresses as well as DNA damage. In the current review, we summarize the recent findings regarding the emerging functional significance of G4 structures in plants and discuss their potential value in the development of improved crop varieties.
A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore
Energy Technology Data Exchange (ETDEWEB)
Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC
2014-08-21
Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.
Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.
Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.
Directory of Open Access Journals (Sweden)
Yunqiang Bian
2014-04-01
Full Text Available In this work we studied the folding process of the hybrid-1 type human telomeric DNA G-quadruplex with solvent and K(+ ions explicitly modeled. Enabled by the powerful bias-exchange metadynamics and large-scale conventional molecular dynamic simulations, the free energy landscape of this G-DNA was obtained for the first time and four folding intermediates were identified, including a triplex and a basically formed quadruplex. The simulations also provided atomistic pictures for the structures and cation binding patterns of the intermediates. The results showed that the structure formation and cation binding are cooperative and mutually supporting each other. The syn/anti reorientation dynamics of the intermediates was also investigated. It was found that the nucleotides usually take correct syn/anti configurations when they form native and stable hydrogen bonds with the others, while fluctuating between two configurations when they do not. Misfolded intermediates with wrong syn/anti configurations were observed in the early intermediates but not in the later ones. Based on the simulations, we also discussed the roles of the non-native interactions. Besides, the formation process of the parallel conformation in the first two G-repeats and the associated reversal loop were studied. Based on the above results, we proposed a folding pathway for the hybrid-1 type G-quadruplex with atomistic details, which is new and more complete compared with previous ones. The knowledge gained for this type of G-DNA may provide a general insight for the folding of the other G-quadruplexes.
Sparapani, Silvia; Bellini, Stefania; Gunaratnam, Mekala; Haider, Shozeb M; Andreani, Aldo; Rambaldi, Mirella; Locatelli, Alessandra; Morigi, Rita; Granaiola, Massimiliano; Varoli, Lucilla; Burnelli, Silvia; Leoni, Alberto; Neidle, Stephen
2010-08-21
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
Directory of Open Access Journals (Sweden)
Stefano Alcaro
2013-09-01
Full Text Available The G-quadruplex DNA structures are mainly present at the terminal portion of telomeres and can be stabilized by ligands able to recognize them in a specific manner. The recognition process is usually related to the inhibition of the enzyme telomerase indirectly involved and over-expressed in a high percentage of human tumors. There are several ligands, characterized by different chemical structures, already reported in the literature for their ability to bind and stabilize the G-quadruplex structures. Using the structural and biological information available on these structures; we performed a high throughput in silico screening of commercially natural compounds databases by means of a structure-based approach followed by docking experiments against the human telomeric sequence d[AG3(T2AG33]. We identified 12 best hits characterized by different chemical scaffolds and conformational and physicochemical properties. All of them were associated to an improved theoretical binding affinity with respect to that of known selective G-binders. Among these hits there is a chalcone derivative; structurally very similar to the polyphenol butein; known to remarkably inhibit the telomerase activity.
Niazov-Elkan, Angelica; Golub, Eyal; Sharon, Etery; Balogh, Dora; Willner, Itamar
2014-07-23
L-cysteine induces the aggregation of Au nanoparticles (NPs), resulting in a color transition from red to blue due to interparticle plasmonic coupling in the aggregated structure. The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme catalyzes the aerobic oxidation of L-cysteine to cystine, a process that inhibits the aggregation of the NPs. The degree of inhibition of the aggregation process is controlled by the concentration of the DNAzyme in the system. These functions are implemented to develop sensing platforms for the detection of a target DNA, for the analysis of aptamer-substrate complexes, and for the analysis of L-cysteine in human urine samples. A hairpin DNA structure that includes a recognition site for the DNA analyte and a caged G-quadruplex sequence, is opened in the presence of the target DNA. The resulting self-assembled hemin/G-quadruplex acts as catalyst that controls the aggregation of the Au NPs. Also, the thrombin-binding aptamer folds into a G-quadruplex nanostructure upon binding to thrombin. The association of hemin to the resulting G-quadruplex aptamer-thrombin complex leads to a catalytic label that controls the L-cysteine-mediated aggregation of the Au NPs. The hemin/G-qaudruplex-controlled aggregation of Au NPs process is further implemented for visual and spectroscopic detection of L-cysteine concentration in urine samples. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.
Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia
2015-01-01
A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.
Directory of Open Access Journals (Sweden)
David Monchaud
2010-01-01
Full Text Available Macrocyclic scaffolds are particularly attractive for designing selective G-quadruplex ligands essentially because, on one hand, they show a poor affinity for the “standard” B-DNA conformation and, on the other hand, they fit nicely with the external G-quartets of quadruplexes. Stimulated by the pioneering studies on the cationic porphyrin TMPyP4 and the natural product telomestatin, follow-up studies have developed, rapidly leading to a large diversity of macrocyclic structures with remarkable-quadruplex binding properties and biological activities. In this review we summarize the current state of the art in detailing the three main categories of quadruplex-binding macrocycles described so far (telomestatin-like polyheteroarenes, porphyrins and derivatives, polyammonium cyclophanes, and in addressing both synthetic issues and biological aspects.
Tera, Masayuki; Iida, Keisuke; Shin-ya, Kazuo; Nagasawa, Kazuo
2009-01-01
Guanine-rich DNA sequences form unique three-dimensional conformation known as G-quadruplexes (G-q). G-q structures have been found in telomere and in some oncogene promoter. Recently, it was suggested that G-q showed some biological activities including telomere shortening and transcriptional regulation. In this paper, we synthesized selective G-q binders and evaluated of their biological activities.
Phenanthroline-2,9-bistriazoles as selective G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, Mads Corvinius; Larsen, Anders Foller; Abdikadir, Faisal Hussein
2014-01-01
G-quadruplex (G4) ligands are currently receiving considerable attention as potential anticancer therapeutics. A series of phenanthroline-2,9-bistriazoles carrying tethered positive end groups has been synthesized and evaluated as G4 stabilizers. The compounds were efficiently assembled by copper......(I)-catalyzed azide-alkyne cycloaddition (CuAAC) in CH2Cl2 and water in the presence of a complexing agent. Characterization of the target compounds on telomeric and c-KIT G4 sequences led to the identification of guanidinium-substituted compounds as potent G4 DNA ligands with high selectivity over duplex DNA....... The diisopropylguanidium ligands exhibited high selectivity for the proto-oncogenic sequence c-KIT over the human telomeric sequence in the surface plasmon resonance (SPR) assay, whereas the compounds appeared potent on both G4 structures in the FRET melting temperature assay. The phenanthroline-2,9-bistriazole ligands...
Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.
Directory of Open Access Journals (Sweden)
Bidisha Sengupta
Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.
Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach
Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.
2013-01-01
Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423
Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole
2018-03-01
Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Sun, Aili; Qi, Qingan; Wang, Xuannian; Bie, Ping
2014-07-15
For the first time, a sensitive electrochemical aptasensor for thrombin (TB) was developed by using porous platinum nanotubes (PtNTs) labeled with hemin/G-quadruplex and glucose dehydrogenase (GDH) as labels. Porous PtNTs with large surface area exhibited the peroxidase-like activity. Coupling with GDH and hemin/G-quadruplex as NADH oxidase and HRP-mimicking DNAzyme, the cascade signal amplification was achieved by the following ways: in the presence of glucose and NAD(+) in the working buffer, GDH electrocatalyzed the oxidation of glucose with the production of NADH. Then, hemin/G-quadruplex as NADH oxidase catalyzed the oxidation of NADH to in situ generate H2O2. Based on the corporate electrocatalysis of PtNTs and hemin/G-quadruplex toward H2O2, the electrochemical signal was significantly amplified, allowing the detection limit of TB down to 0.15 pM level. Moreover, the proposed strategy was simple because the intercalated hemin offered the readout signal, avoiding the adding of additional redox mediator as signal donator. Such an electrochemical aptasensor is highly promising for sensitive detection of other proteins in clinical diagnostics. Copyright © 2014 Elsevier B.V. All rights reserved.
Park, Jin Ha; Lee, Hyun Suk; Jang, Myung Duk; Han, Sung Wook; Kim, Seog K; Lee, Young-Ae
2018-06-01
The interaction of Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ (DPPZ = dipyrido[3,2-a:2', 3'-c]phenazine, phen = phenanthroline) with a G-quadruplex formed from 5'-G 2 T 2 G 2 TGTG 2 T 2 G 2-3 '(15-mer) was investigated. The well-known enhancement of luminescence intensity (the 'light-switch' effect) was observed for the [Ru(phen) 2 DPPZ] 2+ complexes upon formation of an adduct with the G-quadruplex. The emission intensity of the G-quadruplex-bound Λ-isomer was 3-fold larger than that of the Δ-isomer when bound to the G-quadruplex, which is opposite of the result observed in the case of double stranded DNA (dsDNA); the light switch effect is larger for the dsDNA-bound Δ-isomer. In the job plot of the G-quadruplex with Δ- and Λ-[Ru(phen) 2 DPPZ] 2+ , a major inflection point for the two isomers was observed at x ≈ .65, which suggests a binding stoichiometry of 2:1 for both enantiomers. When the G base at the 8th position was replaced with 6-methyl isoxanthopterin (6MI), a fluorescent guanine analog, the excited energy of 6-MI transferred to bound Δ- or Λ-[Ru(phen) 2 DPPZ] 2+ , which suggests that at least a part of both Ru(II) enantiomers is close to or in contact with the diagonal loop of the G-quadruplex. A luminescence quenching experiment using [Fe(CN) 6 ] 4- for the G-quadruplex-bound Ru(II) complex revealed downward bending curves for both enantiomers in the Stern-Volmer plot, which suggests the presence of Ru(II) complexes that are both accessible and inaccessible to the quencher and may be related to the 2:1 binding stoichiometry.
Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.
Directory of Open Access Journals (Sweden)
Khondaker M Rahman
Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.
G-quadruplex recognition activities of E. Coli MutS
Directory of Open Access Journals (Sweden)
Ehrat Edward A
2012-07-01
Full Text Available Abstract Background Guanine quadruplex (G4 DNA is a four-stranded structure that contributes to genome instability and site-specific recombination. G4 DNA folds from sequences containing tandemly repetitive guanines, sequence motifs that are found throughout prokaryote and eukaryote genomes. While some cellular activities have been identified with binding or processing G4 DNA, the factors and pathways governing G4 DNA metabolism are largely undefined. Highly conserved mismatch repair factors have emerged as potential G4-responding complexes because, in addition to initiating heteroduplex correction, the human homologs bind non-B form DNA with high affinity. Moreover, the MutS homologs across species have the capacity to recognize a diverse range of DNA pairing variations and damage, suggesting a conserved ability to bind non-B form DNA. Results Here, we asked if E. coli MutS and a heteroduplex recognition mutant, MutS F36A, were capable of recognizing and responding to G4 DNA structures. We find by mobility shift assay that E. coli MutS binds to G4 DNA with high affinity better than binding to G-T heteroduplexes. In the same assay, MutS F36A failed to recognize G-T mismatched oligonucleotides, as expected, but retained an ability to bind to G4 DNA. Association with G4 DNA by MutS is not likely to activate the mismatch repair pathway because nucleotide binding did not promote release of MutS or MutS F36A from G4 DNA as it does for heteroduplexes. G4 recognition activities occur under physiological conditions, and we find that M13 phage harboring G4-capable DNA poorly infected a MutS deficient strain of E. coli compared to M13mp18, suggesting functional roles for mismatch repair factors in the cellular response to unstable genomic elements. Conclusions Taken together, our findings demonstrate that E. coli MutS has a binding activity specific for non-B form G4 DNA, but such binding appears independent of canonical heteroduplex repair activation.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Czech Academy of Sciences Publication Activity Database
Cragnolini, T.; Chakraborty, D.; Šponer, Jiří; Derreumaux, P.; Pasquali, S.; Wales, D.J.
2017-01-01
Roč. 147, č. 15 (2017), č. článku 152715. ISSN 0021-9606 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * gb1 hairpin peptide Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016
Designing a New Class of Bases for Nucleic Acid Quadruplexes and Quadruplex-Active Ligands.
Bazzi, Sophia; Novotný, Jan; Yurenko, Yevgen P; Marek, Radek
2015-06-22
A new class of quadruplex nucleobases, derived from 3-deazaguanine, has been designed for various applications as smart quadruplex ligands as well as quadruplex-based aptamers, receptors, and sensors. An efficient strategy for modifying the guanine quadruplex core has been developed and tested by using quantum chemistry methods. Several potential guanine derivatives modified at the 3- or 8-position or both are analyzed, and the results compared to reference systems containing natural guanine. Analysis of the formation energies (BLYP-D3(BJ)/def2-TZVPP level of theory, in combination with the COSMO model for water) in model systems consisting of two and three stacked tetrads with Na(+) /K(+) ion(s) inside the internal channel indicates that the formation of structures with 3-halo-3-deazaguanine bases leads to a substantial gain in energy, as compared to the corresponding reference guanine complexes. The results cast light on changes in the noncovalent interactions (hydrogen bonding, stacking, and ion coordination) in a quadruplex stem upon modification of the guanine core. In particular, the enhanced stability of the modified quadruplexes was shown to originate mainly from increased π-π stacking. Our study suggests the 3-halo-3-deazaguanine skeleton as a potential building unit for quadruplex systems and smart G-quadruplex ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
John A Capra
2010-07-01
Full Text Available G-quadruplex DNA is a four-stranded DNA structure formed by non-Watson-Crick base pairing between stacked sets of four guanines. Many possible functions have been proposed for this structure, but its in vivo role in the cell is still largely unresolved. We carried out a genome-wide survey of the evolutionary conservation of regions with the potential to form G-quadruplex DNA structures (G4 DNA motifs across seven yeast species. We found that G4 DNA motifs were significantly more conserved than expected by chance, and the nucleotide-level conservation patterns suggested that the motif conservation was the result of the formation of G4 DNA structures. We characterized the association of conserved and non-conserved G4 DNA motifs in Saccharomyces cerevisiae with more than 40 known genome features and gene classes. Our comprehensive, integrated evolutionary and functional analysis confirmed the previously observed associations of G4 DNA motifs with promoter regions and the rDNA, and it identified several previously unrecognized associations of G4 DNA motifs with genomic features, such as mitotic and meiotic double-strand break sites (DSBs. Conserved G4 DNA motifs maintained strong associations with promoters and the rDNA, but not with DSBs. We also performed the first analysis of G4 DNA motifs in the mitochondria, and surprisingly found a tenfold higher concentration of the motifs in the AT-rich yeast mitochondrial DNA than in nuclear DNA. The evolutionary conservation of the G4 DNA motif and its association with specific genome features supports the hypothesis that G4 DNA has in vivo functions that are under evolutionary constraint.
Liu, Shuangna; Peng, Pai; Wang, Huihui; Shi, Lili; Li, Tao
2017-12-01
A molecular rotor thioflavin T (ThT) is usually used as a fluorescent ligand specific for G-quadruplexes. Here, we demonstrate that ThT can tightly bind non-G-quadruplex DNAs with several GA motifs and dimerize them in a parallel double-stranded mode, accompanied by over 100-fold enhancement in the fluorescence emission of ThT. The introduction of reverse Watson-Crick T-A base pairs into these dimeric parallel-stranded DNA systems remarkably favors the binding of ThT into the pocket between G•G and A•A base pairs, where ThT is encapsulated thereby restricting its two rotary aromatic rings in the excited state. A similar mechanism is also demonstrated in antiparallel DNA duplexes where several motifs of two consecutive G•G wobble base pairs are incorporated and serve as the active pockets for ThT binding. The insight into the interactions of ThT with non-G-quadruplex DNAs allows us to introduce a new concept for constructing DNA-based sensors and devices. As proof-of-concept experiments, we design a DNA triplex containing GA motifs in its Hoogsteen hydrogen-bonded two parallel strands as a pH-driven nanoswitch and two GA-containing parallel duplexes as novel metal sensing platforms where C-C and T-T mismatches are included. This work may find further applications in biological systems (e.g. disease gene detection) where parallel duplex or triplex stretches are involved. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2015-02-15
Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.
Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina
2018-03-01
Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Leung, Ka-Ho; Lu, Lihua; Wang, Modi; Mak, Tsun-Yin; Chan, Daniel Shiu-Hin; Tang, Fung-Kit; Leung, Chung-Hang; Kwan, Hiu-Yee; Yu, Zhiling; Ma, Dik-Lung
2013-01-01
We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III) complex for the detection of adenosine-5'-triphosphate (ATP) in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III) complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
A label-free luminescent switch-on assay for ATP using a G-quadruplex-selective iridium(III complex.
Directory of Open Access Journals (Sweden)
Ka-Ho Leung
Full Text Available We report herein the G-quadruplex-selective property of a luminescent cyclometallated iridium(III complex for the detection of adenosine-5'-triphosphate (ATP in aqueous solution. The ATP-binding aptamer was employed as the ATP recognition unit, while the iridium(III complex was used to monitor the formation of the G-quadruplex structure induced by ATP. The sensitivity and fold enhancement of the assay were higher than those of the previously reported assay using the organic dye crystal violet as a fluorescent probe. This label-free luminescent switch-on assay exhibits high sensitivity and selectivity towards ATP with a limit of detection of 2.5 µM.
Lech, Christopher Jacques; Phan, Anh Tuân
2017-06-20
Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Kuehrova, P.; Banáš, P.; Koča, J.; Bussi, G.; Trantírek, L.; Otyepka, M.; Šponer, Jiří
2016-01-01
Roč. 43, č. 20 (2016), s. 9626-9644 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP208/11/1822 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * INTRAMOLECULAR DNA QUADRUPLEXES * PARTICLE MESH EWALD Subject RIV: BO - Biophysics Impact factor: 10.162, year: 2016
Li, Yinghao; Jia, Guoqing; Wang, Changhao; Cheng, Mingpan; Li, Can
2015-03-02
Short human telomeric (HT) DNA sequences form single G-quadruplex (G4 ) units and exhibit structure-based stereocontrol for a series of reactions. However, for more biologically relevant higher-order HT G4 -DNAs (beyond a single G4 unit), the catalytic performances are unknown. Here, we found that higher-order HT G4 -DNA copper metalloenzymes (two or three G4 units) afford remarkably higher enantioselectivity (>90 % ee) and a five- to sixfold rate increase, compared to a single G4 unit, for the Diels-Alder reaction. Electron paramagnetic resonance (EPR) and enzymatic kinetic studies revealed that the distinct catalytic function between single and higher-order G4 -DNA copper metalloenzymes can be attributed to different Cu(II) coordination environments and substrate specificity. Our finding suggests that, like protein enzymes and ribozymes, higher-order structural organization is crucial for G4 -DNA-based catalysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Thermal stability of DNA quadruplex-duplex hybrids.
Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân
2014-01-14
DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.
DNA and RNA Quadruplex-Binding Proteins
Czech Academy of Sciences Publication Activity Database
Brázda, Václav; Haroniková, Lucia; Liao, J.C.C.; Fojta, Miroslav
2014-01-01
Roč. 15, č. 10 (2014), s. 17493-17517 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : DNA quadruplex * RNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 2.862, year: 2014
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
DEFF Research Database (Denmark)
Pedersen, Erik Bjerregaard; Nielsen, Jakob Toudahl; Nielsen, Claus
2011-01-01
Two G-quadruplex forming sequences, 50-TGGGAG and the 17-mer sequence T30177, which exhibit anti-HIV-1 activity on cell lines, were modified using either locked nucleic acids (LNA) or via insertions of (R)-1-O-(pyren-1-ylmethyl)glycerol (intercalating nucleic acid, INA) or (R)-1-O-[4-(1......-pyrenylethynyl)phenylmethyl]glycerol (twisted intercalating nucleic acid, TINA). Incorporation of LNA or INA/TINA monomers provide as much as 8-fold improvement of anti-HIV-1 activity. We demonstrate for the first time a detailed analysis of the effect the incorporation of INA/TINA monomers in quadruplex forming...
Selvam, Sangeetha; Mandal, Shankar; Mao, Hanbin
2017-09-05
The formation of biologically significant tetraplex DNA species, such as G-quadruplexes and i-motifs, is affected by chemical (ions and pH) and mechanical [superhelicity (σ) and molecular crowding] factors. Because of the extremely challenging experimental conditions, the relative importance of these factors on tetraplex folding is unknown. In this work, we quantitatively evaluated the chemical and mechanical effects on the population dynamics of DNA tetraplexes in the insulin-linked polymorphic region using magneto-optical tweezers. By mechanically unfolding individual tetraplexes, we found that ions and pH have the largest effects on the formation of the G-quadruplex and i-motif, respectively. Interestingly, superhelicity has the second largest effect followed by molecular crowding conditions. While chemical effects are specific to tetraplex species, mechanical factors have generic influences. The predominant effect of chemical factors can be attributed to the fact that they directly change the stability of a specific tetraplex, whereas the mechanical factors, superhelicity in particular, reduce the stability of the competing species by changing the kinetics of the melting and annealing of the duplex DNA template in a nonspecific manner. The substantial dependence of tetraplexes on superhelicity provides strong support that DNA tetraplexes can serve as topological sensors to modulate fundamental cellular processes such as transcription.
Quadruplex-forming sequences occupy discrete regions inside plant LTR retrotransposons
Czech Academy of Sciences Publication Activity Database
Lexa, M.; Kejnovský, Eduard; Šteflová, Pavlína; Konvalinová, H.; Vorlíčková, Michaela; Vyskot, Boris
2014-01-01
Roč. 42, č. 2 (2014), s. 968-978 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GA522/09/0083; GA ČR GPP501/10/P483 Institutional support: RVO:68081707 Keywords : INTRAMOLECULAR DNA QUADRUPLEXES * VIRUS TYPE-1 RNA * CIRCULAR-DICHROISM Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
Lannan, Ford M; Mamajanov, Irena; Hud, Nicholas V
2012-09-19
Structures formed by human telomere sequence (HTS) DNA are of interest due to the implication of telomeres in the aging process and cancer. We present studies of HTS DNA folding in an anhydrous, high viscosity deep eutectic solvent (DES) comprised of choline choride and urea. In this solvent, the HTS DNA forms a G-quadruplex with the parallel-stranded ("propeller") fold, consistent with observations that reduced water activity favors the parallel fold, whereas alternative folds are favored at high water activity. Surprisingly, adoption of the parallel structure by HTS DNA in the DES, after thermal denaturation and quick cooling to room temperature, requires several months, as opposed to less than 2 min in an aqueous solution. This extended folding time in the DES is, in part, due to HTS DNA becoming kinetically trapped in a folded state that is apparently not accessed in lower viscosity solvents. A comparison of times required for the G-quadruplex to convert from its aqueous-preferred folded state to its parallel fold also reveals a dependence on solvent viscosity that is consistent with Kramers rate theory, which predicts that diffusion-controlled transitions will slow proportionally with solvent friction. These results provide an enhanced view of a G-quadruplex folding funnel and highlight the necessity to consider solvent viscosity in studies of G-quadruplex formation in vitro and in vivo. Additionally, the solvents and analyses presented here should prove valuable for understanding the folding of many other nucleic acids and potentially have applications in DNA-based nanotechnology where time-dependent structures are desired.
Multifunctional energy landscape for a DNA G-quadruplex: An evolved molecular switch
Cragnolini, Tristan; Chakraborty, Debayan; Šponer, Jiří; Derreumaux, Philippe; Pasquali, Samuela; Wales, David J.
2017-10-01
We explore the energy landscape for a four-fold telomere repeat, obtaining interconversion pathways between six experimentally characterised G-quadruplex topologies. The results reveal a multi-funnel system, with a variety of intermediate configurations and misfolded states. This organisation is identified with the intrinsically multi-functional nature of the system, suggesting a new paradigm for the classification of such biomolecules and clarifying issues regarding apparently conflicting experimental results.
Han, Tian; Cao, Xueli; Xu, Jing; Pei, Hairun; Zhang, Hong; Tang, Yalin
2017-07-21
G-quadruplex DNA structure is considered to be a very attractive target for antitumor drug design due to its unique role in maintaining telomerase activities. Therefore, discovering ligands with high stability of G-quadruplex structure is of great interest. In this paper, pH-zone refining counter current chromatography (CCC) and preparative high performance liquid chromatography (HPLC) were employed for the separation of potent G-quadruplex ligands from the n-butanol fraction of the crude extract of Zanthoxylum ailanthoides, which is a traditional Chinese medicine recently found to display high inhibitory activity against several human cancer cells. The 75% aqueous ethanol extract of the stem bark of Z. ailanthoides and its fractions with petroleum ether, ethyl acetate and n-butanol displayed almost the same G-quadruplex stabilization ability. Here, pH-zone refining CCC was used for the separation of the alkaloids from the n-butanol fraction by a seldom used solvent system composed of dichloromethane-methanol-water (4:1:2.5) with 10mM TEA in the organic stationary phase as retainer and 10mM HCl in the aqueous mobile phase as eluter. Compounds I, II and III were obtained, with purity greater than 95%, in the quantities of 31.2, 94.0, and 26.4mg respectively from 300mg of lipophilic fraction within 80min, which were identified as three tetrahydroprotoberberines isolated for the first time in this plant. In addition, a phenylpropanoid glycoside compound IV (Syringin), an isoquinoline (Magnoflorine, V), and two lignin isomers (+)-lyoniresiol-3α-O-β-d-glucopyranoside (VI) and (-)-lyoniresinol -3α-O-β-D -glucopyranoside (VII) were isolated by traditional CCC together with preparative HPLC. Compounds IV, V, VI and VII were obtained, with purity greater than 95%, in the quantities of 4.0, 13.2, 6.7, and 6.5mg respectively from 960mg of hydrophilic fraction. Among the seven isolated compounds, tetrahydroprotoberberine I, II and III were found to display remarkable
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
Directory of Open Access Journals (Sweden)
Felipe Opazo
2015-01-01
Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.
Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.
Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P
2010-01-15
A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.
RecQ-core of BLM unfolds telomeric G-quadruplex in the absence of ATP
Czech Academy of Sciences Publication Activity Database
Budhathoki, J.B.; Ray, S.; Urban, Václav; Janščák, Pavel; Jodh, J.G.; Balci, H.
2014-01-01
Roč. 42, č. 18 (2014), s. 11528-11545 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:U.S. National Science Foundation through the Physics Frontiers Center Program(US) 1430124 Institutional support: RVO:68378050 Keywords : single-stranded DNA * RECQ5 helicase * G-quadruplex structures Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
DEFF Research Database (Denmark)
Porru, Manuela; Artuso, Simona; Salvati, Erica
2015-01-01
We previously identified EMICORON as a novel G-quadruplex (G4) ligand showing high selectivity for G4 structures over the duplex DNA, causing telomere damage and inhibition of cell proliferation in transformed and tumor cells. Here, we evaluated the antitumoral effect of EMICORON on advanced mode...
Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.
Directory of Open Access Journals (Sweden)
Ezekiel Crenshaw
Full Text Available A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP. APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes, non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region at residues 3008-3027 (NM_201414.2. This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.
Czech Academy of Sciences Publication Activity Database
Vidláková, Pavlína; Pivoňková, Hana; Kejnovská, Iva; Trnková, L.; Vorlíčková, Michaela; Fojta, Miroslav; Havran, Luděk
2015-01-01
Roč. 407, č. 19 (2015), s. 5817-5826 ISSN 1618-2642 R&D Projects: GA ČR GAP206/12/2378 Institutional support: RVO:68081707 Keywords : Oligonucleotides * Electrochemical methods * G-quadruplex Subject RIV: BO - Biophysics Impact factor: 3.125, year: 2015
Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C
2018-02-15
Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.
Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective g-quadruplex ligands
DEFF Research Database (Denmark)
Larsen, Anders Foller; Nielsen, Mads Corvinius; Ulven, Trond
2012-01-01
Small molecules capable of stabilizing the G-quadruplex (G4) structure are of interest for the development of improved anticancer drugs. Novel 4,7-diamino-substituted 1,10-phenanthroline-2,9-dicarboxamides that represent hybrid structures of known phenanthroline-based ligands have been designed....... An efficient synthetic route to the compounds has been developed and their interactions with various G4 sequences have been evaluated by Förster resonance energy transfer (FRET) melting assays, fluorescent intercalator displacement (FID), electrospray ionization mass spectrometry (ESI-MS), and circular...... dichroism (CD) spectroscopy. The preferred compounds have high aqueous solubility and are strong and potent G4 binders with a high selectivity over duplex DNA; thus, they represent a significant improvement over the lead compounds. Two of the compounds are inhibitors of HeLa and HT1080 cell proliferation....
DEFF Research Database (Denmark)
Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels
2017-01-01
The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...
Sadhukhan, Ratan; Chowdhury, Priyanka; Ghosh, Sourav; Ghosh, Utpal
2018-06-01
Telomere DNA can form specialized nucleoprotein structure with telomere-associated proteins to hide free DNA ends or G-quadruplex structures under certain conditions especially in presence of G-quadruplex ligand. Telomere DNA is transcribed to form non-coding telomere repeat-containing RNA (TERRA) whose biogenesis and function is poorly understood. Our aim was to find the role of telomere-associated proteins and telomere structures in TERRA transcription. We silenced four [two shelterin (TRF1, TRF2) and two non-shelterin (PARP-1, SLX4)] telomere-associated genes using siRNA and verified depletion in protein level. Knocking down of one gene modulated expression of other telomere-associated genes and increased TERRA from 10q, 15q, XpYp and XqYq chromosomes in A549 cells. Telomere was destabilized or damaged by G-quadruplex ligand pyridostatin (PDS) and bleomycin. Telomere dysfunction-induced foci (TIFs) were observed for each case of depletion of proteins, treatment with PDS or bleomycin. TERRA level was elevated by PDS and bleomycin treatment alone or in combination with depletion of telomere-associated proteins.
G-quadruplex formation in telomeres enhances POT1/TPP1 protection against RPA binding
Ray, Sujay; Bandaria, Jigar N.; Qureshi, Mohammad H.; Yildiz, Ahmet; Balci, Hamza
2014-01-01
Human telomeres terminate with a single-stranded 3′ G overhang, which can be recognized as a DNA damage site by replication protein A (RPA). The protection of telomeres (POT1)/POT1-interacting protein 1 (TPP1) heterodimer binds specifically to single-stranded telomeric DNA (ssTEL) and protects G overhangs against RPA binding. The G overhang spontaneously folds into various G-quadruplex (GQ) conformations. It remains unclear whether GQ formation affects the ability of POT1/TPP1 to compete against RPA to access ssTEL. Using single-molecule Förster resonance energy transfer, we showed that POT1 stably loads to a minimal DNA sequence adjacent to a folded GQ. At 150 mM K+, POT1 loading unfolds the antiparallel GQ, as the parallel conformation remains folded. POT1/TPP1 loading blocks RPA’s access to both folded and unfolded telomeres by two orders of magnitude. This protection is not observed at 150 mM Na+, in which ssTEL forms only a less-stable antiparallel GQ. These results suggest that GQ formation of telomeric overhangs may contribute to suppression of DNA damage signals. PMID:24516170
Zhang, Peng; Liu, Hui; Ma, Suzhen; Men, Shuai; Li, Qingzhou; Yang, Xin; Wang, Hongning; Zhang, Anyun
2016-06-15
The harm of Salmonella enteritidis (S. enteritidis ) to public health mainly by contaminating fresh food and water emphasizes the urgent need for rapid detection techniques to help control the spread of the pathogen. In this assay, an newly designed capture probe complex that contained specific S. enteritidis-aptamer and hybridized signal target sequence was used for viable S. enteritidis recognition directly. In the presence of the target S. enteritidis, single-stranded target sequences were liberated and initiated the replication-cleavage reaction, producing numerous G-quadruplex structures with a linker on the 3'-end. And then, the sensing system took innovative advantage of quadratic linker-induced strand-displacement for the first time to release target sequence in succession, leading to the cyclic reuse of the target sequences and cascade signal amplification, thereby achieving the successive production of G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binded to these G-quadruplex structures and generated significantly enhanced fluorescent signals to achieve highly sensitive detection of S. enteritidis down to 60 CFU/mL with a linear range from 10(2) to 10(7)CFU/mL. By coupling the cascade two-stage target sequences-recyclable toehold strand-displacement with aptamer-based target recognition successfully, it is the first report on a novel non-label, modification-free and DNA extraction-free ultrasensitive fluorescence biosensor for detecting viable S. enteritidis directly, which can discriminate from dead S. enteritidis. Copyright © 2016 Elsevier B.V. All rights reserved.
Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel
2018-05-01
An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.
Yu, Xinhui; Lin, Yaohui; Wang, Xusheng; Xu, Liangjun; Wang, Zongwen; Fu, FengFu
2018-04-21
An exonuclease-assisted multicolor aptasensor was developed for the visual detection of ochratoxin A (OTA). It is based on the etching of gold nanorods (AuNRs) mediated by a G-quadruplex-hemin DNAzyme. A DNA sequence (AG4-OTA) was designed that comprises a hemin aptamer and an OTA aptamer. OTA binds to AG4-OTA to form an antiparallel G-quadruplex, which halts its digestion by exonuclease I (Exo I) from the 3'-end of AG4-OTA. Thus, the retained hemin aptamer can bind to hemin to form a G-quadruplex-hemin DNAzyme. This DNAzyme has peroxidase-like activity that catalyzes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by H 2 O 2 to produce its diimine derivative (TMB 2+ ) in acidic solution. TMB 2+ can etch the AuNRs by oxidizing Au(0) into Au(I). This results in the generation of rainbow-like colors and provides a multicolor platform for the visual detection of OTA. The assay is based on the use of a single isolated aptamer and possesses obvious advantages such as multi-color visual inspection, relatively high sensitivity and accuracy. It can be used to detect as little as 30 nM concentrations of OTA by visual observation and even 10 nM concentrations by spectrophotometry. The method was successfully applied to the determination of OTA in spiked beer where it gave recoveries of 101-108%, with a relative standard deviation (RSD, n = 5) of <5%. Graphical abstract Schematic of an exonuclease-assisted multicolor bioassay based on the G-quadruplex-hemin DNAzyme-mediated etching of gold nanorods (AuNRs). It enables visual detection of ochratoxin A (OTA) with a detection limit of 30 nM.
Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro
Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.
2015-01-01
The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241
DEFF Research Database (Denmark)
Zhang, Ling; Ulstrup, Jens; Zhang, Jingdong
2016-01-01
DNA quadruplexes (qs’s) are a class of “non-canonical” oligonucleotides (OGNs) composed of stacked guanine (G) quartets generally stabilized by monovalent cations. Metal porphyrins selectively bind to G-qs complexes to form DNAzyme, which can exhibit peroxidase and other catalytic activity simila...
Local, Andrea; Zhang, Hongying; Benbatoul, Khalid D; Folger, Peter; Sheng, Xia; Tsai, Cheng-Yu; Howell, Stephen B; Rice, William G
2018-06-01
APTO-253 is a phase I clinical stage small molecule that selectively induces CDKN1A (p21), promotes G 0 -G 1 cell-cycle arrest, and triggers apoptosis in acute myeloid leukemia (AML) cells without producing myelosuppression in various animal species and humans. Differential gene expression analysis identified a pharmacodynamic effect on MYC expression, as well as induction of DNA repair and stress response pathways. APTO-253 was found to elicit a concentration- and time-dependent reduction in MYC mRNA expression and protein levels. Gene ontogeny and structural informatic analyses suggested a mechanism involving G-quadruplex (G4) stabilization. Intracellular pharmacokinetic studies in AML cells revealed that APTO-253 is converted intracellularly from a monomer to a ferrous complex [Fe(253) 3 ]. FRET assays demonstrated that both monomeric APTO-253 and Fe(253) 3 stabilize G4 structures from telomeres, MYC, and KIT promoters but do not bind to non-G4 double-stranded DNA. Although APTO-253 exerts a host of mechanistic sequelae, the effect of APTO-253 on MYC expression and its downstream target genes, on cell-cycle arrest, DNA damage, and stress responses can be explained by the action of Fe(253) 3 and APTO-253 on G-quadruplex DNA motifs. Mol Cancer Ther; 17(6); 1177-86. ©2018 AACR . ©2018 American Association for Cancer Research.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate
2016-09-21
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela
2016-03-18
The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
RPA-mediated unfolding of systematically varying G-quadruplex structures.
Ray, Sujay; Qureshi, Mohammad H; Malcolm, Dominic W; Budhathoki, Jagat B; Celik, Uğur; Balci, Hamza
2013-05-21
G-quadruplex (GQ) is a noncanonical nucleic acid structure that is formed by guanine rich sequences. Unless it is destabilized by proteins such as replication protein A (RPA), GQ could interfere with DNA metabolic functions, such as replication or repair. We studied RPA-mediated GQ unfolding using single-molecule FRET on two groups of GQ structures that have different loop lengths and different numbers of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Those with shorter loops (less than three nucleotides long) or a greater number of layers (more than three layers) maintained a significant folded population even at physiological RPA concentration (≈1 μM), raising the possibility of physiological viability of such GQ structures. Finally, we measured the transition time between the start and end of the RPA-mediated GQ unfolding process to be 0.35 ± 0.10 s for all GQ constructs we studied, despite significant differences in their steady-state stabilities. We propose a two-step RPA-mediated GQ unfolding mechanism that is consistent with our observations. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.
Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole
2014-08-01
Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Li, Haiyin; Chang, Jiafu; Gai, Panpan; Li, Feng
2018-02-07
Fluorescence biosensing strategy has drawn substantial attention due to their advantages of simplicity, convenience, sensitivity, and selectivity, but unsatisfactory structure stability, low fluorescence quantum yield, high cost of labeling, and strict reaction conditions associated with current fluorescence methods severely prohibit their potential application. To address these challenges, we herein propose an ultrasensitive label-free fluorescence biosensor by integrating hemin/G-quadruplex-catalyzed oxidation reaction with aggregation induced emission (AIE) fluorogen-based system. l-Cysteine/TPE-M, which is carefully and elaborately designed and developed, obviously contributes to strong fluorescence emission. In the presence of G-rich DNA along with K + and hemin, efficient destruction of l-cysteine occurs due to hemin/G-quadruplex-catalyzed oxidation reactions. As a result, highly sensitive fluorescence detection of G-rich DNA is readily realized, with a detection limit down to 33 pM. As a validation for the further development of the proposed strategy, we also successfully construct ultrasensitive platforms for microRNA by incorporating the l-cysteine/TPE-M system with target-triggered cyclic amplification reaction. Thus, this proposed strategy is anticipated to find use in basic biochemical research and clinical diagnosis.
Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei
2016-01-15
Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Chang, Tianjun; Li, Weiguo; Ding, Zhan; Cheng, Shaofei; Liang, Kun; Liu, Xiangjun; Bing, Tao; Shangguan, Dihua
2017-08-01
Putative G-quadruplex (G4) forming sequences (PQS) are highly prevalent in the genome and transcriptome of various organisms and are considered as potential regulation elements in many biological processes by forming G4 structures. The formation of G4 structures highly depends on the sequences and the environment. In most cases, it is difficult to predict G4 formation by PQS, especially PQS containing G2 tracts. Therefore, the experimental identification of G4 formation is essential in the study of G4-related biological functions. Herein, we report a rapid and simple method for the detection of G4 structures by using a pair of complementary reporters, hemin and BMSP. This method was applied to detect G4 structures formed by PQS (DNA and RNA) searched in the genome and transcriptome of Oryza sativa. Unlike most of the reported G4 probes that only recognize part of G4 structures, the proposed method based on combined probes positively responded to almost all G4 conformations, including parallel, antiparallel, and mixed/hybrid G4, but did not respond to non-G4 sequences. This method shows potential for high-throughput identification of G4 structures in genome and transcriptome. Furthermore, BMSP was observed to drive some PQS to form more stable G4 structures or induce the G4 formation of some PQS that cannot form G4 in normal physiological conditions, which may provide a powerful molecular tool for gene regulation.
Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization
Directory of Open Access Journals (Sweden)
Victor Constantin Diculescu
2010-01-01
Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.
Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.
Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang
2017-12-01
Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.
Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.
Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng
2014-01-29
We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.
Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun
2017-06-02
G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Bussi, G.; Stadlbauer, Petr; Kührová, P.; Banáš, P.; Islam, Barira; Haider, S.; Neidle, S.; Otyepka, M.
2017-01-01
Roč. 1861, č. 5 (2017), s. 1246-1263 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : telomeric g-quadruplex * parallel g-quadruplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivam, Manikandan; Filitchev, Vyacheslav Viatcheslav
2009-01-01
A new quadruplex motif located in the promoter of the human KRAS gene, within a nuclease hypersensitive element (NHE), has been characterized. Oligonucleotides mimicking this quadruplex are found to compete with a DNA-protein complex between NHE and a nuclear extract from pancreatic cancer cells........ When modified with (R)-1-O-[4-1-(1-pyrenylethynyl) phenylmethyl]glycerol insertions (TINA), the quadruplex oligonucleotides showed a dramatic increase of the Tm (ΔTm from 22 to 32 °C) and a strong antiproliferative effects in Panc-1 cells....
Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena
2018-02-01
Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.
De Tito, Stefano; Morvan, François; Meyer, Albert; Vasseur, Jean-Jacques; Cummaro, Annunziata; Petraccone, Luigi; Pagano, Bruno; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Montesarchio, Daniela
2013-11-20
A novel fluorescent thrombin binding aptamer (TBA), conjugated with the environmentally sensitive dansyl probe at the 3'-end and a β-cyclodextrin residue at the 5'-end, has been efficiently synthesized exploiting Cu(I)-catalyzed azide-alkyne cycloaddition procedures. Its conformation and stability in solution have been studied by an integrated approach, combining in-depth NMR, CD, fluorescence, and DSC studies. ITC measurements have allowed us to analyze in detail its interaction with human thrombin. All the collected data show that this bis-conjugated aptamer fully retains its G-quadruplex formation ability and thrombin recognition properties, with the terminal appendages only marginally interfering with the conformational behavior of TBA. Folding of this modified aptamer into the chairlike, antiparallel G-quadruplex structure, promoted by K(+) and/or thrombin binding, typical of TBA, is associated with a net fluorescence enhancement, due to encapsulation of dansyl, attached at the 3'-end, into the apolar cavity of the β-cyclodextrin at the 5'-end. Overall, the structural characterization of this novel, bis-conjugated TBA fully demonstrates its potential as a diagnostic tool for thrombin recognition, also providing a useful basis for the design of suitable aptamer-based devices for theranostic applications, allowing simultaneously both detection and inhibition or modulation of the thrombin activity.
Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua
2018-05-01
Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.
Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations.
Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Pagano, Bruno; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio
2017-03-14
G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 ( d [AG 3 (T 2 AG 3 ) 3 ]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy ([Formula: see text] = -10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Kai, E-mail: zhangkai@jsinm.org; Wang, Ke; Zhu, Xue; Xie, Minhao
2015-08-05
Proteins play important roles in biological and cellular processes. The levels of proteins can be useful biomarkers for cellular events or disease diagnosis, thus the method for sensitive and selective detection of proteins is imperative to proteins express, study, and clinical diagnosis. Herein, we report a “signal-on” platform for the assay of protein based on binding-induced strategy and photoinduced electron transfer between Ag nanoclusters and split G-quadruplex-hemin complexes. By using biotin as the affinity ligand, this simple protocol could sensitively detect streptavidin with a detection limit down to 10 pM. With the use of an antibody as the affinity ligand, a method for homogeneous fluorescence detection of Prostate Specific Antigen (PSA) was also proposed with a detection limit of 10 pM. The one-step and wash-free assay showed good selectivity. Its high sensitivity, acceptable accuracy, and satisfactory versatility of analytes led to various applications in bioanalysis. - Highlights: • AgNCs have great potential for application in biomedicine. • Binding of two affinity ligands can result in binding-induced DNA assemblies. • PET can be happened between DNA/AgNCs and G-quadruplex/hemin complexes. • A platform for the detection of proteins was proposed by using PET and binding-induced strategy.
Directory of Open Access Journals (Sweden)
Julia H Chariker
Full Text Available G-quadruplex structures (G4 are found throughout the human genome and are known to play a regulatory role in a variety of molecular processes. Structurally, they have many configurations and can form from one or more DNA strands. At the gene level, they regulate gene expression and protein synthesis. In this paper, chromosomal-level patterns of distribution are analyzed on the human genome to identify high-level distribution patterns potentially related to global functional processes. Here we show unique high density banding patterns on individual chromosomes that are highly correlated, appearing in a mirror pattern, across forward and reverse DNA strands. The highest density of G4 sequences occurs within four megabases of one end of most chromosomes and contains G4 motifs that bind with zinc finger proteins. These findings suggest that G4 may play a role in global chromosomal processes such as those found in meiosis.
DEFF Research Database (Denmark)
Cogoi, Susanna; Paramasivan, Manikandan; Xodo, Luigi E.
2007-01-01
Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-q...
Belmonte-Reche, Efres; Martínez-García, Marta; Guédin, Aurore; Zuffo, Michela; Arévalo-Ruiz, Matilde; Doria, Filippo; Campos-Salinas, Jenny; Maynadier, Marjorie; López-Rubio, José Juan; Freccero, Mauro; Mergny, Jean-Louis; Pérez-Victoria, José María; Morales, Juan Carlos
2018-02-08
G-quadruplexes (G4) are DNA secondary structures that take part in the regulation of gene expression. Putative G4 forming sequences (PQS) have been reported in mammals, yeast, bacteria, and viruses. Here, we present PQS searches on the genomes of T. brucei, L. major, and P. falciparum. We found telomeric sequences and new PQS motifs. Biophysical experiments showed that EBR1, a 29 nucleotide long highly repeated PQS in T. brucei, forms a stable G4 structure. G4 ligands based on carbohydrate conjugated naphthalene diimides (carb-NDIs) that bind G4's including hTel could bind EBR1 with selectivity versus dsDNA. These ligands showed important antiparasitic activity. IC 50 values were in the nanomolar range against T. brucei with high selectivity against MRC-5 human cells. Confocal microscopy confirmed these ligands localize in the nucleus and kinetoplast of T. brucei suggesting they can reach their potential G4 targets. Cytotoxicity and zebrafish toxicity studies revealed sugar conjugation reduces intrinsic toxicity of NDIs.
The SARS-unique domain (SUD of SARS coronavirus contains two macrodomains that bind G-quadruplexes.
Directory of Open Access Journals (Sweden)
Jinzhi Tan
2009-05-01
Full Text Available Since the outbreak of severe acute respiratory syndrome (SARS in 2003, the three-dimensional structures of several of the replicase/transcriptase components of SARS coronavirus (SARS-CoV, the non-structural proteins (Nsps, have been determined. However, within the large Nsp3 (1922 amino-acid residues, the structure and function of the so-called SARS-unique domain (SUD have remained elusive. SUD occurs only in SARS-CoV and the highly related viruses found in certain bats, but is absent from all other coronaviruses. Therefore, it has been speculated that it may be involved in the extreme pathogenicity of SARS-CoV, compared to other coronaviruses, most of which cause only mild infections in humans. In order to help elucidate the function of the SUD, we have determined crystal structures of fragment 389-652 ("SUD(core" of Nsp3, which comprises 264 of the 338 residues of the domain. Both the monoclinic and triclinic crystal forms (2.2 and 2.8 A resolution, respectively revealed that SUD(core forms a homodimer. Each monomer consists of two subdomains, SUD-N and SUD-M, with a macrodomain fold similar to the SARS-CoV X-domain. However, in contrast to the latter, SUD fails to bind ADP-ribose, as determined by zone-interference gel electrophoresis. Instead, the entire SUD(core as well as its individual subdomains interact with oligonucleotides known to form G-quadruplexes. This includes oligodeoxy- as well as oligoribonucleotides. Mutations of selected lysine residues on the surface of the SUD-N subdomain lead to reduction of G-quadruplex binding, whereas mutations in the SUD-M subdomain abolish it. As there is no evidence for Nsp3 entering the nucleus of the host cell, the SARS-CoV genomic RNA or host-cell mRNA containing long G-stretches may be targets of SUD. The SARS-CoV genome is devoid of G-stretches longer than 5-6 nucleotides, but more extended G-stretches are found in the 3'-nontranslated regions of mRNAs coding for certain host-cell proteins
DEFF Research Database (Denmark)
Foulk, M. S.; Urban, J. M.; Casella, Cinzia
2015-01-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (lambda-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent...... strands intact. We used genomics and biochemical approaches to determine if lambda-exo digests all parental DNA sequences equally. We report that lambda-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, lambda-exo digestion of nonreplicating genomic DNA (LexoG0) enriches...... GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent lambda-exo biases in NSseq and validated this approach at the rDNA locus. The lambda-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s...
Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E
2014-02-21
Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.
Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong
2017-11-29
G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.
Moriyama, Kenji; Yoshizawa-Sugata, Naoko; Masai, Hisao
2018-03-09
Rap1-interacting protein 1 (Rif1) regulates telomere length in budding yeast. We previously reported that, in metazoans and fission yeast, Rif1 also plays pivotal roles in controlling genome-wide DNA replication timing. We proposed that Rif1 may assemble chromatin compartments that contain specific replication-timing domains by promoting chromatin loop formation. Rif1 also is involved in DNA lesion repair, restart after replication fork collapse, anti-apoptosis activities, replicative senescence, and transcriptional regulation. Although multiple physiological functions of Rif1 have been characterized, biochemical and structural information on mammalian Rif1 is limited, mainly because of difficulties in purifying the full-length protein. Here, we expressed and purified the 2418-amino-acid-long, full-length murine Rif1 as well as its partially truncated variants in human 293T cells. Hydrodynamic analyses indicated that Rif1 forms elongated or extended homo-oligomers in solution, consistent with the presence of a HEAT-type helical repeat segment known to adopt an elongated shape. We also observed that the purified murine Rif1 bound G-quadruplex (G4) DNA with high specificity and affinity, as was previously shown for Rif1 from fission yeast. Both the N-terminal (HEAT-repeat) and C-terminal segments were involved in oligomer formation and specifically bound G4 DNA, and the central intrinsically disordered polypeptide segment increased the affinity for G4. Of note, pulldown assays revealed that Rif1 simultaneously binds multiple G4 molecules. Our findings support a model in which Rif1 modulates chromatin loop structures through binding to multiple G4 assemblies and by holding chromatin fibers together. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Spectroscopic insights into quadruplexes of five-repeat telomere DNA sequences upon G-block damage
Czech Academy of Sciences Publication Activity Database
Dvořáková, Zuzana; Vorlíčková, Michaela; Renčiuk, Daniel
2017-01-01
Roč. 1861, č. 11 (2017), s. 2750-2757 ISSN 0304-4165 R&D Projects: GA ČR(CZ) GJ17-19170Y Institutional support: RVO:68081707 Keywords : k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 4.702, year: 2016
G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Ryneš, J.; Kejnovská, Iva; Foldynova-Trantirkova, S.; Andaeng, M.; Trantírek, L.; Vorlíčková, Michaela
2017-01-01
Roč. 1860, č. 2 (2017), s. 175-183 ISSN 1874-9399 R&D Projects: GA ČR(CZ) GP14-33947P; GA ČR GAP205/12/0466; GA ČR(CZ) GA15-06785S Institutional support: RVO:68081707 Keywords : linked polymorphic region * guanine quadruplexes * transcription factor Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 5.018, year: 2016
Xu, Wenju; Xue, Shuyan; Yi, Huayu; Jing, Pei; Chai, Yaqin; Yuan, Ruo
2015-01-28
In this work, a sensitive electrochemical aptasensor for the detection of thrombin (TB) is developed and demonstrated based on the co-catalysis of hemin/G-quadruplex, platinum nanoparticles (PtNPs) and flower-like MnO2 nanosphere functionalized multi-walled carbon nanotubes (MWCNT-MnO2).
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
Directory of Open Access Journals (Sweden)
Yanhua Chen
2016-05-01
Full Text Available A series of arene Ru(II complexes coordinated with phenanthroimidazole derivatives, [(η6-C6H6Ru(lCl]Cl(1b L = p-ClPIP = 2-(4-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 2b L = m-ClPIP = 2-(3-Chlorophenylimidazole[4,5f] 1,10-phenanthroline; 3b L = p-NPIP = 2-(4-Nitrophenylimidazole[4,5f] 1,10-phenanthroline; 4b L = m-NPIP = 2-(3-Nitrophenyl imidazole [4,5f] 1,10-phenanthroline were synthesized in yields of 89.9%–92.7% under conditions of microwave irradiation heating for 30 min to liberate four arene Ru(II complexes (1b, 2b, 3b, 4b. The anti-tumor activity of 1b against various tumor cells was evaluated by MTT assay. The results indicated that this complex blocked the growth of human lung adenocarcinoma A549 cells with an IC50 of 16.59 μM. Flow cytometric analysis showed that apoptosis of A549 cells was observed following treatment with 1b. Furthermore, the in vitro DNA-binding behaviors that were confirmed by spectroscopy indicated that 1b could selectively bind and stabilize bcl-2 G-quadruplex DNA to induce apoptosis of A549 cells. Therefore, the synthesized 1b has impressive bcl-2 G-quadruplex DNA-binding and stabilizing activities with potential applications in cancer chemotherapy.
Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.
Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V
2015-03-28
Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.
Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A
2015-05-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.
DNA adducts of antitumor cisplatin preclude telomeric sequences from forming G quadruplexes
Czech Academy of Sciences Publication Activity Database
Heringová, Pavla; Kašpárková, Jana; Brabec, Viktor
2009-01-01
Roč. 14, č. 6 (2009), s. 959-968 ISSN 0949-8257 R&D Projects: GA MZd(CZ) NR8562; GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803 Grant - others:GA MŠk(CZ) OC09018 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cisplatin * DNA quadruplex * telomere Subject RIV: BO - Biophysics Impact factor: 3.415, year: 2009
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Reshetnikov, Roman V.; Sponer, Jiri; Rassokhina, Olga I.; Kopylov, Alexei M.; Tsvetkov, Philipp O.; Makarov, Alexander A.; Golovin, Andrey V.
2011-01-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. PMID:21893589
Integration of G-quadruplex and DNA-templated Ag NCs for nonarithmetic information processing.
Gao, Ru-Ru; Yao, Tian-Ming; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei; Shi, Shuo
2017-06-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future.
Charge splitters and charge transport junctions based on guanine quadruplexes
Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.
2018-04-01
Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.
Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang
2015-01-01
This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Bednářová, Klára; Renčiuk, Daniel; Dvořáková, Zuzana; Školáková, Petra; Trantírek, L.; Fiala, R.; Vorlíčková, Michaela; Sagi, J.
2017-01-01
Roč. 45, č. 8 (2017), s. 4294-4305 ISSN 0305-1048 R&D Projects: GA MŠk EF15_003/0000477; GA ČR GAP205/12/0466; GA ČR GA13-28310S; GA ČR(CZ) GA15-06785S; GA MŠk(CZ) LQ1601 Institutional support: RVO:68081707 Keywords : dna-damage clusters * k+ solution * guanine quadruplexes Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 10.162, year: 2016
Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka
2018-03-01
The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process.
Reshetnikov, Roman V; Sponer, Jiri; Rassokhina, Olga I; Kopylov, Alexei M; Tsvetkov, Philipp O; Makarov, Alexander A; Golovin, Andrey V
2011-12-01
A combination of explicit solvent molecular dynamics simulation (30 simulations reaching 4 µs in total), hybrid quantum mechanics/molecular mechanics approach and isothermal titration calorimetry was used to investigate the atomistic picture of ion binding to 15-mer thrombin-binding quadruplex DNA (G-DNA) aptamer. Binding of ions to G-DNA is complex multiple pathway process, which is strongly affected by the type of the cation. The individual ion-binding events are substantially modulated by the connecting loops of the aptamer, which play several roles. They stabilize the molecule during time periods when the bound ions are not present, they modulate the route of the ion into the stem and they also stabilize the internal ions by closing the gates through which the ions enter the quadruplex. Using our extensive simulations, we for the first time observed full spontaneous exchange of internal cation between quadruplex molecule and bulk solvent at atomistic resolution. The simulation suggests that expulsion of the internally bound ion is correlated with initial binding of the incoming ion. The incoming ion then readily replaces the bound ion while minimizing any destabilization of the solute molecule during the exchange. © The Author(s) 2011. Published by Oxford University Press.
Gkionis, Konstantinos; Kruse, Holger; Šponer, Jiří
2016-04-12
Modern dispersion-corrected DFT methods have made it possible to perform reliable QM studies on complete nucleic acid (NA) building blocks having hundreds of atoms. Such calculations, although still limited to investigations of potential energy surfaces, enhance the portfolio of computational methods applicable to NAs and offer considerably more accurate intrinsic descriptions of NAs than standard MM. However, in practice such calculations are hampered by the use of implicit solvent environments and truncation of the systems. Conventional QM optimizations are spoiled by spurious intramolecular interactions and severe structural deformations. Here we compare two approaches designed to suppress such artifacts: partially restrained continuum solvent QM and explicit solvent QM/MM optimizations. We report geometry relaxations of a set of diverse double-quartet guanine quadruplex (GQ) DNA stems. Both methods provide neat structures without major artifacts. However, each one also has distinct weaknesses. In restrained optimizations, all errors in the target geometries (i.e., low-resolution X-ray and NMR structures) are transferred to the optimized geometries. In QM/MM, the initial solvent configuration causes some heterogeneity in the geometries. Nevertheless, both approaches represent a decisive step forward compared to conventional optimizations. We refine earlier computations that revealed sizable differences in the relative energies of GQ stems computed with AMBER MM and QM. We also explore the dependence of the QM/MM results on the applied computational protocol.
Audry, Julien; Maestroni, Laetitia; Delagoutte, Emmanuelle; Gauthier, Tiphaine; Nakamura, Toru M; Gachet, Yannick; Saintomé, Carole; Géli, Vincent; Coulon, Stéphane
2015-07-14
Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in DNA replication, recombination, and repair. In fission yeast, the Rpa1-D223Y mutation provokes telomere shortening. Here, we show that this mutation impairs lagging-strand telomere replication and leads to the accumulation of secondary structures and recruitment of the homologous recombination factor Rad52. The presence of these secondary DNA structures correlates with reduced association of shelterin subunits Pot1 and Ccq1 at telomeres. Strikingly, heterologous expression of the budding yeast Pif1 known to efficiently unwind G-quadruplex rescues all the telomeric defects of the D223Y cells. Furthermore, in vitro data show that the identical D to Y mutation in human RPA specifically affects its ability to bind G-quadruplex. We propose that RPA prevents the formation of G-quadruplex structures at lagging-strand telomeres to promote shelterin association and facilitate telomerase action at telomeres. © 2015 The Authors.
Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia
2011-05-17
Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.
Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh
2014-09-05
The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Chen, Chien-Han; Hu, Tsung-Hao; Huang, Tzu-Chiao; Chen, Ying-Lan; Chen, Yet-Ran; Cheng, Chien-Chung; Chen, Chao-Tsen
2015-11-23
A new G-quadruplex (G-4)-directing alkylating agent BMVC-C3M was designed and synthesized to integrate 3,6-bis(1-methyl-4-vinylpyridinium iodide)carbazole (BMVC) with aniline mustard. Various telomeric G-4 structures (hybrid-2 type and antiparallel) and an oncogene promoter, c-MYC (parallel), were constructed to react with BMVC-C3M, yielding 35 % alkylation yield toward G-4 DNA over other DNA categories (alkylation adducts by electrospray ionization mass spectroscopy (ESI-MS) revealed the stepwise DNA alkylation mechanism of aniline mustard for the first time. Furthermore, the monoalkylation sites and intrastrand cross-linking sites were determined and found to be dependent on G-4 topology based on the results of footprinting analysis in combination with mass spectroscopic techniques and in silico modeling. The results indicated that BMVC-C3M preferentially alkylated at A15 (H26), G12 (H24), and G2 (c-MYC), respectively, as monoalkylated adducts and formed A15-C3M-A21 (H26), G12-C3M-G4 (H24), and G2-C3M-G4/G17 (c-MYC), respectively, as cross-linked dialkylated adducts. Collectively, the stability and site-selective cross-linking capacity of BMVC-C3M provides a credible tool for the structural and functional characterization of G-4 DNAs in biological systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Thiagarajan, Viruthachalam; Ramamurthy, Perumal
2007-01-01
We present a simple but highly specific acridinedione fluorophore (ADD-1) that acts both as a fluorescent and colorimetric sensor for anions in acetonitrile. The specific optical signalling of ADD-1 is due to the formation of new distinct intramolecular charge transfer (ICT) emitting states in the presence of AcO - (490 nm), H 2 PO 4 - (440 nm), and F - (510 nm) over other anions. Presence of F - shows a colour change that is perceptible to the naked eye, from colourless to an intense fluorescent green due to the deprotonation of acridinedione ring amino hydrogen
DEFF Research Database (Denmark)
Kotkowiak, Weronika; Lisowiec-Wachnicka, Jolanta; Grynda, Jakub
2018-01-01
Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antipar......Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA) is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular......, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation......-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G...
Fleming, Aaron M; Zhou, Jia; Wallace, Susan S; Burrows, Cynthia J
2015-08-26
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC , KRAS , VEGF , BCL-2 , HIF-1α , and RET oncogenes, as examples, are targets for oxidation at loop and 5'-core guanines (G) as showcased in this study by CO 3 •- oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MY C, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a "spare tire," facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new "spare tire"-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a "spare-tire" fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress.
Directory of Open Access Journals (Sweden)
Alexandro Membrino
Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.
Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.
Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh
2017-10-18
G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Czech Academy of Sciences Publication Activity Database
Stadlbauer, Petr; Trantírek, L.; Cheatham III, T. E.; Koča, J.; Šponer, Jiří
105C, OCT2014 (2014), s. 22-35 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GAP208/12/1822; GA ČR(CZ) GA13-28310S Institutional support: RVO:68081707 Keywords : G-DNA folding * Quadruplex * Triplex Subject RIV: BO - Biophysics Impact factor: 2.963, year: 2014
Czech Academy of Sciences Publication Activity Database
Islam, B.; Stadlbauer, Petr; Neidle, S.; Haider, S.; Šponer, Jiří
2016-01-01
Roč. 120, č. 11 (2016), s. 2899-2912 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * TELOMERIC G-QUADRUPLEX * AMBER FORCE-FIELD Subject RIV: BO - Biophysics Impact factor: 3.177, year: 2016
2015-01-01
Uncontrolled inflammation or oxidative stress generates electron-deficient species that oxidize the genome increasing its instability in cancer. The G-quadruplex (G4) sequences regulating the c-MYC, KRAS, VEGF, BCL-2, HIF-1α, and RET oncogenes, as examples, are targets for oxidation at loop and 5′-core guanines (G) as showcased in this study by CO3•– oxidation of the VEGF G4. Products observed include 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). Our previous studies found that OG and Gh, when present in the four G-tracks of the solved structure for VEGF and c-MYC, were not substrates for the base excision repair (BER) DNA glycosylases in biologically relevant KCl solutions. We now hypothesize that a fifth G-track found a few nucleotides distant from the G4 tracks involved in folding can act as a “spare tire,” facilitating extrusion of a damaged G-run into a large loop that then becomes a substrate for BER. Thermodynamic, spectroscopic, and DMS footprinting studies verified the fifth domain replacing a damaged G-track with OG or Gh at a loop or core position in the VEGF G4. These new “spare tire”-containing strands with Gh in loops are now found to be substrates for initiation of BER with the NEIL1, NEIL2, and NEIL3 DNA glycosylases. The results support a hypothesis in which regulatory G4s carry a “spare-tire” fifth G-track for aiding in the repair process when these sequences are damaged by radical oxygen species, a feature observed in a large number of these sequences. Furthermore, formation and repair of oxidized bases in promoter regions may constitute an additional example of epigenetic modification, in this case of guanine bases, to regulate gene expression in which the G4 sequences act as sensors of oxidative stress. PMID:26405692
Hirashima, Kyotaro; Seimiya, Hiroyuki
2015-02-27
Telomere erosion causes cell mortality, suggesting that longer telomeres enable more cell divisions. In telomerase-positive human cancer cells, however, telomeres are often kept shorter than those of surrounding normal tissues. Recently, we showed that cancer cell telomere elongation represses innate immune genes and promotes their differentiation in vivo. This implies that short telomeres contribute to cancer malignancy, but it is unclear how such genetic repression is caused by elongated telomeres. Here, we report that telomeric repeat-containing RNA (TERRA) induces a genome-wide alteration of gene expression in telomere-elongated cancer cells. Using three different cell lines, we found that telomere elongation up-regulates TERRA signal and down-regulates innate immune genes such as STAT1, ISG15 and OAS3 in vivo. Ectopic TERRA oligonucleotides repressed these genes even in cells with short telomeres under three-dimensional culture conditions. This appeared to occur from the action of G-quadruplexes (G4) in TERRA, because control oligonucleotides had no effect and a nontelomeric G4-forming oligonucleotide phenocopied the TERRA oligonucleotide. Telomere elongation and G4-forming oligonucleotides showed similar gene expression signatures. Most of the commonly suppressed genes were involved in the innate immune system and were up-regulated in various cancers. We propose that TERRA G4 counteracts cancer malignancy by suppressing innate immune genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
De Boeck, Benoit; Herbert, Nicola M A; Harrington-Frost, Nicole M; Pattenden, Gerald
2005-01-21
Treatment of a variety of substituted vinylcyclopropyl selenyl esters, e.g. 11, with Bu(3)SnH-AIBN in refluxing benzene leads to the corresponding acyl radical intermediates, which undergo rearrangement and intramolecular cyclisations via their ketene alkyl radical equivalents producing cyclohexenones in 50-60% yield. By contrast, treatment of conjugated triene selenyl esters, e.g. 32, with Bu(3)SnH-AIBN produces substituted 2-cyclopentenones via intramolecular cyclisations of their ketene alkyl radical intermediates. Under the same radical-initiating conditions the selenyl esters derived from o-vinylbenzoic acid and o-vinylcinnamic acid undergo intramolecular cyclisations producing 1-indanone and 5,6-dihydrobenzocyclohepten-7-one respectively in 60-70% yields. A tandem radical cyclisation from the alpha,beta,gamma,delta-diene selenyl ester 31 provides an expeditious synthesis of the diquinane 35 in 69% yield.
Directory of Open Access Journals (Sweden)
Liliana Mammino
2017-08-01
Full Text Available Arzanol is a naturally-occurring prenylated acylphloroglucinol isolated from Helichrysum italicum and exhibiting anti-oxidant, antibiotic and antiviral activities. The molecule contains an α-pyrone moiety attached to the phloroglucinol moiety through a methylene bridge. The presence of several hydrogen bond donor or acceptor sites makes intramolecular hydrogen bonding patterns the dominant stabilising factor. Conformers with all the possible different hydrogen bonding patterns were calculated at the HF/6-31G(d,p and DFT/B3LYP/6-31+G(d,p levels with fully relaxed geometry in vacuo and in three solvents—chloroform, acetonitrile and water (these levels being chosen to enable comparisons with previous studies on acylphloroglucinols. Calculations in solution were performed with the Polarisable Continuum Model. The results show that the lowest energy conformers have the highest number of stronger intramolecular hydrogen bonds. The influence of intramolecular hydrogen bonding patterns on the other molecular properties is also analysed.
Mostafavi, Najmeh; Ebrahimi, Ali
2018-06-01
In order to characterize various interactions in the G-quadruplex ⋯ Mn+ (G-Q ⋯ Mn+) complexes, the individual H-bond (EHB) and metal ion-ligand interaction (EMO) energies have been estimated using the electron charge densities (ρs) calculated at the X ⋯ H (X = N and O) and Mn+ ⋯ O (Mn+ is an alkaline, alkaline earth and transition metal ion) bond critical points (BCPs) obtained from the atoms in molecules (AIM) analysis. The estimated values of EMO and EHB were evaluated using the structural parameters, results of natural bond orbital analysis (NBO), aromaticity indexes and atomic charges. The EMO value increase with the ratio of ionic charge to radius, e/r, where a linear correlation is observed between EMO and e/r (R = 0.97). Meaningful relationships are also observed between EMO and indexes used for aromaticity estimation. The ENH value is higher than EOH in the complexes; this is in complete agreement with the trend of N⋯Hsbnd N and O⋯Hsbnd N angles, the E (2) value of nN → σ*NH and nO → σ*NH interactions and the difference between the natural charges on the H-bonded atom and the hydrogen atom of guanine (Δq). In general, the O1MO2 angle becomes closer to 109.5° with the increase in EMO and decrease in EHB in the presence of metal ion.
Raff, Lionel M.
1989-06-01
The unimolecular decomposition reactions of 1,2-difluoroethane upon mode-specific excitation to a total internal energy of 7.5 eV are investigated using classical trajectory methods and a previously formulated empirical potential-energy surface. The decomposition channels for 1,2-difluoroethane are, in order of importance, four-center HF elimination, C-C bond rupture, and hydrogen-atom dissociation. This order is found to be independent of the particular vibrational mode excited. Neither fluorine-atom nor F2 elimination reactions are ever observed even though these dissociation channels are energetically open. For four-center HF elimination, the average fraction of the total energy partitioned into internal HF motion varies between 0.115-0.181 depending upon the particular vibrational mode initially excited. The internal energy of the fluoroethylene product lies in the range 0.716-0.776. Comparison of the present results with those previously obtained for a random distribution of the initial 1,2-difluoroethane internal energy [J. Phys. Chem. 92, 5111 (1988)], shows that numerous mode-specific effects are present in these reactions in spite of the fact that intramolecular energy transfer rates for this system are 5.88-25.5 times faster than any of the unimolecular reaction rates. Mode-specific excitation always leads to a total decomposition rate significantly larger than that obtained for a random distribution of the internal energy. Excitation of different 1,2-difluoroethane vibrational modes is found to produce as much as a 51% change in the total decomposition rate. Mode-specific effects are also seen in the product energy partitioning. The rate coefficients for decomposition into the various channels are very sensitive to the particular mode excited. A comparison of the calculated mode-specific effects with the previously determined mode-to-mode energy transfer rate coefficients [J. Chem. Phys. 89, 5680 (1988)] shows that, to some extent, the presence of mode-specific
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
Felsenstein, Kenneth M; Saunders, Lindsey B; Simmons, John K; Leon, Elena; Calabrese, David R; Zhang, Shuling; Michalowski, Aleksandra; Gareiss, Peter; Mock, Beverly A; Schneekloth, John S
2016-01-15
The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Directory of Open Access Journals (Sweden)
Charlotte Rehm
Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S
2015-01-01
In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Intramolecular Association within the SAFT Framework
DEFF Research Database (Denmark)
Avlund, Ane Søgaard; Kontogeorgis, Georgios; Chapman, Walter G.
2011-01-01
A general theory for modelling intramolecular association within the SAFT framework is proposed. Sear and Jackson [Phys. Rev. E. 50 (1), 386 (1994)] and Ghonasgi and Chapman [J. Chem. Phys. 102 (6), 2585 (1995)] have previously extended SAFT to include intramolecular association for chains with two...... the contribution to the Helmholtz free energy from association (inter- as well as intramolecularly) at equilibrium. Sear and Jackson rederived the contribution to the Helmholtz free energy from association from the theory by Wertheim [J. Stat. Phys. 42 (3–4), 459 (1986)] with inclusion of intramolecular...
QuadBase2: web server for multiplexed guanine quadruplex mining and visualization
Dhapola, Parashar; Chowdhury, Shantanu
2016-01-01
DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 (quadbase.igib.res.in) presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890
The role of alkali metal cations in the stabilization of guanine quadruplexes: why K(+) is the best.
Zaccaria, F; Paragi, G; Fonseca Guerra, C
2016-08-21
The alkali metal ion affinity of guanine quadruplexes has been studied using dispersion-corrected density functional theory (DFT-D). We have done computational investigations in aqueous solution that mimics artificial supramolecular conditions where guanine bases assemble into stacked quartets as well as biological environments in which telomeric quadruplexes are formed. In both cases, an alkali metal cation is needed to assist self-assembly. Our quantum chemical computations on these supramolecular systems are able to reproduce the experimental order of affinity of the guanine quadruplexes for the cations Li(+), Na(+), K(+), Rb(+), and Cs(+). The strongest binding is computed between the potassium cation and the quadruplex as it occurs in nature. The desolvation and the size of alkali metal cations are thought to be responsible for the order of affinity. Until now, the relative importance of these two factors has remained unclear and debated. By assessing the quantum chemical 'size' of the cation, determining the amount of deformation of the quadruplex needed to accommodate the cation and through the energy decomposition analysis (EDA) of the interaction energy between the cation and the guanines, we reveal that the desolvation and size of the alkali metal cation are both almost equally responsible for the order of affinity.
Intramolecular BSSE and dispersion affect the structure of a dipeptide conformer
Hameed, Rabia; Khan, Afsar; van Mourik, Tanja
2018-05-01
B3LYP and MP2 calculations with the commonly-used 6-31+G(d) basis set predict qualitatively different structures for the Tyr-Gly conformer book1, which is the most stable conformer identified in a previous study. The structures differ mainly in the ψtyr Ramachandran angle (138° in the B3LYP structure and 120° in the MP2 structure). The causes for the discrepant structures are attributed to missing dispersion in the B3LYP calculations and large intramolecular BSSE in the MP2 calculations. The correct ψtyr value is estimated to be 130°. The MP2/6-31+G(d) profile identified an additional conformer, not present on the B3LYP surface, with a ψtyr value of 96° and a more folded structure. This minimum is, however, likely an artefact of large intramolecular BSSE values. We recommend the use of basis sets of at least quadruple-zeta quality in density functional theory (DFT), DFTaugmented with an empirical dispersion term (DFT-D) and second-order Møller-Plesset perturbation theory (MP2 ) calculations in cases where intramolecular BSSE is expected to be large.
OH stretching frequencies in systems with intramolecular hydrogen bonds
DEFF Research Database (Denmark)
Spanget-Larsen, Jens; Hansen, Bjarke Knud Vilster; Hansen, Poul Erik
2011-01-01
OH stretching wavenumbers were investigated for 30 species with intramolecularly hydrogen bonded hydroxyl groups, covering the range from 3600 to ca. 1900 cm-1. Theoretical wavenumbers were predicted with B3LYP/6-31G(d) density functional theory using the standard harmonic approximation, as well...
Structure of a Stable G-Hairpin
Czech Academy of Sciences Publication Activity Database
Gajarský, M.; Zivkovic, M.L.; Stadlbauer, Petr; Pagano, B.; Fiala, R.; Amato, J.; Tomáška, L´.; Šponer, Jiří; Plavec, J.; Trantírek, L.
2017-01-01
Roč. 139, č. 10 (2017), s. 3591-3594 ISSN 0002-7863 R&D Projects: GA ČR GA13-28310S; GA ČR(CZ) GA16-13721S Institutional support: RVO:68081707 Keywords : g-quadruplex structures * human telomeric dna * single-stranded-dna * g-triplex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.858, year: 2016
Stability of Human Telomere Quadruplexes at High DNA Concentrations
Czech Academy of Sciences Publication Activity Database
Kejnovská, Iva; Vorlíčková, Michaela; Brázdová, Marie; Sagi, J.
2014-01-01
Roč. 101, č. 4 (2014), s. 428-438 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : quadruplex * DNA concentration * folding topology Subject RIV: BO - Biophysics Impact factor: 2.385, year: 2014
Isolation of deletion alleles by G4 DNA-induced mutagenesis
Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel
Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature
Czech Academy of Sciences Publication Activity Database
Gkionis, K.; Kruse, H.; Platts, J. A.; Mládek, Arnošt; Koča, J.; Šponer, Jiří
2014-01-01
Roč. 10, č. 3 (2014), s. 1326-1340 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : MOLECULAR-DYNAMICS SIMULATIONS * GAUSSIAN-BASIS SETS * TETRAMOLECULAR G-QUADRUPLEXES Subject RIV: BO - Biophysics Impact factor: 5.498, year: 2014
Directory of Open Access Journals (Sweden)
Weronika Kotkowiak
2018-03-01
Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.
On prediction of OH stretching frequencies in intramolecularly hydrogen bonded systems
DEFF Research Database (Denmark)
Hansen, Poul Erik; Spanget-Larsen, Jens
2012-01-01
OH stretching frequencies are investigated for a series of non-tautomerizing systems with intramolecular hydrogen bonds. Effective OH stretching wavenumbers are predicted by the application of empirical correlation procedures based on the results of B3LYP/6-31G(d) theoretical calculations...
Wieloch, Thomas; Ehlers, Ina; Yu, Jun; Frank, David; Grabner, Michael; Gessler, Arthur; Schleucher, Jürgen
2018-03-22
Measurements of carbon isotope contents of plant organic matter provide important information in diverse fields such as plant breeding, ecophysiology, biogeochemistry and paleoclimatology. They are currently based on 13 C/ 12 C ratios of specific, whole metabolites, but we show here that intramolecular ratios provide higher resolution information. In the glucose units of tree-ring cellulose of 12 tree species, we detected large differences in 13 C/ 12 C ratios (>10‰) among carbon atoms, which provide isotopically distinct inputs to major global C pools, including wood and soil organic matter. Thus, considering position-specific differences can improve characterisation of soil-to-atmosphere carbon fluxes and soil metabolism. In a Pinus nigra tree-ring archive formed from 1961 to 1995, we found novel 13 C signals, and show that intramolecular analysis enables more comprehensive and precise signal extraction from tree rings, and thus higher resolution reconstruction of plants' responses to climate change. Moreover, we propose an ecophysiological mechanism for the introduction of a 13 C signal, which links an environmental shift to the triggered metabolic shift and its intramolecular 13 C signature. In conclusion, intramolecular 13 C analyses can provide valuable new information about long-term metabolic dynamics for numerous applications.
Excited state Intramolecular Proton Transfer in Anthralin
DEFF Research Database (Denmark)
Møller, Søren; Andersen, Kristine B.; Spanget-Larsen, Jens
1998-01-01
Quantum chemical calculations performed on anthralin (1,8-dihydroxy-9(10H)-anthracenone) predict the possibility of an excited-state intramolecular proton transfer process. Fluorescence excitation and emission spectra of the compound dissolved in n-hexane at ambient temperature results in an unus......Quantum chemical calculations performed on anthralin (1,8-dihydroxy-9(10H)-anthracenone) predict the possibility of an excited-state intramolecular proton transfer process. Fluorescence excitation and emission spectra of the compound dissolved in n-hexane at ambient temperature results......, associated with an excited-state intramolecular proton transfer process....
Müştak, Hamit Kaan; Günaydin, Elçin; Kaya, İnci Başak; Salar, Merve Özdal; Babacan, Orkun; Önat, Kaan; Ata, Zafer; Diker, Kadir Serdar
2015-01-01
Escherichia coli is one of the major causative agents of bovine mastitis worldwide, and is typically associated with acute, clinical mastitis. Besides this, E. coli strains which belong to the extra-intestinal pathogenic group are also the major cause of urinary tract infections and pyometra in dogs. In this study, it was aimed to investigate phylo-groups/subgroups in 155 E. coli isolates obtained from acute bovine mastitis, 43 from urinary tract infections of dogs and 20 from canine pyometra by a formerly described triplex PCR and recently described new quadruplex polymerase chain reaction (PCR) method. Group A1 (n = 118; 76%) and B1 (n = 71; 46%) were found to be the most prevalent groups by triplex and quadruplex PCR assays in mastitis isolates, respectively. Phylo-typing of 43 urinary tract isolates also revealed that most of the isolates belonged to A1 (n = 23; 54%) by triplex and B2 (n = 36; 84%) by quadruplex PCR assays. The isolates assigned as group A1 (n = 17; 85%) by triplex PCR could not be classified by quadruplex PCR in pyometra isolates. The results support the hypothesis that E. coli strains isolated from bovine mastitis cases are environmental. Also, groups C, E and F were identified as new phylo-groups for the first time in acute bovine mastitis cases. The comparison of triplex PCR with quadruplex PCR results revealed that most of the groups assigned in triplex PCR were altered by quadruplex PCR assay.
Gao, Ru-Ru; Lv, Xiao-Yan; Zhu, Yan-Yan; Zhang, Yi-Wei
2017-01-01
To create sophisticated molecular logic circuits from scratch, you may not believe how common the building blocks can be and how diverse and powerful such circuits can be when scaled up. Using the two simple building blocks of G-quadruplex and silver nanoclusters (Ag NCs), we experimentally construct a series of multifunctional, label-free, and multi-output logic circuits to perform nonarithmetic functions: a 1-to-2 decoder, a 4-to-2 encoder, an 8-to-3 encoder, dual transfer gates, a 2 : 1 multiplexer, and a 1 : 2 demultiplexer. Moreover, a parity checker which is capable of identifying odd and even numbers from natural numbers is constructed conceptually. Finally, a multi-valued logic gate (ternary inhibit gate) is readily achieved by taking this DNA/Ag NC system as a universal platform. All of the above logic circuits share the same building blocks, indicating the great prospects of the assembly of nanomaterials and DNA for biochemical logic devices. Considering its biocompatibility, the novel prototypes developed here may have potential applications in the fields of biological computers and medical diagnosis and serve as a promising proof of principle in the not-too-distant future. PMID:28626564
Femtosecond laser studies of ultrafast intramolecular processes
Energy Technology Data Exchange (ETDEWEB)
Hayden, C. [Sandia National Laboratories, Livermore, CA (United States)
1993-12-01
The goal of this research is to better understand the detailed mechanisms of chemical reactions by observing, directly in time, the dynamics of fundamental chemical processes. In this work femtosecond laser pulses are used to initiate chemical processes and follow the progress of these processes in time. The authors are currently studying ultrafast internal conversion and subsequent intramolecular relaxation in unsaturated hydrocarbons. In addition, the authors are developing nonlinear optical techniques to prepare and monitor the time evolution of specific vibrational motions in ground electronic state molecules.
On combinatorial properties of elementary intramolecular operations
Directory of Open Access Journals (Sweden)
Vladimir Rogojin
2014-11-01
Full Text Available Here we tackle a problem from biology in terms of discrete mathematics. We are interested in a complex DNA manipulation process happening in eukaryotic organisms of a subclass of ciliate species called {\\it Stichotrichia} during so-called gene assembly. This process is in particular interesting since one can interpret gene assembly in ciliates as sorting of permutations. We survey here results related to studies on sorting permutations with some specific rewriting rules that formalize elementary intramolecular gene assembly operations. The research question is ``what permutation may be sorted with our operations?"
Intramolecular hydrogen bonding in malonaldehyde and its radical analogues.
Lin, Chen; Kumar, Manoj; Finney, Brian A; Francisco, Joseph S
2017-09-28
High level Brueckner doubles with triples correction method-based ab initio calculations have been used to investigate the nature of intramolecular hydrogen bonding and intramolecular hydrogen atom transfer in cis-malonaldehyde (MA) and its radical analogues. The radicals considered here are the ones that correspond to the homolytic cleavage of C-H bonds in cis-MA. The results suggest that cis-MA and its radical analogues, cis-MA RS , and cis-MA RA , both exist in planar geometry. The calculated intramolecular O-H⋯O=C bond in cis-MA is shorter than that in the radical analogues. The intramolecular hydrogen bond in cis-MA is stronger than in its radicals by at least 3.0 kcal/mol. The stability of a cis-malonaldehyde radical correlates with the extent of electron spin delocalization; cis-MA RA , in which the radical spin is more delocalized, is the most stable MA radical, whereas cis-MA RS , in which the radical spin is strongly localized, is the least stable radical. The natural bond orbital analysis indicates that the intramolecular hydrogen bonding (O⋯H⋯O) in cis-malonaldehyde radicals is stabilized by the interaction between the lone pair orbitals of donor oxygen and the σ * orbital of acceptor O-H bond (n → σ * OH ). The calculated barriers indicate that the intramolecular proton transfer in cis-MA involves 2.2 kcal/mol lower barrier than that in cis-MA RS .
Quadruplex-forming properties of FRAXA (CGG) repeats interrupted by (AGG) triplets
Czech Academy of Sciences Publication Activity Database
Renčiuk, Daniel; Zemánek, Michal; Kejnovská, Iva; Vorlíčková, Michaela
2009-01-01
Roč. 91, č. 3 (2009), s. 416-422 ISSN 0300-9084 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : fragile X-chromosome * quadruplex * CD spectroscopy Subject RIV: BO - Biophysics Impact factor: 3.897, year: 2009
Parthenopoulos, Dimitri A.; Kasha, Michael
1988-04-01
Coherent stimulated emission and laser beams of good quality are reported for 3-hydroxyfiavone (3-HF) and a polyhydroxyfiavone, risetin, acting as intramolecular proton-transfer lasers. The laser beam quality of these materials is comparable to that observed for rhodamine-6G. Studies of amplified spontaneous emission of 3-hydroxyflavone in highly polar solvents are also reported. The very large changes in dipole moment upon electronic excitation of 3-HF expected according to ZINDO semiempirical molecular orbital calculations fail to give rise to spectral shifts in the high dielectric constant solvents. The results are interpreted as a masking spectral effect caused by specific hydrogen bonding by the solvent.
Molecular dynamics simulations of guanine quadruplex loops: Advances and force field limitations
Czech Academy of Sciences Publication Activity Database
Fadrná, E.; Špačková, Naďa; Štefl, R.; Koča, J.; Cheatham III, T. E.; Šponer, Jiří
2004-01-01
Roč. 87, č. 1 (2004), s. 227-242 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF Institutional research plan: CEZ:AV0Z5004920 Keywords : quanine quadruplex * four-thymidine loop * locally enhanced sampling Subject RIV: BO - Biophysics Impact factor: 4.585, year: 2004
New stereoselective intramolecular
Alajarin; Vidal; Tovar; Ramirez De Arellano MC; Cossio; Arrieta; Lecea
2000-11-03
Efficient 1,4-asymmetric induction has been achieved in the highly stereocontrolled intramolecular [2 + 2] cycloadditions between ketenimines and imines, leading to 1,2-dihydroazeto[2, 1-b]quinazolines. The chiral methine carbon adjacent to the iminic nitrogen controls the exclusive formation of the cycloadducts with relative trans configuration at C2 and C8. The stepwise mechanistic model, based on theoretical calculations, fully supports the stereochemical outcome of these cycloadditions.
Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding
Czech Academy of Sciences Publication Activity Database
Babinský, M.; Fiala, R.; Kejnovská, Iva; Bednářová, Klára; Marek, R.; Sagi, J.; Sklenář, V.; Vorlíčková, Michaela
2014-01-01
Roč. 42, č. 22 (2014), s. 14031-14041 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GAP205/12/0466 Institutional support: RVO:68081707 Keywords : human telomere * DNA quadruplex * cellular DNA Subject RIV: BO - Biophysics Impact factor: 9.112, year: 2014
Intramolecular addition of benzylic radicals onto ketenimines. Synthesis of 2-alkylindoles.
Alajarín, Mateo; Vidal, Angel; Ortín, María-Mar
2003-12-07
The inter- and intramolecular addition of free radicals onto ketenimines is studied. All the attempts to add intermolecularly several silicon, oxygen or carbon centered radicals to N-(4-methylphenyl)-C,C-diphenyl ketenimine were unsuccessful. In contrast, the intramolecular addition of benzylic radicals, generated from xanthates, onto the central carbon of a ketenimine function with its N atom linked to the ortho position of the aromatic ring occurred under a variety of reaction conditions. These intramolecular cyclizations provide a novel radical-mediated synthesis of 2-alkylindoles.
Intramolecular and nonlinear dynamics
Energy Technology Data Exchange (ETDEWEB)
Davis, M.J. [Argonne National Laboratory, IL (United States)
1993-12-01
Research in this program focuses on three interconnected areas. The first involves the study of intramolecular dynamics, particularly of highly excited systems. The second area involves the use of nonlinear dynamics as a tool for the study of molecular dynamics and complex kinetics. The third area is the study of the classical/quantum correspondence for highly excited systems, particularly systems exhibiting classical chaos.
Intramolecular and Transannular Diels-Alder Reactions
DEFF Research Database (Denmark)
Tanner, David Ackland; Ascic, Erhad
2014-01-01
Few reactions can compete with the Diels-Alder (DA) [4+2] cycloaddition for the rapid and efficient generation of molecular complexity. The DA reaction is atom-economic and stereospecific, as well as diastereo- and regioselective. The intramolecular version (IMDA) of the DA cycloaddition and its...... and dienophile, methods for acceleration of IMDA reactions (such as use of high pressure) and catalysis (using oxophilic or carbophilic metal complexes, Brønsted acids, and enzymes). The use of furans as diene components (IMDAF), intramolecular hetero-DA (IMHDA) and IMDA reactions with inverse electron demand...... are also covered. Applications of IMDA to asymmetric synthesis (from substrate control through to enantioselective catalysis, including organocatalysis) are presented, along with tandem sequences involving IMDA cycloaddition. A theme pervading the whole chapter is the use of IMDA reactions for the total...
Highly efficient induction of chirality in intramolecular
Cossio; Arrieta; Lecea; Alajarin; Vidal; Tovar
2000-06-16
Highly stereocontrolled, intramolecular [2 + 2] cycloadditions between ketenimines and imines leading to 1,2-dihydroazeto[2, 1-b]quinazolines have been achieved. The source of stereocontrol is a chiral carbon atom adjacent either to the iminic carbon or nitrogen atom. In the first case, the stereocontrol stems from the preference for the axial conformer in the first transition structure. In the second case, the origin of the stereocontrol lies on the two-electron stabilizing interaction between the C-C bond being formed and the sigma orbital corresponding to the polar C-X bond, X being an electronegative atom. These models can be extended to other related systems for predicting the stereochemical outcome in this intramolecular reaction.
Yang, Minglei; Wu, Ying; Jin, Shan; Hou, Jinyan; Mao, Yingji; Liu, Wenbo; Shen, Yangcheng; Wu, Lifang
2015-01-01
Sapium sebiferum (Linn.) Roxb. (Chinese Tallow Tree) is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA) and triacylglycerol (TAG) biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Zhou, Xingxing; Guo, Shijing; Gao, Jiaxi; Zhao, Jianmin; Xue, Shuyan; Xu, Wenju
2017-12-15
Based on cascade catalysis amplification driven by glucose oxidase (GOx), a sensitive electrochemical impedimetric aptasensor for protein (carcinoembryonic antigen, CEA as tested model) was proposed by using Cu-based metal-organic frameworks functionalized with Pt nanoparticles, aptamer, hemin and GOx (Pt@CuMOFs-hGq-GOx). CEA aptamer loaded onto Pt@CuMOFs was bound with hemin to form hemin@G-quadruplex (hGq) with mimicking peroxidase activity. Through sandwich-type reaction of target CEA and CEA aptamers (Apt1 and Apt2), the obtained Pt@CuMOFs-hGq-GOx as signal transduction probes (STPs) was captured to the modified electrode interface. When 3,3-diaminobenzidine (DAB) and glucose were introduced, the cascade reaction was initiated by GOx to catalyze the oxidation of glucose, in situ generating H 2 O 2 . Simultaneously, the decomposition of the generated H 2 O 2 was greatly promoted by Pt@CuMOFs and hGq as synergistic peroxide catalysts, accompanying with the significant oxidation process of DAB and the formation of nonconductive insoluble precipitates (IPs). As a result, the electron transfer in the resultant sensing interface was effectively hindered and the electrochemical impedimetric signal (EIS) was efficiently amplified. Thus, the high sensitivity of the proposed CEA aptasensor was successfully improved with 0.023pgmL -1 , which may be promising and potential in assaying certain clinical disease related to CEA. Copyright © 2017 Elsevier B.V. All rights reserved.
Photoswitchable Intramolecular H-Stacking of Perylenebisimide
Wang, Jiaobing; Kulago, Artem; Browne, Wesley R.; Feringa, Ben L.
2010-01-01
Dynamic control over the formation of H- or J-type aggregates of chromophores is of fundamental importance for developing responsive organic optoelectronic materials. In this study, the first example of photoswitching between a nonstacked and an intramolecularly H-stacked arrangement of
Marathias, V M; Sawicki, M J; Bolton, P H
1999-07-15
The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.
Photochemical Dynamics of Intramolecular Singlet Fission
Lin, Zhou; Iwasaki, Hikari; Van Voorhis, Troy
2017-06-01
Singlet fission (SF) converts a singlet exciton (S_1) into a pair of triplet ones (T_1) via a ``multi-exciton'' (ME) intermediate: S_1 \\longleftrightarrow ^1ME \\longleftrightarrow ^1(T_1T_1) \\longrightarrow 2T_1. In exothermic cases, e.g., crystalline pentacene or its derivatives, the quantum yield of SF can reach 200%. With SF doubling the electric current generated by an incident high-energy photon, the solar conversion efficiency in pentacene-based organic photovoltaics (OPVs) can exceed the Shockley-Queisser limit of 33.7%. The ME state is popularly considered to be a dimeric state with significant charge transfer (CT) character that is strongly coupled to both S_1 and ^1(T_1T_1), while this local model lacks strong support from full quantum dynamics studies. Intramolecular SF (ISF) occurring to covalently-bound dimers in the solution phase is an excellent model for a straightforward dynamics simulation of local excitons. In the present study, we investigate the ISF mechanisms for three covalently-bound dimers of pentacene derivatives, including ortho-, meta-, and para-bis(6,13-bis(triisopropylsilylethynyl)pentacene)benzene, in non-protic solvents. Specifically, we propagate the real-time, non-adiabatic quantum mechanical/molecular mechanical (QM/MM) dynamics on the potential energy surfaces associated with the states of S_1, ^1(T_1T_1) and CT. We explore how the energies of these ISF-relevant states and the non-adiabatic couplings between each other fluctuate with time and the instantaneous molecular configuration (e.g., intermonomer distance and orientation). We also quantitatively compare Condon and non-Condon ISF dynamics with solution-phase spectroscopic data. Our results allow us to understand the roles of CT energy levels in the ISF mechanism and propose a design strategy to maximize ISF efficiency. M. B. Smith and J. Michl, Chem. Rev. 110, 6891 (2010). W. Shockley and H. J. Queisser, J. Appl. Phys. 32, 510 (1961). T. C. Berkelbach, M. S. Hybertsen
Hybrid ligand-alkylating agents targeting telomeric G-quadruplex structures.
Doria, Filippo; Nadai, Matteo; Folini, Marco; Di Antonio, Marco; Germani, Luca; Percivalle, Claudia; Sissi, Claudia; Zaffaroni, Nadia; Alcaro, Stefano; Artese, Anna; Richter, Sara N; Freccero, Mauro
2012-04-14
The synthesis, physico-chemical properties and biological effects of a new class of naphthalene diimides (NDIs) capable of reversibly binding telomeric DNA and alkylate it through an electrophilic quinone methide moiety (QM), are reported. FRET and circular dichroism assays showed a marked stabilization and selectivity towards telomeric G4 DNA folded in a hybrid topology. NDI-QMs' alkylating properties revealed a good reactivity on single nucleosides and selectivity towards telomeric G4. A selected NDI was able to significantly impair the growth of melanoma cells by causing telomere dysfunction and down-regulation of telomerase expression. These findings points to our hybrid ligand-alkylating NDIs as possible tools for the development of novel targeted anticancer therapies. This journal is © The Royal Society of Chemistry 2012
Hsu, Liang-Yan; Wu, Ning; Rabitz, Herschel
2016-11-30
We investigate electron transport through series and parallel intramolecular circuits in the framework of the multi-level Redfield theory. Based on the assumption of weak monomer-bath couplings, the simulations depict the length and temperature dependence in six types of intramolecular circuits. In the tunneling regime, we find that the intramolecular circuit rule is only valid in the weak monomer coupling limit. In the thermally activated hopping regime, for circuits based on two different molecular units M a and M b with distinct activation energies E act,a > E act,b , the activation energies of M a and M b in series are nearly the same as E act,a while those in parallel are nearly the same as E act,b . This study gives a comprehensive description of electron transport through intramolecular circuits from tunneling to thermally activated hopping. We hope that this work can motivate additional studies to design intramolecular circuits based on different types of building blocks, and to explore the corresponding circuit laws and the length and temperature dependence of conductance.
International Nuclear Information System (INIS)
Xiang, Debo; Noel, Jerome; Shao, Huibo; Dupas, Georges; Merbouh, Nabyl; Yu, Hua-Zhong
2015-01-01
Highlights: • Unique intramolecular electronic communications (electron withdrawing and π-bond delocalization effects) exist in the mono-ferrocenylpyrimidine derivatives. • The redox potential shift correlates the pyrimidine ring torsion angle with the extent of electron delocalization. • The correlation between redox properties and structural nature in mono-ferrocenylpyrimidine derivatives is evident. - Abstract: The correlation between redox properties and structural nature in a complete set of mono-ferrocenylpyrimidine derivatives (2-ferrocenylpyrimidine, 2-FcPy; 4-ferrocenylpyrimidine, 4-FcPy; 5-ferrocenylpyrimidine, 5-FcPy) was evaluated by investigating the intramolecular electronic communications. Both conventional electrochemical measurements in organic solvents and thin-film voltammetric studies of these compounds were carried out. It was discovered that their formal potentials are significantly different from each other, and shift negatively in the order of 4-FcPy > 5-FcPy > 2-FcPy. This result suggests that the intramolecular electronic communication is dictated by the delocalization effect of the π-bonding systems in 2-FcPy, and that the electron-withdrawing effect of the nitrogen atoms in the pyrimidine ring plays the key role in 4-FcPy and 5-FcPy. The single crystal X-ray structure analyis and Density Functional Theory (DFT) calculation provided additional evidence (e.g., different torsion angles between the cyclopentadienyl and pyrimidine rings) to support the observed correlation between the redox properties and structural nature
Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions
Kocman, Vojč; Plavec, Janez
2017-05-01
Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.
Quadruplex gold immunochromatogaraphic assay for four families of antibiotic residues in milk.
Zhou, Jinyu; Nie, Wei; Chen, Yiqiang; Yang, Chunjiang; Gong, Lu; Zhang, Chi; Chen, Qian; He, Lidong; Feng, Xiaoyu
2018-08-01
In this study, we developed a quadruplex gold immunochromatogaraphic assay (GICA) for the simultaneous determination of four families of antibiotics including β-lactams, tetracyclines, streptomycin and chloramphenicol in milk. For qualitative analysis, the visual cut-off values were measured to be 2-100 ng/mL, 16-32 ng/mL, 50 ng/mL and 2.4 ng/mL for β-lactams, tetracyclines, streptomycin and chloramphenicol, respectively. For quantitative analysis, the detection ranges were 0.13-1 ng/mL for penicillin G, 0.13-8 ng/mL for tetracycline, 0.78-25 ng/mL for streptomycin, 0.019-1.2 ng/mL for chloramphenicol in milk respectively, with linear correlation coefficients higher than 0.97. The spiked experiment indicated that the mean recoveries ranged from 84.5% to 107.6% with coefficient of variations less than 16.2%, and real sample analysis revealed that the GICA can produce consistent results with instrumental analysis. These results demonstrated that this novel immunoassay is a promising approach for rapidly screening common antibiotic residues in milk. Copyright © 2018 Elsevier Ltd. All rights reserved.
New findings on the d(TGGGAG) sequence: Surprising anti-HIV-1 activity.
Romanucci, Valeria; Zarrelli, Armando; Liekens, Sandra; Noppen, Sam; Pannecouque, Christophe; Di Fabio, Giovanni
2018-02-10
The biological relevance of tetramolecular G-quadruplexes especially as anti-HIV agents has been extensively reported in the literature over the last years. In the light of our recent results regarding the slow G-quadruplex folding kinetics of ODNs based on d(TGGGAG) sequence, here we report a systematic anti-HIV screening to investigate the impact of the G-quadruplex folding on their anti-HIV activity. In particular, varying the single stranded concentrations of ODNs, it has been tested a pool of ODN sample solutions with different G-quadruplex concentrations. The anti-HIV assays have been designed favouring the limited kinetics involved in the tetramolecular G4-association based on the d(TGGGAG) sequence. Aiming to determine the stoichiometry of G-quadruplex structures in the same experimental conditions of the anti-HIV assays, a native gel electrophoresis was performed. The gel confirmed the G-quadruplex formation for almost all sample solutions while showing the formation of high order G4 structures for the more concentrated ODNs solutions. The most significant result is the discovery of a potent anti-HIV activity of the G-quadruplex formed by the natural d(TGGGAG) sequence (IC 50 = 14 nM) that, until now, has been reported to be completely inactive against HIV infection. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Minglei Yang
Full Text Available Sapium sebiferum (Linn. Roxb. (Chinese Tallow Tree is a perennial woody tree and its seeds are rich in oil which hold great potential for biodiesel production. Despite a traditional woody oil plant, our understanding on S. sebiferum genetics and molecular biology remains scant. In this study, the first comprehensive transcriptome of S. sebiferum flower has been generated by sequencing and de novo assembly. A total of 149,342 unigenes were generated from raw reads, of which 24,289 unigenes were successfully matched to public database. A total of 61 MADS box genes and putative pathways involved in S. sebiferum flower development have been identified. Abiotic stress response network was also constructed in this work, where 2,686 unigenes are involved in the pathway. As for lipid biosynthesis, 161 unigenes have been identified in fatty acid (FA and triacylglycerol (TAG biosynthesis. Besides, the G-Quadruplexes in RNA of S. sebiferum also have been predicted. An interesting finding is that the stress-induced flowering was observed in S. sebiferum for the first time. According to the results of semi-quantitative PCR, expression tendencies of flowering-related genes, GA1, AP2 and CRY2, accorded with stress-related genes, such as GRX50435 and PRXⅡ39562. This transcriptome provides functional genomic information for further research of S. sebiferum, especially for the genetic engineering to shorten the juvenile period and improve yield by regulating flower development. It also offers a useful database for the research of other Euphorbiaceae family plants.
Solvent control of intramolecular proton transfer
DEFF Research Database (Denmark)
Manolova, Y.; Marciniak, Heinz; Tschierlei, S.
2017-01-01
of molecules in the enol and zwitterionic proton transfer (PT) form exists in the ground state. However, the zwitterion is the energetically favored one in the electronically excited state. Optical excitation of the enol form results in intramolecular proton transfer and formation of the PT form within 1.4 ps...
Competing Intramolecular vs. Intermolecular Hydrogen Bonds in Solution
Directory of Open Access Journals (Sweden)
Peter I. Nagy
2014-10-01
Full Text Available A hydrogen bond for a local-minimum-energy structure can be identified according to the definition of the International Union of Pure and Applied Chemistry (IUPAC recommendation 2011 or by finding a special bond critical point on the density map of the structure in the framework of the atoms-in-molecules theory. Nonetheless, a given structural conformation may be simply favored by electrostatic interactions. The present review surveys the in-solution competition of the conformations with intramolecular vs. intermolecular hydrogen bonds for different types of small organic molecules. In their most stable gas-phase structure, an intramolecular hydrogen bond is possible. In a protic solution, the intramolecular hydrogen bond may disrupt in favor of two solute-solvent intermolecular hydrogen bonds. The balance of the increased internal energy and the stabilizing effect of the solute-solvent interactions regulates the new conformer composition in the liquid phase. The review additionally considers the solvent effects on the stability of simple dimeric systems as revealed from molecular dynamics simulations or on the basis of the calculated potential of mean force curves. Finally, studies of the solvent effects on the type of the intermolecular hydrogen bond (neutral or ionic in acid-base complexes have been surveyed.
Intramolecularly Hydrogen-Bonded Polypyrroles as Electro-Optical Sensors
National Research Council Canada - National Science Library
Nicholson, Jesse
2001-01-01
We have developed a new class of polypyrroles bearing both hydrogen-bond acceptor and hydrogen-donor groups such that the intramolecular hydrogen bonding holds the system planar enhancing conjugation...
Shi, Jian-Jun; Zhu, Jing-Chun; Zhao, Ming; Wang, Yan; Yang, Ping; He, Jie
2018-06-01
An ultrasensitive photoelectrochemical (PEC) aptasensor for lead ion (Pb 2+ ) detection was fabricated based on MoS 2 -CdS:Mn nanocomposites and sensitization effect of CdTe quantum dots (QDs). MoS 2 -CdS:Mn modified electrode was used as the PEC matrix for the immobilization of probe DNA (pDNA) labeled with CdTe QDs. Target DNA (tDNA) were hybridized with pDNA to made the QDs locate away from the electrode surface by the rod-like double helix. The detection of Pb 2+ was based on the conformational change of the pDNA to G-quadruplex structure in the presence of Pb 2+ , which made the labeled QDs move close to the electrode surface, leading to the generation of sensitization effect and evident increase of the photocurrent intensity. The linear range was 50 fM to 100 nM with a detection limit of 16.7 fM. The recoveries of the determination of Pb 2+ in real samples were in the range of 102.5-108.0%. This proposed PEC aptasensor provides a new sensing strategy for various heavy metal ions at ultralow levels. Copyright © 2018 Elsevier B.V. All rights reserved.
INTRAMOLECULAR ISOTOPE EFFECTS IN HYDROCARBON MASS SPECTRA
Energy Technology Data Exchange (ETDEWEB)
Stevenson, D. P.; Schachtschneider, J. H.
1963-07-15
Approximate calculations based on the quasi-equilibrium rate theory of the origin of mass spectra are shown to lead to an approximately correct magnitude for the intramolecular ( pi /sup -/) isotope effect on C--H bond dissociation probabilities of various deuterohydrocarbons. (auth)
Cation binding to 15-TBA quadruplex DNA is a multiple-pathway cation-dependent process
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.V.; Šponer, Jiří; Rassokhina, O.I.; Kopylov, A.M.; Tsvetkov, P.O.; Makarov, A.A.; Golovin, A.V.
2011-01-01
Roč. 39, č. 22 (2011), s. 9789-9802 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA ČR(CZ) GAP208/11/1822; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : QM/MM * quadruplex DNA * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 8.026, year: 2011
Effects of acid concentration on intramolecular charge transfer ...
Indian Academy of Sciences (India)
rate. Time-dependent density functional theory calculations have been performed to understand the observed spectroscopic results. Keywords. Intramolecular charge transfer; absorption and fluorescence; time resolved fluorescence measurements; acid concentration dependence; time-dependent density functional theory.
Determination of specific IgG antibody by crossed radioimmunoelectrophoresis
International Nuclear Information System (INIS)
Nordvall, S.L.; Uhlin, T.; Einarsson, R.
1983-01-01
A crossed radioimmunoelectrophoretic method was developed for detection of honey bee venom specific IgG antibodies in patient sera. At the serum concentration 1/200 the contrast between specific binding and backgroud was the most favourable. The detection limit was fairly low, approximately 30 kU/l(IgG RAST units). A reference system based on the reference kits in Phadebas IgG-RAST was elaborated. (author)
Determination of specific IgG antibody by crossed radioimmunoelectrophoresis
Energy Technology Data Exchange (ETDEWEB)
Nordvall, S.L. (Dept. of Paediatrics, University Hospital, Uppsala, Sweden); Uhlin, T.; Einarsson, R. (Allergy Research, Pharmacia Diagnostics AB, Uppsala, Sweden)
1983-01-01
A crossed radioimmunoelectrophoretic method was developed for detection of honey bee venom specific IgG antibodies in patient sera. At the serum concentration 1/200 the contrast between specific binding and backgroud was the most favourable. The detection limit was fairly low, approximately 30 kU/l(IgG RAST units). A reference system based on the reference kits in Phadebas IgG-RAST was elaborated.
Liu, Wei; Chen, Wen; Liu, Si-Jia; Jiang, Jian-Hui
2017-03-01
Small molecule probes suitable for selective and specific fluorescence imaging of some important but low-concentration intracellular reactive sulfur species such as cysteine (Cys) pose a challenge in chemical biology. We present a readily available, fast-response fluorescence probe CHCQ-Ac, with 2-(5‧-chloro-2-hydroxyl-phenyl)-6-chloro-4(3 H)-quinazolinone (CHCQ) as the fluorophore and acrylate group as the functional moiety, that enables high-selectivity and high-sensitivity for detecting Cys in both solution and biological system. After specifically reacted with Cys, the probe undergoes a seven-membered intramolecular cyclization and released the fluorophore CHCQ with excited-state intramolecular photon transfer effect. A highly fluorescent, insoluble aggregate was then formed to facilitate high-sensitivity and high-resolution imaging. The results showed that probe CHCQ-Ac affords a remarkably large Stokes shift and can detect Cys under physiological pH condition with no interference from other analytes. Moreover, this probe was proved to have excellent chemical stability, low cytotoxicity and good cell permeability. Our design of this probe provides a novel potential tool to visualize and localize cysteine in bioimaging of live cells that would greatly help to explore various Cys-related physiological and pathological cellular processes in cell biology and diagnostics.
Structure and Intramolecular Proton Transfer of Alanine Radical Cations
International Nuclear Information System (INIS)
Lee, Gab Yong
2012-01-01
The structures of the four lowest alanine conformers, along with their radical cations and the effect of ionization on the intramolecular proton transfer process, are studied using the density functional theory and MP2 method. The energy order of the radical cations of alanine differs from that of the corresponding neutral conformers due to changes in the basicity of the NH 2 group upon ionization. Ionization favors the intramolecular proton transfer process, leading to a proton-transferred radical-cation structure, [NH 3 + -CHCH 3 -COO·], which contrasts with the fact that a proton-transferred zwitterionic conformer is not stable for a neutral alanine in the gas phase. The energy barrier during the proton transfer process is calculated to be about 6 kcal/mol
Intramolecular electron transfer in single-site-mutated azurins
DEFF Research Database (Denmark)
Farver, O; Skov, L K; Pascher, T
1993-01-01
. Natl. Acad. Sci. U.S.A. 86, 6968-6972]. The RSSR- radical produced in the above reaction was reoxidized in a slower intramolecular electron-transfer process (30-70 s-1 at 298 K) concomitant with a further reduction of the Cu(II) ion. The temperature dependence of the latter rates was determined......, lambda = 135 kJ mol-1 for the reorganization energy was derived. When Trp48, situated midway between the donor and the acceptor, was replaced by Leu or Met, only a small change in the rate of intramolecular electron transfer was observed, indicating that the aromatic residue in this position...... is apparently only marginally involved in electron transfer in wild-type azurin. Pathway calculations also suggest that a longer, through-backbone path is more efficient than the shorter one involving Trp48. The former pathway yields an exponential decay factor, beta, of 6.6 nm-1. Another mutation, raising...
Karpfen, Alfred; Kryachko, Eugene S
2009-04-30
A series of intermolecular complexes formed between the triatomic hydrides HAX and various interaction partners are investigated computationally aiming (1) to demonstrate that either an appearance or nonappearance of a blue shift of the A-H stretching frequency is directly related to the sign of the intramolecular coupling that exists between the two degrees of freedom, the A-H and A-X bond lengths, and (2) to offer the following conjecture: the theoretical protonation of a triatomic neutral molecule HAX at the site X is a simple and rather efficient probe of a red or blue shift that the stretching frequency nu(A-H) undergoes upon complex formation regardless of whether this bond is directly involved in hydrogen bonding or not. In other words, to predict whether this A-H bond is capable to display a blue or red shift of nu(A-H), it suffices to compare the equilibrium structures and vibrational spectra of a given molecule with its protonated counterpart. The two above goals are achieved invoking a series of 11 triatomic molecules: HNO, HSN, HPO, and HPS characterized by a negative intramolecular coupling; HON and HNS as intermediate cases; and HOF, HOCl, HCN, HNC, and HCP with a positive intramolecular coupling. For these purposes, the latter molecules are investigated at the MP2/6-311++G(2p,2d) level in the neutral and protonated HAXH(+) forms as well as their complexes with H(2)O and with the fluoromethanes H(3)CF, H(2)CF(2), and HCF(3).
Symmetry of intramolecular quantum dynamics
Burenin, Alexander V
2012-01-01
The main goal of this book is to give a systematic description of intramolecular quantum dynamics on the basis of only the symmetry principles. In this respect, the book has no analogs in the world literature. The obtained models lead to a simple, purely algebraic, scheme of calculation and are rigorous in the sense that their correctness is limited only to the correct choice of symmetry of the internal dynamics. The book is basically intended for scientists working in the field of molecular spectroscopy, quantum and structural chemistry.
Filarowski, A.; Kochel, A.; Koll, A.; Bator, G.; Mukherjee, S.
2006-03-01
The crystal structures of two ortho-hydroxy aryl ketones (5-chloro-3-nitro-2-hydroxyacetophenone, 5-methyl-3-nitro-2-hydroxyacetophenone and the complex 5-chloro-3-nitro-2-hydroxyacetophenone with 2-aminobenzoic acid (anthranilic acid)) were determined by X-ray diffraction. The existence of an intramolecular hydrogen bond of enol character between the hydroxyl and acetyl groups was found by the X-ray method. The enol character was also confirmed by DFT (B3LYP/6-31+G(d,p)) calculations. A phase transition was found at 138 K in 5-chloro-3-nitro-2-hydroxyacetophenone. This phase transition was investigated by differential scanning calorimetry (DSC), dilatometry, and the dielectric method. A study of the nitro-group dynamics in the ortho-hydroxy acetophenones was carried out with DFT (B3LYP/6-31+G(d,p)) calculations.
Timothy-specific IgG antibody levels vary with the pollen seasons.
Nordvall, S L; Larsson, P H; Johansson, S G
1986-11-01
Serum samples were collected from eight grass pollen hypersensitive children during a 4-year period. The sera were assayed for contents of timothy-specific IgE antibodies by RAST. Timothy-specific IgG and IgA antibodies were quantified by a refined ELISA in which covalent binding of the antigen to the polystyrene solid phase had been performed. IgG antibodies were also assayed by a Sepharose-protein-A technique with radiolabelled timothy allergens as the antigen. It was possible to register clearcut seasonal variations with postseasonally boosted antibody levels not only of timothy-specific IgE but also of IgG antibody. Both IgG1 and IgG4 antibodies specific for timothy showed seasonal variations of a similar degree. It was not possible to register seasonal variations of the same magnitude of timothy-specific IgA antibodies.
Li, Kai; Feng, Qi; Niu, Guangle; Zhang, Weijie; Li, Yuanyuan; Kang, Miaomiao; Xu, Kui; He, Juan; Hou, Hongwei; Tang, Ben Zhong
2018-04-23
In this work, a benzothiazole-based aggregation-induced emission luminogen (AIEgen) of 2-(5-(4-carboxyphenyl)-2-hydroxyphenyl)benzothiazole (3) was designed and synthesized, which exhibited multifluorescence emissions in different dispersed or aggregated states based on tunable excited-state intramolecular proton transfer (ESIPT) and restricted intramolecular rotation (RIR) processes. 3 was successfully used as a ratiometric fluorescent chemosensor for the detection of pH, which exhibited reversible acid/base-switched yellow/cyan emission transition. More importantly, the pH jump of 3 was very precipitous from 7.0 to 8.0 with a midpoint of 7.5, which was well matched with the physiological pH. This feature makes 3 very suitable for the highly sensitive detection of pH fluctuation in biosamples and neutral water samples. 3 was also successfully used as a ratiometric fluorescence chemosensor for the detection of acidic and basic organic vapors in test papers.
Preparation of CN /Carbon Nanotube Intramolecular Junctions by ...
African Journals Online (AJOL)
NICO
intramolecular junctions composed of CNx with a bamboo-like structure and empty hollow carbon nanotubes were observed, ... and excellent thermal and mechanical properties.1,2 In recent .... tion of hexane, and the other segment with a curved compart- ... by an arrow lies at the interface of the junction between 'b' and.
Regulation of interleukin-4 signaling by extracellular reduction of intramolecular disulfides
International Nuclear Information System (INIS)
Curbo, Sophie; Gaudin, Raphael; Carlsten, Mattias; Malmberg, Karl-Johan; Troye-Blomberg, Marita; Ahlborg, Niklas; Karlsson, Anna; Johansson, Magnus; Lundberg, Mathias
2009-01-01
Interleukin-4 (IL-4) contains three structurally important intramolecular disulfides that are required for the bioactivity of the cytokine. We show that the cell surface of HeLa cells and endotoxin-activated monocytes can reduce IL-4 intramolecular disulfides in the extracellular space and inhibit binding of IL-4 to the IL-4Rα receptor. IL-4 disulfides were in vitro reduced by thioredoxin 1 (Trx1) and protein disulfide isomerase (PDI). Reduction of IL-4 disulfides by the cell surface of HeLa cells was inhibited by auranofin, an inhibitor of thioredoxin reductase that is an electron donor to both Trx1 and PDI. Both Trx1 and PDI have been shown to be located at the cell surface and our data suggests that these enzymes are involved in catalyzing reduction of IL-4 disulfides. The pro-drug N-acetylcysteine (NAC) that promotes T-helper type 1 responses was also shown to mediate the reduction of IL-4 disulfides. Our data provides evidence for a novel redox dependent pathway for regulation of cytokine activity by extracellular reduction of intramolecular disulfides at the cell surface by members of the thioredoxin enzyme family.
Czech Academy of Sciences Publication Activity Database
Reshetnikov, R.; Golovin, A.; Spiridonova, V.; Kopylov, A.; Šponer, Jiří
2010-01-01
Roč. 6, č. 10 (2010), s. 3003-3014 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : molecular dynamics * quadruplex DNA * thrombin Subject RIV: BO - Biophysics Impact factor: 5.138, year: 2010
Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis
International Nuclear Information System (INIS)
Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.
2004-01-01
Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)
Sky-blue emitting bridged diiridium complexes: beneficial effects of intramolecular π-π stacking.
Congrave, Daniel G; Hsu, Yu-Ting; Batsanov, Andrei S; Beeby, Andrew; Bryce, Martin R
2018-02-06
The potential of intramolecular π-π interactions to influence the photophysical properties of diiridium complexes is an unexplored topic, and provides the motivation for the present study. A series of diarylhydrazide-bridged diiridium complexes functionalised with phenylpyridine (ppy)-based cyclometalating ligands is reported. It is shown by NMR studies in solution and single crystal X-ray analysis that intramolecular π-π interactions between the bridging and cyclometalating ligands rigidify the complexes leading to high luminescence quantum efficiencies in solution and in doped films. Fluorine substituents on the phenyl rings of the bridge promote the intramolecular π-π interactions. Notably, these non-covalent interactions are harnessed in the rational design and synthesis of the first examples of highly emissive sky-blue diiridium complexes featuring conjugated bridging ligands, for which they play a vital role in the structural and photophysical properties. Experimental results are supported by computational studies.
Novel molecular targets for kRAS downregulation: promoter G-quadruplexes
2016-11-01
proteins studied. 6. Products: • Publications, conference papers , and presentations o Journal Publications • Morgan, RK; Batra, H; Gaerig, VC; Hockings, J... papers , and presentations • Batra, H; Brooks, TA. Binding and function of regulatory proteins to the kRAS promoter: a role in pancreatic cancer. 6th...development due to difficulties with delivery and excessive albumin binding, and antisoma’s G-rich phosphodiester oligonucleotide AS1411, a DNA aptamer with
Sekita, Hiroko; Adachi, Kyohei; Kobayashi, Ippei; Sato, Yusuke; Nakada, Masahisa
2017-05-05
An enantio- and stereoselective construction of the atisane scaffold via organocatalytic intramolecular Michael reaction and Diels-Alder reaction is described. The organocatalytic intramolecular Michael reaction has been found to stereoselectively generate a trans-stereodiad comprising an all-carbon quaternary and a tertiary stereogenic centers. Use of the chiral secondary amine bearing thiourea with benzoic acid as additive is the key to obtaining the desired product with excellent ee in synthetically acceptable yield. The prepared chiral building block has been successfully converted to the compound including the atisane scaffold via the highly stereoselective intramolecular Diels-Alder reaction.
Directory of Open Access Journals (Sweden)
Lisandra Akemi Suzuki
Full Text Available In the present study, an enzyme-linked immunosorbent assay (ELISA standardized with vesicular fluid of Taenia solium cysticerci was used to screen for IgG (total and subclasses and IgE antibodies in cerebrospinal fluid (CSF samples from patients with neurocysticercosis showing intrathecal production of specific IgG antibodies and patients with other neurological disorders. The following results were obtained: IgG-ELISA: 100% sensitivity (median of the ELISA absorbances (MEA=1.17 and 100% specificity; IgG1-ELISA: 72.7% sensitivity (MEA=0.49 and 100% specificity; IgG2-ELISA: 81.8% sensitivity (MEA=0.46 and 100% specificity; IgG3-ELISA: 63.6% sensitivity (MEA=0.12 and 100% specificity; IgG4-ELISA: 90.9% sensitivity (MEA=0.85 and 100% specificity; IgE-ELISA 93.8% sensitivity (MEA=0.60 and 100% specificity. There were no significant differences between the sensitivities and specificities in the detection of IgG-ELISA and IgE-ELISA, although in CSF samples from patients with neurocysticercosis the MEA of the IgG-ELISA was significantly higher than that of the IgE-ELISA. The sensitivity and MEA values of the IgG4-ELISA were higher than the corresponding values for the other IgG subclasses. Future studies should address the contribution of IgG4 and IgE antibodies to the physiopathology of neurocysticercosis.
Spinello, A; Barone, G; Grunenberg, J
2016-01-28
In depth Monte Carlo conformational scans in combination with molecular dynamics (MD) simulations and electronic structure calculations were applied in order to study the molecular recognition process between tetrasubstituted naphthalene diimide (ND) guests and G-quadruplex (G4) DNA receptors. ND guests are a promising class of telomere stabilizers due to which they are used in novel anticancer therapeutics. Though several ND guests have been studied experimentally in the past, the protonation state under physiological conditions is still unclear. Based on chemical intuition, in the case of N-methyl-piperazine substitution, different protonation states are possible and might play a crucial role in the molecular recognition process by G4-DNA. Depending on the proton concentration, different nitrogen atoms of the N-methyl-piperazine might (or might not) be protonated. This fact was considered in our simulation in terms of a case by case analysis, since the process of molecular recognition is determined by possible donor or acceptor positions. The results of our simulations show that the electrostatic interactions between the ND ligands and the G4 receptor are maximized in the case of the protonation of the terminal nitrogen atoms, forming compact ND G4 complexes inside the grooves. The influence of different protonation states in terms of the ability to form hydrogen bonds with the sugar-phosphate backbone, as well as the importance of mediated vs. direct hydrogen bonding, was analyzed in detail by MD and relaxed force constant (compliance constant) simulations.
21 CFR 866.5520 - Immunoglobulin G (Fab fragment specific) immunological test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fab fragment specific... Test Systems § 866.5520 Immunoglobulin G (Fab fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fab fragment specific) immunological test system is a device that consists...
21 CFR 866.5540 - Immunoglobulin G (Fd fragment specific) immunological test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fd fragment specific... Test Systems § 866.5540 Immunoglobulin G (Fd fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fd fragment specific) immunological test system is a device that consists of...
21 CFR 866.5530 - Immunoglobulin G (Fc fragment specific) immunological test system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fc fragment specific... Test Systems § 866.5530 Immunoglobulin G (Fc fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fc fragment specific) immunological test system is a device that consists of...
Intramolecular inverse electron demand Diels-Alder reactions of pyrimidines
Frissen, A.E.
1990-01-01
This thesis deals with the intramolecular inverse electron demand Diels-Alder reaction of pyrimidines. The main objective of the study was to investigate the synthetic applicability of this reaction and to get more insight in the electronic and steric effects which determine the reactivity
International Nuclear Information System (INIS)
Hsu, C.-H.; Lin, S.-Y.
2009-01-01
The thermal stability and thermodynamics of gabapentin (GBP) in the solid state were investigated by DSC and TG techniques, and FTIR microspectroscopy. The detailed intramolecular lactamization process of GBP to form gabapentin-lactam (GBP-L) was also determined by thermal FTIR microspectroscopy. GBP exhibited a DSC endothermic peak at 169 deg. C. The weight loss in TG curve of GBP suggested that the evaporation process of water liberated via intramolecular lactamization was simultaneously combined with the evaporation process of GBP-L having a DSC endothermic peak at 91 deg. C. A thermal FTIR microspectroscopy clearly evidenced the IR spectra at 3350 cm -1 for water liberated and at 1701 cm -1 for lactam structure formed due to the lactam formation of GBP. This study indicates that the activation energy for combined processes of intramolecular lactamization of GBP and evaporation of GBP-L was about 114.3 ± 23.3 kJ/mol, but for the evaporation of GBP-L alone was 76.2 ± 1.5 kJ/mol. A powerful simultaneous DSC-FTIR combined technique was easily used to quickly examine the detailed kinetic processes of intramolecular cyclization of GPB and evaporation of GBP-L in the solid state
Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond
Indian Academy of Sciences (India)
Ultrafast Dynamics of Chemical Reactions in Condensed Phase: Intramolecular Energy Transfer, Charge Transfer & Hydrogen Bond · PowerPoint Presentation · Slide 3 · Slide 4 · Slide 5 · Slide 6 · Slide 7 · Slide 8 · Slide 9 · Slide 10 · Slide 11 · Slide 12 · Slide 13 · Slide 14 · Slide 15 · Slide 16 · Slide 17 · Slide 18 · Slide 19.
Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA
DEFF Research Database (Denmark)
Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch
2016-01-01
of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...
Transposable elements and G-quadruplexes
Czech Academy of Sciences Publication Activity Database
Kejnovský, Eduard; Tokan, Viktor; Lexa, M.
2015-01-01
Roč. 23, č. 3 (2015), s. 615-623 ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.590, year: 2015
Immunoradiometric assay for cytomegalovirus-specific IgG antibodies
International Nuclear Information System (INIS)
Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J.
1990-01-01
An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 [human cytomegalovirus (CMV)] has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab
Symmetry of quantum intramolecular dynamics
International Nuclear Information System (INIS)
Burenin, Alexander V
2002-01-01
The paper reviews the current progress in describing quantum intramolecular dynamics using merely symmetry principles as a basis. This closed qualitative approach is of particular interest because it is the only method currently available for a broad class of topical problems in the internal dynamics of molecules. Moreover, a molecule makes a physical system whose collective internal motions are geometrically structured, so that its description by perturbation methods requires a symmetry analysis of this structure. The nature of the geometrical symmetry groups crucial for the closed formulation of the qualitative approach is discussed. In particular, the point group of a molecule is of this type. (methodological notes)
Mechanism of Intramolecular Rhodium- and Palladium-Catalyzed Alkene Alkoxyfunctionalizations
Vummaleti, Sai V. C.
2015-11-13
Density functional theory calculations have been used to investigate the reaction mechanism for the [Rh]-catalyzed intramolecular alkoxyacylation ([Rh] = [RhI(dppp)+] (dppp, 1,3-bis(diphenylphosphino)propane) and [Pd]/BPh3 dual catalytic system assisted intramolecular alkoxycyanation ([Pd] = Pd-Xantphos) using acylated and cyanated 2-allylphenol derivatives as substrates, respectively. Our results substantially confirm the proposed mechanism for both [Rh]- and [Pd]/ BPh3-mediated alkoxyfunctionalizations, offering a detailed geometrical and energetical understanding of all the elementary steps. Furthermore, for the [Rh]-mediated alkoxyacylation, our observations support the hypothesis that the quinoline group of the substrate is crucial to stabilize the acyl metal complex and prevent further decarbonylation. For [Pd]/BPh3-catalyzed alkoxycyanation, our findings clarify how the Lewis acid BPh3 cocatalyst accelerates the only slow step of the reaction, corresponding to the oxidative addition of the cyanate O-CN bond to the Pd center. © 2015 American Chemical Society.
Mechanism of Intramolecular Rhodium- and Palladium-Catalyzed Alkene Alkoxyfunctionalizations
Vummaleti, Sai V. C.; Alghamdi, Miasser; Poater, Albert; Falivene, Laura; Scaranto, Jessica; Beetstra, Dirk J.; Morton, Jason G.; Cavallo, Luigi
2015-01-01
Density functional theory calculations have been used to investigate the reaction mechanism for the [Rh]-catalyzed intramolecular alkoxyacylation ([Rh] = [RhI(dppp)+] (dppp, 1,3-bis(diphenylphosphino)propane) and [Pd]/BPh3 dual catalytic system assisted intramolecular alkoxycyanation ([Pd] = Pd-Xantphos) using acylated and cyanated 2-allylphenol derivatives as substrates, respectively. Our results substantially confirm the proposed mechanism for both [Rh]- and [Pd]/ BPh3-mediated alkoxyfunctionalizations, offering a detailed geometrical and energetical understanding of all the elementary steps. Furthermore, for the [Rh]-mediated alkoxyacylation, our observations support the hypothesis that the quinoline group of the substrate is crucial to stabilize the acyl metal complex and prevent further decarbonylation. For [Pd]/BPh3-catalyzed alkoxycyanation, our findings clarify how the Lewis acid BPh3 cocatalyst accelerates the only slow step of the reaction, corresponding to the oxidative addition of the cyanate O-CN bond to the Pd center. © 2015 American Chemical Society.
Somasundaram, Sivaraman; Kamaraj, Eswaran; Hwang, Su Jin; Park, Sanghyuk
2018-02-01
Imidazole-based excited state intramolecular proton transfer (ESIPT) blue fluorescent molecules, 2-(1-(4-chlorophenyl)-4,5-diphenyl-1H-imidazol-2-yl)phenol (BHPI-Cl) and 2-(1-(4-bromophenyl)-4,5-diphenyl-1H-imidazol-2-yl)phenol (BHPI-Br) were designed and synthesized by Debus-Radziszewski method through a one-pot multicomponent reaction in high yield. The synthesized compounds were fully characterized by 1H NMR, 13C NMR, FT-IR, FT-Raman, GC-Mass, and elemental analysis. The molecular structures in single crystal lattice were studied by X-ray crystallographic analysis. Because of the intramolecular hydrogen bonding, hydroxyphenyl group is planar to the central imidazole ring, while the other phenyl rings gave distorted conformations to the central heterocyclic ring. BHPI-Cl and BHPI-Br molecules showed intense ESIPT fluorescence at 480 nm, because the two twisted phenyl rings on 4- and 5-positions have reduced intermolecular interaction between adjacent molecules in each crystal through a head-to-tail packing manner. Quantum chemical calculations of energies were carried out by (TD-)DFT using B3LYP/6-31G(d, p) basis set to predict the electronic absorption spectra of the compounds, and they showed good agreement between the computational and the experimental values. The thermal analyses of the synthesized molecules were also carried out by TGA/DSC method.
Kruse, Holger; Grimme, Stefan
2012-04-01
A semi-empirical counterpoise-type correction for basis set superposition error (BSSE) in molecular systems is presented. An atom pair-wise potential corrects for the inter- and intra-molecular BSSE in supermolecular Hartree-Fock (HF) or density functional theory (DFT) calculations. This geometrical counterpoise (gCP) denoted scheme depends only on the molecular geometry, i.e., no input from the electronic wave-function is required and hence is applicable to molecules with ten thousands of atoms. The four necessary parameters have been determined by a fit to standard Boys and Bernadi counterpoise corrections for Hobza's S66×8 set of non-covalently bound complexes (528 data points). The method's target are small basis sets (e.g., minimal, split-valence, 6-31G*), but reliable results are also obtained for larger triple-ζ sets. The intermolecular BSSE is calculated by gCP within a typical error of 10%-30% that proves sufficient in many practical applications. The approach is suggested as a quantitative correction in production work and can also be routinely applied to estimate the magnitude of the BSSE beforehand. The applicability for biomolecules as the primary target is tested for the crambin protein, where gCP removes intramolecular BSSE effectively and yields conformational energies comparable to def2-TZVP basis results. Good mutual agreement is also found with Jensen's ACP(4) scheme, estimating the intramolecular BSSE in the phenylalanine-glycine-phenylalanine tripeptide, for which also a relaxed rotational energy profile is presented. A variety of minimal and double-ζ basis sets combined with gCP and the dispersion corrections DFT-D3 and DFT-NL are successfully benchmarked on the S22 and S66 sets of non-covalent interactions. Outstanding performance with a mean absolute deviation (MAD) of 0.51 kcal/mol (0.38 kcal/mol after D3-refit) is obtained at the gCP-corrected HF-D3/(minimal basis) level for the S66 benchmark. The gCP-corrected B3LYP-D3/6-31G* model
Kruse, Holger; Grimme, Stefan
2012-04-21
A semi-empirical counterpoise-type correction for basis set superposition error (BSSE) in molecular systems is presented. An atom pair-wise potential corrects for the inter- and intra-molecular BSSE in supermolecular Hartree-Fock (HF) or density functional theory (DFT) calculations. This geometrical counterpoise (gCP) denoted scheme depends only on the molecular geometry, i.e., no input from the electronic wave-function is required and hence is applicable to molecules with ten thousands of atoms. The four necessary parameters have been determined by a fit to standard Boys and Bernadi counterpoise corrections for Hobza's S66×8 set of non-covalently bound complexes (528 data points). The method's target are small basis sets (e.g., minimal, split-valence, 6-31G*), but reliable results are also obtained for larger triple-ζ sets. The intermolecular BSSE is calculated by gCP within a typical error of 10%-30% that proves sufficient in many practical applications. The approach is suggested as a quantitative correction in production work and can also be routinely applied to estimate the magnitude of the BSSE beforehand. The applicability for biomolecules as the primary target is tested for the crambin protein, where gCP removes intramolecular BSSE effectively and yields conformational energies comparable to def2-TZVP basis results. Good mutual agreement is also found with Jensen's ACP(4) scheme, estimating the intramolecular BSSE in the phenylalanine-glycine-phenylalanine tripeptide, for which also a relaxed rotational energy profile is presented. A variety of minimal and double-ζ basis sets combined with gCP and the dispersion corrections DFT-D3 and DFT-NL are successfully benchmarked on the S22 and S66 sets of non-covalent interactions. Outstanding performance with a mean absolute deviation (MAD) of 0.51 kcal/mol (0.38 kcal/mol after D3-refit) is obtained at the gCP-corrected HF-D3/(minimal basis) level for the S66 benchmark. The gCP-corrected B3LYP-D3/6-31G* model
Fang, Zhongxue; Liu, Ying; Barry, Badru-Deen; Liao, Peiqiu; Bi, Xihe
2015-02-20
An atom-economic route to benzo[f]-1-indanone frameworks has been developed starting from the readily available gem-dialkylthio trienynes by intramolecular annulations. The chemoselectivity of the intramolecular cyclizations can be regulated by both the base and the type of gas atmosphere used in the reaction, thus allowing the divergent synthesis of the corresponding functionalized benzo[f]-1-indanones in good to excellent yields.
Angeli, A; Peat, T S; Bartolucci, G; Nocentini, A; Supuran, C T; Carta, F
2016-12-28
A mild, efficient and one pot procedure to access benzoxazoles using easily accessible acylselenoureas as starting materials has been discovered. Mechanistic studies revealed a pH dependent intramolecular oxidative deselenization, with ring closure due to an intramolecular nucleophilic attack of a phenoxide ion. All the benzoxazoles herein reported possessed a primary sulfonamide zinc binding group and showed effective inhibitory action on the enzymes, carbonic anhydrases.
Intramolecular Diels-Alder Reactions in Organic Synthesis
Sizemore, Nicholas Blandford Luke
2014-01-01
Intramolecular Diels-Alder (IMDA) reactions are an important class of reactions in synthetic organic chemistry for the rapid construction of polycyclic frameworks. Three classes of IMDA reactions were investigated synthetically and computationally: 1) all-carbon type 1 IMDA reactions, 2) N-acylnitroso type 2 IMDA reactions, and 3) cyano-azadiene IMDA reactions. The first class was implemented in research toward the total synthesis of maoecrystal Z and isopalhinine A. The second class was stud...
Enantioselective synthesis of almorexant via iridium-catalysed intramolecular allylic amidation
Fananas Mastral, Martin; Teichert, Johannes F.; Fernandez-Salas, Jose Antonio; Heijnen, Dorus; Feringa, Ben L.
2013-01-01
An enantioselective synthesis of almorexant, a potent antagonist of human orexin receptors, is presented. The chiral tetrahydroisoquinoline core structure was prepared via iridium-catalysed asymmetric intramolecular allylic amidation. Further key catalytic steps of the synthesis include an oxidative
DEFF Research Database (Denmark)
Agarwal, Tani; Pradhan, Devranjan; Géci, Imrich
2012-01-01
Human telomeric DNA has the ability to fold into a 4-stranded G-quadruplex structure. Several G-quadruplex ligands are known to stabilize the structure and thereby inhibit telomerase activity. Such ligands have demonstrated efficient telomerase inhibition in dilute conditions, but under molecular...
THE ROLE OF INTRAMOLECULAR TIES ENERGY IN THE PYROLYSIS PROCESS OF PET
Directory of Open Access Journals (Sweden)
P. Iu. Salikov
2014-01-01
Full Text Available Summary. Recycling plastic waste to focus on. The main type of used products made of polyethylene terephthalate (PET is a container from the various types of beverages. There was considered a possibility of waste of PET (bottles, bottles, packaging containers by pyrolysis. Most of the proposed methods are not suitable for recycling (recycling of waste consumption contamination. Purpose - to develop technological foundations and optimum modes waste PET to obtain useful secondary products, taking into account the energy of chemical intramolecular bonds. Applied scientific basis of recycling PET into useful forms of secondary products, in particular the establishment of the collapse of the intramolecular bonds, depending on the temperature of the pyrolysis method of mathematical processing - differentiation of polynomial equations change in the degree of pyrolysis temperature-dependent. The optimum modes of processing. The block diagram of apparatus for processing contaminated waste PET pyrolysis methods of control processing in accordance with the specified composition of secondary products. The possibility of controlling the amount and types of fuel components of secondary products due to measurable parameters of the pyrolysis process. The effective temperature pyrolysis of waste PET with the CCA-tures energy intramolecular bonds.
International Nuclear Information System (INIS)
Wieghardt, K.
1978-01-01
Reduction of the binuclear μ-p-nitrobenzoato -di-μ-hydroxo -bis[triammine cobalt(III)] cation with (CH 3 ) 2 COH radicals yields a radical cation with the p-nitrobenzoato radical being coordinated to two cobalt(III) ions at the carboxylic group. The unprotonated form of this species undergoes intramolecular electron transfer producing Co(II) (k = (3.3 +- 0.3). x 10 3 s -1 ). The role of the carboxylate group in the intramolecular electron transfer process is tentatively assessed in terms of an intramolecular outer-sphere reaction because of lack of overlap of the donor orbitals (π) and the acceptor orbital (sigma). The protonated form of the radical cation (pKsub(a) = 2.5) disproportionates via a bimolecular process without production of Co(II). The effect of two coordinated Co(III) ions as compared to only one on the properties of the nitrobenzoate radical anion are discussed. (orig.) 891 HK 892 GM [de
Li, An Yong
2007-04-21
Upon formation of a H bond Y...H-XZ, intramolecular hyperconjugation n(Z)-->sigma*(X-H) of the proton donor plays a key role in red- and blueshift characters of H bonds and must be introduced in the concepts of hyperconjugation and rehybridization. Intermolecular hyperconjugation transfers electron density from Y to sigma*(X-H) and causes elongation and stretch frequency redshift of the X-H bond; intramolecular hyperconjugation couples with intermolecular hyperconjugation and can adjust electron density in sigma*(X-H); rehybridization causes contraction and stretch frequency blueshift of the X-H bond on complexation. The three factors--intra- and intermolecular hyperconjugations and rehybridization--determine commonly red- or blueshift of the formed H bond. A proton donor that has strong intramolecular hyperconjugation often forms blueshifted H bonds.
Structural Insight into the interaction of Flavonoids with Human Telomeric Sequence
Tawani, Arpita; Kumar, Amit
2015-01-01
Flavonoids are a group of naturally available compounds that are an attractive source for drug discovery. Their potential to act as anti-tumourigenic and anti-proliferative agents has been reported previously but is not yet fully understood. Targeting human telomeric G-quadruplex DNA could be one of the mechanisms by which these flavonoids exert anticancer activity. We have performed detailed biophysical studies for the interaction of four representative flavonoids, Luteolin, Quercetin, Rutin and Genistein, with the human telomeric G-quadruplex sequence tetramolecular d-(T2AG3T) (Tel7). In addition, we used NMR spectroscopy to derive the first model for the complex formed between Quercetin and G-quadruplex sequence. The model showed that Quercetin stabilises the G-quadruplex structure and does not open the G-tetrad. It interacts with the telomeric sequence through π-stacking at two sites: between T1pT2 and between G6pT7. Based on our findings, we suggest that Quercetin could be a potent candidate for targeting the telomere and thus, act as a potent anti-cancer agent. PMID:26627543
Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen
DEFF Research Database (Denmark)
Farver, O; Wherland, S; Pecht, I
1994-01-01
Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...
Intramolecular migration of amide hydrogens in protonated peptides upon collisional activation
DEFF Research Database (Denmark)
Jørgensen, Thomas J. D.; Gårdsvoll, H.; Ploug, M.
2005-01-01
Presently different opinions exist as to the degree of scrambling of amide hydrogens in gaseous protonated peptides and proteins upon collisional activation in tandem mass spectrometry experiments. This unsettled controversy is not trivial, since only a very low degree of scrambling is tolerable...... if collision-induced dissociation (CID) should provide reliable site-specific information from (1)H/(2)H exchange experiments. We have explored a series of unique, regioselectively deuterium-labeled peptides as model systems to probe for intramolecular amide hydrogen migration under low-energy collisional...... are protected against exchange with the solvent, while the amide hydrogens of the nonbinding sequences exchange rapidly with the solvent. We have utilized such long-lived complexes to generate peptides labeled with deuterium in either the binding or nonbinding region, and the expected regioselectivity...
2017-01-01
We have carried out a series of extended unbiased molecular dynamics (MD) simulations (up to 10 μs long, ∼162 μs in total) complemented by replica-exchange with the collective variable tempering (RECT) approach for several human telomeric DNA G-quadruplex (GQ) topologies with TTA propeller loops. We used different AMBER DNA force-field variants and also processed simulations by Markov State Model (MSM) analysis. The slow conformational transitions in the propeller loops took place on a scale of a few μs, emphasizing the need for long simulations in studies of GQ dynamics. The propeller loops sampled similar ensembles for all GQ topologies and for all force-field dihedral-potential variants. The outcomes of standard and RECT simulations were consistent and captured similar spectrum of loop conformations. However, the most common crystallographic loop conformation was very unstable with all force-field versions. Although the loss of canonical γ-trans state of the first propeller loop nucleotide could be related to the indispensable bsc0 α/γ dihedral potential, even supporting this particular dihedral by a bias was insufficient to populate the experimentally dominant loop conformation. In conclusion, while our simulations were capable of providing a reasonable albeit not converged sampling of the TTA propeller loop conformational space, the force-field description still remained far from satisfactory. PMID:28475322
Evaluation of intramolecular charge transfer state of 4-N, N ...
Indian Academy of Sciences (India)
Abstract. Intramolecular charge transfer of 4-N,N-dimethylamino cinnamaldehyde (DMACA) in vacuum and in five different aprotic solvents has been studied by using time-dependent density functional theory. (TDDFT). Polarizable continuum model (PCM) was employed to consider solvent–solute interactions. The potential ...
A novel stereoselective synthesis of N-heterocycles by intramolecular hydrovinylation
DEFF Research Database (Denmark)
Bothe, Ulrich; Rudbeck, H. C.; Tanner, David Ackland
2001-01-01
A novel method for the synthesis of bicyclic amines has been developed. Cyclisation of 1,6-dienes by intramolecular hydrovinylation in the presence of catalytic amounts of allylpalladium chloride dimer afforded bicyclic amines in one step. Added phosphines, silver salts, as well as the nature of ...
Intramolecular symmetry-adapted perturbation theory with a single-determinant wavefunction
Energy Technology Data Exchange (ETDEWEB)
Pastorczak, Ewa; Prlj, Antonio; Corminboeuf, Clémence, E-mail: clemence.corminboeuf@epfl.ch [Laboratory for Computational Molecular Design, Institut des Sciences et Ingénierie Chimiques, École Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland); Gonthier, Jérôme F. [Center for Computational Molecular Science and Technology, School of Chemistry and Biochemistry, School of Computational Science and Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332-0400 (United States)
2015-12-14
We introduce an intramolecular energy decomposition scheme for analyzing non-covalent interactions within molecules in the spirit of symmetry-adapted perturbation theory (SAPT). The proposed intra-SAPT approach is based upon the Chemical Hamiltonian of Mayer [Int. J. Quantum Chem. 23(2), 341–363 (1983)] and the recently introduced zeroth-order wavefunction [J. F. Gonthier and C. Corminboeuf, J. Chem. Phys. 140(15), 154107 (2014)]. The scheme decomposes the interaction energy between weakly bound fragments located within the same molecule into physically meaningful components, i.e., electrostatic-exchange, induction, and dispersion. Here, we discuss the key steps of the approach and demonstrate that a single-determinant wavefunction can already deliver a detailed and insightful description of a wide range of intramolecular non-covalent phenomena such as hydrogen bonds, dihydrogen contacts, and π − π stacking interactions. Intra-SAPT is also used to shed the light on competing intra- and intermolecular interactions.
Application of Food-specific IgG Antibody Detection in Allergy Dermatosis
Directory of Open Access Journals (Sweden)
Yine Hu
2015-01-01
Full Text Available The application of food-specific IgG antibody detection in allergy dermatoses was explored. 181 patients with allergy dermatoses were diagnosed from January to September 2014 and 20 healthy subjects were selected. Fourteen kinds of food-specific IgG antibodies were detected by ELISA method among all the subjects. The positive rates of IgG antibody of the patient group and the healthy group were respectively 65.2% and 5.0%. The positive rates of IgG antibody of egg, milk, shrimp and crab took a large proportion in three groups of patients with three kinds of allergy dermatoses of urticaria, eczema and allergic dermatitis, the proportion of which was respectively 70.2%, 77.8% and 71.7%. Among urticaria and allergic dermatitis patients with positive antibody, the positive rate of children was significantly higher than that of adults (p0.05. Allergy dermatoses are closely related to food-specific IgG antibodies, and the allergy dermatoses patients have a high incidence rate of food intolerance; detecting IgG antibody in the serum of patients is of great significance for the diagnosis and treatment of allergy dermatoses.
Jia, Xueli; Li, Chaozheng; Li, Donglin; Liu, Yufang
2018-03-01
The intramolecular proton transfer reaction of the 2-amino-3-(2‧-benzoxazolyl)-quinoline (ABO) and 2-amino-3-(2‧-benzothiazolyl)-quinoline (ABT) molecules in both S0 and S1 states at B3LYP/6-311 ++G(d,p) level in ethanol solvent have been studied to reveal the deactivation mechanism of the tautomers of the two molecules from the S1 state to the S0 state. The results show that the tautomers of ABO and ABT molecules may return to the S0 state by emitting fluorescence. In addition, the bond lengths, angles and infrared spectra are analyzed to confirm the hydrogen bonds strengthened upon photoexcitation, which can facilitate the proton transfer process. The frontier molecular orbitals (MOs) and natural bond orbital (NBO) are also calculated to indicate the intramolecular charge transfer which can be used to explore the tendency of ESIPT reaction. The potential energy surfaces of the ABO and ABT molecules in the S0 and S1 states have been constructed. According to the energy potential barrier of 9.12 kcal/mol for ABO molecule and 5.96 kcal/mol for ABT molecule, it can be indicated that the proton transfer may occur in the S1 state.
Mouse allergen-specific immunoglobulin G4 and risk of mouse skin test sensitivity
Matsui, E. C.; Diette, G. B.; Krop, E. J. M.; Aalberse, R. C.; Smith, A. L.; Eggleston, P. A.
2006-01-01
High serum levels of cat-specific IgG and IgG4 are associated with protection against allergic sensitization to cat, but whether this association applies to other animal allergens remains unclear. To determine if high levels of mouse-specific IgG and IgG4 are associated with a decreased risk of
Scuotto, Maria; Rivieccio, Elisa; Varone, Alessia; Corda, Daniela; Bucci, Mariarosaria; Vellecco, Valentina; Cirino, Giuseppe; Virgilio, Antonella; Esposito, Veronica; Galeone, Aldo; Borbone, Nicola; Varra, Michela; Mayol, Luciano
2015-09-18
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13. © Crown copyright 2015.
Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong
2016-04-05
Thrombin-binding aptamer (TBA) with the sequence 5'GGTTGGTGTGGTTGG3' could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.
Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori
2006-11-01
The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.
Intramolecular Diels-Alder reactions of pyrimidines, a synthetic and computational study
Stolle, W.A.W.
1992-01-01
This thesis deals with an investigation on the ringtransformation reactions of 2and 5-(ω-alkynyl)pyrimidine derivatives, which undergo upon heating an intramolecular Diels-Alder reaction and subsequently a spontaneous retro Diels- Alder reaction. To get a better insight into the
Recent applications of intramolecular Diels-Alder reactions to natural product synthesis
DEFF Research Database (Denmark)
Juhl, M.; Tanner, David Ackland
2009-01-01
This tutorial review presents some recent examples of intramolecular Diels-Alder (IMDA) reactions as key complexity-generating steps in the total synthesis of structurally intricate natural products. The opportunities afforded by transannular (TADA) versions of the IMDA reaction in complex molecu...... comprehensive, reviews....
Intramolecular excimer and exciplex emission of 1,4-dipyrenyl substituted cyclohexasilane
van Walree, C.A.; Kaats-Richters, V.E.M.; Jenneskens, L.W.; Williams, R.M.; van Stokkum, I.H.M.
2002-01-01
Intramolecular excimer emission is observed for cis-1,4-di(1-pyrenyl)decamethylcyclohexasilane in nonpolar solvents. Time-resolved fluorescence spectroscopy and kinetic modelling indicate that the driving force of excimer formation is very small, and that the process is governed by the flexibility
TDDFT study on intramolecular hydrogen bond of photoexcited methyl salicylate.
Qu, Peng; Tian, Dongxu
2014-01-01
The equilibrium geometries, IR-spectra and transition mechanism of intramolecular hydrogen-bonded methyl salicylate in excited state were studied using DFT and TDDFT with 6-31++G (d, p) basis set. The length of hydrogen bond OH⋯OC is decreased from 1.73 Å in the ground state to 1.41 and 1.69 Å in the excited S1 and S3 states. The increase of bond length for HO and CO group also indicates that in excited state the hydrogen bond OH⋯OC is strengthened. IR spectra show HO and CO stretching bands are strongly redshifted by 1387 and 67 cm(-1) in the excited S1 and S3 states comparing to the ground state. The excitation energy and the absorption spectrum show the S3 state is the main excited state of the low-lying excited states. By analyzing the frontier molecular orbitals, the transition from the ground state to the excited S1 and S3 states was predicted to be the π→π∗ mode. Copyright © 2013 Elsevier B.V. All rights reserved.
Intramolecular photoinduced electron-transfer in azobenzene-perylene diimide
International Nuclear Information System (INIS)
Feng Wen-Ke; Wang Shu-Feng; Gong Qi-Huang; Feng Yi-Yu; Feng Wei; Yi Wen-Hui
2010-01-01
This paper studies the intramolecular photoinduced electron-transfer (PET) of covalent bonded azobenzene-perylene diimide (AZO-PDI) in solvents by using steady-state and time-resolved fluorescence spectroscopy together with ultrafast transient absorption spectroscopic techniques. Fast fluorescence quenching is observed when AZO-PDI is excited at characteristic wavelengths of AZO and perylene moieties. Reductive electron-transfer with transfer rate faster than 10 11 s −1 is found. This PET process is also consolidated by femtosecond transient absorption spectra
High-resolution AFM structure of DNA G-wires in aqueous solution.
Bose, Krishnashish; Lech, Christopher J; Heddi, Brahim; Phan, Anh Tuân
2018-05-17
We investigate the self-assembly of short pieces of the Tetrahymena telomeric DNA sequence d[G 4 T 2 G 4 ] in physiologically relevant aqueous solution using atomic force microscopy (AFM). Wire-like structures (G-wires) of 3.0 nm height with well-defined surface periodic features were observed. Analysis of high-resolution AFM images allowed their classification based on the periodicity of these features. A major species is identified with periodic features of 4.3 nm displaying left-handed ridges or zigzag features on the molecular surface. A minor species shows primarily left-handed periodic features of 2.2 nm. In addition to 4.3 and 2.2 nm ridges, background features with periodicity of 0.9 nm are also observed. Using molecular modeling and simulation, we identify a molecular structure that can explain both the periodicity and handedness of the major G-wire species. Our results demonstrate the potential structural diversity of G-wire formation and provide valuable insight into the structure of higher-order intermolecular G-quadruplexes. Our results also demonstrate how AFM can be combined with simulation to gain insight into biomolecular structure.
Hooper, Joel F; James, Natalie C; Bozkurt, Esra; Aviyente, Viktorya; White, Jonathan M; Holland, Mareike C; Gilmour, Ryan; Holmes, Andrew B; Houk, K N
2015-12-18
The intramolecular Diels-Alder reaction has been used as a powerful method to access the tricyclic core of the eunicellin natural products from a number of 9-membered-ring precursors. The endo/exo selectivity of this reaction can be controlled through a remarkable organocatalytic approach, employing MacMillan's imidazolidinone catalysts, although the mechanistic origin of this selectivity remains unclear. We present a combined experimental and density functional theory investigation, providing insight into the effects of medium-ring constraints on the organocatalyzed intramolecular Diels-Alder reaction to form the isobenzofuran core of the eunicellins.
Matsui, Elizabeth C.; Krop, Esmeralda J. M.; Diette, Gregory B.; Aalberse, Rob C.; Smith, Abigail L.; Eggleston, Peyton A.
2004-01-01
Although there is evidence that contact with mice is associated with IgE-mediated mouse sensitization and mouse specific antibody responses, the exposure-response relationships remain unclear. To determine whether IgE-mediated mouse sensitization and mouse specific IgG (mIgG) and mIgG4 levels
DEFF Research Database (Denmark)
Jensen, Troels B.; Henriksen, Jonas Rosager; Rasmussen, Bjarne E.
2011-01-01
Thrombin binding aptamer is a DNA 15-mer which forms a G-quadruplex structure and possess promising anticoagulant properties due to specific interactions with thrombin. Herein we present the influence of a single 2′-C-piperazino-UNA residue and UNA residues incorporated in several positions on th...
Optimized measurements of separations and angles between intra-molecular fluorescent markers
DEFF Research Database (Denmark)
Mortensen, Kim; Sung, Jongmin; Flyvbjerg, Henrik
2015-01-01
We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each colour-separated microscope image in a time-lapse movie...
Heterocycles by Transition Metals Catalyzed Intramolecular Cyclization of Acetylene Compounds
International Nuclear Information System (INIS)
Vizer, S.A.; Yerzhanov, K.B.; Dedeshko, E.C.
2003-01-01
Review shows the new strategies in the synthesis of heterocycles, having nitrogen, oxygen and sulfur atoms, via transition metals catalyzed intramolecular cyclization of acetylenic compounds on the data published at the last 30 years, Unsaturated heterocyclic compounds (pyrroles and pyrroline, furans, dihydro furans and benzofurans, indoles and iso-indoles, isoquinolines and isoquinolinones, aurones, iso coumarins and oxazolinone, lactams and lactones with various substitutes in heterocycles) are formed by transition metals, those salts [PdCl 2 , Pd(OAc) 2 , HgCl 2 , Hg(OAc) 2 , Hg(OCOCF 3 ) 2 , AuCl 3 ·2H 2 O, NaAuCl 4 ·2H 2 O, CuI, CuCl], oxides (HgO) and complexes [Pd(OAc) 2 (PPh 3 )2, Pd(PPh 3 ) 4 , PdCl 2 (MeCN) 2 , Pd(OAc ) 2 /TPPTS] catalyzed intramolecular cyclization of acetylenic amines, amides, ethers, alcohols, acids, ketones and βdiketones. More complex hetero polycyclic systems typical for natural alkaloids can to obtain similar. Proposed mechanisms of pyrroles, isoquinolines, iso indoles and indoles, benzofurans and iso coumarins, thiazolopyrimidinones formation are considered. (author)
Energy Technology Data Exchange (ETDEWEB)
Giribabu, Lingamallu, E-mail: giribabu@iict.res.in [Inorganic & Physical Chemistry Division, CSIR-Indian Institute of Chemical Technology, Tarnaka, Hyderabad 500007, Telangana (India); Jain, Kanika [Department of Chemistry, School of Chemical Sciences & Pharmacy, Central University of Rajasthan, Kishangarh, Dist. Ajmer, Rajasthan 305817 (India); Sudhakar, Kolanu; Duvva, Naresh [Inorganic & Physical Chemistry Division, CSIR-Indian Institute of Chemical Technology, Tarnaka, Hyderabad 500007, Telangana (India); Chitta, Raghu, E-mail: raghuchitta@curaj.ac.in [Department of Chemistry, School of Chemical Sciences & Pharmacy, Central University of Rajasthan, Kishangarh, Dist. Ajmer, Rajasthan 305817 (India)
2016-09-15
We have designed and synthesized a photo-induced energy/electron donor–acceptor conjugate comprising of corrole linked to BODIPY at the 5-position via ester linkage. The dyad was characterized by elemental analysis, MALDI-MS, UV-Visible, {sup 1}H NMR fluorescence spectroscopy (steady-state and time-resolved) as well as electrochemical methods. A comparison of the UV–visible and {sup 1}H NMR spectra of the dyad with those of the corresponding individual model compounds (i.e., BODIPY-CO{sub 2}H and BPFC-OH) reveal that there exist minimum π–π interactions between BODIPY and corrole π-planes. Quenched emission of BODIPY and corrole part of the dyad has been observed in five different solvents. Excitation spectral data provided evidence for an intramolecular excitation energy transfer (EET) from the singlet BODIPY to the corrole and an intramolecular photoinduced electron transfer (PET) from singlet state of corrole to ground state of BODIPY. Detailed analysis of the data suggests that Forster's dipole–dipole mechanism does not adequately explain this energy transfer but, an electron exchange mediated mechanism can, in principle, contribute to the intramolecular EET.
Gonthier, Jérôme F.; Corminboeuf, Clémence
2014-04-01
Non-covalent interactions occur between and within all molecules and have a profound impact on structural and electronic phenomena in chemistry, biology, and material science. Understanding the nature of inter- and intramolecular interactions is essential not only for establishing the relation between structure and properties, but also for facilitating the rational design of molecules with targeted properties. These objectives have motivated the development of theoretical schemes decomposing intermolecular interactions into physically meaningful terms. Among the various existing energy decomposition schemes, Symmetry-Adapted Perturbation Theory (SAPT) is one of the most successful as it naturally decomposes the interaction energy into physical and intuitive terms. Unfortunately, analogous approaches for intramolecular energies are theoretically highly challenging and virtually nonexistent. Here, we introduce a zeroth-order wavefunction and energy, which represent the first step toward the development of an intramolecular variant of the SAPT formalism. The proposed energy expression is based on the Chemical Hamiltonian Approach (CHA), which relies upon an asymmetric interpretation of the electronic integrals. The orbitals are optimized with a non-hermitian Fock matrix based on two variants: one using orbitals strictly localized on individual fragments and the other using canonical (delocalized) orbitals. The zeroth-order wavefunction and energy expression are validated on a series of prototypical systems. The computed intramolecular interaction energies demonstrate that our approach combining the CHA with strictly localized orbitals achieves reasonable interaction energies and basis set dependence in addition to producing intuitive energy trends. Our zeroth-order wavefunction is the primary step fundamental to the derivation of any perturbation theory correction, which has the potential to truly transform our understanding and quantification of non
International Nuclear Information System (INIS)
Gonthier, Jérôme F.; Corminboeuf, Clémence
2014-01-01
Non-covalent interactions occur between and within all molecules and have a profound impact on structural and electronic phenomena in chemistry, biology, and material science. Understanding the nature of inter- and intramolecular interactions is essential not only for establishing the relation between structure and properties, but also for facilitating the rational design of molecules with targeted properties. These objectives have motivated the development of theoretical schemes decomposing intermolecular interactions into physically meaningful terms. Among the various existing energy decomposition schemes, Symmetry-Adapted Perturbation Theory (SAPT) is one of the most successful as it naturally decomposes the interaction energy into physical and intuitive terms. Unfortunately, analogous approaches for intramolecular energies are theoretically highly challenging and virtually nonexistent. Here, we introduce a zeroth-order wavefunction and energy, which represent the first step toward the development of an intramolecular variant of the SAPT formalism. The proposed energy expression is based on the Chemical Hamiltonian Approach (CHA), which relies upon an asymmetric interpretation of the electronic integrals. The orbitals are optimized with a non-hermitian Fock matrix based on two variants: one using orbitals strictly localized on individual fragments and the other using canonical (delocalized) orbitals. The zeroth-order wavefunction and energy expression are validated on a series of prototypical systems. The computed intramolecular interaction energies demonstrate that our approach combining the CHA with strictly localized orbitals achieves reasonable interaction energies and basis set dependence in addition to producing intuitive energy trends. Our zeroth-order wavefunction is the primary step fundamental to the derivation of any perturbation theory correction, which has the potential to truly transform our understanding and quantification of non
Magyar, Angéla; Wölfling, János; Kubas, Melanie; Cuesta Seijo, Jose Antonio; Sevvana, Madhumati; Herbst-Irmer, Regine; Forgó, Péter; Schneider, Gyula
2004-05-01
Steroidal aryliminium salts were prepared from D-seco-pregnene aldehyde 2b, and their BF3.OEt2-catalyzed reactions were studied. The nature of the substituent R1 in the anilines 3-6 essentially influenced the chemoselectivity. Using unsubstituted 3, 4-methoxy- (4) or 4-bromoaniline (5), different tetrahydroquinoline derivatives 7a-13a via intramolecular hetero Diels-Alder reaction were formed. In the case of 4-nitroaniline (6) the N-arylamino-D-homopregnane (14a) were also obtained. We assume, that an intramolecular Prins reaction led to this type of fluoro-D-homosteroid. The main products represent a new class of tetrahydroquinolino-androstenes.
International Nuclear Information System (INIS)
Chu, Hongzhu; He, Lutao; Jiang, Qian; Fang, Yuyu; Jia, Yiming; Yuan, Xiangyang; Zou, Shuliang; Li, Xianghui; Feng, Wen; Yang, Yuanyou; Liu, Ning; Luo, Shunzhong; Yang, Yanqiu; Yang, Liang; Yuan, Lihua
2014-01-01
Highlights: • Three CMPO-calix[4]arenes with spacer containing intramolecular hydrogen bonds were designed and synthesized. • The influence of local rigidification caused by intramolecular hydrogen bonds upon extraction of f-elements was investigated. • Selective extraction is realized via tuning local chelating surroundings by aid of intramolecular hydrogen bonds. -- Abstract: To understand intramolecular hydrogen bonding in effecting liquid–liquid extraction behavior of CMPO-calixarenes, three CMPO-modified calix[4]arenes (CMPO-CA) 5a–5c with hydrogen-bonded spacer were designed and synthesized. The impact of spacer rotation that is hindered by introduction of intramolecular hydrogen bonding upon extraction of La 3+ , Eu 3+ , Yb 3+ , Th 4+ , and UO 2 2+ has been examined. The results show that 5b and 5c containing only one hydrogen bond with a less hindered rotation spacer extract La 3+ more efficiently than 5a containing two hydrogen bonds with a more hindered rotation spacer, demonstrating the importance of local rigidification of spacer in the design of extractants in influencing the coordination environment. The large difference in extractability between La 3+ and Yb 3+ (or Eu 3+ ) by 5b (or 5c), and the small difference by 5a, suggests intramolecular hydrogen bonding do exert pronounced influence upon selective extraction of light and heavy lanthanides. Log–log plot analysis indicates a 1:1, 2:1 and 1:1 stoichiometry (ligand/metal) for the extracted complex formed between 5b and La 3+ , Th 4+ , UO 2 2+ , respectively. Additionally, their corresponding acyclic analogs 7a–7c exhibit negligible extraction toward these metal ions. These results reveal the possibility of selective extraction via tuning local chelating surroundings of CMPO-CA by aid of intramolecular hydrogen bonding
Non-"g" Residuals of the SAT and ACT Predict Specific Abilities
Coyle, Thomas R.; Purcell, Jason M.; Snyder, Anissa C.; Kochunov, Peter
2013-01-01
This research examined whether non-"g" residuals of the SAT and ACT subtests, obtained after removing g, predicted specific abilities. Non-"g" residuals of the verbal and math subtests of the SAT and ACT were correlated with academic (verbal and math) and non-academic abilities (speed and shop), both based on the Armed Services…
Iwanaga, Tetsuo; Ogawa, Marina; Yamauchi, Tomokazu; Toyota, Shinji
2016-05-20
We designed anthracene bisimide (ABI) derivatives having two triphenylamine (TPA) groups as donor units at the 9,10-positions to form a novel π-conjugated donor-acceptor system. These compounds and their analogues with ethynylene linkers were synthesized by Suzuki-Miyaura and Sonogashira coupling reactions, respectively. In UV-vis spectra, the linker-free derivatives showed broad absorption bands arising from intramolecular charge-transfer interactions. Introducing ethynylene linkers resulted in a considerable red shift of the absorption bands. In fluorescence spectra, the ethynylene derivatives showed intense emission bands at 600-650 nm. Their photophysical and electrochemical properties were compared with those of the corresponding mono TPA derivatives on the basis of theoretical calculations and cyclic voltammetry to evaluate the intramolecular electronic interactions between the donor and acceptor units.
Energy Technology Data Exchange (ETDEWEB)
Yukihira, Nao [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan; Sugai, Yuko [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan; Fujiwara, Masazumi [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan; Kosumi, Daisuke [Institute of Pulsed Power Science; Kumamoto University; Kumamoto; Japan; Iha, Masahiko [South Product Co. Ltd.; Uruma-shi; Japan; Sakaguchi, Kazuhiko [Department of Chemistry; Graduate School of Science; Osaka City University; Osaka 558-8585; Japan; Katsumura, Shigeo [Department of Chemistry; Graduate School of Science; Osaka City University; Osaka 558-8585; Japan; Gardiner, Alastair T. [Glasgow Biomedical Research Centre; University of Glasgow; 126 University Place; Glasgow, G12 8QQ; UK; Cogdell, Richard J. [Glasgow Biomedical Research Centre; University of Glasgow; 126 University Place; Glasgow, G12 8QQ; UK; Hashimoto, Hideki [Department of Applied Chemistry for Environment; School of Science and Technology; Kwansei Gakuin University; Sanda; Japan
2017-01-01
Fucoxanthin is a carotenoid that is mainly found in light-harvesting complexes from brown algae and diatoms. Due to the presence of a carbonyl group attached to polyene chains in polar environments, excitation produces an excited intra-molecular charge transfer. This intra-molecular charge transfer state plays a key role in the highly efficient (~95%) energy-transfer from fucoxanthin to chlorophyll
How-Kit, Alexandre; Daunay, Antoine; Mazaleyrat, Nicolas; Busato, Florence; Daviaud, Christian; Teyssier, Emeline; Deleuze, Jean-François; Gallusci, Philippe; Tost, Jörg
2015-07-01
Pyrosequencing permits accurate quantification of DNA methylation of specific regions where the proportions of the C/T polymorphism induced by sodium bisulfite treatment of DNA reflects the DNA methylation level. The commercially available high-throughput locus-specific pyrosequencing instruments allow for the simultaneous analysis of 96 samples, but restrict the DNA methylation analysis to CpG dinucleotide sites, which can be limiting in many biological systems. In contrast to mammals where DNA methylation occurs nearly exclusively on CpG dinucleotides, plants genomes harbor DNA methylation also in other sequence contexts including CHG and CHH motives, which cannot be evaluated by these pyrosequencing instruments due to software limitations. Here, we present a complete pipeline for accurate CpG and non-CpG cytosine methylation analysis at single base-resolution using high-throughput locus-specific pyrosequencing. The devised approach includes the design and validation of PCR amplification on bisulfite-treated DNA and pyrosequencing assays as well as the quantification of the methylation level at every cytosine from the raw peak intensities of the Pyrograms by two newly developed Visual Basic Applications. Our method presents accurate and reproducible results as exemplified by the cytosine methylation analysis of the promoter regions of two Tomato genes (NOR and CNR) encoding transcription regulators of fruit ripening during different stages of fruit development. Our results confirmed a significant and temporally coordinated loss of DNA methylation on specific cytosines during the early stages of fruit development in both promoters as previously shown by WGBS. The manuscript describes thus the first high-throughput locus-specific DNA methylation analysis in plants using pyrosequencing.
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
Zhang, Z.; Birkedal, V.; Gothelf, K. V.
2016-05-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.
Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction
DEFF Research Database (Denmark)
Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager
2016-01-01
The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...
FANCJ couples replication past natural fork barriers with maintenance of chromatin structure.
Schwab, Rebekka A; Nieminuszczy, Jadwiga; Shin-ya, Kazuo; Niedzwiedz, Wojciech
2013-04-01
Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer-predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.
Thermal and catalytic intramolecular [4+2]-cycloaddition in 2-alkenylfurans
International Nuclear Information System (INIS)
Zubkov, Fedor I; Nikitina, Evgenia V; Varlamov, Alexey V
2005-01-01
The published data on the intramolecular Diels-Alder reaction in compounds of the 2-alkenylfuran series are generalised. The methods and conditions for the preparation of tricyclic systems are considered. The effects of the substituents in the furan and the unsaturated fragments on the cycloaddition are discussed. The application of this reaction to the synthesis of alkaloids and terpenoids is exemplified.
Thermal and catalytic intramolecular [4+2]-cycloaddition in 2-alkenylfurans
Energy Technology Data Exchange (ETDEWEB)
Zubkov, Fedor I; Nikitina, Evgenia V; Varlamov, Alexey V [Department of Physical, Mathematical and Natural Sciences, Peoples' Friendship University of Russia (Russian Federation)
2005-07-31
The published data on the intramolecular Diels-Alder reaction in compounds of the 2-alkenylfuran series are generalised. The methods and conditions for the preparation of tricyclic systems are considered. The effects of the substituents in the furan and the unsaturated fragments on the cycloaddition are discussed. The application of this reaction to the synthesis of alkaloids and terpenoids is exemplified.
Azhibek, Dulat; Skvortsov, Dmitry; Andreeva, Anna; Zatsepin, Timofei; Arutyunyan, Alexandr; Zvereva, Maria; Dontsova, Olga
2016-06-01
Telomerase is a key component of the telomere length maintenance system in the majority of eukaryotes. Telomerase displays maximal activity in stem and cancer cells with high proliferative potential. In humans, telomerase activity is regulated by various mechanisms, including the interaction with telomere ssDNA overhangs that contain a repetitive G-rich sequence, and with noncoding RNA, Telomeric repeat-containing RNA (TERRA), that contains the same sequence. So these nucleic acids can compete for telomerase RNA templates in the cell. In this study, we have investigated the ability of different model substrates mimicking telomere DNA overhangs and TERRA RNA to compete for telomerase in vitro through a previously developed telomerase inhibitor assay. We have shown in this study that RNA oligonucleotides are better competitors for telomerase that DNA ones as RNA also use an alternative binding site on telomerase, and the presence of 2'-OH groups is significant in these interactions. In contrast to DNA, the possibility of forming intramolecular G-quadruplex structures has a minor effect for RNA binding to telomerase. Taking together our data, we propose that TERRA RNA binds better to telomerase compared with its native substrate - the 3'-end of telomere DNA overhang. As a result, some specific factor may exist that participates in switching telomerase from TERRA to the 3'-end of DNA for telomere elongation at the distinct period of a cell cycle in vivo. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.
van der Velde, Jasper H M; Oelerich, Jens; Huang, Jingyi; Smit, Jochem H; Aminian Jazi, Atieh; Galiani, Silvia; Kolmakov, Kirill; Guoridis, Giorgos; Eggeling, Christian; Herrmann, Andreas; Roelfes, Gerard; Cordes, Thorben
2016-01-01
Intramolecular photostabilization via triple-state quenching was recently revived as a tool to impart synthetic organic fluorophores with 'self-healing' properties. To date, utilization of such fluorophore derivatives is rare due to their elaborate multi-step synthesis. Here we present a general
Presence of specific IgG antibody to grain dust does not go with respiratory symptoms.
Park, H S; Suh, C H; Nahm, D H; Kim, H Y
1999-02-01
A high prevalence of work-related symptoms in relation to grain dust exposure has been reported in grain dust workers, but the role of the specific IgG antibody is unknown. To study the possible role of specific IgG (sIgG) and specific IgG4 (sIgG4) in the development of work-related symptoms, sIgG and sIgG4 subclass antibodies against grain dust antigens were determined by ELISA in sera from 43 workers and 27 non-exposed controls. They were compared with results of specific IgE antibodies, exposure intensity and the presence of respiratory symptoms. SIgG and sIgG4 antibodies were detectable in almost all sera of exposed workers, and the prevalence were significantly higher than those of controls (pgrain dust exposure and may unlikely play a role in the etiology of respiratory symptoms.
Directory of Open Access Journals (Sweden)
Cheng-Wei Ma
Full Text Available A novel approach to reveal intramolecular signal transduction network is proposed in this work. To this end, a new algorithm of network construction is developed, which is based on a new protein dynamics model of energy dissipation. A key feature of this approach is that direction information is specified after inferring protein residue-residue interaction network involved in the process of signal transduction. This enables fundamental analysis of the regulation hierarchy and identification of regulation hubs of the signaling network. A well-studied allosteric enzyme, E. coli aspartokinase III, is used as a model system to demonstrate the new method. Comparison with experimental results shows that the new approach is able to predict all the sites that have been experimentally proved to desensitize allosteric regulation of the enzyme. In addition, the signal transduction network shows a clear preference for specific structural regions, secondary structural types and residue conservation. Occurrence of super-hubs in the network indicates that allosteric regulation tends to gather residues with high connection ability to collectively facilitate the signaling process. Furthermore, a new parameter of propagation coefficient is defined to determine the propagation capability of residues within a signal transduction network. In conclusion, the new approach is useful for fundamental understanding of the process of intramolecular signal transduction and thus has significant impact on rational design of novel allosteric proteins.
Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.
Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar
2010-06-01
The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.
Antimalarial peroxides: the first intramolecular 1,2,4,5-tetraoxane
Directory of Open Access Journals (Sweden)
BOGDAN A. SOLAJA
2002-07-01
Full Text Available An intramolecular steroidal 1,2,4,5-tetraoxane has been synthesised in six steps starting from methyl 3-oxo-7a,12a-diacetoxy-5b-cholan-24-oate. The synthesised 1,2,4,5-tetraoxane has moderate in vitro antimalarial activity against P. falciparum strains (IC50 (D6 = 0.35 mg/mL; IC50 (W2 = 0.29 mg/mL.
Intramolecular ketenimine-ketenimine [2 + 2] and [4 + 2] cycloadditions.
Alajarín, Mateo; Bonillo, Baltasar; Sanchez-Andrada, Pilar; Vidal, Angel; Bautista, Delia
2007-07-20
Bis(ketenimines), in which the two heterocumulenic functions are placed in close proximity on a carbon skeleton to allow their mutual interaction, show a rich and not easily predictable chemistry. Intramolecular [2 + 2] or [4 + 2] cycloadditions are, respectively, observed when both ketenimine functions are supported on either ortho-benzylic or 2,2'-biphenylenic scaffolds. In addition, nitrogen-to-carbon [1,3] and [1,5] shifts of arylmethyl groups in N-arylmethyl-C,C-diphenyl ketenimines are also disclosed.
Padula, Daniele; Lee, Myeong H; Claridge, Kirsten; Troisi, Alessandro
2017-11-02
In this paper, we adopt an approach suitable for monitoring the time evolution of the intramolecular contribution to the spectral density of a set of identical chromophores embedded in their respective environments. We apply the proposed method to the Fenna-Matthews-Olson (FMO) complex, with the objective to quantify the differences among site-dependent spectral densities and the impact of such differences on the exciton dynamics of the system. Our approach takes advantage of the vertical gradient approximation to reduce the computational demands of the normal modes analysis. We show that the region of the spectral density that is believed to strongly influence the exciton dynamics changes significantly in the timescale of tens of nanoseconds. We then studied the impact of the intramolecular vibrations on the exciton dynamics by considering a model of FMO in a vibronic basis and neglecting the interaction with the environment to isolate the role of the intramolecular exciton-vibration coupling. In agreement with the assumptions in the literature, we demonstrate that high frequency modes at energy much larger than the excitonic energy splitting have negligible influence on exciton dynamics despite the large exciton-vibration coupling. We also find that the impact of including the site-dependent spectral densities on exciton dynamics is not very significant, indicating that it may be acceptable to apply the same spectral density on all sites. However, care needs to be taken for the description of the exciton-vibrational coupling in the low frequency part of intramolecular modes because exciton dynamics is more susceptible to low frequency modes despite their small Huang-Rhys factors.
Autism-specific covariation in perceptual performances: "g" or "p" factor?
Meilleur, Andrée-Anne S; Berthiaume, Claude; Bertone, Armando; Mottron, Laurent
2014-01-01
Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination) and mid-level (e.g., pattern matching) tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals. We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ) and Raven Progressive Matrices (RPM). We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence. In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism. Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor). Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor), which may drive perceptual abilities differently in autistic and
Autism-specific covariation in perceptual performances: "g" or "p" factor?
Directory of Open Access Journals (Sweden)
Andrée-Anne S Meilleur
Full Text Available Autistic perception is characterized by atypical and sometimes exceptional performance in several low- (e.g., discrimination and mid-level (e.g., pattern matching tasks in both visual and auditory domains. A factor that specifically affects perceptive abilities in autistic individuals should manifest as an autism-specific association between perceptual tasks. The first purpose of this study was to explore how perceptual performances are associated within or across processing levels and/or modalities. The second purpose was to determine if general intelligence, the major factor that accounts for covariation in task performances in non-autistic individuals, equally controls perceptual abilities in autistic individuals.We asked 46 autistic individuals and 46 typically developing controls to perform four tasks measuring low- or mid-level visual or auditory processing. Intelligence was measured with the Wechsler's Intelligence Scale (FSIQ and Raven Progressive Matrices (RPM. We conducted linear regression models to compare task performances between groups and patterns of covariation between tasks. The addition of either Wechsler's FSIQ or RPM in the regression models controlled for the effects of intelligence.In typically developing individuals, most perceptual tasks were associated with intelligence measured either by RPM or Wechsler FSIQ. The residual covariation between unimodal tasks, i.e. covariation not explained by intelligence, could be explained by a modality-specific factor. In the autistic group, residual covariation revealed the presence of a plurimodal factor specific to autism.Autistic individuals show exceptional performance in some perceptual tasks. Here, we demonstrate the existence of specific, plurimodal covariation that does not dependent on general intelligence (or "g" factor. Instead, this residual covariation is accounted for by a common perceptual process (or "p" factor, which may drive perceptual abilities differently in
International Nuclear Information System (INIS)
Pal, H.; Mukherjee, T.
1994-01-01
The acid-base and redox characteristics of the semiquinones of a number of hydroxy and amino-substituted anthraquinones have been investigated. Results are explained on the basis of electron-donating properties and intramolecular hydrogen bond forming capabilities of the substituents. (author). 4 refs., 1 tab., 1 fig
An Intramolecular Heck reaction that Prefers a 5-endo- to a 6-exo-trig Cyclization Pathway
DEFF Research Database (Denmark)
Vital, Paulo; Norrby, Per-Ola; Tanner, David Ackland
2006-01-01
A regioselective aromatic Claisen rearrangement was used to prepare 17a, the precursor of triflate 17e. The intramolecular Heck reaction of 17e is promoted only by bidentate phosphine ligands, giving exclusively and in excellent yield 20, the product of a 5-endo-trig cyclization, despite the poss......A regioselective aromatic Claisen rearrangement was used to prepare 17a, the precursor of triflate 17e. The intramolecular Heck reaction of 17e is promoted only by bidentate phosphine ligands, giving exclusively and in excellent yield 20, the product of a 5-endo-trig cyclization, despite...
In-depth analysis of subclass-specific conformational preferences of IgG antibodies
Directory of Open Access Journals (Sweden)
Xinsheng Tian
2015-01-01
Full Text Available IgG subclass-specific differences in biological function and in vitro stability are often referred to variations in the conformational flexibility, while this flexibility has rarely been characterized. Here, small-angle X-ray scattering data from IgG1, IgG2 and IgG4 antibodies, which were designed with identical variable regions, were thoroughly analysed by the ensemble optimization method. The extended analysis of the optimized ensembles through shape clustering reveals distinct subclass-specific conformational preferences, which provide new insights for understanding the variations in physical/chemical stability and biological function of therapeutic antibodies. Importantly, the way that specific differences in the linker region correlate with the solution structure of intact antibodies is revealed, thereby visualizing future potential for the rational design of antibodies with designated physicochemical properties and tailored effector functions. In addition, this advanced computational approach is applicable to other flexible multi-domain systems and extends the potential for investigating flexibility in solutions of macromolecules by small-angle X-ray scattering.
Directory of Open Access Journals (Sweden)
Paweł Misiak
2018-01-01
Full Text Available The formation of an intramolecular hydrogen bond in pyrrolo[1,2-a]pyrazin-1(2H-one bicyclic diazoles was analyzed, and the influence of N-substitution on HB formation is discussed in this study. B3LYP/aug-cc-pVDZ calculations were performed for the diazole, and the quantum theory of atoms in molecules (QTAIM approach as well as the natural bond orbital (NBO method was applied to analyze the strength of this interaction. It was found that the intramolecular hydrogen bond that closes an extra ring between the C=O proton acceptor group and the CH proton donor, that is, C=O⋯H–C, influences the spectroscopic properties of pyrrolopyrazine bicyclic diazoles, particularly the carbonyl frequencies. The influence of N-substitution on the aromaticity of heterocyclic rings is also discussed in this report.
Gilbert, Alexis; Hattori, Ryota; Silvestre, Virginie; Wasano, Nariaki; Akoka, Serge; Hirano, Satoshi; Yamada, Keita; Yoshida, Naohiro; Remaud, Gérald S
2012-09-15
Isotopic (13)C NMR is a relatively recent technique which allows the determination of intramolecular (13)C isotope composition at natural abundance. It has been used in various scientific fields such as authentication, counterfeiting or plant metabolism. Although its precision has already been evaluated, the determination of its trueness remains still challenging. To deal with that issue, a comparison with another normalized technique must be achieved. In this work, we compare the intramolecular (13)C isotope distribution of ethanol from different origins obtained using both Isotope Ratio Mass Spectrometry (IRMS) and Nuclear Magnetic Resonance (NMR) spectrometry techniques. The IRMS approach consists of the oxidation of ethanol to acetic acid followed by the degradation of the latter for the analysis of each fragments formed. We show here that the oxidation of ethanol to acetic acid does not bring any significant error on the determination of the site-specific δ(13)C (δ(13)C(i)) of ethanol using the IRMS approach. The difference between the data obtained for 16 samples from different origins using IRMS and NMR approaches is not statistically significant and remains below 0.3‰. These results are encouraging for the future studies using isotopic NMR, especially in combination with the IRMS approach. Copyright © 2012. Published by Elsevier B.V.
Imoto, Mitsutaka; Ikeda, Hiroshi; Fujii, Takayuki; Taniguchi, Hisaji; Tamaki, Akihiro; Takeda, Motonori; Mizuno, Kazuhiko
2010-05-07
An intramolecular exciplex is formed upon excitation of the cyclohexane solution of the 1,4-dicyano-2-methylnaphthalene-N,N-dimethyl-p-toluidine dyad, but little if any intramolecular CT complex exists in the ground state of this substance in solution. In contrast, in the crystalline state, the dyad forms an intermolecular mixed-stack CT complex in the ground state and an intermolecular exciplex when it is photoexcited.
Human Leukocyte Antigen-G and Regulatory T Cells during Specific Immunotherapy for Pollen Allergy
DEFF Research Database (Denmark)
Sørensen, Anja Elaine; Johnsen, Claus R; Dalgaard, Louise Torp
2013-01-01
of the cytokine profile towards a TH1-polarized immune response. We investigated the effects of SIT on T cells, on immunomodulation of human leukocyte antigen (HLA)-G, which has been associated with allergy, on regulatory cytokine expression, and on serum allergen-specific antibody subclasses (IgE and IgG4......). Methods: Eleven birch and/or grass pollen-allergic patients and 10 healthy nonatopic controls were studied before and during SIT. Tregs, chemokine receptors, soluble HLA-G (sHLA-G), Ig-like transcript (ILT) 2, specific IgE, and IgG4 were studied. Peripheral blood mononuclear cells (PBMCs) were stimulated...... with pollen extract in vitro and immune factors were evaluated. Results: During SIT, the main changes in the peripheral blood were an increase in CXCR3+CD4+CD25+CD127low/- Tregs and a decrease in CCR4+CD4+CD25+CD127low/- Tregs, an increase in allergen-specific IgG4, and a decrease in sHLA-G during the first...
Synthesis of benzannelated sultams by intramolecular Pd-catalyzed arylation of tertiary sulfonamides
Directory of Open Access Journals (Sweden)
Valentin A. Rassadin
2017-09-01
Full Text Available A new and efficient approach to five- and six-membered benzannelated sultams by intramolecular C-arylation of tertiary 1-(methoxycarbonylmethanesulfonamides under palladium catalysis is described. In case of the α-toluenesulfonamide derivative, an unexpected formation of a 2,3-diarylindole was observed under the same conditions.
Basic Concepts in G-Protein-Coupled Receptor Homo- and Heterodimerization
Directory of Open Access Journals (Sweden)
Rafael Franco
2007-01-01
Full Text Available Until recently, heptahelical G-protein-coupled receptors (GPCRs were considered to be expressed as monomers on the cell surface of neuronal and non-neuronal cells. It is now becoming evident that this view must be overtly changed since these receptors can form homodimers, heterodimers, and higher-order oligomers on the plasma membrane. Here we discuss some of the basics and some new concepts of receptor homo- and heteromerization. Dimers-oligomers modify pharmacology, trafficking, and signaling of receptors. First of all, GPCR dimers must be considered as the main molecules that are targeted by neurotransmitters or by drugs. Thus, binding data must be fitted to dimer-based models. In these models, it is considered that the conformational changes transmitted within the dimer molecule lead to cooperativity. Cooperativity must be taken into account in the binding of agonists-antagonists-drugs and also in the binding of the so-called allosteric modulators. Cooperativity results from the intramolecular cross-talk in the homodimer. As an intramolecular cross-talk in the heterodimer, the binding of one neurotransmitter to one receptor often affects the binding of the second neurotransmitter to the partner receptor. Coactivation of the two receptors in a heterodimer can change completely the signaling pathway triggered by the neurotransmitter as well as the trafficking of the receptors. Heterodimer-specific drugs or dual drugs able to activate the two receptors in the heterodimer simultaneously emerge as novel and promising drugs for a variety of central nervous system (CNS therapeutic applications.
Intramolecular Hydrogen Bonding in (2-Hydroxybenzoyl)benzoylmethane Enol
DEFF Research Database (Denmark)
Hansen, Bjarke Knud Vilster; Winther, Morten; Spanget-Larsen, Jens
2014-01-01
, and the dienol form of 1,3-dibenzoylacetone. But in these examples the two H-bonds are equivalent, while in the case of OHDBM they are chemically different, involving one enolic and one phenolic hydroxy group. OHDBM is thus an interesting model compound with two competing H-bonds to the same carbonyl group......In the stable enol tautomer of the title compound (OHDBM), one carbonyl group is flanked by two β-hydroxy groups, giving rise to bifold intramolecular H-bonding. A similar situation is found in other β,β'-dihydroxy carbonyl compounds like chrysazin, anthralin, 2,2'-dihydroxybenzophenone...
DEFF Research Database (Denmark)
Eriksen, J.J.; Sauer, S.P.A.; Mikkelsen, K.V.
2013-01-01
We investigate the failure of Time{Dependent Density Functional Theory (TDDFT) with the CAM{B3LYP exchange{correlation (xc) functional coupled to the Polarizable Embedding (PE) scheme (PE-CAM-B3LYP) in reproducing the solvatochromic shift of the lowest intense charge{transfer excitation in para...... the electric dipole moments in the gas phase and for 100 solvent congurations. We find that CAM-B3LYP overestimates the amount of charge separation inherent in the ground state and TDDFT/CAM-B3LYP drastically underestimates this amount in the excited charge-transfer state. As the errors in the solvatochromatic...... to benchmark results of TDDFT calculations with CAM-B3LYP for intramolecular charge{transfer excitations in molecular systems similar to pNA against higher{level ab initio wave function methods, like, e.g., CCSD, prior to their use. Using the calculated change in dipole moment upon excitation as a measure...
Byk, Gerardo; Cohen-Ohana, Mirit; Raichman, Daniel
2006-01-01
We have revisited the intramolecular Heck reaction and investigated the microwave-assisted macrocyclization on preformed peptides using a model series of ring-varying peptides acryloyl-Gly-[Gly](n)-Phe(4-I)NHR; n = 0-4. The method was applied to both solution and solid supported cyclizations. We demonstrate that the intramolecular Heck reaction can be performed in peptides both in solution and solid support using a modified domestic microwave within 1 to 30 minutes in DMF under reflux with moderate yields ranging from 15 to 25% for a scale between 2-45 mg of linear precursors. The approach was applied to the synthesis of a constrained biologically relevant peptidomimetic bearing an Arg-Gly-Asp (RGD) sequence. These results make the microwave-assisted Heck reaction an attractive renovated approach for peptidomimetics. Copyright 2006 Wiley Periodicals, Inc.
Yan, Shengyong; Huang, Rong; Zhou, Yangyang; Zhang, Ming; Deng, Minggang; Wang, Xiaolin; Weng, Xiaocheng; Zhou, Xiang
2011-01-28
In this thrombin detection system, the bright fluorescence of TASPI is almost eliminated by the DNA aptamer TBA (turn-off); however, in the presence of thrombin, it specifically binds to TBA by folding unrestricted TBA into an anti-parallel G-quadruplex structure and then releasing TASPI molecules, resulting in vivid and facile fluorescence recovery (turn-on).
International Nuclear Information System (INIS)
Paul, Bijan Kumar; Guchhait, Nikhil
2011-01-01
Here, we report a Density Functional Theoretical (DFT) study on the photophysics of a potent Excited-State Intramolecular Proton Transfer (ESIPT) molecular system, viz., 10-hydroxybenzo[h]quinoline (HBQ). Particular emphasis has been rendered on the assessment of the proton transfer reaction in HBQ in the ground and excited-states through elucidation and a careful perusal of the potential energy surfaces (PES). The non-viability of Ground-State Intramolecular Proton Transfer (GSIPT) process is dictated by a high-energy barrier coupled with no energy minimum for the proton transferred (K-form) form at the ground-state (S 0 ) PES. Remarkable reduction of the barrier along with thermodynamic stability inversion between the enol (E-form) and the keto forms (K-form) of HBQ upon photoexcitation from S 0 to the S 1 -state advocate for the operation of ESIPT process. These findings have been cross-validated on the lexicon of analysis of optimized geometry parameters, Mulliken's charge distribution on the heavy atoms, and molecular orbitals (MO) of the E- and the K-forms of HBQ. Our computational results also corroborate to experimental observations. From the modulations in optimized geometry parameters in course of the PT process a critical assessment has been endeavoured to delve into the movement of the proton during the process. Additional stress has been placed on the analysis of the intramolecular hydrogen bonding (IMHB) interaction in HBQ. The IMHB interaction has been explored by calculation of electron density ρ(r) and the Laplacian ∇ 2 ρ(r) at the bond critical point (BCP) using Atoms-In-Molecule (AIM) method and by calculation of interaction between σ* of OH with the lone pair of the nitrogen atom using Natural Bond Orbital (NBO) analysis. - Highlights: → Theoretical modelling of the photophysics of an ESIPT probe 10-hydroxybenzo[h]quinoline (HBQ). → Calculation of intramolecular hydrogen bond (IMHB) energy. → Role of hyperconjugative charge transfer
Haka, Jaana; Niemi, Merja H; Iljin, Kristiina; Reddy, Vanga Siva; Takkinen, Kristiina; Laukkanen, Marja-Leena
2015-05-27
Around 3-5% of the population suffer from IgE-mediated food allergies in Western countries and the number of food-allergenic people is increasing. Individuals with certain pollen allergies may also suffer from a sensitisation to proteins in the food products. As an example a person sensitised to the major birch pollen allergen, Bet v 1, is often sensitised to its homologues, such as the major allergens of apple, Mal d 1, and celery, Api g 1, as well. Development of tools for the reliable, sensitive and quick detection of allergens present in various food products is essential for allergic persons to prevent the consumption of substances causing mild and even life-threatening immune responses. The use of monoclonal antibodies would ensure the specific detection of the harmful food content for a sensitised person. Mouse IgG antibody libraries were constructed from immunised mice and specific recombinant antibodies for Mal d 1 and Api g 1 were isolated from the libraries by phage display. More detailed characterisation of the resulting antibodies was carried out using ELISA, SPR experiments and immunoprecipitation assays. The allergen-specific Fab fragments exhibited high affinity towards the target recombinant allergens. Furthermore, the Fab fragments also recognised native allergens from natural sources. Interestingly, isolated Mal d 1-specific antibody bound also to Bet v 1, the main allergen eliciting the cross-reactivity syndrome between the birch pollen and apple. Despite the similarities in Api g 1 and Bet v 1 tertiary structures, the isolated Api g 1-specific antibodies showed no cross-reactivity to Bet v 1. Here, high-affinity allergen-specific recombinant antibodies were isolated with interesting binding properties. With further development, these antibodies can be utilised as tools for the specific and reliable detection of allergens from different consumable products. This study gives new preliminary insights to elucidate the mechanism behind the pollen
Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua
2017-11-01
In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.
Vibrational Spectroscopy of Intramolecular Hydrogen Bonds in the Infrared and Near-Infrared Regions
DEFF Research Database (Denmark)
Schrøder, Sidsel Dahl
and 1,4-diaminobutane). Experimentally, the hydrogen bonds have been studied with vibrational spectroscopy in the infrared and near-infrared regions. The focus is primarily on spectra recorded in the near-infrared regions, which in these studies are dominated by O-H and N-H stretching overtones....... Overtone spectra have been recorded with intracavity laser photoacoustic laser spectroscopy and conventional long path absorption spectroscopy. Theoretically, a combination of electronic structure calculations and local mode models have been employed to guide the assignment of bands in the vibrational......,4-diaminobutane, no sign of intramolecular N-H···N hydrogen bonds were identified in the overtone spectra. However, theoretical analyzes indicate that intramolecular N-H···N hydrogen bonds are present in all three diamines if two hydrogen atoms on one of the methylene groups are substituted with triuoromethyl...
Directory of Open Access Journals (Sweden)
Michael Ravensdale
Full Text Available L locus resistance (R proteins are nucleotide binding (NB-ARC leucine-rich repeat (LRR proteins from flax (Linum usitatissimum that provide race-specific resistance to the causal agent of flax rust disease, Melampsora lini. L5 and L6 are two alleles of the L locus that directly recognize variants of the fungal effector AvrL567. In this study, we have investigated the molecular details of this recognition by site-directed mutagenesis of AvrL567 and construction of chimeric L proteins. Single, double and triple mutations of polymorphic residues in a variety of AvrL567 variants showed additive effects on recognition strength, suggesting that multiple contact points are involved in recognition. Domain-swap experiments between L5 and L6 show that specificity differences are determined by their corresponding LRR regions. Most positively selected amino acid sites occur in the N- and C-terminal LRR units, and polymorphisms in the first seven and last four LRR units contribute to recognition specificity of L5 and L6 respectively. This further confirms that multiple, additive contact points occur between AvrL567 variants and either L5 or L6. However, we also observed that recognition of AvrL567 is affected by co-operative polymorphisms between both adjacent and distant domains of the R protein, including the TIR, ARC and LRR domains, implying that these residues are involved in intramolecular interactions to optimize detection of the pathogen and defense signal activation. We suggest a model where Avr ligand interaction directly competes with intramolecular interactions to cause activation of the R protein.
Iron(II)-catalyzed intramolecular aminohydroxylation of olefins with functionalized hydroxylamines.
Liu, Guan-Sai; Zhang, Yong-Qiang; Yuan, Yong-An; Xu, Hao
2013-03-06
A diastereoselective aminohydroxylation of olefins with a functionalized hydroxylamine is catalyzed by new iron(II) complexes. This efficient intramolecular process readily affords synthetically useful amino alcohols with excellent selectivity (dr up to > 20:1). Asymmetric catalysis with chiral iron(II) complexes and preliminary mechanistic studies reveal an iron nitrenoid is a possible intermediate that can undergo either aminohydroxylation or aziridination, and the selectivity can be controlled by careful selection of counteranion/ligand combinations.
Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki
2014-01-01
The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.
Origin of Exo/Endo Selectivity in the Intramolecular Diels-Alder Reaction
International Nuclear Information System (INIS)
Yan, Shihai; Ryu, Do Hyun; Lee, Jin Yong
2010-01-01
The stereoselectivity of the intramolecular Diels-Alder reactions of 1 and its derivatives were investigated by ab initio calculations. The stereoselectivity mainly originates from the steric repulsion and the orbital interactions. The additional s-cis and s-trans conformations by introducing the carbonyl group at the neighbor of diene or dienophile may change the stereoselectivity, hence this kind of substitution can be utilized for stereoselective asymmetric synthesis
Organometallic copper I, II or III species in an intramolecular dechlorination reaction
Poater, Albert
2013-03-15
The present paper gives insight into an intramolecular dechlorination reaction involving Copper (I) and an ArCH2Cl moiety. The discussion of the presence of a CuIII organometallic intermediate becomes a challenge, and because of the lack of clear experimental detection of this proposed intermediate, and due to the computational evidence that it is less stable than other isomeric species, it can be ruled out for the complex studied here. Our calculations are completely consistent with the key hypothesis of Karlin et al. that TMPA-CuI is the substrate of intramolecular dechlorination reactions as well as the source to generate organometallic species. However the organometallic character of some intermediates has been refused because computationally these species are less stable than other isomers. Thus this study constitutes an additional piece towards the full understanding of a class of reaction of biological relevance. Further, the lack of high energy barriers and deep energy wells along the reaction pathway explains the experimental difficulties to trap other intermediates. © Springer-Verlag Berlin Heidelberg 2013.
RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity.
Vannier, Jean-Baptiste; Pavicic-Kaltenbrunner, Visnja; Petalcorin, Mark I R; Ding, Hao; Boulton, Simon J
2012-05-11
T loops and telomeric G-quadruplex (G4) DNA structures pose a potential threat to genome stability and must be dismantled to permit efficient telomere replication. Here we implicate the helicase RTEL1 in the removal of telomeric DNA secondary structures, which is essential for preventing telomere fragility and loss. In the absence of RTEL1, T loops are inappropriately resolved by the SLX4 nuclease complex, resulting in loss of the telomere as a circle. Depleting SLX4 or blocking DNA replication abolished telomere circles (TCs) and rescued telomere loss in RTEL1(-/-) cells but failed to suppress telomere fragility. Conversely, stabilization of telomeric G4-DNA or loss of BLM dramatically enhanced telomere fragility in RTEL1-deficient cells but had no impact on TC formation or telomere loss. We propose that RTEL1 performs two distinct functions at telomeres: it disassembles T loops and also counteracts telomeric G4-DNA structures, which together ensure the dynamics and stability of the telomere. Copyright © 2012 Elsevier Inc. All rights reserved.
Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6
Dai, Yawei; Seeger, Markus; Weng, Jingwei; Song, Song; Wang, Wenning; Tan, Yan-Wen
2016-08-01
Cellular informational and metabolic processes are propagated with specific membrane fusions governed by soluble N-ethylmaleimide sensitive factor attachment protein receptors (SNARE). SNARE protein Ykt6 is highly expressed in brain neurons and plays a critical role in the membrane-trafficking process. Studies suggested that Ykt6 undergoes a conformational change at the interface between its longin domain and the SNARE core. In this work, we study the conformational state distributions and dynamics of rat Ykt6 by means of single-molecule Förster Resonance Energy Transfer (smFRET) and Fluorescence Cross-Correlation Spectroscopy (FCCS). We observed that intramolecular conformational dynamics between longin domain and SNARE core occurred at the timescale ~200 μs. Furthermore, this dynamics can be regulated and even eliminated by the presence of lipid dodecylphoshpocholine (DPC). Our molecular dynamic (MD) simulations have shown that, the SNARE core exhibits a flexible structure while the longin domain retains relatively stable in apo state. Combining single molecule experiments and theoretical MD simulations, we are the first to provide a quantitative dynamics of Ykt6 and explain the functional conformational change from a qualitative point of view.
Ren, Wang; Zhang, Ying; Huang, Wei Tao; Li, Nian Bing; Luo, Hong Qun
2015-06-15
This work reported a label-free colorimetric assay for sensitive detection of Hg(2+) based on Hg(2+)-triggered hairpin DNA probe (H-DNA) termini-binding and exonuclease Ш (Exo Ш)-assisted target recycling, as well as hemin/G-quadruplex (DNAzyme) signal amplification. The specific binding of free Hg(2+) with the thymine-thymine (T-T) mismatches termini of H-DNA could immediately trigger the Exo Ш digestion, and then set free G-quadruplex segments and Hg(2+). The Exo Ш impellent recycling of ultratrace Hg(2+) produced numerous G-quadruplexes. The corresponding DNAzymes catalyzed efficiently the H2O2-mediated oxidation of the ABTS(2-) to the colored product in the presence of hemin. Using the color change as the output signal, and the Exo Ш-aided Hg(2+) recycling and DNAzyme as the signal amplifier, the ultrasensitive assay system successfully achieved visual detection of Hg(2+) as low as 1.0 nM by the naked eye, and was suitable for field monitoring. The calibration curve was linear in the range of 50.0 pM to 20.0 nM for Hg(2+) (R=0.9962) with a detection limit of 10.0 pM. Moreover, this proposed strategy showed excellent selectivity, portability and low-cost, and was successfully applied to colorimetric detection of Hg(2+) in laboratory tap water and Jialing river water samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Epr, structural characteristics and intramolecular movements of some phenoxyl radicals in toluene
Nizameev, I.; Pudovkin, M.; Kadirov, M.
2010-01-01
The method of electron paramagnetic resonance (EPR) spectroscopy was used for studying magnetic and dynamic properties of phenoxyl radicals in toluene at 170-370 K. Characteristics of intramolecular motion and structure of phenoxyl radicals were determined from the temperature dependence of EPR spectra. For all the given compounds the activation energies of transitions between the conformers were calculated.
In-depth analysis of subclass-specific conformational preferences of IgG antibodies
DEFF Research Database (Denmark)
Tian, Xinsheng; Vestergaard, Bente; Thorolfsson, Matthias
2015-01-01
IgG subclass-specific differences in biological function and in vitro stability are often referred to variations in the conformational flexibility, while this flexibility has rarely been characterized. Here, small-angle X-ray scattering data from IgG1, IgG2 and IgG4 antibodies, which were designe...... properties and tailored effector functions. In addition, this advanced computational approach is applicable to other flexible multi-domain systems and extends the potential for investigating flexibility in solutions of macromolecules by small-angle X-ray scattering....
Energy Technology Data Exchange (ETDEWEB)
Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)
2017-10-09
IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.
Characterizing the strand-specific distribution of non-CpG methylation in human pluripotent cells.
Guo, Weilong; Chung, Wen-Yu; Qian, Minping; Pellegrini, Matteo; Zhang, Michael Q
2014-03-01
DNA methylation is an important defense and regulatory mechanism. In mammals, most DNA methylation occurs at CpG sites, and asymmetric non-CpG methylation has only been detected at appreciable levels in a few cell types. We are the first to systematically study the strand-specific distribution of non-CpG methylation. With the divide-and-compare strategy, we show that CHG and CHH methylation are not intrinsically different in human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). We also find that non-CpG methylation is skewed between the two strands in introns, especially at intron boundaries and in highly expressed genes. Controlling for the proximal sequences of non-CpG sites, we show that the skew of non-CpG methylation in introns is mainly guided by sequence skew. By studying subgroups of transposable elements, we also found that non-CpG methylation is distributed in a strand-specific manner in both short interspersed nuclear elements (SINE) and long interspersed nuclear elements (LINE), but not in long terminal repeats (LTR). Finally, we show that on the antisense strand of Alus, a non-CpG site just downstream of the A-box is highly methylated. Together, the divide-and-compare strategy leads us to identify regions with strand-specific distributions of non-CpG methylation in humans.
International Nuclear Information System (INIS)
Curro, J.G.; Schweizer, K.S.; Grest, G.S.; Kremer, K.; Corporate Research Science Laboratory, Exxon Research and Engineering Company, Annandale, New Jersey 08801; Institut fur Festkorperforschung der Kernforschungsanlage Julich, D-5170 Julich, Federal Republic of Germany)
1989-01-01
Recently we (J.G.C. and K.S.S.) formulated a tractable ''reference interaction site model'' (RISM) integral equation theory of flexible polymer liquids. The purpose of this paper is to compare the results of the theory with recent molecular dynamics simulations (G.S.G. and K.K.) on dense chain liquids of degree of polymerization N=50 and 200. Specific comparisons were made between theory and simulation for the intramolecular structure factor ω(k) and the intermolecular radial distribution function g(r) in the liquid. In particular it was possible to independently test the assumptions inherent in the RISM theory and the additional ideality approximation that was made in the initial application of the theory. This comparison was accomplished by calculating the intermolecular g(r) using the simulated intramolecular structure factor, as well as, ω(k) derived from a freely jointed chain model.The RISM theory results, using the simulated ω(k), were found to be in excellent agreement, over all length scales, with the g(r) from molecular dynamics simulations. The theoretical predictions using the ''ideal'' intramolecular structure factor tended to underestimate g(r) near contact, indicating local intramolecular expansion of the chains. This local expansion can be incorporated into the theory self consistently by including the effects of the ''medium induced'' potential on the intramolecular structure
DEFF Research Database (Denmark)
Bodtger, U; Ejrnaes, A M; Hummelshoj, L
2005-01-01
The role of IgG4 during allergen-specific immunotherapy (SIT) is still controversial. The available studies present paramount differences in in vitro techniques, allergens, and clinical outcome parameters. By implementing a sensitive method, and pivotal clinical outcome parameters, we wanted to a...
C9orf72 nucleotide repeat structures initiate molecular cascades of disease.
Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou
2014-03-13
A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.
Specific IgG and its subclass antibodies after immunotherapy with gynandropsis gynandra
Directory of Open Access Journals (Sweden)
Latha G
2005-01-01
Full Text Available Background : About 10 to 15 % of the Indian population is known to suffer from major allergic disorders such as Asthma, Rhinitis, Atopic Dermatitis and Urticaria. Aeroallergens play a major role in the pathogenesis of respiratory allergic diseases. Among the aeroallergens, pollens are major causative agents. The predominance of pollen allergens necessitate the need to assess the specific immunotherapy (SIT in allergic patients. Objective : To evaluate the effect of immunotherapy based on the presence of IgG and its subclass antibodies towards whole pollen antigen of Gynandropsis gynandra (G.gynandra and its fractions. Material and Methods : A study was conducted in 30 bronchial asthma patients on immunotherapy, by assessing the levels of IgG and its subclasses specific to G. gynandra pollen. Results : There was a significant increase in IgG and its subclass antibodies to whole pollen antigen and its fractions i.e.> 90kD, 46-37kD and 36-32kD after the course of IT. Conclusion : The use of peptide fractions may be more appropriate instead of the whole pollen antigen to test the effect of immunotherapy.
Surprisingly Mild Enolate-Counterion-Free Pd(0)-Catalyzed Intramolecular Allylic Alkylations
DEFF Research Database (Denmark)
Madec, David; Prestat, Guillaume; Martini, Elisabetta
2005-01-01
Palladium-catalyzed intramolecular allylic alkylations of unsaturated EWG-activated amides can take place under phase-transfer conditions or in the presence of a crown ether. These new reaction conditions are milder and higher yielding than those previously reported. A rationalization for such an...... for such an unexpected result is put forth and validated by DFT-B3LYP calculations. The results suggest cyclization via a counterion-free (E)-enolate TS....
Bhuvaneswari, Nagarajan; Dai, Feng-Rong; Chen, Zhong-Ning
2018-05-02
An elaborately designed pyridinium-functionalized octanuclear zinc(II) coordination container 1-Zn was prepared through the self-assembly of Zn 2+ , p-tert-butylsulfonylcalix[4]arene, and pyridinium-functionalized angular flexible dicarboxylate linker (H 2 BrL1). The structure was determined by a single-crystal X-ray diffractometer. 1-Zn displays highly sensitive and specific recognition to 2-picolylamine as revealed by drastic blueshifts of the absorption and emission spectra, ascribed to the decrease of intramolecular charge transfer (ICT) character of the container and the occurrence of intermolecular charge transfer between the host and guest molecules. The intramolecular charge transfer plays a key role in the modulation of the electronic properties and is tunable through endo-encapsulation of specific guest molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhou, Li; Morel, Mathieu; Rudiuk, Sergii; Baigl, Damien
2017-07-01
DNA micro- and nanogels-small-sized hydrogels made of a crosslinked DNA backbone-constitute new promising materials, but their functions have mainly been limited to those brought by DNA. Here a new way is described to prepare sub-micrometer-sized DNA gels of controllable crosslinking density that are able to embed novel functions, such as an enzymatic activity. It consists of using proteins, instead of traditional base-pairing assembly or covalent approaches, to form crosslinks inside individual DNA molecules, resulting in structures referred to as intramolecularly protein-crosslinked DNA gels (IPDGs). It is first shown that the addition of streptavidin to biotinylated T4DNA results in the successful formation of thermally stable IPDGs with a controllable crosslinking density, forming structures ranging from elongated to raspberry-shaped and pearl-necklace-like morphologies. Using reversible DNA condensation strategies, this paper shows that the gels can be reversibly actuated at a low crosslinking density, or further stabilized when they are highly crosslinked. Finally, by using streptavidin-protein conjugates, IPDGs with various enzymes are successfully functionalized. It is demonstrated that the enzymes keep their catalytic activity upon their incorporation into the gels, opening perspectives ranging from biotechnologies (e.g., enzyme manipulation) to nanomedicine (e.g., vectorization). © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
An intramolecular inverse electron demand Diels–Alder approach to annulated α-carbolines
Directory of Open Access Journals (Sweden)
Zhiyuan Ma
2012-06-01
Full Text Available Intramolecular inverse electron demand cycloadditions of isatin-derived 1,2,4-triazines with acetylenic dienophiles tethered by amidations or transesterifications proceed in excellent yields to produce lactam- or lactone-fused α-carbolines. Beginning with various isatins and alkynyl dienophiles, a pilot-scale library of eighty-eight α-carbolines was prepared by using this robust methodology for biological evaluation.
Assess the Intra-molecular Cavity in PAMAM Dendrimers by Small Angle Neutron Scattering
International Nuclear Information System (INIS)
Chen, Wei-Ren
2008-01-01
In this report, we present a contrast variation small angle neutron scattering (SANS) study of a series of neutral PAMAM dendrimer in aqueous solutions using three different generations (G4-6) at a concentration of about 10 mg/ml. Varying the solvent hydrogen-deuterium ratio, the scattering contributions from the water molecules and the constituent components of PAMAM dendrimer can be determined. Using an analytical model of the scattering cross section I(Q) incorporating the effect of water penetration, we have quantified the intra-molecular space of PAMAM dendrimer by evaluating the number of guest water molecules and we draw a direct comparison to computational predictions. As expected, the overall available internal cavity was seen to increase as a function of increasing dendrimer generation. However, the fraction of water accessible volume in the internal cavity of a dendrimer was found to remain invariant for the three generation PAMAM dendrimers studied in this report. We have also estimated the average water density inside a dendrimer, which is found to be higher than that of bulk water
NMO-IgG: A Specific Biomarker for Neuromyelitis Optica
Directory of Open Access Journals (Sweden)
Brian G. Weinshenker
2006-01-01
Full Text Available Neuromyelitis optica (NMO is an inflammatory demyelinating disease that principally targets the optic nerves and spinal cord and often leads to severe disability and occasionally life threatening respiratory failure. Although its clinical manifestations overlap with those of multiple sclerosis (MS, in established cases these two conditions can be distinguished on the basis of clinical, radiological, and routine spinal fluid studies. The diagnosis in early cases or limited forms of NMO is difficult. We recently discovered a unique IgG autoantibody (NMO-IgG that is highly specific to patients with NMO and thus a valuable diagnostic aid. Its antigen, aquaporin-4 (AQP4, is the central nervous system’s predominant water channel protein. This antibody has not yet been proven to be pathogenic, but several facts suggest that it might be, including the similarity of the immunohistochemical pattern of NMO-(AQP4 IgG binding to mouse CNS tissues to the pattern of immune complex deposition in autopsied patients’ spinal cord tissue. The spectrum of diseases identified by NMO-IgG is broader than has previously been recognized clinically and includes incomplete forms of NMO, such as recurrent transverse myelitis without optic neuritis and recurrent optic neuritis without myelitis.
Directory of Open Access Journals (Sweden)
Padwa Albert
1999-01-01
Full Text Available The Rh2(OAc4 catalyzed intramolecular O-H insertion reaction of delta-hydroxy-alpha-diazoesters affords 3(2H-furanone-2-carboxylates in good yield but with moderate selectivity (d.e. ca 60%. The initially formed 2,5-substituted cis-furanones were found to epimerize to the corresponding 2,5-trans isomers when subjected to silica gel chromatography. The Rh2(OAc4 catalyzed decomposition of gamma-azido-delta-hydroxy-alpha-diazoesters also furnished 3(2H-furanone-2-carboxylates. These compounds are derived by a sequential O-H insertion reaction followed by a concerted [3,3]-sigmatropic shift of the allylic azide intermediate.
Juhász, Imre Benedek; Csurgay, Árpád I.
2018-04-01
In recent years, the role of molecular vibrations in exciton energy transfer taking place during the first stage of photosynthesis attracted increasing interest. Here, we present a model formulated as a Lindblad-type master equation that enables us to investigate the impact of undamped and especially damped intramolecular vibrational modes on the exciton energy transfer, particularly its efficiency. Our simulations confirm the already reported effects that the presence of an intramolecular vibrational mode can compensate the energy detuning of electronic states, thus promoting the energy transfer; and, moreover, that the damping of such a vibrational mode (in other words, vibrational relaxation) can further enhance the efficiency of the process by generating directionality in the energy flow. As a novel result, we show that this enhancement surpasses the one caused by pure dephasing, and we present its dependence on various system parameters (time constants of the environment-induced relaxation and excitation processes, detuning of the electronic energy levels, frequency of the intramolecular vibrational modes, Huang-Rhys factors, temperature) in dimer model systems. We demonstrate that vibrational-relaxation-enhanced exciton energy transfer (VREEET) is robust against the change of these characteristics of the system and occurs in wide ranges of the investigated parameters. With simulations performed on a heptamer model inspired by the Fenna-Matthews-Olson (FMO) complex, we show that this mechanism can be even more significant in larger systems at T = 300 K. Our results suggests that VREEET might be prevalent in light-harvesting complexes.
DEFF Research Database (Denmark)
Kuznetsov, A. M.; Ulstrup, Jens
1981-01-01
Intramolecular electron transfer (ET) over distances up to about 10 Å between states in which the electron is localized on donor and acceptor groups by interaction with molecular or external solvent nuclear motion occurs, in particular, in two classes of systems. The excess electron in anionic ra...
Takasu, K
2001-12-01
Intramolecular cascade reaction has received much attention as a powerful methodology to construct a polycyclic framework in organic synthesis. We have been developing "boomerang-type cascade reaction" to construct a variety of polycyclic skeletons efficiently. In the above reactions, a nucleophilic function of substrates changes the character into an electrophile after the initial reaction, and the electrophilic group acts as a nucleophile in the second reaction. That is, the reaction center stepwise moves from one functional group back to the same one via other functional groups. The stream of the electron concerning the cascade reaction is like a locus of boomerang. We show here three different boomerang-type reactions via ionic species or free radicals. 1) Diastereoselective Michael-aldol reaction based on the chiral auxiliary method and enantioselective Michael-aldol reaction by the use of external chiral sources. 2) Short and efficient total syntheses of longifolane sesquiterpenes utilizing intramolecular double Michael addition as a key step. 3) Development of boomerang-type radical cascade reaction of halopolyenes to construct terpenoid skeletons and its regioselectivity.
An Immunoglobulin G1 Monoclonal Antibody Highly Specific to the Wall of Cryptosporidium Oocysts
Weir, C.; Vesey, G.; Slade, M.; Ferrari, B.; Veal, D. A.; Williams, K.
2000-01-01
The detection of Cryptosporidium oocysts in drinking water is critically dependent on the quality of immunofluorescent reagents. Experiments were performed to develop a method for producing highly specific antibodies to Cryptosporidium oocysts that can be used for water testing. BALB/c mice were immunized with six different antigen preparations and monitored for immunoglobulin G (IgG) and IgM responses to the surface of Cryptosporidium oocysts. One group of mice received purified oocyst walls, a second group received a soluble protein preparation extracted from the outside of the oocyst wall, and the third group received whole inactivated oocysts. Three additional groups were immunized with sequentially prepared oocyst extracts to provide for a comparison of the immune response. Mice injected with the soluble protein extract demonstrated an IgG response to oocysts surface that was not seen in the whole-oocyst group. Mice injected with whole oocysts showed an IgM response only, while mice injected with purified oocyst walls showed little increase in IgM or IgG levels. Of the additional reported preparations only one, BME (2-mercaptoethanol treated), produced a weak IgM response to the oocyst wall. A mouse from the soluble oocyst extract group yielding a high IgG response was utilized to produce a highly specific IgG1 monoclonal antibody (Cry104) specific to the oocyst surface. Comparative flow cytometric analysis indicated that Cry104 has a higher avidity and specificity to oocysts in water concentrates than other commercially available antibodies. PMID:10973448
Huang, Li-shar; Cobessi, David; Tung, Eric Y.; Berry, Edward A.
2005-01-01
Antimycin A (antimycin), one of the first known and most potent inhibitors of the mitochondrial respiratory chain, binds to the quinone reduction site of the cytochrome bc1 complex. Structure-activity-relationship studies have shown that the N-formylamino-salicyl-amide group is responsible for most of the binding specificity, and suggested that a low pKa for the phenolic OH group and an intramolecular H-bond between that OH and the carbonyl O of the salicylamide linkage are important. Tw...
Decoding Finger Flexion From Band-specific ECoG Signals in Humans
Directory of Open Access Journals (Sweden)
Nanying eLiang
2012-06-01
Full Text Available This article presents the method that won the BCI competition IV addressed to the pre- diction of the finger flexion from ECoG signals. ECoG-based BCIs have recently drawn the attention from the community. Indeed, ECoG can provide a higher spatial resolution, a higher signal quality and is more suitable for long-term use than classical EEG recordings. These characteristics allow to decode precise brain activities and to realize efficient ECoG-based neu- roprostheses. Signal processing is a very important task in BCIs research for translating brain signals into commands. Here, we present a linear regression method based on the amplitude modulation of band-specific ECoG including a short term memory for individual finger flexion prediction. The effectiveness of the method was proven by achieving the highest value of corre- lation coefficient between the predicted and recorded finger flexion values on data set 4 during the BCI competition IV.
Beyer, Astrid; Reucher, Christine M M; Bolm, Carsten
2011-06-03
A new protocol for intramolecular N-arylations of ureas to form benzimidazol-2-ones has been developed. The cyclization reaction occurs in the presence of KOH and DMSO at close to ambient temperature. Under these conditions the yields are high and a wide range of functional groups are tolerated.
Mikutis, Gediminas; Karaköse, Hande; Jaiswal, Rakesh; LeGresley, Adam; Islam, Tuhidul; Fernandez-Lahore, Marcelo; Kuhnert, Nikolai
2013-02-01
Flavanols from tea have been reported to accumulate in the cell nucleus in considerable concentrations. The nature of this phenomenon, which could provide novel approaches in understanding the well-known beneficial health effects of tea phenols, is investigated in this contribution. The interaction between epigallocatechin gallate (EGCG) from green tea and a selection of theaflavins from black tea with selected cell nuclear structures such as model histone proteins, double stranded DNA and quadruplex DNA was investigated using mass spectrometry, Circular Dichroism spectroscopy and fluorescent assays. The selected polyphenols were shown to display affinity to all of the selected cell nuclear structures, thereby demonstrating a degree of unexpected molecular promiscuity. Most interestingly theaflavin-digallate was shown to display the highest affinity to quadruplex DNA reported for any naturally occurring molecule reported so far. This finding has immediate implications in rationalising the chemopreventive effect of the tea beverage against cancer and possibly the role of tea phenolics as "life span essentials".
Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu
2018-02-01
In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.
Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong
2016-10-21
Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Understanding perovskite formation through the intramolecular exchange method in ambient conditions
Szostak, Rodrigo; Castro, Jhon A. P.; Marques, Adriano S.; Nogueira, Ana F.
2017-04-01
Among the methods to prepare hybrid organic-inorganic perovskite films, the intramolecular exchange method was the first one that made possible to prepare perovskite solar cells with efficiencies higher than 20%. However, perovskite formation by this method is not completely understood, especially in ambient conditions. In this work, perovskite films were prepared by the intramolecular exchange method in ambient conditions. The spin coating speed and the frequency of the MAI solution dripping onto PbI2(DMSO) were varied during the deposition steps. With the combination of these two parameters, a rigid control of the solvent drying was possible. Thus, depending on the chosen conditions, the intermediate MAPb3I8·2DMSO was formed with residual PbI2. Otherwise, direct formation of perovskite film was attained. A mechanism for the direct formation of bulk perovskite was proposed. We also investigated how the posterior thermal annealing affects the crystallinity and defects in perovskite films. With prolonged thermal annealing, the excess of MAI can be avoided, increasing the efficiency and decreasing the hysteresis of the solar cells. The best perovskite solar cell achieved a stabilized power output of 12.9%. The findings of this work pave the way for realizing the fabrication of efficient perovskite solar cells in ambient atmosphere, a very desirable condition for cost-efficient large scale manufacturing of this technology.
International Nuclear Information System (INIS)
Heredia, Daniel; Otero, Luis; Gervaldo, Miguel; Fungo, Fernando; Dittrich, Thomas; Lin, Chih-Yen; Chi, Liang-Chen; Fang, Fu-Chuan; Wong, Ken-Tsung
2013-01-01
Surface photovoltage (SPV) measurements were performed with a Kelvin-probe in spirobifluorene-based donor (diphenylamine)–acceptor (dicyano or cyanoacrylic acid moieties) compounds adsorbed from highly diluted solutions onto Au and indium tin oxide electrode surfaces. Strong intramolecular charge separation (negative SPV signals up to more than 0.1 V) due to directed molecule adsorption was observed only for spirobifluorene donor–acceptor compounds with carboxylic acid moiety. SPV signals and onset energies of electronic transitions depended on ambience conditions. - Highlights: ► Fluorene donor–acceptor derivatives were adsorbed at Au and indium tin oxide. ► Surface photovoltage measurements were performed with a Kelvin-probe. ► Strong intra-molecular charge separation was observed. ► SPV signals depended on ambience conditions
Directory of Open Access Journals (Sweden)
Hamzehloueian Mahshid
2014-01-01
Full Text Available The present study reports a systematic computational analysis of the two possible pathways, fused and bridged, for an intramolecular hetero Diels-Alder (IMHDA and an intramolecular 1,3-dipolar cycloaddition (IMDCA of 2-vinyloxybenzaldehyde derivatives. The potential energy surface analysis for both reactions is in agreement with experimental observations. The activation energies associated with the two regioisomeric channels in IMHDA reaction show that the bridged product is favored, although in IMDCA, the most stable TS results the fused product. The global electronic properties of fragments within each molecule were studied to discuss the reactivity patterns and charge transfer direction in the intramolecular processes. The asynchronicity of the bond formation and aromaticity of the optimized TSs in the Diels-Alder reaction as well as cycloaddition reaction were evaluated. Finally, 1H NMR chemical shifts of the possible regioisomers have been calculated using the GIAO method which of the most stable products are in agreement with the experimental data in the both reaction.
Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B
2008-09-01
We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.
Directory of Open Access Journals (Sweden)
Christelle Boléa
2001-02-01
Full Text Available The Cu-catalyzed intramolecular CH insertion of phenyliodonium ylide 5b has been investigated at 0° C in the presence of several chiral ligands. Enantioselectivities vary in the range of 38–72 %, and are higher than those resulting from reaction of the diazo compound 5c at 65° C. The results are consistent with a carbenoid mechanism for Cu-catalyzed decomposition of phenyliodonium ylides.
The preparation and intramolecular radical cyclisation reactions of chiral oxyme ethers
International Nuclear Information System (INIS)
Booth, Susan E.; Jenkins, Paul R.
1998-01-01
Chiral oxime ether 2 and Oxime ester 4 have been prepared by alkylation and esterification of the oxime 1. Racemic hydroxylamine 6 and chiral hydroxylamine 10 have been synthesised from N-hydroxysuccinimide and the corresponding alcohol in the presence of diethyl azo dicarboxylate, the two product were converted into the oxime ethers 7 and 11 respectively. The intramolecular radical cyclisation reactions of these oxime ethers and esters has been studied, successful reaction was observed to produce alkyl hydroxylamines 3,8 and 12. (author)
The Preparation and Intramolecular Radical Cyclisation Reactions of Chiral Oxime Ethers
Directory of Open Access Journals (Sweden)
Booth Susan E.
1998-01-01
Full Text Available Chiral oxime ether 2 and Oxime ester 4 have been prepared by alkylation and esterification of the oxime 1. Racemic hydroxylamine 6 and chiral hydroxylamine 10 have been synthesised from N-hydroxysuccinimide and the corresponding alcohol in the presence of diethylazodicarboxylate, the two products were converted into the oxime ethers 7 and 11 respectively. The intramolecular radical cyclisation reactions of these oxime ethers and esters has been studied, successful reaction was observed to produce alkyl hydroxylamines 3, 8 and 12.
Ductile Glass of Polyrotaxane Toughened by Stretch-Induced Intramolecular Phase Separation.
Kato, Kazuaki; Nemoto, Kaito; Mayumi, Koichi; Yokoyama, Hideaki; Ito, Kohzo
2017-09-27
A new class of ductile glasses is created from a thermoplastic polyrotaxane. The hard glass, which has a Young's modulus of 1 GPa, shows crazing, necking, and strain hardening with a total elongation of 330%. Stress concentration is prevented through a unique stretch-induced intramolecular phase separation of the cyclic components and the exposed backbone. In situ synchrotron X-ray scattering studies indicate that the backbone polymer chains slip through the cyclic components in the regions where the stress is concentrated.
Photoinduced intramolecular substitution reaction of aryl halide with carbonyl oxygen of amide group
Park, Y T; Kim, M S; Kwon, J H
2002-01-01
Photoreaction of N-(o-halophenyl)acetamide in basic acetonitrile produces an intramolecular substituted product, 2-methylbenzoxazole in addition to reduced product, acetanilide, whereas photoreaction of N-(o-halobenzyl)acetamide affords a reduced product, N-benzylacetamide only. On the basis of preparative reaction, kinetics, and UV/vis absorption behavior, an electrophilic aromatic substitution of aryl halide with oxygen of its amide bond are proposed.
Photoinduced intramolecular substitution reaction of aryl halide with carbonyl oxygen of amide group
Energy Technology Data Exchange (ETDEWEB)
Park, Yong Tae; Song, Myong Geun; Kim, Moon Sub; Kwon, Jeong Hee [Kyungpook National Univ., Daegu (Korea, Republic of)
2002-09-01
Photoreaction of N-(o-halophenyl)acetamide in basic acetonitrile produces an intramolecular substituted product, 2-methylbenzoxazole in addition to reduced product, acetanilide, whereas photoreaction of N-(o-halobenzyl)acetamide affords a reduced product, N-benzylacetamide only. On the basis of preparative reaction, kinetics, and UV/vis absorption behavior, an electrophilic aromatic substitution of aryl halide with oxygen of its amide bond are proposed.
Photoinduced intramolecular substitution reaction of aryl halide with carbonyl oxygen of amide group
International Nuclear Information System (INIS)
Park, Yong Tae; Song, Myong Geun; Kim, Moon Sub; Kwon, Jeong Hee
2002-01-01
Photoreaction of N-(o-halophenyl)acetamide in basic acetonitrile produces an intramolecular substituted product, 2-methylbenzoxazole in addition to reduced product, acetanilide, whereas photoreaction of N-(o-halobenzyl)acetamide affords a reduced product, N-benzylacetamide only. On the basis of preparative reaction, kinetics, and UV/vis absorption behavior, an electrophilic aromatic substitution of aryl halide with oxygen of its amide bond are proposed
DEFF Research Database (Denmark)
Cogoi, Susanna; Zorzet, Sonia; Rapozzi, Valentina
2013-01-01
and stability, two polycyclic aromatic hydrocarbon units (TINA or AMANY) were inserted internally, to cap the quadruplex. The most active G4-decoy (2998), which had two para-TINAs, strongly suppressed KRAS expression in Panc-1 cells. It also repressed their metabolic activity (IC50 = 520 nM), and it inhibited...... cell growth and colony formation by activating apoptosis. We finally injected 2998 and control oligonucleotides 5153, 5154 (2 nmol/mouse) intratumorally in SCID mice bearing a Panc-1 xenograft. After three treatments, 2998 reduced tumor xenograft growth by 64% compared with control and increased...
Hayashi, Gosuke; Kamo, Naoki; Okamoto, Akimitsu
2017-05-30
We report a novel method for multisite protein conjugation by setting differently silyl-protected alkynes as conjugation handles, which can remain intact through the whole synthetic procedure and provide sequential and orthogonal conjugation. This strategy enables efficient preparation of a dual dye-labeled protein and structural analysis via an intramolecular FRET mechanism.
On the nature of intramolecular vibrational energy transfer in dense molecular environments
Energy Technology Data Exchange (ETDEWEB)
Benten, Rebekka S. von [Institut fuer Physikalische Chemie der Universitaet Goettingen, Tammannstrasse 6, D-37077 Goettingen (Germany); Abel, Bernd, E-mail: Bernd.Abel@uni-lepzig.de [Wilhelm-Ostwald-Institut fuer Physikalische und Theoretische Chemie, Universitaet Leipzig, Linne-Strasse 2, D-04103 Leipzig (Germany)
2010-12-09
Graphical abstract: Mechanisms of IVR in multi-tiers of intramolecular energy levels in different molecular environments are investigated. - Abstract: Transient femtosecond-IR-pump-UV-absorption probe-spectroscopy has been employed to shed light on the nature of intramolecular vibrational energy transfer (IVR) in dense molecular environments ranging from the diluted gas phase to the liquid. A general feature in our experiments and those of others is that IVR proceeds via multiple timescales if overtones or combination vibrations of high frequency modes are excited. It has been found that collisions enhance IVR if its (slower) timescales can compete with collisions. This enhancement is, however, much more weaker and rather inefficient as opposed to the effect of collisions on intermolecular energy transfer which is well known. In a series of experiments we found that IVR depends not significantly on the average energy transferred in a collision but rather on the number of collisions. The collisions are much less efficient in affecting IVR than VET. We conclude that collision induced broadening of vibrational energy levels reduces the energy gaps and enhances existing couplings between tiers. The present results are an important step forward to rationalize and understand apparently different and not consistent results from different groups on different molecular systems between gas and liquid phases.
Directory of Open Access Journals (Sweden)
Weissbrich Benedikt
2007-05-01
Full Text Available Abstract Background The determination of virus-specific immunoglobulin G (IgG antibodies in cerebrospinal fluid (CSF is useful for the diagnosis of virus associated diseases of the central nervous system (CNS and for the detection of a polyspecific intrathecal immune response in patients with multiple sclerosis. Quantification of virus-specific IgG in the CSF is frequently performed by calculation of a virus-specific antibody index (AI. Determination of the AI is a demanding and labour-intensive technique and therefore automation is desirable. We evaluated the precision and the diagnostic value of a fully automated enzyme immunoassay for the detection of virus-specific IgG in serum and CSF using the analyser BEP2000 (Dade Behring. Methods The AI for measles, rubella, varicella-zoster, and herpes simplex virus IgG was determined from pairs of serum and CSF samples of patients with viral CNS infections, multiple sclerosis and of control patients. CSF and serum samples were tested simultaneously with reference to a standard curve. Starting dilutions were 1:6 and 1:36 for CSF and 1:1386 and 1:8316 for serum samples. Results The interassay coefficient of variation was below 10% for all parameters tested. There was good agreement between AIs obtained with the BEP2000 and AIs derived from the semi-automated reference method. Conclusion Determination of virus-specific IgG in serum-CSF-pairs for calculation of AI has been successfully automated on the BEP2000. Current limitations of the assay layout imposed by the analyser software should be solved in future versions to offer more convenience in comparison to manual or semi-automated methods.
Directory of Open Access Journals (Sweden)
Pramod Kumar Verma
2016-03-01
Full Text Available We employ transient absorption from the deep-UV to the visible region and fluorescence upconversion to investigate the photoinduced excited-state intramolecular proton-transfer dynamics in a biologically relevant drug molecule, 2-acetylindan-1,3-dione. The molecule is a ß-diketone which in the electronic ground state exists as exocyclic enol with an intramolecular H-bond. Upon electronic excitation at 300 nm, the first excited state of the exocyclic enol is initially populated, followed by ultrafast proton transfer (≈160 fs to form the vibrationally hot endocyclic enol. Subsequently, solvent-induced vibrational relaxation takes place (≈10 ps followed by decay (≈390 ps to the corresponding ground state.
International Nuclear Information System (INIS)
Hibma, M.; Griffin, J.F.T.
1992-01-01
Monoclonal antibodies (mAb) which react with cervine immunoglobulin (Ig) light chain, IgM and IgG were produced using conventional cell fusion technology. Hybridoma supernatants were initially screened for specificity against cervine Ig using an enzyme-linked immunosorbent assay (ELISA). The specificity of supernatants against size-fractionated cervine Ig was further determined. Supernatants were characterised using western blotting and autoradiographic techniques. The mAb OU1G, OU2G and OU3G were specific for cervine gamma-chain of IgG, whereas OU1L was specific for light chain of Ig. A further mAb (OU1M) bound IgM and not IgG. These mAb were found to have varying cross-reactivity against Ig from other species
Energy Technology Data Exchange (ETDEWEB)
Paul, Bijan Kumar [Department of Chemistry, University of Calcutta, 92 Acharya Prafulla Chandra Road, Calcutta 700009 (India); Guchhait, Nikhil, E-mail: nikhil.guchhait@rediffmail.com [Department of Chemistry, University of Calcutta, 92 Acharya Prafulla Chandra Road, Calcutta 700009 (India)
2012-07-25
Highlights: Black-Right-Pointing-Pointer Experimental and computational studies on the photophysics of 4-chlorosalicylic acid. Black-Right-Pointing-Pointer Spectroscopically established ESIPT reaction substantiated by theoretical calculation. Black-Right-Pointing-Pointer Quantum chemical treatment of IMHB unveils strength, nature and directional nature. Black-Right-Pointing-Pointer Superiority of quantum chemical treatment of H-bond over geometric criteria. Black-Right-Pointing-Pointer Role of H-bond as a modulator of aromaticity. -- Abstract: The photophysical study of a pharmaceutically important chlorine substituted derivative of salicylic acid viz., 4-chlorosalicylic acid (4ClSA) has been carried out by steady-state absorption, emission and time-resolved emission spectroscopy. A large Stokes shifted emission band with negligible solvent polarity dependence marks the spectroscopic signature of excited-state intramolecular proton transfer (ESIPT) reaction in 4ClSA. Theoretical calculation by ab initio and Density Functional Theory methods yields results consistent with experimental findings. Theoretical potential energy surfaces predict the occurrence of proton transfer in S{sub 1}-state. Geometrical and energetic criteria, Atoms-In-Molecule topological parameters, Natural Bond Orbital population analysis have been exploited to evaluate the intramolecular hydrogen bond (IMHB) interaction and to explore its directional nature. The inter-correlation between aromaticity and resonance assisted H-bond is also discussed in this context. Our results unveil that the quantum chemical treatment is a more accurate tool to assess hydrogen bonding interaction in comparison to geometrical criteria.
Directory of Open Access Journals (Sweden)
Karen J. Brewer
2010-08-01
Full Text Available Steady-state and time-resolved emission spectroscopy are valuable tools to probe photochemical processes of metal-ligand, coordination complexes. Ru(II polyazine light absorbers are efficient light harvesters absorbing in the UV and visible with emissive 3MLCT excited states known to undergo excited state energy and electron transfer. Changes in emission intensity, energy or band-shape, as well as excited state lifetime, provide insight into excited state dynamics. Photophysical processes such as intramolecular electron transfer between electron donor and electron acceptor sub-units may be investigated using these methods. This review investigates the use of steady-state and time-resolved emission spectroscopy to measure excited state intramolecular electron transfer in polyazine bridged Ru(II,Rh(III supramolecular complexes. Intramolecular electron transfer in these systems provides for conversion of the emissive 3MLCT (metal-to-ligand charge transfer excited state to a non-emissive, but potentially photoreactive, 3MMCT (metal-to-metal charge transfer excited state. The details of the photophysics of Ru(II,Rh(III and Ru(II,Rh(III,Ru(II systems as probed by steady-state and time-resolved emission spectroscopy will be highlighted.
Thyrocyte-specific Gq/G11 deficiency impairs thyroid function and prevents goiter development.
Kero, Jukka; Ahmed, Kashan; Wettschureck, Nina; Tunaru, Sorin; Wintermantel, Tim; Greiner, Erich; Schütz, Günther; Offermanns, Stefan
2007-09-01
The function of the adult thyroid is regulated by thyroid-stimulating hormone (TSH), which acts through a G protein-coupled receptor. Overactivation of the TSH receptor results in hyperthyroidism and goiter. The Gs-mediated stimulation of adenylyl cyclase-dependent cAMP formation has been regarded as the principal intracellular signaling mechanism mediating the action of TSH. Here we show that the Gq/G11-mediated signaling pathway plays an unexpected and essential role in the regulation of thyroid function. Mice lacking the alpha subunits of Gq and G11 specifically in thyroid epithelial cells showed severely reduced iodine organification and thyroid hormone secretion in response to TSH, and many developed hypothyroidism within months after birth. In addition, thyrocyte-specific Galphaq/Galpha11-deficient mice lacked the normal proliferative thyroid response to TSH or goitrogenic diet, indicating an essential role of this pathway in the adaptive growth of the thyroid gland. Our data suggest that Gq/G11 and their downstream effectors are promising targets to interfere with increased thyroid function and growth.
Backbone modified TBA analogues endowed with antiproliferative activity.
Esposito, Veronica; Russo, Annapina; Amato, Teresa; Varra, Michela; Vellecco, Valentina; Bucci, Mariarosaria; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo
2017-05-01
The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Quack, M.
1983-01-01
The description and definition of intramolecular vibrational relaxation processes is discussed within the framework of the quantum mechanical and statistical mechanical equations of motion. The evidence from quite different experimental sources is summarized under the common aspect of vibrational relaxation. Although much of the evidence remains ambiguous, there is good indication that a localized vibrational excitation relaxes typically in 0.1 to 10 picoseconds, which is long compared to many optical and reactive processes
Energy Technology Data Exchange (ETDEWEB)
Hattori, Akifumi [Graduate School of Bio-Applications and Systems Engineering (BASE), Tokyo University of Agriculture and Technology, 2-24-16 Naka-machi, Koganei, Tokyo, 184-8588 (Japan); Department of Organic and Polymeric Materials, Tokyo Institute of Technology, Ookayama 2-12-1-S8, Meguro-ku, Tokyo, 152-8552 (Japan); Sato, Hisaya [Graduate School of Bio-Applications and Systems Engineering (BASE), Tokyo University of Agriculture and Technology, 2-24-16 Naka-machi, Koganei, Tokyo, 184-8588 (Japan); Vacha, Martin [Department of Organic and Polymeric Materials, Tokyo Institute of Technology, Ookayama 2-12-1-S8, Meguro-ku, Tokyo, 152-8552 (Japan)]. E-mail: vacha@op.titech.ac.jp
2007-01-15
We report luminescence study of intramolecular exciplexes based on an aminobenzanthrone derivative, dimethyl-amino-N-acetyl-3-aminobenzanthrone (BDA). The BDA compound shows strong dependence of the exciplex emission band intensity on the solvent dielectric function and moderate dependence on its viscosity. The exciplex emission mechanism is discussed in view of the unusual solvent polarity dependence and solvent-dependent excited state lifetimes. Preliminary results on single-molecule detection in polymer films are also presented.
International Nuclear Information System (INIS)
Hattori, Akifumi; Sato, Hisaya; Vacha, Martin
2007-01-01
We report luminescence study of intramolecular exciplexes based on an aminobenzanthrone derivative, dimethyl-amino-N-acetyl-3-aminobenzanthrone (BDA). The BDA compound shows strong dependence of the exciplex emission band intensity on the solvent dielectric function and moderate dependence on its viscosity. The exciplex emission mechanism is discussed in view of the unusual solvent polarity dependence and solvent-dependent excited state lifetimes. Preliminary results on single-molecule detection in polymer films are also presented
International Nuclear Information System (INIS)
Morozov, V.A.; Chuvulkin, N.D.; Smolenskij, E.A.; Dubina, Yu.M.
2014-01-01
The dynamic quenching of intensity pulses of the dual-split fluorescence (DSF) has been simulated using numerical solutions of the equations for the population matrix of five states of the model fluorescent molecule (FM). The state with the highest energy is considered as resonantly excited by irradiation, and two other excited states populated by subsequent relaxation processes are taken as initial states for the FM transitions with emission of the DSF photons. The FM model parameters are selected to fit typical parameters of the molecules with intramolecular proton photo transfer. Quenching is considered as a consequence of non-radiative decay of the FM excited states due to collisions with the quencher molecules. Examples of two types of the DSF quenching of the FM are given. The first type leads to an intramolecular radiationless decay of particular excited states of the FM, and the second one results in radiationless transitions from the same states to the quencher molecule states. (authors)
Directory of Open Access Journals (Sweden)
S. Compernolle
2011-09-01
Full Text Available We present EVAPORATION (Estimation of VApour Pressure of ORganics, Accounting for Temperature, Intramolecular, and Non-additivity effects, a method to predict (subcooled liquid pure compound vapour pressure p0 of organic molecules that requires only molecular structure as input. The method is applicable to zero-, mono- and polyfunctional molecules. A simple formula to describe log10p0(T is employed, that takes into account both a wide temperature dependence and the non-additivity of functional groups. In order to match the recent data on functionalised diacids an empirical modification to the method was introduced. Contributions due to carbon skeleton, functional groups, and intramolecular interaction between groups are included. Molecules typically originating from oxidation of biogenic molecules are within the scope of this method: aldehydes, ketones, alcohols, ethers, esters, nitrates, acids, peroxides, hydroperoxides, peroxy acyl nitrates and peracids. Therefore the method is especially suited to describe compounds forming secondary organic aerosol (SOA.
International Nuclear Information System (INIS)
Lyons, B.J.
1986-01-01
Intramolecular crosslinks have been suggested to occur in bulk crystallized, irradiated, high density polyethylene (HDPE) and to account for the low rates of gel formation, especially those of previously annealed samples when compared with that manifested by the same resin when previously quenched from the melt. Such crosslinks do not contribute to the development of gel and contribute to only a limited extent to the elastic properties above the crystalline melting point when compared with intermolecular crosslinks, but, if the mesh size of the intra- and inter-molecular networks are comparable, are fully reflected in the rupture elongation. The rupture elongations of a wide range of HDPE resins, for a given sol fraction or elastic modulus, are found to be at least as high as and often higher than those of low (LDPE) or linear low (LLDPE) polyethylene resins, indicating that intramolecular crosslinking of this type does not occur to a significantly greater extent in these higher crystallinity resins. Other factors more likely to account for the reduced rates of inter alia gel formation in some HDPE resins are discussed. (author)
Chu, Hongzhu; He, Lutao; Jiang, Qian; Fang, Yuyu; Jia, Yiming; Yuan, Xiangyang; Zou, Shuliang; Li, Xianghui; Feng, Wen; Yang, Yuanyou; Liu, Ning; Luo, Shunzhong; Yang, Yanqiu; Yang, Liang; Yuan, Lihua
2014-01-15
To understand intramolecular hydrogen bonding in effecting liquid-liquid extraction behavior of CMPO-calixarenes, three CMPO-modified calix[4]arenes (CMPO-CA) 5a-5c with hydrogen-bonded spacer were designed and synthesized. The impact of spacer rotation that is hindered by introduction of intramolecular hydrogen bonding upon extraction of La(3+), Eu(3+), Yb(3+), Th(4+), and UO2(2+) has been examined. The results show that 5b and 5c containing only one hydrogen bond with a less hindered rotation spacer extract La(3+) more efficiently than 5a containing two hydrogen bonds with a more hindered rotation spacer, demonstrating the importance of local rigidification of spacer in the design of extractants in influencing the coordination environment. The large difference in extractability between La(3+) and Yb(3+) (or Eu(3+)) by 5b (or 5c), and the small difference by 5a, suggests intramolecular hydrogen bonding do exert pronounced influence upon selective extraction of light and heavy lanthanides. Log-log plot analysis indicates a 1:1, 2:1 and 1:1 stoichiometry (ligand/metal) for the extracted complex formed between 5b and La(3+), Th(4+), UO2(2+), respectively. Additionally, their corresponding acyclic analogs 7a-7c exhibit negligible extraction toward these metal ions. These results reveal the possibility of selective extraction via tuning local chelating surroundings of CMPO-CA by aid of intramolecular hydrogen bonding. Copyright © 2013 Elsevier B.V. All rights reserved.
Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang
2015-07-09
The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.
Synthesis of anatoxin a via intramolecular cyclization of iminium salts
International Nuclear Information System (INIS)
Bates, H.A.; Rapoport, H.
1979-01-01
Anatoxin a (1) has been synthesized by exploiting intramolecular cyclization between an iminium salt and a nucleophilic carbon to construct the 9-azabicyclo[4.2.1]nonane ring system. Cyclization of malonate iminiumsalt 16 at alkaline pH afforded a low yield of bicyclic malonate 18 owing to an unfavorable equilibrium constant and lability of the iminium salt in base. In contrast, cyclization of ketoiminium salt 31 afforded a good yield of bicyclic ketone 34 in acidic methanol. Dihydropyrrolium salts 16 and 31 were generated quantitatively by decarbonylation of substituted N-methylprolines 15 and 30b, obtained by reduction of the corresponding pyrroles
Prevalence of rubella-specific IgG antibodies in unimmunized young female population
Directory of Open Access Journals (Sweden)
Jayakrishnan Thayyil
2016-01-01
Full Text Available Context: Rubella is a mild self-limiting disease all over the world; nevertheless, it is of significant public health importance due to its teratogenic effect of congenital rubella syndrome. Rubella vaccine is currently not included in the national immunization program in India. Rubella-specific IgG in the unvaccinated population is a marker of previous rubella infection. Rubella IgG estimation in children will provide data for initiation and necessary modification to the immunization strategy. Aims: In this background, this study was conducted with an aim to know the age-specific susceptibility of acquiring rubella infections and future risk of congenital rubella syndrome (CRS among girls. Settings and Design: This was a community-based, observational study. Participants and Methods: The study was conducted at a randomly selected rural area Mavoor Panchayath of Kozhikode District, Kerala, among adolescent girls. The estimation of rubella-specific IgG antibody was done by quantitative enzyme-linked immunosorbent assay method. IgG titer value of >15 IU was taken positive, 8-15 IU as equivocal, and <8 IU as negative. Statistical Analysis Used: Statistical analysis was performed using Statistical program for Social science version 16 for Windows. Chi-square test was applied to find out significant difference and Fisher′s exact test wherever applicable. Results: The data and blood sample collection was done from 250 girls. The mean IgG titer was 151.93 ± 128.78 IU, and as per the criteria, 68.3% were positive, 28.5% were negative, and 3.2% were equivocal. At this age, majority (68.3% of the girls get protection by natural infection without any vaccine. Some girls (32% may remain susceptible to infection during adulthood and pregnancy. Conclusions: Natural rubella infection was widely prevalent among child population and at this age. An immunization policy recommending rubella-containing vaccine is highly desirable to prevent rubella and CRS.
Beloki, Lorea; Ciaurriz, Miriam; Mansilla, Cristina; Zabalza, Amaya; Perez-Valderrama, Estela; Samuel, Edward R; Lowdell, Mark W; Ramirez, Natalia; Olavarria, Eduardo
2014-11-19
Cytomegalovirus (CMV)-specific T cell infusion to immunocompromised patients following allogeneic Hematopoietic Stem Cell Transplantation (allo-HSCT) is able to induce a successful anti-viral response. These cells have classically been manufactured from steady-state apheresis samples collected from the donor in an additional harvest prior to G-CSF mobilization, treatment that induces hematopoietic stem cell (HSC) mobilization to the periphery. However, two closely-timed cellular collections are not usually available in the unrelated donor setting, which limits the accessibility of anti-viral cells for adoptive immunotherapy. CMV-specific cytotoxic T cell (CTL) manufacture from the same G-CSF mobilized donor stem cell harvest offers great regulatory advantages, but the isolation using MHC-multimers is hampered by the high non-specific binding to myeloid progenitors, which reduces the purity of the cellular product. In the present study we describe an easy and fast method based on plastic adherence to remove myeloid cell subsets from 11 G-CSF mobilized donor samples. CMV-specific CTLs were isolated from the non-adherent fraction using pentamers and purity and yield of the process were compared to products obtained from unmanipulated samples. After the elimination of unwanted cell subtypes, non-specific binding of pentamers was notably reduced. Accordingly, following the isolation process the purity of the obtained cellular product was significantly improved. G-CSF mobilized leukapheresis samples can successfully be used to isolate antigen-specific T cells with MHC-multimers to be adoptively transferred following allo-HSCT, widening the accessibility of this therapy in the unrelated donor setting. The combination of the clinically translatable plastic adherence process to the antigen-specific cell isolation using MHC-multimers improves the quality of the therapeutic cellular product, thereby reducing the clinical negative effects associated with undesired
Symmetry-breaking intramolecular charge transfer in the excited state of meso-linked BODIPY dyads
Whited, Matthew T.; Patel, Niral M.; Roberts, Sean T.; Allen, Kathryn; Djurovich, Peter I.; Bradforth, Stephen E.; Thompson, Mark E.
2012-01-01
We report the synthesis and characterization of symmetric BODIPY dyads where the chromophores are attached at the meso position, using either a phenylene bridge or direct linkage. Both molecules undergo symmetry-breaking intramolecular charge transfer in the excited state, and the directly linked dyad serves as a visible-light-absorbing analogue of 9,9′-bianthryl.
Czech Academy of Sciences Publication Activity Database
Zamotaiev, O. M.; Shvadchak, Volodymyr; Sych, T. P.; Melnychuk, N. A.; Yushchenko, Dmytro A.; Mely, Y.; Pivovarenko, V. G.
2016-01-01
Roč. 4, č. 3 (2016), č. článku 034004. ISSN 2050-6120 Institutional support: RVO:61388963 Keywords : quinolone * fluorescent probes * local polarity * hydration * excited-state intramolecular proton transfer * kinetics Subject RIV: CC - Organic Chemistry Impact factor: 2.656, year: 2016
International Nuclear Information System (INIS)
Li, Tsung-Lung; Lu, Wen-Cai
2016-01-01
The geometric and electronic structures of neutral monolithium- and monosodium-rubrene (Li 1 Rub and Na 1 Rub) isomers are investigated and compared with monopotassium-rubrene (K 1 Rub). Based on the alkali binding site, all isomers of these alkali-rubrene complexes can be subdivided into two types: intramolecularly intercalated and extramolecularly adsorbed. The minimum-energy Li 1 Rub and Na 1 Rub are intercalated structures, whereas the minimum-energy K 1 Rub is adsorbed. The fact that the intercalated Li 1 Rub and Na 1 Rub structures are energetically favorable over the adsorbed ones can be explained by two energy rules. First, “double” proximity of the intercalating alkali element to a pair of phenyl side groups enormously reduces the total energy. Second, accommodation of a minuscule intercalant does not significantly deform the carbon frame and, thus, increases the energy only by a small amount. Additionally, the peculiar effects of intramolecular intercalation on the electronic structures of molecules are also studied in this simulation of monoalkali intercalation. In the monoalkali-intercalated rubrene complex, only one of the two pairs of phenyl groups of rubrene is intercalated, intentionally leaving another pair pristine, which facilitates the comparison of electronic structures between the intercalated and pristine pairs of phenyl side groups in a single molecule. The uniformity of chemical environments of the phenyl groups of the intercalated Li 1 Rub/Na 1 Rub is deteriorated by the incorporation of the intercalant, and leads to their spectral characteristics in contrast to K 1 Rub. In particular, the introduction of the intercalant promotes the carbon 2p orbitals of the intercalated phenyl pair to take part in the electronic structures of the HOMO and LUMO peaks of Li 1 Rub/Na 1 Rub. The unpaired electron in the HOMO is delocalized over the backbone with higher probability of distributing over the central two fused rings than over the outer two
Elevated Serum IgG4 Defines Specific Clinical Phenotype of Rheumatoid Arthritis
Directory of Open Access Journals (Sweden)
Le-Feng Chen
2014-01-01
Full Text Available Objectives. To explore the correlation of serum IgG4 (sIgG4 with clinical manifestations or therapeutic response in rheumatoid arthritis (RA. Methods. Consecutive 136 RA patients were recruited and followed up at regular interval. SIgG4 was detected by immunonephelometry. Serial synovial tissue sections from 46 RA patients were stained immunohistochemically for IgG4. Results. Forty-six percent of 136 RA patients had elevated sIgG4. Patients with elevated sIgG4 had higher sIgG4/sIgG ratio, C-reactive protein, erythrocyte sedimentation rate, rheumatoid factor, and anticyclic citrullinated peptide antibodies than those with normal sIgG4 (all P<0.05. Among 45 patients who received methotrexate and leflunomide therapy, 50% (9/18 of patients with elevated sIgG4 and 85% (23/27 of patients with normal sIgG4 reached therapeutic target (disease activity score of 28 joints < 3.2 at 6-month visit (χ2=6.508, P=0.011. IgG4-positive plasma cell count correlated positively with sIgG4, total synovitis score, and CD3-, CD20-, and CD38-positive cell counts (all P<0.05. Conclusions. Our results showed that elevated sIgG4 in RA is common and disproportional to total IgG and RA with elevated sIgG4 may be a specific clinical phenotype with higher disease activity, higher level of autoantibodies, and poor response to methotrexate and leflunomide therapy.
Directory of Open Access Journals (Sweden)
Marc Enßle
2012-03-01
Full Text Available Methionine, S-benzylcysteine and S-allylcysteine were converted into 2-diazo-3-oxo-4-phthalimidocarboxylic esters 8a–c in three steps. Upon rhodium-catalysed dediazoniation, two intramolecular carbenoid reactions competed, namely the formation of a cyclic sulfonium ylide and that of a six-ring carbonyl ylide. The S-methyl and S-benzyl ylides 12a and b could be isolated, while S-allyl ylide 12c underwent a [2,3]-sigmatropic rearrangement. The short-lived carbonyl ylides derived from methionine and S-benzylcysteine formed head-to-tail dimers by a [3 + 3]-cycloaddition and could be trapped with external dipolarophiles, while the S-allyl derivative 14c yielded the pentacyclic compound 17 by an intramolecular [3 + 2]-cycloaddition reaction.
Specific Abilities May Increment Psychometric g for High Ability Populations
2016-04-14
tend to sort themselves into jobs that are commensurate with their ability level ( McCormick , DeNisi, & Staw, 1979; McCormick , Jeanneret, & Mecham...of Genetic Psychology, 153, 229-230. Specific abilities, g, & high ability populations 14 McCormick , E. J., DeNisi, A. S., & Shaw, J. B... McCormick , E. J., Jeanneret, P. R., & Mecham, R. C. (1972). A study of job characteristics and job dimensions as based on the Position Analysis Questionnaire
DeKorver, Kyle A; Hsung, Richard P; Song, Wang-Ze; Wang, Xiao-Na; Walton, Mary C
2012-06-15
A cascade of Pd-catalyzed N-to-C allyl transfer-intramolecular ketenimine-[2 + 2] cycloadditions of N-allyl ynamides is described. This tandem sequence is highly stereoselective and the [2 + 2] cycloaddition could be rendered in a crossed or fused manner depending on alkene substitutions, leading to bridged and fused bicycloimines.
Directory of Open Access Journals (Sweden)
V. Z. Krivitskaya
2012-01-01
Full Text Available Abstract. The aim of the study is evaluation of links between presence in blood of specific pre-existing IgG to respiratory-syncytial virus (RSV, clinical course of RSV infection and character specific to RSV humoral immune response in patients of different ages. The antibodies were detected by ELISA using whole RS virus or synthetic peptides corresponded to the selected determinants of the envelope RSV proteins. It was shown that RS specific maternal IgG antibodies passively transferred to babies in utero can circulate in the blood up to 10 months of life. The analysis of paired sera of 45 babies in the age of 1–10 months revealed firstly that presence of maternal IgG specific antibodies to the conservative B-cell immunogenic determinants of the F-protein (amino acids 221–232 and/or the G-protein (amino acids 152–164 and 184–198 is coupled with more high morbidity of primary RSV infection (89% versus 56%, p = 0.023, and also with more high frequency of complicated by bronchus obstruction course of the disease (81% versus 20%, р = 0.001 in compare with babies who were serologically negative to the maternal determinants specific antibodies. The correlation analysis has shown that the high presence of maternal determinant-specific IgG in the blood in babies till 10 months of life is associated in the case of primary infection with disbalance of humoral anti-viral immune response: intensive synthesis of serum RSV IgA. This is evidence of complicated course of infection with simultaneous suppression of response to RSV specific IgG. As opposed to the primary RSV infection in patients older than 3 years (n = 121 it was not detected links between anamnestic determinant-specific IgG synthesized by own immune system as the results of previous disease episodes and synthesis of anti-RSV IgG, IgM, IgE and IgA in RSV re-infections. In the contrast to babies in more older patients the feedback connection between level of pre-existing determinant-specific
Fe(II)/Fe(III)-Catalyzed Intramolecular Didehydro-Diels-Alder Reaction of Styrene-ynes.
Mun, Hyeon Jin; Seong, Eun Young; Ahn, Kwang-Hyun; Kang, Eun Joo
2018-02-02
The intramolecular didehydro-Diels-Alder reaction of styrene-ynes was catalyzed by Fe(II) and Fe(III) to produce various naphthalene derivatives under microwave heating conditions. Mechanistic calculations found that the Fe(II) catalyst activates the styrenyl diene in an inverse-electron-demand Diels-Alder reaction, and the consecutive dehydrogenation reaction can be promoted by either Fe(II)-catalyzed direct dehydrogenation or an Fe(III)-catalyzed rearomatization/dehydrogenation pathway.
Chen, Xiankai
2017-12-18
The large voltage losses usually encountered in organic solar cells significantly limit the power conversion efficiencies (PCEs) of these devices, with the result that the current highest PCE values in single-junction organic photovoltaic remain smaller than for other solar cell technologies, such as crystalline silicon or perovskite solar cells. In particular, the nonradiative recombinations to the electronic ground state from the lowest-energy charge-transfer (CT) states at the donor-acceptor interfaces in the active layer of organic devices, are responsible for a significant part of the voltage losses. Here, to better comprehend the nonradiative voltage loss mechanisms, a fully quantum-mechanical rate formula is employed within the framework of time-dependent perturbation theory, combined with density functional theory. The objective is to uncover the specific contributions of intramolecular vibrations to the CT-state nonradiative recombinations in several model systems, which include small-molecule and polymer donors as well as fullerene and nonfullerene acceptors.
Vibrational spectroscopy and intramolecular energy transfer in isocyanic acid (HNCO)
International Nuclear Information System (INIS)
Coffey, M.J.; Berghout, H.L.; Woods, E. III; Crim, F.F.
1999-01-01
Room temperature photoacoustic spectra in the region of the first through the fourth overtones (2ν 1 to 5ν 1 ) and free-jet action spectra of the second through the fourth overtones (3ν 1 to 5ν 1 ) of the N - H stretching vibration permit analysis of the vibrational and rotational structure of HNCO. The analysis identifies the strong intramolecular couplings that control the early stages of intramolecular vibrational energy redistribution (IVR) and gives the interaction matrix elements between the zero-order N - H stretching states and the other zero-order states with which they interact. The experimentally determined couplings and zero-order state separations are consistent with ab initio calculations of East, Johnson, and Allen [J. Chem. Phys. 98, 1299 (1993)], and comparison with the calculation identifies the coupled states and likely interactions. The states most strongly coupled to the pure N - H stretching zero-order states are ones with a quantum of N - H stretching excitation (ν 1 ) replaced by different combinations of N - C - O asymmetric or symmetric stretching excitation (ν 2 or ν 3 ) and trans-bending excitation (ν 4 ). The two strongest couplings of the nν 1 state are to the states (n-1)ν 1 +ν 2 +ν 4 and (n-1)ν 1 +ν 3 +2ν 4 , and sequential couplings through a series of low order resonances potentially play a role. The analysis shows that if the pure N - H stretch zero-order state were excited, energy would initially flow out of that mode into the strongly coupled mode in 100 fs to 700 fs, depending on the level of initial excitation. copyright 1999 American Institute of Physics
Directory of Open Access Journals (Sweden)
Zhiguo Chen
2013-01-01
Full Text Available Bacillus amyloliquefaciens ribonuclease Barnase (RNase Ba is a 12 kD (kilodalton small extracellular ribonuclease. It has broad application prospects in agriculture, clinical medicine, pharmaceutical, and so forth. In this work, the thermal stability of Barnase has been studied using molecular dynamics simulation at different temperatures. The present study focuses on the contribution of noncovalent intramolecular interaction to protein stability and how they affect the thermal stability of the enzyme. Profiles of root mean square deviation and root mean square fluctuation identify thermostable and thermosensitive regions of Barnase. Analyses of trajectories in terms of secondary structure content, intramolecular hydrogen bonds and salt bridge interactions indicate distinct differences in different temperature simulations. In the simulations, Four three-member salt bridge networks (Asp8-Arg110-Asp12, Arg83-Asp75-Arg87, Lys66-Asp93-Arg69, and Asp54-Lys27-Glu73 have been identified as critical salt bridges for thermostability which are maintained stably at higher temperature enhancing stability of three hydrophobic cores. The study may help enlighten our knowledge of protein structural properties, noncovalent interactions which can stabilize secondary peptide structures or promote folding, and also help understand their actions better. Such an understanding is required for designing efficient enzymes with characteristics for particular applications at desired working temperatures.
Ohara, Taku; Yuan, Tan Chia; Torii, Daichi; Kikugawa, Gota; Kosugi, Naohiro
2011-07-21
In this paper, the molecular mechanisms which determine the thermal conductivity of long chain polymer liquids are discussed, based on the results observed in molecular dynamics simulations. Linear n-alkanes, which are typical polymer molecules, were chosen as the target of our studies. Non-equilibrium molecular dynamics simulations of bulk liquid n-alkanes under a constant temperature gradient were performed. Saturated liquids of n-alkanes with six different chain lengths were examined at the same reduced temperature (0.7T(c)), and the contributions of inter- and intramolecular energy transfer to heat conduction flux, which were identified as components of heat flux by the authors' previous study [J. Chem. Phys. 128, 044504 (2008)], were observed. The present study compared n-alkane liquids with various molecular lengths at the same reduced temperature and corresponding saturated densities, and found that the contribution of intramolecular energy transfer to the total heat flux, relative to that of intermolecular energy transfer, increased with the molecular length. The study revealed that in long chain polymer liquids, thermal energy is mainly transferred in the space along the stiff intramolecular bonds. This finding implies a connection between anisotropic thermal conductivity and the orientation of molecules in various organized structures with long polymer molecules aligned in a certain direction, which includes confined polymer liquids and self-organized structures such as membranes of amphiphilic molecules in water.
Wang, Lingling; Huan, Guo; Momen, Roya; Azizi, Alireza; Xu, Tianlv; Kirk, Steven R; Filatov, Michael; Jenkins, Samantha
2017-06-29
A quantum theory of atoms in molecules (QTAIM) and stress tensor analysis was applied to analyze intramolecular interactions influencing the photoisomerization dynamics of a light-driven rotary molecular motor. For selected nonadiabatic molecular dynamics trajectories characterized by markedly different S 1 state lifetimes, the electron densities were obtained using the ensemble density functional theory method. The analysis revealed that torsional motion of the molecular motor blades from the Franck-Condon point to the S 1 energy minimum and the S 1 /S 0 conical intersection is controlled by two factors: greater numbers of intramolecular bonds before the hop-time and unusually strongly coupled bonds between the atoms of the rotor and the stator blades. This results in the effective stalling of the progress along the torsional path for an extended period of time. This finding suggests a possibility of chemical tuning of the speed of photoisomerization of molecular motors and related molecular switches by reshaping their molecular backbones to decrease or increase the degree of coupling and numbers of intramolecular bond critical points as revealed by the QTAIM/stress tensor analysis of the electron density. Additionally, the stress tensor scalar and vector analysis was found to provide new methods to follow the trajectories, and from this, new insight was gained into the behavior of the S 1 state in the vicinity of the conical intersection.
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2016-01-01
1,4-Dihydroxyanthraquinone and 1,8-dihydroxyanthraquinone were alkylated with 3-bromopropan-1-ol and subsequently transformed into the corresponding DMT protected phosphoramidite building blocks for insertion into loops of the Gquadruplex of the thrombin binding aptamer (TBA). The 1,4-disubstituted...... potassium buffer conditions as previously observed for TBA. Although the majority of the anthraquinone modified TBA analogues showed a decrease in clotting times in a fibrinogen clotting assay when compared to TBA, modified aptamers containing a 1,8-disubstituted anthraquinone linker replacing G8 or T9...
Facile method for the site-specific, covalent attachment of full-length IgG onto nanoparticles.
Hui, James Zhe; Al Zaki, Ajlan; Cheng, Zhiliang; Popik, Vladimir; Zhang, Hongtao; Luning Prak, Eline T; Tsourkas, Andrew
2014-08-27
Antibodies, most commonly IgGs, have been widely used as targeting ligands in research and therapeutic applications due to their wide array of targets, high specificity and proven efficacy. Many of these applications require antibodies to be conjugated onto surfaces (e.g. nanoparticles and microplates); however, most conventional bioconjugation techniques exhibit low crosslinking efficiencies, reduced functionality due to non-site-specific labeling and random surface orientation, and/or require protein engineering (e.g. cysteine handles), which can be technically challenging. To overcome these limitations, we have recombinantly expressed Protein Z, which binds the Fc region of IgG, with an UV active non-natural amino acid benzoylphenyalanine (BPA) within its binding domain. Upon exposure to long wavelength UV light, the BPA is activated and forms a covalent link between the Protein Z and the bound Fc region of IgG. This technology was combined with expressed protein ligation (EPL), which allowed for the introduction of a fluorophore and click chemistry-compatible azide group onto the C-terminus of Protein Z during the recombinant protein purification step. This enabled the crosslinked-Protein Z-IgG complexes to be efficiently and site-specifically attached to aza-dibenzocyclooctyne-modified nanoparticles, via copper-free click chemistry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Intra-molecular selectivity of muonium towards chlorinated aromatic compounds
International Nuclear Information System (INIS)
Venkateswaran, K.; Stadlbauer, J.M.; Laing, M.E.; Klugkist, J.; Chong, D.P.; Porter, G.B.; Walker, D.C.
1994-01-01
Muon resonance studies show that muonium atoms (Mu) in ethanol add selectively to certain C-sites of aromatic compounds containing -Cl and -OH substituents. The sites chosen seem to be those carrying the lowest electron density. This helps to characterize Mu as a nucleophile in addition reactions and, in this respect, Mu differs from ordinary H-atoms. The study shows no apparent inter-molecular selectivity between a pair of aromatic solutes in an equimolar mixture, but strong intra-molecular selectivity in an ether composed of those two aromatic rings. This difference between intra- and inter-molecular selectivity is interpreted as kinetic in origin - arising from the 'caging effect' of the solvent and peculiar to reactions close to the diffusion-controlled limit. (orig.)
Intramolecular anionic diels-alder reactions of 1-aryl-4-oxahepta-1,6-diyne systems in DMSO.
Kudoh, Takayuki; Mori, Tomoko; Shirahama, Mitsuhito; Yamada, Masashi; Ishikawa, Teruhiko; Saito, Seiki; Kobayashi, Hisayoshi
2007-04-25
Base-promoted cycloaddition reactions of 1-aryl- or 1-aryl-7-substituted-4-oxahepta-1,6-diyne systems in DMSO have proven to involve an anionic intramolecular Diels-Alder process taking place even at room temperature in spite of the reaction suffering from temporary disruption of aromaticity. Although initially formed alpha-arylallenide anion can be protonated by DMSO, it can be back to the allenide anion probably because of a small acidity difference between alpha-arylallene and DMSO. The alpha-arylallenide anion in combination with the alpha-aryl substituent can constitute an anionic diene structure that undergoes the intramolecular Diels-Alder reaction involving the C(6)-yne part, a very fast process probably because of the increased HOMO-1 level of the anionic diene, as shown by DFT calculations. Diversified substituted naphthalenes, benzofurans, phenanthrenes, and quinolines, including biaryl architectures, are available from 4-oxahepta-1,6-diynes in a highly expeditious way.
Borelli, Mirko; Iasilli, Giuseppe; Minei, Pierpaolo; Pucci, Andrea
2017-08-06
Thin films of styrene copolymers containing fluorescent molecular rotors were demonstrated to be strongly sensitive to volatile organic compounds (VOCs). Styrene copolymers of 2-[4-vinyl(1,1'-biphenyl)-4'-yl]-cyanovinyljulolidine (JCBF) were prepared with different P(STY- co -JCBF)(m) compositions (m% = 0.10-1.00) and molecular weights of about 12,000 g/mol. Methanol solutions of JCBF were not emissive due to the formation of the typical twisted intramolecular charge transfer (TICT) state at low viscosity regime, which formation was effectively hampered by adding progressive amounts of glycerol. The sensing performances of the spin-coated copolymer films (thickness of about 4 µm) demonstrated significant vapochromism when exposed to VOCs characterized by high vapour pressure and favourable interaction with the polymer matrix such as THF, CHCl₃ and CH₂Cl₂. The vapochromic response was also reversible and reproducible after successive exposure cycles, whereas the fluorescence variation scaled linearly with VOC concentration, thus suggesting future applications as VOC optical sensors.
DEFF Research Database (Denmark)
Carlsen, Lars; Duus, Fritz
1980-01-01
The intramolecular hydrogen bondings in enolic malondialdehyde and it mono- and dithio-analogues have been evaluated by a semiempricial SCF–MO–CNDO method. The calculations predict that the hydrogen bonds play an important part in the stabilities of malondialdehyde and monothiomalondialdehyde...
DEFF Research Database (Denmark)
Tran, Phuong Hoang; Huynh, Vy Hieu; Hansen, Poul Erik
2015-01-01
Metal-triflate-catalyzed intramolecular Friedel–Crafts acylation of 3-arylpropanoic and 4-arylbutanoic acids in triflate-anion ionic liquids under monomodal microwave irradiation is reported. The environmentally benign synthetic procedure allows the formation of cyclic ketones in good yields with...
Hormesis of specific IgG antibody to rabies virus in serum of mice irradiated with low dose γ-rays
International Nuclear Information System (INIS)
Liu Qingjie; Chen Deqing
1998-01-01
Objective: To explore the effect of low dose ionizing radiation on specific antibody in mouse serum. Methods: Kunming strain male mice, weighing 18-22 g, aged 6-8 weeks, were immunized intraperitoneally with rabies vaccine after exposure to cobalt-60 γ-rays. The specific IgG antibody against rabies virus in mouse serum was measured. Results: (1) The serum levels of specific IgG in mice irradiated with 5-30 cGy γ-rays were significantly elevated in comparison with those in control mice (P<0.01), the optimum stimulating dose being 10 cGy. (2) Exposure to 10 cGy caused significant enhancement and earlier emergence of the peak level of specific IgG in serum. (3) The hormesis of specific IgG to rabies virus induced by 10 cGy γ-rays could last one week at least. Conclusion: Low dose ionizing radiation can enhance the level of specific antibody in mouse serum, and this effect can last for one week at least
Directory of Open Access Journals (Sweden)
R. Sharma
2010-02-01
Full Text Available The present investigation was carried out on 15 randomly selected milch buffaloes divided into three groups on the basis of lactation at an organized farm, to study the foot and mouth disease virus type specific antibodies in milk and serum following FMD vaccination. Milk and serum samples collected before vaccination i.e. 0 day and on 7, 14, 28, 42 and 56 days post vaccination, were analyzed for the detection of FMD virus specific IgG1, IgG2 and IgA antibody response by indirect double antibody sandwich ELISA. Significant FMD virus type specific antibody titres (IgG1, IgG2 and IgA were detected in milk and serum of buffaloes on different days post vaccination, though the levels of antibodies were lower in milk as compared to serum. FMD virus type specific IgG1 was found to be the predominant subclass as compared to IgG2 and IgA both in milk and serum of vaccinated buffaloes. Milk and serum IgG1, IgG2 and IgA antibody titres were positively correlated with values of regression coefficient (R as 0.506, 0.434 and 0.396, respectively.
Guo, Jing; Tolstoy, Peter M; Koeppe, B; Denisov, Gleb S; Limbach, Hans-Heinrich
2011-09-08
We present a (1)H, (2)H, and (13)C NMR study of the monoanions of succinic (1), meso- and rac-dimethylsuccinic (2, 3), and methylsuccinic (4) acids (with tetraalkylammonium as the counterion) dissolved in CDF(3)/CDF(2)Cl at 300-120 K. In all four monoanions, the carboxylic groups are linked by a short intramolecular OHO hydrogen bond revealed by the bridging-proton chemical shift of about 20 ppm. We show that the flexibility of the carbon skeleton allows for two gauche isomers in monoanions 1, 2, and 4, interconverting through experimental energy barriers of 10-15 kcal/mol (the process itself and the energy barrier are also reproduced in MP2/6-311++G** calculations). In 3, one of the gauche forms is absent because of the steric repulsion of the methyl groups. In all four monoanions, the bridging proton is located in a double-well potential and subject, at least to some extent, to proton tautomerism, for which we estimate the two proton positions to be separated by ca. 0.2 Å. In 1 and 3, the proton potential is symmetric. In 2, slowing the conformational interconversion introduces an asymmetry to the proton potential, an effect that might be strong enough even to synchronize the proton tautomerism with the interconversion of the two gauche forms. In 4, the asymmetry of the proton potential is due to the asymmetric substitution. The intramolecular H-bond is likely to remain intact during the interconversion of the gauche forms in 1, 3, and 4, whereas the situation in 2 is less clear.
Laux-Biehlmann, Alexis; Chung, Hélène; Mouheiche, Jinane; Vérièpe, Julie; Delalande, François; Lamshöft, Marc; Welters, Ingeborg D; Soldevila, Stéphanie; Bazin, Hervé; Lamarque, Laurent; Van Dorsselaer, Alain; Poisbeau, Pierrick; Schneider, Francis; Goumon, Yannick; Garnero, Patrick
2014-01-01
Endogenous morphine and its derivatives (morphine-6-glucuronide [M6G]; morphine-3-glucuronide [M3G]) are formed by mammalian cells from dopamine. Changes in the concentrations of endogenous morphine have been demonstrated in several pathologies (sepsis, Parkinson's disease, etc.), and they might be relevant as pathological markers. While endogenous morphine levels are detectable using enzyme-linked immunosorbant assay (ELISA), mass spectrometry (MS) analysis was, so far, the only approach to detect and quantify M6G. This study describes the preparation of a specific anti-M6G rabbit polyclonal antibody and its validation. The specificity of this antibody was assessed against 30 morphine-related compounds. Then, a M6G-specific ELISA-assay was tested to quantify M6G in the plasma of healthy donors, morphine-treated, and critically ill patients. The antibody raised against M6G displays a strong affinity for M6G, codeine-6-glucuronide, and morphine-3-6-glucuronide, whereas only weak cross-reactivities were observed for the other compounds. Both M6G-ELISA and LC-MS/MS approaches revealed the absence of M6G in the plasma of healthy donors (controls, n = 8). In all positive donors treated with morphine-patch (n = 5), M6G was detected using both M6G-ELISA and LC-MS/MS analysis. Finally, in a study on critically ill patients with circulating endogenous morphine (n = 26), LC-MS/MS analysis revealed that 73% of the positive-patients (19 of 26), corresponding to high M6G-levels in M6G-ELISA, contained M6G. In conclusion, we show that endogenous M6G can be found at higher levels than morphine in the blood of morphine-naive patients. With respect to the interest of measuring endogenous M6G in pathologies, we provide evidences that our ELISA procedure represents a powerful tool as it can easily and specifically detect endogenous M6G levels. © 2013 International Union of Biochemistry and Molecular Biology.
Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.
2010-01-01
Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468
DEFF Research Database (Denmark)
Ishøy, Mette; Petersen, Rico; Petersen, Michael Åxman
2017-01-01
A high-yielding, stereoselective and extraordinarily complexity generatingPetasis 3-component/intramolecular Diels-Alderreaction has been developed. In combination with ROM-RCM, rapid access to complex sp3-rich heterocyclic scaffolds amenableto subsequent functionalization and library synthesis...
Characterizing the strand-specific distribution of non-CpG methylation in human pluripotent cells
Guo, Weilong; Chung, Wen-Yu; Qian, Minping; Pellegrini, Matteo; Zhang, Michael Q.
2013-01-01
DNA methylation is an important defense and regulatory mechanism. In mammals, most DNA methylation occurs at CpG sites, and asymmetric non-CpG methylation has only been detected at appreciable levels in a few cell types. We are the first to systematically study the strand-specific distribution of non-CpG methylation. With the divide-and-compare strategy, we show that CHG and CHH methylation are not intrinsically different in human embryonic stem cells (ESCs) and induced pluripotent stem cells...
Intramolecular interactions in a new tris-dithizonatocobalt(III) complex
International Nuclear Information System (INIS)
Eschwege, Karel G. von; As, Lydia van; Joubert, Chris C.; Swarts, Jannie C.; Aquino, Manuel A.S.; Cameron, T. Stanley
2013-01-01
Graphical abstract: Electrochemically Co(HDz) 3 (5), show three main ligand-based redox processes, two reductions and one oxidation. Ligand oxidations can be resolved into three components highlighting effective intramolecular interactions between molecular fragments; a spectroelectrochemical study of (5) highlighted spectroscopic changes during the six observed redox steps. - Highlights: • Comparative CV's of dithizone (1), PhHg(HDz) and new Co(HDz) 3 (5), is discussed. • One oxidation and two reductions per ligand and a Co III/II couple for (5) are observed. • Mono- and tris-coordinated PhHg(HDz) and (5) have stable metal thioether bonds. • Crystal structure details explain good resolution between ligand redox processes. • Spectro-electrochemistry of (5) highlights spectroscopic properties of redox products. - Abstract: The reactions between dithizone (H 2 Dz (1)) or potassium dithizonate (KHDz (3)), and [Co(H 2 O) 6 ] 2+ (6), in acetone or methanol to liberate tris-dithizonatocobalt(III), Co(HDz) 3 (5), are described. The structure of (5) was confirmed by single crystal X-ray analyses and shows bidentate coordination to Co III via S and N donor atoms for all three HDz − ligands. A comparative voltammetric and spectro-electrochemical study revealed that (1) can be oxidised in two one-electron transfer steps, to generate a disulphide first and then HDz + . In contrast, upon complexation with cobalt, the free mercaptan group of (1) becomes a stable “metal thioether”, Co-S-C, which effectively prevents disulphide formation in all three ligands of (5) upon electrochemical oxidation. As a result, each ligand of Co(HDz) 3 shows just one oxidation process. Intramolecular communication between ligands is evident because the three separate ligand-based oxidations are well resolved. Two irreversible ligand reduction steps, each consisting of three unresolved components related to each of the three ligands, were also observed. The Co II /Co III couple
Energy Technology Data Exchange (ETDEWEB)
Li, Tsung-Lung, E-mail: quantum@mail.ncyu.edu.tw [Department of Electrophysics, National Chia-Yi University, 300 Hsueh-Fu Road, Chiayi, 60004, Taiwan, ROC (China); Lu, Wen-Cai, E-mail: wencailu@jlu.edu.cn [Laboratory of Fiber Materials and Modern Textile, Growing Base for State Key Laboratory, College of Physics, Qingdao University, Qingdao, Shandong 266071 (China); State Key Laboratory of Theoretical and Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun, Jilin 130021 (China)
2016-11-01
The geometric and electronic structures of neutral monolithium- and monosodium-rubrene (Li{sub 1} Rub and Na{sub 1} Rub) isomers are investigated and compared with monopotassium-rubrene (K{sub 1} Rub). Based on the alkali binding site, all isomers of these alkali-rubrene complexes can be subdivided into two types: intramolecularly intercalated and extramolecularly adsorbed. The minimum-energy Li{sub 1} Rub and Na{sub 1} Rub are intercalated structures, whereas the minimum-energy K{sub 1} Rub is adsorbed. The fact that the intercalated Li{sub 1} Rub and Na{sub 1} Rub structures are energetically favorable over the adsorbed ones can be explained by two energy rules. First, “double” proximity of the intercalating alkali element to a pair of phenyl side groups enormously reduces the total energy. Second, accommodation of a minuscule intercalant does not significantly deform the carbon frame and, thus, increases the energy only by a small amount. Additionally, the peculiar effects of intramolecular intercalation on the electronic structures of molecules are also studied in this simulation of monoalkali intercalation. In the monoalkali-intercalated rubrene complex, only one of the two pairs of phenyl groups of rubrene is intercalated, intentionally leaving another pair pristine, which facilitates the comparison of electronic structures between the intercalated and pristine pairs of phenyl side groups in a single molecule. The uniformity of chemical environments of the phenyl groups of the intercalated Li{sub 1} Rub/Na{sub 1} Rub is deteriorated by the incorporation of the intercalant, and leads to their spectral characteristics in contrast to K{sub 1} Rub. In particular, the introduction of the intercalant promotes the carbon 2p orbitals of the intercalated phenyl pair to take part in the electronic structures of the HOMO and LUMO peaks of Li{sub 1} Rub/Na{sub 1} Rub. The unpaired electron in the HOMO is delocalized over the backbone with higher probability of
Directory of Open Access Journals (Sweden)
Karl Hemming
2014-10-01
Full Text Available The coupling of proline- and azetidinone-substituted alkenes to 2-azidobenzoic and 2-azidobenzenesulfonic acid gives precursors that undergo intramolecular azide to alkene 1,3-dipolar cycloadditions to give imine-, triazoline- or aziridine-containing pyrrolo[1,4]benzodiazepines (PBDs, pyrrolo[1,2,5]benzothiadiazepines (PBTDs, and azetidino[1,4]benzodiazepines. The imines and aziridines are formed after loss of nitrogen from a triazoline cycloadduct. The PBDs are a potent class of antitumour antibiotics.
Molecular structures and intramolecular dynamics of pentahalides
Ischenko, A. A.
2017-03-01
This paper reviews advances of modern gas electron diffraction (GED) method combined with high-resolution spectroscopy and quantum chemical calculations in studies of the impact of intramolecular dynamics in free molecules of pentahalides. Some recently developed approaches to the electron diffraction data interpretation, based on direct incorporation of the adiabatic potential energy surface parameters to the diffraction intensity are described. In this way, complementary data of different experimental and computational methods can be directly combined for solving problems of the molecular structure and its dynamics. The possibility to evaluate some important parameters of the adiabatic potential energy surface - barriers to pseudorotation and saddle point of intermediate configuration from diffraction intensities in solving the inverse GED problem is demonstrated on several examples. With increasing accuracy of the electron diffraction intensities and the development of the theoretical background of electron scattering and data interpretation, it has become possible to investigate complex nuclear dynamics in fluxional systems by the GED method. Results of other research groups are also included in the discussion.
The Intramolecular Diels–Alder Reaction of Tryptamine-Derived Zincke Aldehydes Is a Stepwise Process
Pham, Hung V.; Martin, David B. C.; Vanderwal, Christopher D.; Houk, K. N.
2012-01-01
Computational studies show that the base-mediated intramolecular Diels–Alder of tryptamine-derived Zincke aldehydes, used as a key step in the synthesis of the Strychnos alkaloids norfluorocurarine and strychnine, proceeds via a stepwise pathway. The experimentally determined importance of a potassium counterion in the base is explained by its ability to preorganize the Zincke aldehyde diene in an s-cis conformation suitable to bicyclization. Computation also supports the thermodynamic import...
J. Groen (Jan); P. Koraka (Penelope); J. Velzing (Jans); C. Copra (Cederick); A.D.M.E. Osterhaus (Albert)
2000-01-01
textabstractThe performance of six commercially available immunoassay systems for the detection of dengue virus-specific immunoglobulin M (IgM) and IgG antibodies in serum was evaluated. These included two IgM and IgG enzyme immunoassays (EIA) from MRL Laboratories and PanBio, a rapid
Koneczny, Inga; Stevens, Jo A A; De Rosa, Anna; Huda, Saif; Huijbers, Maartje G; Saxena, Abhishek; Maestri, Michelangelo; Lazaridis, Konstantinos; Zisimopoulou, Paraskevi; Tzartos, Socrates; Verschuuren, Jan; van der Maarel, Silvère M; van Damme, Philip; De Baets, Marc H; Molenaar, Peter C; Vincent, Angela; Ricciardi, Roberta; Martinez-Martinez, Pilar; Losen, Mario
2017-02-01
Autoimmunity mediated by IgG4 subclass autoantibodies is an expanding field of research. Due to their structural characteristics a key feature of IgG4 antibodies is the ability to exchange Fab-arms with other, unrelated, IgG4 molecules, making the IgG4 molecule potentially monovalent for the specific antigen. However, whether those disease-associated antigen-specific IgG4 are mono- or divalent for their antigens is unknown. Myasthenia gravis (MG) with antibodies to muscle specific kinase (MuSK-MG) is a well-recognized disease in which the predominant pathogenic IgG4 antibody binds to extracellular epitopes on MuSK at the neuromuscular junction; this inhibits a pathway that clusters the acetylcholine (neurotransmitter) receptors and leads to failure of neuromuscular transmission. In vitro Fab-arm exchange-inducing conditions were applied to MuSK antibodies in sera, purified IgG4 and IgG1-3 sub-fractions. Solid-phase cross-linking assays were established to determine the extent of pre-existing and inducible Fab-arm exchange. Functional effects of the resulting populations of IgG4 antibodies were determined by measuring inhibition of agrin-induced AChR clustering in C2C12 cells. To confirm the results, κ/κ, λ/λ and hybrid κ/λ IgG4s were isolated and tested for MuSK antibodies. At least fifty percent of patients had IgG4, but not IgG1-3, MuSK antibodies that could undergo Fab-arm exchange in vitro under reducing conditions. Also MuSK antibodies were found in vivo that were divalent (monospecific for MuSK). Fab-arm exchange with normal human IgG4 did not prevent the inhibitory effect of serum derived MuSK antibodies on AChR clustering in C2C12 mouse myotubes. The results suggest that a considerable proportion of MuSK IgG4 could already be Fab-arm exchanged in vivo. This was confirmed by isolating endogenous IgG4 MuSK antibodies containing both κ and λ light chains, i.e. hybrid IgG4 molecules. These new findings demonstrate that Fab-arm exchanged antibodies
DEFF Research Database (Denmark)
Natzmutdinov, Renat R.; Bronshtein, Michael D.; Zinkicheva, Tamara T.
2012-01-01
force were determined using dielectric continuum models. We then calculated the electronic transmission coefficient of the intramolecular ET rate using perturbation theory combined with the electronic wave functions determined by the DFT calculations for different heme group orientations and Fe...
DEFF Research Database (Denmark)
Tanner, David Ackland; Hagberg, Lars
1998-01-01
A convergent enantioselective total synthesis of the neurotoxic spirocyclic alkaloid (-)-perhydrohistrionicotoxin (2) is described. A Lewis acid-mediated intramolecular imine ene-type reaction was used for the key spirocyclisation step (14 to 3, with 3 being obtained as a single diastereoisomer...
Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika
2014-08-01
This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Nguyen, Trong-Nghia; Putikam, Raghunath; Lin, M. C.
2015-01-01
We have discovered a new and highly competitive product channel in the unimolecular decay process for small Criegee intermediates, CH 2 OO and anti/syn-CH 3 C(H)OO, occurring by intramolecular insertion reactions via a roaming-like transition state (TS) based on quantum-chemical calculations. Our results show that in the decomposition of CH 2 OO and anti-CH 3 C(H)OO, the predominant paths directly produce cis-HC(O)OH and syn-CH 3 C(O)OH acids with >110 kcal/mol exothermicities via loose roaming-like insertion TSs involving the terminal O atom and the neighboring C–H bonds. For syn-CH 3 C(H)OO, the major decomposition channel occurs by abstraction of a H atom from the CH 3 group by the terminal O atom producing CH 2 C(H)O–OH. At 298 K, the intramolecular insertion process in CH 2 OO was found to be 600 times faster than the commonly assumed ring-closing reaction
Doucette, Jaimee; Zhao, Ziyan; Geyer, Rory J; Barra, Melanie M; Balunas, Marcy J; Zweifach, Adam
2016-07-01
Genetically encoded sensors based on intramolecular FRET between CFP and YFP are used extensively in cell biology research. Flow cytometry has been shown to offer a means to measure CFP-YFP FRET; we suspected it would provide a unique way to conduct multiplexed measurements from cells expressing different FRET sensors, which is difficult to do with microscopy, and that this could be used for screening. We confirmed that flow cytometry accurately measures FRET signals using cells transiently transfected with an ERK activity reporter, comparing responses measured with imaging and cytometry. We created polyclonal long-term transfectant lines, each expressing a different intramolecular FRET sensor, and devised a way to bar-code four distinct populations of cells. We demonstrated the feasibility of multiplexed measurements and determined that robust multiplexed measurements can be conducted in plate format. To validate the suitability of the method for screening, we measured responses from a plate of bacterial extracts that in unrelated experiments we had determined contained the protein kinase C (PKC)-activating compound teleocidin A-1. The multiplexed assay correctly identifying the teleocidin A-1-containing well. We propose that multiplexed cytometric FRET measurements will be useful for analyzing cellular function and for screening compound collections. © 2016 Society for Laboratory Automation and Screening.
Cho, Daeheum; Ko, Kyoung Chul; Ikabata, Yasuhiro; Wakayama, Kazufumi; Yoshikawa, Takeshi; Nakai, Hiromi; Lee, Jin Yong
2015-01-01
The intramolecular magnetic coupling constant (J) of diradical systems linked with five- or six-membered aromatic rings was calculated to obtain the scaling factor (experimental J/calculated J ratio) for various density functional theory (DFT) functionals. Scaling factors of group A (PBE, TPSSh, B3LYP, B97-1, X3LYP, PBE0, and BH&HLYP) and B (M06-L, M06, M06-2X, and M06-HF) were shown to decrease as the amount of Hartree-Fock exact exchange (HFx) increases, in other words, overestimation of calculated J becomes more severe as the HFx increases. We further investigated the effect of HFx fraction of DFT functional on J value, spin contamination, and spin density distributions by comparing the B3LYP analogues containing different amount of HFx. It was revealed that spin contamination and spin densities at each atom increases as the HFx increases. Above all, newly developed BLYP-5 functional, which has 5% of HFx, was found to have the scaling factor of 1.029, indicating that calculated J values are very close to that of experimental values without scaling. BLYP-5 has potential to be utilized for accurate evaluation of intramolecular magnetic coupling constant (J) of diradicals linked by five- or six-membered aromatic ring couplers.
Energy Technology Data Exchange (ETDEWEB)
Cho, Daeheum; Ko, Kyoung Chul; Lee, Jin Yong, E-mail: jinylee@skku.edu [Department of Chemistry, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Ikabata, Yasuhiro; Wakayama, Kazufumi; Yoshikawa, Takeshi [Department of Chemistry and Biochemistry, School of Advanced Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); Nakai, Hiromi, E-mail: nakai@waseda.jp [Department of Chemistry and Biochemistry, School of Advanced Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); Research Institute for Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); CREST, Japan Science and Technology Agency, Tokyo 102-0075 (Japan); Elements Strategy Initiative for Catalysts and Batteries (ESICB), Kyoto University, Katsura, Kyoto 615-8520 (Japan)
2015-01-14
The intramolecular magnetic coupling constant (J) of diradical systems linked with five- or six-membered aromatic rings was calculated to obtain the scaling factor (experimental J/calculated J ratio) for various density functional theory (DFT) functionals. Scaling factors of group A (PBE, TPSSh, B3LYP, B97-1, X3LYP, PBE0, and BH and HLYP) and B (M06-L, M06, M06-2X, and M06-HF) were shown to decrease as the amount of Hartree-Fock exact exchange (HFx) increases, in other words, overestimation of calculated J becomes more severe as the HFx increases. We further investigated the effect of HFx fraction of DFT functional on J value, spin contamination, and spin density distributions by comparing the B3LYP analogues containing different amount of HFx. It was revealed that spin contamination and spin densities at each atom increases as the HFx increases. Above all, newly developed BLYP-5 functional, which has 5% of HFx, was found to have the scaling factor of 1.029, indicating that calculated J values are very close to that of experimental values without scaling. BLYP-5 has potential to be utilized for accurate evaluation of intramolecular magnetic coupling constant (J) of diradicals linked by five- or six-membered aromatic ring couplers.
Brandenburg, Jan Gerit; Alessio, Maristella; Civalleri, Bartolomeo; Peintinger, Michael F; Bredow, Thomas; Grimme, Stefan
2013-09-26
We extend the previously developed geometrical correction for the inter- and intramolecular basis set superposition error (gCP) to periodic density functional theory (DFT) calculations. We report gCP results compared to those from the standard Boys-Bernardi counterpoise correction scheme and large basis set calculations. The applicability of the method to molecular crystals as the main target is tested for the benchmark set X23. It consists of 23 noncovalently bound crystals as introduced by Johnson et al. (J. Chem. Phys. 2012, 137, 054103) and refined by Tkatchenko et al. (J. Chem. Phys. 2013, 139, 024705). In order to accurately describe long-range electron correlation effects, we use the standard atom-pairwise dispersion correction scheme DFT-D3. We show that a combination of DFT energies with small atom-centered basis sets, the D3 dispersion correction, and the gCP correction can accurately describe van der Waals and hydrogen-bonded crystals. Mean absolute deviations of the X23 sublimation energies can be reduced by more than 70% and 80% for the standard functionals PBE and B3LYP, respectively, to small residual mean absolute deviations of about 2 kcal/mol (corresponding to 13% of the average sublimation energy). As a further test, we compute the interlayer interaction of graphite for varying distances and obtain a good equilibrium distance and interaction energy of 6.75 Å and -43.0 meV/atom at the PBE-D3-gCP/SVP level. We fit the gCP scheme for a recently developed pob-TZVP solid-state basis set and obtain reasonable results for the X23 benchmark set and the potential energy curve for water adsorption on a nickel (110) surface.
Patil, Bhushan; Kobayashi, Yoshiki; Fujikawa, Shigenori; Okajima, Takeyoshi; Mao, Lanqun; Ohsaka, Takeo
2014-02-01
A direct electrochemistry and intramolecular electron transfer of multicopper oxidases are of a great importance for the fabrication of these enzyme-based bioelectrochemical-devices. Ascorbate oxidase from Acremonium sp. (ASOM) has been successfully immobilized via a chemisorptive interaction on the l-cysteine self-assembled monolayer modified gold electrode (cys-SAM/AuE). Thermodynamics and kinetics of adsorption of ASOM on the cys-SAM/AuE were studied using cyclic voltammetry. A well-defined redox wave centered at 166±3mV (vs. Ag│AgCl│KCl(sat.)) was observed in 5.0mM phosphate buffer solution (pH7.0) at the fabricated ASOM electrode, abbreviated as ASOM/cys-SAM/AuE, confirming a direct electrochemistry, i.e., a direct electron transfer (DET) between ASOM and cys-SAM/AuE. The direct electrochemistry of ASOM was further confirmed by taking into account the chemical oxidation of ascorbic acid (AA) by O2 via an intramolecular electron transfer in the ASOM as well as the electrocatalytic oxidation of AA at the ASOM/cys-SAM/AuE. Thermodynamics and kinetics of the adsorption of ASOM on the cys-SAM/AuE have been elaborated along with its direct electron transfer at the modified electrodes on the basis of its intramolecular electron transfer and electrocatalytic activity towards ascorbic acid oxidation and O2 reduction. ASOM saturated surface area was obtained as 2.41×10(-11)molcm(-2) with the apparent adsorption coefficient of 1.63×10(6)Lmol(-1). The ASOM confined on the cys-SAM/AuE possesses its essential enzymatic function. © 2013.
Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2014-05-30
Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Oyoshi Takanori
2012-01-01
Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.
Szady-Chełmieniecka, Anna; Kołodziej, Beata; Morawiak, Maja; Kamieński, Bohdan; Schilf, Wojciech
2018-01-01
The structural study of five Schiff bases derived from diaminomaleonitrile (DAMN) and 2-hydroxy carbonyl compounds was performed using 1H, 13C and 15N NMR methods in solution and in the solid state as well. ATR-FTIR and X-Ray spectroscopies were used for confirmation of the results obtained by NMR method. The imine obtained from DAMN and benzaldehyde was synthesized as a model compound which lacks intramolecular hydrogen bond. Deprotonation of all synthesized compounds was done by treating with tetramethylguanidine (TMG). NMR data revealed that salicylidene Schiff bases in DMSO solution exist as OH forms without intramolecular hydrogen bonds and independent on the substituents in aromatic ring. In the case of 2-hydroxy naphthyl derivative, the OH proton is engaged into weak intramolecular hydrogen bond. Two of imines (salDAMN and 5-BrsalDAMN) exist in DMSO solution as equilibrium mixtures of two isomers (A and B). The structures of equilibrium mixture in the solid state have been studied by NMR, ATR-FTIR and X-Ray methods. The deprotonation of three studied compounds (salDAMN, 5-BrsalDAMN, and 5-CH3salDAMN) proceeded in two different ways: deprotonation of oxygen atom (X form) or of nitrogen atom of free primary amine group of DAMN moiety (Y form). For 5-NO2salDAMN and naphDAMN only one form (X) was observed.
Huang, Li-Shar; Cobessi, David; Tung, Eric Y; Berry, Edward A
2005-08-19
Antimycin A (antimycin), one of the first known and most potent inhibitors of the mitochondrial respiratory chain, binds to the quinone reduction site of the cytochrome bc1 complex. Structure-activity relationship studies have shown that the N-formylamino-salicyl-amide group is responsible for most of the binding specificity, and suggested that a low pKa for the phenolic OH group and an intramolecular H-bond between that OH and the carbonyl O of the salicylamide linkage are important. Two previous X-ray structures of antimycin bound to vertebrate bc1 complex gave conflicting results. A new structure reported here of the bovine mitochondrial bc1 complex at 2.28 A resolution with antimycin bound, allows us for the first time to reliably describe the binding of antimycin and shows that the intramolecular hydrogen bond described in solution and in the small-molecule structure is replaced by one involving the NH rather than carbonyl O of the amide linkage, with rotation of the amide group relative to the aromatic ring. The phenolic OH and formylamino N form H-bonds with conserved Asp228 of cytochrome b, and the formylamino O H-bonds via a water molecule to Lys227. A strong density, the right size and shape for a diatomic molecule is found between the other side of the dilactone ring and the alphaA helix.
Energy Technology Data Exchange (ETDEWEB)
Huang, Li-shar; Cobessi, David; Tung, Eric Y.; Berry, Edward A.
2005-05-10
Antimycin A (antimycin), one of the first known and most potent inhibitors of the mitochondrial respiratory chain, binds to the quinone reduction site of the cytochrome bc1 complex.Structure-activity-relationship studies have shown that the N-formylamino-salicyl-amide group is responsible for most of the binding specificity, and suggested that a low pKa for the phenolic OH group and an intramolecular H-bond between that OH and the carbonyl O of the salicylamide linkage are important. Two previous X-ray structures of antimycin bound to vertebrate bc1 complex gave conflicting results. A new structure reported here of the bovine mitochondrial bc1 complex at 2.28Angstrom resolution with antimycin bound, allows us for the first time to reliably describe the binding of antimycin and shows that the intramolecular hydrogen bond described in solution and in the small-molecule structure is replaced by one involving the NH rather than carbonyl O of the amide linkage, with rotation of the amide group relative to the aromatic ring. The phenolic OH and formylamino N form H-bonds with conserved Asp228 of cyt b, and the formylamino O H-bonds via a water molecule to Lys227. A strong density the right size and shape for a diatomic molecule is found between the other side of the dilactone ring and the alpha-A helix.
Directory of Open Access Journals (Sweden)
Yin’e Hu
2015-01-01
Full Text Available To use food-specific IgG antibody detection to explore its application in the allergy dermatoses. 181 patients were included from January 2014 to September 2014. Fourteen food-specific IgG antibodies were detected by ELISA. The positive rates of IgG antibody of the patient group and the healthy group were significantly different. The positive rates of IgG antibody of egg, milk, shrimp and crab took a large proportion in three groups of patients with three kinds of allergy dermatoses of urticaria, eczema and allergic dermatitis, the proportion of which was respectively 70.2%, 77.8% and 71.7%. There was mild and moderate intolerance of food in the allergic dermatitis group while there was no distribution difference of food intolerance in urticaria group and eczema group. Among urticaria and allergic dermatitis patients with positive antibody, the positive rate of children was significantly higher than that of adults while there was no significant difference between children and adults among eczema patients with positive antibody. Allergy dermatoses are closely related to food-specific IgG antibody and the allergy dermatoses patients have a high incidence rate of food intolerance; detecting IgG antibody in patients is of great significance for the diagnosis and treatment of allergy dermatoses.
Duan, Abing; Yu, Peiyuan; Liu, Fang; Qiu, Huang; Gu, Feng Long; Doyle, Michael P; Houk, K N
2017-02-22
The first experimental examples of Diels-Alder (DA) reactions of diazo compounds as heterodienophiles with dienes have been studied with density functional theory (DFT) using the M06-2X functional. For comparison, the reactivities of diazo esters as dienophiles or 1,3-dipoles with 1,3-dienes in intermolecular model systems have been analyzed by the distortion/interaction model. The 1,3-dipolar cycloaddition is strongly favored for the intermolecular system. The intramolecular example is unique because the tether strongly favors the (4 + 2) cycloaddition.
Ganglioside-specific IgG and IgA recruit leukocyte effector functions in Guillain-Barre syndrome
Sorge, N.M. van; Yuki, N.; Koga, M.; Susuki, K.; Jansen, M.D.; Kooten, C. van; Wokke, J.H.; Winkel, J.G.J. van de; Pol, W.L. van der; Berg, L.H. van den
2007-01-01
The capacity of ganglioside-specific autoantibodies to recruit leukocyte effector functions was studied. Serum samples from 87 patients with Guillain–Barré (GBS) or Miller Fisher syndrome (MFS), containing GM1-, GQ1b-, or GD1b-specific IgG or IgA, were tested for leukocyte activating capacity.
Directory of Open Access Journals (Sweden)
Matteo eLambrughi
2012-11-01
Full Text Available Cyclin-dependent kinase inhibitors (CKIs are key regulatory proteins of the eukaryotic cell cycle, which modulate cyclin-dependent kinase (Cdk activity. CKIs perform their inhibitory effect by the formation of ternary complexes with a target kinase and its cognate cyclin. These regulators generally belong to the class of intrinsically disordered proteins (IDPs, which lack a well-defined and organized three-dimensional structure in their free state, undergoing folding upon binding to specific partners. Unbound IDPs are not merely random-coil structures, but can present intrinsically folded structural units (IFSUs and collapsed conformations. These structural features can be relevant to protein function in vivo.The yeast CKI Sic1 is a 284-amino acid IDP that binds to Cdk1 in complex with the Clb5,6 cyclins, preventing phosphorylation of G1 substrates and, therefore, entrance to the S phase. Sic1 degradation, triggered by multiple phosphorylation events, promotes cell-cycle progression. Previous experimental studies pointed out a propensity of Sic1 and its isolated domains to populate both extended and compact conformations. The present contribution provides models of the compact conformations of the Sic1 kinase-inhibitory domain (KID by all-atom molecular-dynamics simulations in explicit solvent and in the absence of interactors. The results are integrated by spectroscopic and spectrometric data. Helical IFSUs are identified, along with networks of intramolecular interactions. The results identify a group of hub residues and electrostatic interactions which are likely to be involved in the stabilization of globular states.
Spoerry, Christian; Hessle, Pontus; Lewis, Melanie J; Paton, Lois; Woof, Jenny M; von Pawel-Rammingen, Ulrich
2016-01-01
Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use.
Czech Academy of Sciences Publication Activity Database
Kumbhakar, D.; Sarkar, B.; Maji, S.; Mobin, S. M.; Fiedler, Jan; Urbanos, F. A.; Jimenez-Aparicio, R.; Kaim, W.; Lahiri, G. K.
2008-01-01
Roč. 130, č. 51 (2008), s. 17575-17583 ISSN 0002-7863 R&D Projects: GA MŠk OC 139; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : intramolecular valence * spin interaction * diruthenium complex Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.091, year: 2008
Specificity and Effector Functions of Human RSV-Specific IgG from Bovine Milk.
Directory of Open Access Journals (Sweden)
Gerco den Hartog
Full Text Available Respiratory syncytial virus (RSV infection is the second most important cause of death in the first year of life, and early RSV infections are associated with the development of asthma. Breastfeeding and serum IgG have been shown to protect against RSV infection. Yet, many infants depend on bovine milk-based nutrition, which at present lacks intact immunoglobulins.To investigate whether IgG purified from bovine milk (bIgG can modulate immune responses against human RSV.ELISAs were performed to analyse binding of bIgG to human respiratory pathogens. bIgG or hRSV was coated to plates to assess dose-dependent binding of bIgG to human Fcγ receptors (FcγR or bIgG-mediated binding of myeloid cells to hRSV respectively. S. Epidermidis and RSV were used to test bIgG-mediated binding and internalisation of pathogens by myeloid cells. Finally, the ability of bIgG to neutralise infection of HEp2 cells by hRSV was evaluated.bIgG recognised human RSV, influenza haemagglutinin and Haemophilus influenza. bIgG bound to FcγRII on neutrophils, monocytes and macrophages, but not to FcγRI and FcγRIII, and could bind simultaneously to hRSV and human FcγRII on neutrophils. In addition, human neutrophils and dendritic cells internalised pathogens that were opsonised with bIgG. Finally, bIgG could prevent infection of HEp2 cells by hRSV.The data presented here show that bIgG binds to hRSV and other human respiratory pathogens and induces effector functions through binding to human FcγRII on phagocytes. Thus bovine IgG may contribute to immune protection against RSV.