David eRoquis
2014-07-01
Full Text Available Schistosoma mansoni is a parasitic plathyhelminth responsible for intestinal schistosomiasis (or bilharziasis, a disease affecting 67 million people worldwide and causing an important economic burden. The schistosomicides hycanthone, and its later proxy oxamniquine, were widely used for treatments in endemic areas during the 20th century. Recently, the mechanism of action, as well as the genetic origin of a stably and Mendelian inherited resistance for both drugs was elucidated in two strains. However, several observations suggested early on that alternative mechanisms might exist, by which resistance could be induced for these two drugs in sensitive lines of schistosomes. This induced resistance appeared rapidly, within the first generation, but was metastable (not stably inherited. Epigenetic inheritance could explain such a phenomenon and we therefore re-analyzed the historical data with our current knowledge of epigenetics. In addition, we performed new experiments such as ChIP-seq on hycanthone treated worms. We found distinct chromatin structure changes between sensitive worms and induced resistant worms from the same strain. No specific pathway was discovered, but genes in which chromatin structure modification were observed are mostly associated with transport and catabolism, which makes sense in the context of the elimination of the drug. Specific differences were observed in the repetitive compartment of the genome. We finally describe what types of experiments are needed to understand the complexity of heritability that can be based on genetic and/or epigenetic mechanisms for drug resistance in schistosomes.
Silvia Dal Santo
Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the
Keyhaninejad, Neda; Curry, Jeanne; Romero, Joslynn; O'Connell, Mary A
2014-02-01
Accumulation of capsaicinoids in the placental tissue of ripening chile (Capsicum spp.) fruit follows the coordinated expression of multiple biosynthetic enzymes producing the substrates for capsaicin synthase. Transcription factors are likely agents to regulate expression of these biosynthetic genes. Placental RNAs from habanero fruit (Capsicum chinense) were screened for expression of candidate transcription factors; with two candidate genes identified, both in the ERF family of transcription factors. Characterization of these transcription factors, Erf and Jerf, in nine chile cultivars with distinct capsaicinoid contents demonstrated a correlation of expression with pungency. Amino acid variants were observed in both ERF and JERF from different chile cultivars; none of these changes involved the DNA binding domains. Little to no transcription of Erf was detected in non-pungent Capsium annuum or C. chinense mutants. This correlation was characterized at an individual fruit level in a set of jalapeño (C. annuum) lines again with distinct and variable capsaicinoid contents. Both Erf and Jerf are expressed early in fruit development, 16-20 days post-anthesis, at times prior to the accumulation of capsaicinoids in the placental tissues. These data support the hypothesis that these two members of the complex ERF family participate in regulation of the pungency phenotype in chile. Copyright © 2013. Published by Elsevier Ireland Ltd.
Raymond A Clarke
Full Text Available The prostate cancer antigen 3 (PCA3/DD3 gene is a highly specific biomarker upregulated in prostate cancer (PCa. In order to understand the importance of PCA3 in PCa we investigated the organization and evolution of the PCA3 gene locus.We have employed cDNA synthesis, RTPCR and DNA sequencing to identify 4 new transcription start sites, 4 polyadenylation sites and 2 new differentially spliced exons in an extended form of PCA3. Primers designed from these novel PCA3 exons greatly improve RT-PCR based discrimination between PCa, PCa metastases and BPH specimens. Comparative genomic analyses demonstrated that PCA3 has only recently evolved in an anti-sense orientation within a second gene, BMCC1/PRUNE2. BMCC1 has been shown previously to interact with RhoA and RhoC, determinants of cellular transformation and metastasis, respectively. Using RT-PCR we demonstrated that the longer BMCC1-1 isoform - like PCA3 - is upregulated in PCa tissues and metastases and in PCa cell lines. Furthermore PCA3 and BMCC1-1 levels are responsive to dihydrotestosterone treatment.Upregulation of two new PCA3 isoforms in PCa tissues improves discrimination between PCa and BPH. The functional relevance of this specificity is now of particular interest given PCA3's overlapping association with a second gene BMCC1, a regulator of Rho signalling. Upregulation of PCA3 and BMCC1 in PCa has potential for improved diagnosis.
Sizova, Olga V; Shashkov, Alexander S; Kondakova, Anna N; Knirel, Yuriy A; Shaikhutdinova, Rima Z; Ivanov, Sergei A; Kislichkina, Angelina A; Kadnikova, Lidia A; Bogun, Aleksandr G; Dentovskaya, Svetlana V
2018-05-02
Lipopolysaccharide was isolated from bacteria Yersinia intermedia H9-36/83 (O:17) and degraded with mild acid to give an O-specific polysaccharide, which was isolated by GPC on Sephadex G-50 and studied by sugar analysis and 1D and 2D NMR spectroscopy. The polysaccharide was found to contain 3-deoxy-3-[(R)-3-hydroxybutanoylamino]-d-fucose (d-Fuc3NR3Hb) and the following structure of the heptasaccharide repeating unit was established: The structure established is consistent with the gene content of the O-antigen gene cluster. The O-polysaccharide structure and gene cluster of Y. intermedia are related to those of Hafnia alvei 1211 and Escherichia coli O:103. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
L.J. Niedernhofer (Laura); J. Essers (Jeroen); G. Weeda (Geert); H.B. Beverloo (Berna); J. de Wit (Jan); M. Muijtjens (Manja); H. Odijk (Hanny); J.H.J. Hoeijmakers (Jan); R. Kanaar (Roland)
2001-01-01
textabstractThe Ercc1-Xpf heterodimer, a highly conserved structure-specific endonuclease, functions in multiple DNA repair pathways that are pivotal for maintaining genome stability, including nucleotide excision repair, interstrand crosslink repair and homologous recombination. Erccl-Xpf incises
Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas
2016-05-01
Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng
2016-05-01
Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.
Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library
Eddy Edward M
2007-07-01
Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Hepatocyte specific expression of human cloned genes
Cortese, R
1986-01-01
A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.
Salton, S R; Fischberg, D J; Dong, K W
1991-05-01
Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.
Specific gene mutations induced by heavy ions
Freeling, M.; Karoly, C.W.; Cheng, D.S.K.
1980-01-01
This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens
Iwata, Yuji; Nishino, Tsuneyo; Iwano, Megumi; Takayama, Seiji; Koizumi, Nozomu
2012-01-01
Accumulation of unfolded proteins in the endoplasmic reticulum (ER) of eukaryotic cells triggers the transcriptional activation of ER-resident molecular chaperones and folding enzymes to maintain cellular homeostasis. This process is known as the ER stress response or the unfolded protein response. We have identified tunicamycin induced 1 (TIN1), a plant-specific ER stress-inducible Arabidopsis thaliana gene. The TIN1 protein is localized in the ER; however, its molecular function has yet to be clarified. In this study, we performed functional analysis of TIN1 in planta. RT-PCR analysis showed that TIN1 is highly expressed in pollen. Analysis using the β-glucuronidase reporter gene demonstrated that the TIN1 promoter is active throughout pollen development, peaking at the time of flowering and in an ovule of an open flower. Although a T-DNA insertion mutant of TIN1 grows normally under ambient laboratory conditions, abnormal pollen surface morphology was observed under a scanning electron microscope. Based on the current and previous observations, a possible physiological function of TIN1 during pollen development is discussed. © 2012 The Japanese Society for Plant Cell and Molecular Biology.
Oh, Dongha
2010-09-10
The genome of Thellungiella parvula, a halophytic relative of Arabidopsis (Arabidopsis thaliana), is being assembled using Roche-454 sequencing. Analyses of a 10-Mb scaffold revealed synteny with Arabidopsis, with recombination and inversion and an uneven distribution of repeat sequences. T. parvula genome structure and DNA sequences were compared with orthologous regions from Arabidopsis and publicly available bacterial artificial chromosome sequences from Thellungiella salsuginea (previously Thellungiella halophila). The three-way comparison of sequences, from one abiotic stress-sensitive species and two tolerant species, revealed extensive sequence conservation and microcolinearity, but grouping Thellungiella species separately from Arabidopsis. However, the T. parvula segments are distinguished from their T. salsuginea counterparts by a pronounced paucity of repeat sequences, resulting in a 30% shorter DNA segment with essentially the same gene content in T. parvula. Among the genes is SALT OVERLY SENSITIVE1 (SOS1), a sodium/proton antiporter, which represents an essential component of plant salinity stress tolerance. Although the SOS1 coding region is highly conserved among all three species, the promoter regions show conservation only between the two Thellungiella species. Comparative transcript analyses revealed higher levels of basal as well as salt-induced SOS1 expression in both Thellungiella species as compared with Arabidopsis. The Thellungiella species and other halophytes share conserved pyrimidine-rich 5\\' untranslated region proximal regions of SOS1 that are missing in Arabidopsis. Completion of the genome structure of T. parvula is expected to highlight distinctive genetic elements underlying the extremophile lifestyle of this species. © American Society of Plant Biologists.
Cordts, S.; Bantin, J.; Wittich, P.; Kranz, E.; Lorz, H.; Dresselhaus, T.
2001-01-01
All four members of a gene family, which are highly expressed in the cells of the female gametophyte (ZmES1--4: Zea mays embryo sac), were isolated from a cDNA library of maize egg cells. High expression of ZmES genes in the synergids around the micropylar region was detected in thin sections of
A gene regulatory network armature for T-lymphocyte specification
Fung, Elizabeth-sharon [Los Alamos National Laboratory
2008-01-01
Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.
MADS-box gene evolution - structure and transcription patterns
Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin
2002-01-01
Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...
Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana
2011-01-01
Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species
Characterization of a novel autophagy-specific gene, ATG29
Kawamata, Tomoko; Kamada, Yoshiaki; Suzuki, Kuninori; Kuboshima, Norihiro; Akimatsu, Hiroshi; Ota, Shinichi; Ohsumi, Mariko; Ohsumi, Yoshinori
2005-01-01
Autophagy is a process whereby cytoplasmic proteins and organelles are sequestered for bulk degradation in the vacuole/lysosome. At present, 16 ATG genes have been found that are essential for autophagosome formation in the yeast Saccharomyces cerevisiae. Most of these genes are also involved in the cytoplasm to vacuole transport pathway, which shares machinery with autophagy. Most Atg proteins are colocalized at the pre-autophagosomal structure (PAS), from which the autophagosome is thought to originate, but the precise mechanism of autophagy remains poorly understood. During a genetic screen aimed to obtain novel gene(s) required for autophagy, we identified a novel ORF, ATG29/YPL166w. atg29Δ cells were sensitive to starvation and induction of autophagy was severely retarded. However, the Cvt pathway operated normally. Therefore, ATG29 is an ATG gene specifically required for autophagy. Additionally, an Atg29-GFP fusion protein was observed to localize to the PAS. From these results, we propose that Atg29 functions in autophagosome formation at the PAS in collaboration with other Atg proteins
Oh, Dongha; Dassanayake, Maheshi; Haas, Jeffrey S.; Kropornika, Anna; Wright, Chris L.; D'Urzo, Matilde Paino; Hong, Hyewon; Ali, Shahjahan; Herná ndez, Á lvaro Gonzalez; Lambert, Georgina M.; Inan, Gü nsu; Galbraith, David; Bressan, Ray Anthony; Yun, Daejin; Zhu, Jian-Kang; Cheeseman, John McP; Bohnert, Hans Jü rgen
2010-01-01
and an uneven distribution of repeat sequences. T. parvula genome structure and DNA sequences were compared with orthologous regions from Arabidopsis and publicly available bacterial artificial chromosome sequences from Thellungiella salsuginea (previously
Bryson, Steve; Thomson, Christy A; Risnes, Louise F; Dasgupta, Somnath; Smith, Kenneth; Schrader, John W; Pai, Emil F
2016-06-01
The human Ab response to certain pathogens is oligoclonal, with preferred IgV genes being used more frequently than others. A pair of such preferred genes, IGVK3-11 and IGVH3-30, contributes to the generation of protective Abs directed against the 23F serotype of the pneumonococcal capsular polysaccharide of Streptococcus pneumoniae and against the AD-2S1 peptide of the gB membrane protein of human CMV. Structural analyses of Fab fragments of mAbs 023.102 and pn132p2C05 in complex with portions of the 23F polysaccharide revealed five germline-encoded residues in contact with the key component, l-rhamnose. In the case of the AD-2S1 peptide, the KE5 Fab fragment complex identified nine germline-encoded contact residues. Two of these germline-encoded residues, Arg91L and Trp94L, contact both the l-rhamnose and the AD-2S1 peptide. Comparison of the respective paratopes that bind to carbohydrate and protein reveals that stochastic diversity in both CDR3 loops alone almost exclusively accounts for their divergent specificity. Combined evolutionary pressure by human CMV and the 23F serotype of S. pneumoniae acted on the IGVK3-11 and IGVH3-30 genes as demonstrated by the multiple germline-encoded amino acids that contact both l-rhamnose and AD-2S1 peptide. Copyright © 2016 by The American Association of Immunologists, Inc.
[Production, specificity and structure of immunoglobulins].
Goujard, C; Delfraissy, J F
1991-03-21
Immunoglobulin is a key factor of the immune response resulting from B-cell activation and associated with T-cell stimulation. Because of its structure, this antibody has a dual function: it specifically recognizes the inducer antigen in the variable region and eliminates it by a constant portion which is responsible for effector properties. Surface immunoglobulin, therefore, is the B-cell antigen receptor; it differs from the T-cell receptor in that it recognizes the antigen unbound to the major istocompatibility complex; binding the antigen results in direct signal transduction first in the cytoplasm, then in the nucleus. This receptor can be secreted in the body: it is made up of circulating immunoglobulins. Human immunoglobulins are divided into 5 classes, each of them with its own response kinetics, distribution and functions. The variability of the antibody response accounts for a genetic organization involving numerous genes which may be associated with each other, or mutate, or recombine during maturation of the lymphocytes. Altogether, this system has a theoretical capacity of response to three hundred million different antigens.
Dissecting specific and global transcriptional regulation of bacterial gene expression
Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe
Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an
Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.
Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro
2018-05-03
Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.
Gene specific actions of thyroid hormone receptor subtypes.
Jean Z Lin
Full Text Available There are two homologous thyroid hormone (TH receptors (TRs α and β, which are members of the nuclear hormone receptor (NR family. While TRs regulate different processes in vivo and other highly related NRs regulate distinct gene sets, initial studies of TR action revealed near complete overlaps in their actions at the level of individual genes. Here, we assessed the extent that TRα and TRβ differ in target gene regulation by comparing effects of equal levels of stably expressed exogenous TRs +/- T(3 in two cell backgrounds (HepG2 and HeLa. We find that hundreds of genes respond to T(3 or to unliganded TRs in both cell types, but were not able to detect verifiable examples of completely TR subtype-specific gene regulation. TR actions are, however, far from identical and we detect TR subtype-specific effects on global T(3 response kinetics in HepG2 cells and many examples of TR subtype specificity at the level of individual genes, including effects on magnitude of response to TR +/- T(3, TR regulation patterns and T(3 dose response. Cycloheximide (CHX treatment confirms that at least some differential effects involve verifiable direct TR target genes. TR subtype/gene-specific effects emerge in the context of widespread variation in target gene response and we suggest that gene-selective effects on mechanism of TR action highlight differences in TR subtype function that emerge in the environment of specific genes. We propose that differential TR actions could influence physiologic and pharmacologic responses to THs and selective TR modulators (STRMs.
Description of electrophoretic loci and tissue specific gene ...
Protein electrophoresis was used to study the distributions and tissue specificity of gene expression of enzymes encoded by 42 loci in Rhinolophus clivosus and R. landeri, the genetically most divergent of the ten species of southern African horseshoe bats. No differences in gene expression were found between R.
Gene program-specific regulation of PGC-1{alpha} activity
Schmidt, Søren F; Mandrup, Susanne
2011-01-01
Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...
Identification of the two rotavirus genes determining neutralization specificities
Offit, P.A.; Blavat, G.
1986-01-01
Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities
Identification of the two rotavirus genes determining neutralization specificities
Offit, P.A.; Blavat, G.
1986-01-01
Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.
Structural similarity and category-specificity
Gerlach, Christian; Law, Ian; Paulson, Olaf B
2004-01-01
It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...
Specificity of Structural Assessment of Knowledge
Trumpower, David L.; Sharara, Harold; Goldsmith, Timothy E.
2010-01-01
This study examines the specificity of information provided by structural assessment of knowledge (SAK). SAK is a technique which uses the Pathfinder scaling algorithm to transform ratings of concept relatedness into network representations (PFnets) of individuals' knowledge. Inferences about individuals' overall domain knowledge based on the…
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Conservation and sex-specific splicing of the doublesex gene
Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the ...
Gene Composer in a structural genomics environment
Lorimer, Don; Raymond, Amy; Mixon, Mark; Burgin, Alex; Staker, Bart; Stewart, Lance
2011-01-01
For structural biology applications, protein-construct engineering is guided by comparative sequence analysis and structural information, which allow the researcher to better define domain boundaries for terminal deletions and nonconserved regions for surface mutants. A database software application called Gene Composer has been developed to facilitate construct design. The structural genomics effort at the Seattle Structural Genomics Center for Infectious Disease (SSGCID) requires the manipulation of large numbers of amino-acid sequences and the underlying DNA sequences which are to be cloned into expression vectors. To improve efficiency in high-throughput protein structure determination, a database software package, Gene Composer, has been developed which facilitates the information-rich design of protein constructs and their underlying gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bioinformatics steps used in modern structure-guided protein engineering and synthetic gene engineering. An example of the structure determination of H1N1 RNA-dependent RNA polymerase PB2 subunit is given
Discovery of cancer common and specific driver gene sets
2017-01-01
Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295
Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.
Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis
2017-06-08
A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.
Injury, inflammation and the emergence of human specific genes
2016-07-12
genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate
Heritable and lineage-specific gene knockdown in zebrafish embryo.
Mei Dong
Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.
Study on Fusion Protein and Its gene in Baculovirus Specificity
Nemr, W.A.H.
2012-01-01
Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at
Weijers Rob NM
2010-06-01
Full Text Available Abstract Background We examined the effects of the R325W mutation on the three-dimensional (3D structure of the β-cell-specific Zn2+ (zinc transporter ZnT-8. Methods A model of the C-terminal domain of the human ZnT-8 protein was generated by homology modeling based on the known crystal structure of the Escherichia coli (E. coli zinc transporter YiiP at 3.8 Å resolution. Results The homodimer ZnT-8 protein structure exists as a Y-shaped architecture with Arg325 located at the ultimate bottom of this motif at approximately 13.5 Å from the transmembrane domain juncture. The C-terminal domain sequences of the human ZnT-8 protein and the E. coli zinc transporter YiiP share 12.3% identical and 39.5% homologous residues resulting in an overall homology of 51.8%. Validation statistics of the homology model showed a reasonable quality of the model. The C-terminal domain exhibited an αββαβ fold with Arg325 as the penultimate N-terminal residue of the α2-helix. The side chains of both Arg325 and Trp325 point away from the interface with the other monomer, whereas the ε-NH3+ group of Arg325 is predicted to form an ionic interaction with the β-COO- group of Asp326 as well as Asp295. An amino acid alignment of the β2-α2 C-terminal loop domain revealed a variety of neutral amino acids at position 325 of different ZnT-8 proteins. Conclusions Our validated homology models predict that both Arg325 and Trp325, amino acids with a helix-forming behavior, and penultimate N-terminal residues in the α2-helix of the C-terminal domain, are shielded by the planar surface of the three cytoplasmic β-strands and hence unable to affect the sensing capacity of the C-terminal domain. Moreover, the amino acid residue at position 325 is too far removed from the docking and transporter parts of ZnT-8 to affect their local protein conformations. These data indicate that the inherited R325W abnormality in SLC30A8 may be tolerated and results in adequate zinc transfer
Proudhon, D; Wei, J; Briat, J; Theil, E C
1996-03-01
Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may
Curiel, David T; Siegal, Gene; Wang, Minghui
2007-01-01
...) to achieve efficient and selective gene transfer to target tumor cells. Proposed herein is a strategy to modify one candidate vector, recombinant adenovirus, such that it embodies the requisite properties of efficacy and specificity...
Structure and expression of thyroglobulin gene
Vassart, G; Brocas, H; Christophe, D; de Martynoff, G; Leriche, A; Mercken, L; Pohl, V; van Heuverswyn, B [Institut de Recherche Interdisciplinaire en Biologie Humaine et Nucleaire (IRIBHN), Faculte de Medecine, Universite libre de Bruxelles, Campus Hopital Erasme, Brussels (Belgium)
1982-01-01
Thyroglobulin is composed of two 300000 dalton polypeptide chains, translated from an 8000 base mRNA. Preparation of a full length cDNA and its cloning in E. coli have lead to the demonstration that the polypeptides of thyroglobulin protomers were identical. Used as molecular probes, the cloned cDNA allowed the isolation of a fragment of thyroglobulin gene. Electron microscopic studies have demonstrated that this gene contains more than 90 % intronic material separating small size exons (<200 bp). Sequencing of bovine thyroglobulin structural gene is in progress. Preliminary results show evidence for the existence of repetitive segments. Availability of cloned DNA complementary to bovine and human thyroglobulin mRNA allows the study of genetic defects of thyroglobulin gene expression in the human and in various animal models.
Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs.
Chen Xie
2012-09-01
Full Text Available Tinkering with pre-existing genes has long been known as a major way to create new genes. Recently, however, motherless protein-coding genes have been found to have emerged de novo from ancestral non-coding DNAs. How these genes originated is not well addressed to date. Here we identified 24 hominoid-specific de novo protein-coding genes with precise origination timing in vertebrate phylogeny. Strand-specific RNA-Seq analyses were performed in five rhesus macaque tissues (liver, prefrontal cortex, skeletal muscle, adipose, and testis, which were then integrated with public transcriptome data from human, chimpanzee, and rhesus macaque. On the basis of comparing the RNA expression profiles in the three species, we found that most of the hominoid-specific de novo protein-coding genes encoded polyadenylated non-coding RNAs in rhesus macaque or chimpanzee with a similar transcript structure and correlated tissue expression profile. According to the rule of parsimony, the majority of these hominoid-specific de novo protein-coding genes appear to have acquired a regulated transcript structure and expression profile before acquiring coding potential. Interestingly, although the expression profile was largely correlated, the coding genes in human often showed higher transcriptional abundance than their non-coding counterparts in rhesus macaque. The major findings we report in this manuscript are robust and insensitive to the parameters used in the identification and analysis of de novo genes. Our results suggest that at least a portion of long non-coding RNAs, especially those with active and regulated transcription, may serve as a birth pool for protein-coding genes, which are then further optimized at the transcriptional level.
Freedom of expression: cell-type-specific gene profiling.
Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H
2014-01-01
Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.
Repressor-mediated tissue-specific gene expression in plants
Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA
2009-02-17
Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.
Variations in CCL3L gene cluster sequence and non-specific gene copy numbers
Edberg Jeffrey C
2010-03-01
Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.
Sousa, C; Johansson, C; Charon, C; Manyani, H; Sautter, C; Kondorosi, A; Crespi, M
2001-01-01
A diversity of mRNAs containing only short open reading frames (sORF-RNAs; encoding less than 30 amino acids) have been shown to be induced in growth and differentiation processes. The early nodulin gene enod40, coding for a 0.7-kb sORF-RNA, is expressed in the nodule primordium developing in the root cortex of leguminous plants after infection by symbiotic bacteria. Ballistic microtargeting of this gene into Medicago roots induced division of cortical cells. Translation of two sORFs (I and II, 13 and 27 amino acids, respectively) present in the conserved 5' and 3' regions of enod40 was required for this biological activity. These sORFs may be translated in roots via a reinitiation mechanism. In vitro translation products starting from the ATG of sORF I were detectable by mutating enod40 to yield peptides larger than 38 amino acids. Deletion of a Medicago truncatula enod40 region between the sORFs, spanning a predicted RNA structure, did not affect their translation but resulted in significantly decreased biological activity. Our data reveal a complex regulation of enod40 action, pointing to a role of sORF-encoded peptides and structured RNA signals in developmental processes involving sORF-RNAs.
Specific "scientific" data structures, and their processing
Jerzy Karczmarczuk
2011-09-01
Full Text Available Programming physicists use, as all programmers, arrays, lists, tuples, records, etc., and this requires some change in their thought patterns while converting their formulae into some code, since the "data structures" operated upon, while elaborating some theory and its consequences, are rather: power series and Padé approximants, differential forms and other instances of differential algebras, functionals (for the variational calculus, trajectories (solutions of differential equations, Young diagrams and Feynman graphs, etc. Such data is often used in a [semi-]numerical setting, not necessarily "symbolic", appropriate for the computer algebra packages. Modules adapted to such data may be "just libraries", but often they become specific, embedded sub-languages, typically mapped into object-oriented frameworks, with overloaded mathematical operations. Here we present a functional approach to this philosophy. We show how the usage of Haskell datatypes and - fundamental for our tutorial - the application of lazy evaluation makes it possible to operate upon such data (in particular: the "infinite" sequences in a natural and comfortable manner.
Specific Gene Loci of Clinical Pseudomonas putida Isolates.
Lázaro Molina
Full Text Available Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host's immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria.
Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.
Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K
1989-10-01
Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)
The Mycoplasma hominis vaa gene displays a mosaic gene structure
Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.
1998-01-01
Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular...
Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)
2007-07-01
As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.
Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.
Quan Li
Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Exploring the potential relevance of human-specific genes to complex disease
Cooper David N
2011-01-01
Full Text Available Abstract Although human disease genes generally tend to be evolutionarily more ancient than non-disease genes, complex disease genes appear to be represented more frequently than Mendelian disease genes among genes of more recent evolutionary origin. It is therefore proposed that the analysis of human-specific genes might provide new insights into the genetics of complex disease. Cross-comparison with the Human Gene Mutation Database (http://www.hgmd.org revealed a number of examples of disease-causing and disease-associated mutations in putatively human-specific genes. A sizeable proportion of these were missense polymorphisms associated with complex disease. Since both human-specific genes and genes associated with complex disease have often experienced particularly rapid rates of evolutionary change, either due to weaker purifying selection or positive selection, it is proposed that a significant number of human-specific genes may play a role in complex disease.
Gene structure, phylogeny and expression profile of the sucrose ...
Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.
General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD
Chen Xiaoheng
2017-01-01
Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.
Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile
2011-07-01
Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the
Philippe Ganot
2011-07-01
Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both
Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.
Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M
1989-01-01
Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...
Structuring Formal Requirements Specifications for Reuse and Product Families
Heimdahl, Mats P. E.
2001-01-01
In this project we have investigated how formal specifications should be structured to allow for requirements reuse, product family engineering, and ease of requirements change, The contributions of this work include (1) a requirements specification methodology specifically targeted for critical avionics applications, (2) guidelines for how to structure state-based specifications to facilitate ease of change and reuse, and (3) examples from the avionics domain demonstrating the proposed approach.
Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng
2005-01-01
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases
Jin-Sung Hong
2013-09-01
Full Text Available Polygalacturonase (PG gene is a typical gene family present in eukaryotes. Forty-nine PGs were mined from the genomes of Neurospora crassa and five Aspergillus species. The PGs were classified into 3 clades such as clade 1 for rhamno-PGs, clade 2 for exo-PGs and clade 3 for exo- and endo-PGs, which were further grouped into 13 sub-clades based on the polypeptide sequence similarity. In gene structure analysis, a total of 124 introns were present in 44 genes and five genes lacked introns to give an average of 2.5 introns per gene. Intron phase distribution was 64.5% for phase 0, 21.8% for phase 1, and 13.7% for phase 2, respectively. The introns varied in their sequences and their lengths ranged from 20 bp to 424 bp with an average of 65.9 bp, which is approximately half the size of introns in other fungal genes. There were 29 homologous intron blocks and 26 of those were sub-clade specific. Intron losses were counted in 18 introns in which no obvious phase preference for intron loss was observed. Eighteen introns were placed at novel positions, which is considerably higher than those of plant PGs. In an evolutionary sense both intron loss and gain must have taken place for shaping the current PGs in these fungi. Together with the small intron size, low conservation of homologous intron blocks and higher number of novel introns, PGs of fungal species seem to have recently undergone highly dynamic evolution.
Kidney-specific Sonoporation-mediated Gene Transfer.
Ishida, Ryo; Kami, Daisuke; Kusaba, Tetsuro; Kirita, Yuhei; Kishida, Tsunao; Mazda, Osam; Adachi, Takaomi; Gojo, Satoshi
2016-02-01
Sonoporation can deliver agents to target local organs by systemic administration, while decreasing the associated risk of adverse effects. Sonoporation has been used for a variety of materials and in a variety of organs. Herein, we demonstrated that local sonoporation to the kidney can offer highly efficient transfer of oligonucleotides, which were systemically administrated to the tubular epithelium with high specificity. Ultrasonic wave irradiation to the kidney collapsed the microbubbles and transiently affected the glomerular filtration barrier and increased glomerular permeability. Oligonucleotides were passed through the barrier all at once and were absorbed throughout the tubular epithelium. Tumor necrosis factor alpha (TNFα), which plays a central role in renal ischemia-reperfusion injury, was targeted using small interfering RNA (siRNA) with renal sonoporation in a murine model. The reduction of TNFα expression after single gene transfer significantly inhibited the expression of kidney injury markers, suggesting that systemic administration of siRNA under temporary and local sonoporation could be applicable in the clinical setting of ischemic acute kidney injury.
Benjamin Mayne
2016-10-01
Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.
Larsen, P.F.; Eg Nielsen, Einar; Hansen, M.M.
2013-01-01
Recent genetic analyses of candidate genes and gene expression in marine fishes have provided evidence of local adaptation in response to environmental differences, despite the lack of strong signals of population structure from conventional neutral genetic markers. In this study expression...... in flounder. In gill tissue a plastic response to salinity treatments was observed with general up-regulation of these genes concomitant with higher salinity. For liver tissue a population specific expression differences was observed with lower expression at simulated non-native compared to native salinities...... in high gene flow marine fishes. © 2013 The Genetics Society of Korea...
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Genome-scale analysis of positional clustering of mouse testis-specific genes
Lee Bernett TK
2005-01-01
Full Text Available Abstract Background Genes are not randomly distributed on a chromosome as they were thought even after removal of tandem repeats. The positional clustering of co-expressed genes is known in prokaryotes and recently reported in several eukaryotic organisms such as Caenorhabditis elegans, Drosophila melanogaster, and Homo sapiens. In order to further investigate the mode of tissue-specific gene clustering in higher eukaryotes, we have performed a genome-scale analysis of positional clustering of the mouse testis-specific genes. Results Our computational analysis shows that a large proportion of testis-specific genes are clustered in groups of 2 to 5 genes in the mouse genome. The number of clusters is much higher than expected by chance even after removal of tandem repeats. Conclusion Our result suggests that testis-specific genes tend to cluster on the mouse chromosomes. This provides another piece of evidence for the hypothesis that clusters of tissue-specific genes do exist.
2013-01-01
Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the
Crystal Structure and Substrate Specificity of PTPN12
Hui Li
2016-05-01
Full Text Available PTPN12 is an important tumor suppressor that plays critical roles in various physiological processes. However, the molecular basis underlying the substrate specificity of PTPN12 remains uncertain. Here, enzymological and crystallographic studies have enabled us to identify two distinct structural features that are crucial determinants of PTPN12 substrate specificity: the pY+1 site binding pocket and specific basic charged residues along its surface loops. Key structurally plastic regions and specific residues in PTPN12 enabled recognition of different HER2 phosphorylation sites and regulated specific PTPN12 functions. In addition, the structure of PTPN12 revealed a CDK2 phosphorylation site in a specific PTPN12 loop. Taken together, our results not only provide the working mechanisms of PTPN12 for desphosphorylation of its substrates but will also help in designing specific inhibitors of PTPN12.
M Ghasemi
2017-05-01
Full Text Available Introduction: Salmonellosis is an infection caused by eating contaminated food with Salmonella, and it can occur in humans and other animals. Salmonella has acquired the ability to create the infection due to the presence of several virulence genes. One of the virulence genes of salmonella is sipC gene that coding the SipC protein. The aim of this study was creating the gene cassette to genetically engineered Salmonella enteritidis in the specific region of the sipC gene. Methods: In this study, after DNA extraction from Salmonella, the upstream and downstream regions of the sipC gene was amplified based on PCR method. The PCR products were cloned with T/A cloning method and they were inserted into the pGEM vector. In order to generate the final gene cassette, each of the upstream and downstream regions of the sipC gene was subcloned into the pET32 vector, and cloning accuracy was assessed by PCR and enzyme digestion methods. Results: Amplification of the 320 bp upstream and 206 bp downstream of sipC gene was successful by PCR method. T/A cloning of these fragments were caused the formation of two pGEM-up and pGEM-down recombinant vectors. Results that were confirmed the sub-cloning accuracy indicate the formation of the final pET32-up-down gene cassette. Conclusion: The generated gene cassette in this study was considered as a multi-purpose cassette that is able to specific gene manipulation of Salmonella sipC gene by homologous recombination matched. This gene cassette has the necessary potential for sipC gene deletion or insertion of any useful gene instead of sipC gene.
Zhou, Xionghui; Liu, Juan
2014-01-01
Although many methods have been proposed to reconstruct gene regulatory network, most of them, when applied in the sample-based data, can not reveal the gene regulatory relations underlying the phenotypic change (e.g. normal versus cancer). In this paper, we adopt phenotype as a variable when constructing the gene regulatory network, while former researches either neglected it or only used it to select the differentially expressed genes as the inputs to construct the gene regulatory network. To be specific, we integrate phenotype information with gene expression data to identify the gene dependency pairs by using the method of conditional mutual information. A gene dependency pair (A,B) means that the influence of gene A on the phenotype depends on gene B. All identified gene dependency pairs constitute a directed network underlying the phenotype, namely gene dependency network. By this way, we have constructed gene dependency network of breast cancer from gene expression data along with two different phenotype states (metastasis and non-metastasis). Moreover, we have found the network scale free, indicating that its hub genes with high out-degrees may play critical roles in the network. After functional investigation, these hub genes are found to be biologically significant and specially related to breast cancer, which suggests that our gene dependency network is meaningful. The validity has also been justified by literature investigation. From the network, we have selected 43 discriminative hubs as signature to build the classification model for distinguishing the distant metastasis risks of breast cancer patients, and the result outperforms those classification models with published signatures. In conclusion, we have proposed a promising way to construct the gene regulatory network by using sample-based data, which has been shown to be effective and accurate in uncovering the hidden mechanism of the biological process and identifying the gene signature for
DNMT1-interacting RNAs block gene specific DNA methylation
Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.
2013-01-01
Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992
Symbiont modulates expression of specific gene categories in Angomonas deanei
Luciana Loureiro Penha
Full Text Available Trypanosomatids are parasites that cause disease in humans, animals, and plants. Most are non-pathogenic and some harbor a symbiotic bacterium. Endosymbiosis is part of the evolutionary process of vital cell functions such as respiration and photosynthesis. Angomonas deanei is an example of a symbiont-containing trypanosomatid. In this paper, we sought to investigate how symbionts influence host cells by characterising and comparing the transcriptomes of the symbiont-containing A. deanei (wild type and the symbiont-free aposymbiotic strains. The comparison revealed that the presence of the symbiont modulates several differentially expressed genes. Empirical analysis of differential gene expression showed that 216 of the 7625 modulated genes were significantly changed. Finally, gene set enrichment analysis revealed that the largest categories of genes that downregulated in the absence of the symbiont were those involved in oxidation-reduction process, ATP hydrolysis coupled proton transport and glycolysis. In contrast, among the upregulated gene categories were those involved in proteolysis, microtubule-based movement, and cellular metabolic process. Our results provide valuable information for dissecting the mechanism of endosymbiosis in A. deanei.
Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.
Sirjana Devi Shrestha
Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.
Microarray meta-analysis to explore abiotic stress-specific gene expression patterns in Arabidopsis.
Shen, Po-Chih; Hour, Ai-Ling; Liu, Li-Yu Daisy
2017-12-01
Abiotic stresses are the major limiting factors that affect plant growth, development, yield and final quality. Deciphering the underlying mechanisms of plants' adaptations to stresses using few datasets might overlook the different aspects of stress tolerance in plants, which might be simultaneously and consequently operated in the system. Fortunately, the accumulated microarray expression data offer an opportunity to infer abiotic stress-specific gene expression patterns through meta-analysis. In this study, we propose to combine microarray gene expression data under control, cold, drought, heat, and salt conditions and determined modules (gene sets) of genes highly associated with each other according to the observed expression data. By analyzing the expression variations of the Eigen genes from different conditions, we had identified two, three, and five gene modules as cold-, heat-, and salt-specific modules, respectively. Most of the cold- or heat-specific modules were differentially expressed to a particular degree in shoot samples, while most of the salt-specific modules were differentially expressed to a particular degree in root samples. A gene ontology (GO) analysis on the stress-specific modules suggested that the gene modules exclusively enriched stress-related GO terms and that different genes under the same GO terms may be alternatively disturbed in different conditions. The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search. Our protocols study the specificity of the gene modules that were specifically activated under a particular type of abiotic stress. The biplot can also assist to visualize the stress-specific gene modules. In conclusion, our approach has the potential to further elucidate mechanisms in plants and beneficial for future experiments design under different abiotic stresses.
Gene mutation-based and specific therapies in precision medicine.
Wang, Xiangdong
2016-04-01
Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))
1990-08-01
Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
TiGER: a database for tissue-specific gene expression and regulation.
Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang
2008-06-09
Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.
TiGER: A database for tissue-specific gene expression and regulation
Zack Donald J
2008-06-01
Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.
Dasgupta Dipayan
2005-05-01
Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.
Specifically targeted gene therapy for small-cell lung cancer
Christensen, C.L.; Zandi, R.; Gjetting, T.
2009-01-01
Small-cell lung cancer (SCLC) is a highly malignant disease with poor prognosis. Hence, there is great demand for new therapies that can replace or supplement the current available treatment regimes. Gene therapy constitutes a promising strategy and relies on the principle of introducing exogenous...
Clark Taane G
2010-04-01
Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes
Hansen, Kasper Lage; Hansen, Niclas Tue; Karlberg, Erik, Olof, Linnart
2008-01-01
to be overexpressed in the normal tissues where defects cause pathology. In contrast, cancer genes and complexes were not overexpressed in the tissues from which the tumors emanate. We specifically identified a complex involved in XY sex reversal that is testis-specific and down-regulated in ovaries. We also......Heritable diseases are caused by germ-line mutations that, despite tissuewide presence, often lead to tissue-specific pathology. Here, we make a systematic analysis of the link between tissue-specific gene expression and pathological manifestations in many human diseases and cancers. Diseases were...
Structure and chromosomal localization of the human renal kallikrein gene
Evans, B.A.; Yun, Z.X.; Close, J.A.
1988-01-01
Glandular kallikreins are a family of proteases encoded by a variable number of genes in different mammalian species. In all species examined, however, one particular kallikrein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. This kallikrein is found in the kidney, pancreas, and salivary gland, showing a unique pattern of tissue-specific expression relative to other members of the family. The authors have isolated a genomic clone carrying the human renal kallikrein gene and compared the nucleotide sequence of its promoter region with those of the mouse renal kallikrein gene and another mouse kallikrein gene expressed in a distinct cell type. They find four sequence elements conserved between renal kallikrein genes from the two species. They have also shown that the human gene is localized to 19q13, a position analogous to that of the kallikrein gene family on mouse chromosome 7
Testis-Specific Histone Variant H3t Gene Is Essential for Entry into Spermatogenesis
Jun Ueda
2017-01-01
Full Text Available Cellular differentiation is associated with dynamic chromatin remodeling in establishing a cell-type-specific epigenomic landscape. Here, we find that mouse testis-specific and replication-dependent histone H3 variant H3t is essential for very early stages of spermatogenesis. H3t gene deficiency leads to azoospermia because of the loss of haploid germ cells. When differentiating spermatogonia emerge in normal spermatogenesis, H3t appears and replaces the canonical H3 proteins. Structural and biochemical analyses reveal that H3t-containing nucleosomes are more flexible than the canonical nucleosomes. Thus, by incorporating H3t into the genome during spermatogonial differentiation, male germ cells are able to enter meiosis and beyond.
Haisheng Nie
Full Text Available BACKGROUND: The chicken is an important agricultural and avian-model species. A survey of gene expression in a range of different tissues will provide a benchmark for understanding expression levels under normal physiological conditions in birds. With expression data for birds being very scant, this benchmark is of particular interest for comparative expression analysis among various terrestrial vertebrates. METHODOLOGY/PRINCIPAL FINDINGS: We carried out a gene expression survey in eight major chicken tissues using whole genome microarrays. A global picture of gene expression is presented for the eight tissues, and tissue specific as well as common gene expression were identified. A Gene Ontology (GO term enrichment analysis showed that tissue-specific genes are enriched with GO terms reflecting the physiological functions of the specific tissue, and housekeeping genes are enriched with GO terms related to essential biological functions. Comparisons of structural genomic features between tissue-specific genes and housekeeping genes show that housekeeping genes are more compact. Specifically, coding sequence and particularly introns are shorter than genes that display more variation in expression between tissues, and in addition intergenic space was also shorter. Meanwhile, housekeeping genes are more likely to co-localize with other abundantly or highly expressed genes on the same chromosomal regions. Furthermore, comparisons of gene expression in a panel of five common tissues between birds, mammals and amphibians showed that the expression patterns across tissues are highly similar for orthologous genes compared to random gene pairs within each pair-wise comparison, indicating a high degree of functional conservation in gene expression among terrestrial vertebrates. CONCLUSIONS: The housekeeping genes identified in this study have shorter gene length, shorter coding sequence length, shorter introns, and shorter intergenic regions, there seems
Neuronal type-specific gene expression profiling and laser-capture microdissection.
Pietersen, Charmaine Y; Lim, Maribel P; Macey, Laurel; Woo, Tsung-Ung W; Sonntag, Kai C
2011-01-01
The human brain is an exceptionally heterogeneous structure. In order to gain insight into the neurobiological basis of neural circuit disturbances in various neurologic or psychiatric diseases, it is often important to define the molecular cascades that are associated with these disturbances in a neuronal type-specific manner. This can be achieved by the use of laser microdissection, in combination with molecular techniques such as gene expression profiling. To identify neurons in human postmortem brain tissue, one can use the inherent properties of the neuron, such as pigmentation and morphology or its structural composition through immunohistochemistry (IHC). Here, we describe the isolation of homogeneous neuronal cells and high-quality RNA from human postmortem brain material using a combination of rapid IHC, Nissl staining, or simple morphology with Laser-Capture Microdissection (LCM) or Laser Microdissection (LMD).
Suegene Noh
2016-02-01
Full Text Available In the Allonemobius socius complex of crickets, reproductive isolation is primarily accomplished via postmating prezygotic barriers. We tested seven protein-coding genes expressed in the male ejaculate for patterns of evolution consistent with a putative role as postmating prezygotic isolation genes. Our recently diverged species generally lacked sequence variation. As a result, ω-based tests were only mildly successful. Some of our genes showed evidence of elevated ω values on the internal branches of gene trees. In a couple of genes, these internal branches coincided with both species branching events of the species tree, between A. fasciatus and the other two species, and between A. socius and A. sp. nov. Tex. In comparison, more successful approaches were those that took advantage of the varying degrees of lineage sorting and allele sharing among our young species. These approaches were particularly powerful within the contact zone. Among the genes we tested we found genes with genealogies that indicated relatively advanced degrees of lineage sorting across both allopatric and contact zone alleles. Within a contact zone between two members of the species complex, only a subset of genes maintained allelic segregation despite evidence of ongoing gene flow in other genes. The overlap in these analyses was arginine kinase (AK and apolipoprotein A-1 binding protein (APBP. These genes represent two of the first examples of sperm maturation, capacitation, and motility proteins with fixed non-synonymous substitutions between species-specific alleles that may lead to postmating prezygotic isolation. Both genes express ejaculate proteins transferred to females during copulation and were previously identified through comparative proteomics. We discuss the potential function of these genes in the context of the specific postmating prezygotic isolation phenotype among our species, namely conspecific sperm precedence and the superior ability of
Comparative genomics of the relationship between gene structure and expression
Ren, X.
2006-01-01
The relationship between the structure of genes and their expression is a relatively new aspect of genome organization and regulation. With more genome sequences and expression data becoming available, bioinformatics approaches can help the further elucidation of the relationships between gene
Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke
2016-02-15
The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis
Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.
Yuki Mitaka
Full Text Available The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq, we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.
Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J
2013-05-01
FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.
Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C
2013-06-01
Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.
XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD
Devon Shook
2017-12-01
Full Text Available A single-nucleotide polymorphism (SNP of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD. This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in children with and without ADHD. We collected 279 longitudinal T1-weighted structural images and DNA from 58 children with ADHD and 64 typically developing (TD children matched for age, IQ, and gender. Groups were divided by the XKR4 rs2939678 SNP into A-allele carriers versus subjects homozygous for the G-allele. Cerebellar lobular volumes were segmented into 35 regions of interest using MAGeTBrain, an automated multi-atlas segmentation pipeline for anatomical MRI, and statistically analyzed using linear mixed models. We found decreased gray matter (GM volumes in ADHD compared to TD children in bilateral lobules VIIIA, left VIIIB, right VIIB, and vermis VI. Furthermore, we found a linear age by gene interaction in left lobule VIIB where subjects homozygous for the G-allele showed a decrease in volume over time compared to A-allele carriers. We further found quadratic age × gene and age × diagnosis interactions in left lobule IV. Subjects homozygous for the G-allele (the genotype overtransmitted in ADHD showed more suppressed, almost flat quadratic growth curves compared to A-allele carriers, similar to individuals with ADHD compared to controls. However, there was no interaction between genotype and diagnosis, suggesting that any effects of this SNP on cerebellar development are not specific to the disorder.
XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD.
Shook, Devon; Brouwer, Rachel; de Zeeuw, Patrick; Oranje, Bob; Durston, Sarah
2017-01-01
A single-nucleotide polymorphism (SNP) of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD). This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in children with and without ADHD. We collected 279 longitudinal T1-weighted structural images and DNA from 58 children with ADHD and 64 typically developing (TD) children matched for age, IQ, and gender. Groups were divided by the XKR4 rs2939678 SNP into A-allele carriers versus subjects homozygous for the G-allele. Cerebellar lobular volumes were segmented into 35 regions of interest using MAGeTBrain, an automated multi-atlas segmentation pipeline for anatomical MRI, and statistically analyzed using linear mixed models. We found decreased gray matter (GM) volumes in ADHD compared to TD children in bilateral lobules VIIIA, left VIIIB, right VIIB, and vermis VI. Furthermore, we found a linear age by gene interaction in left lobule VIIB where subjects homozygous for the G-allele showed a decrease in volume over time compared to A-allele carriers. We further found quadratic age × gene and age × diagnosis interactions in left lobule IV. Subjects homozygous for the G-allele (the genotype overtransmitted in ADHD) showed more suppressed, almost flat quadratic growth curves compared to A-allele carriers, similar to individuals with ADHD compared to controls. However, there was no interaction between genotype and diagnosis, suggesting that any effects of this SNP on cerebellar development are not specific to the disorder.
Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne
2017-08-01
Activation of G protein-coupled estrogen receptor (GPER) by its agonist, G1, protects the heart from stressors such as pressure-overload, ischemia, a high-salt diet, estrogen loss, and aging, in various male and female animal models. Due to nonspecific effects of G1, the exact functions of cardiac GPER cannot be concluded from studies using systemic G1 administration. Moreover, global knockdown of GPER affects glucose homeostasis, blood pressure, and many other cardiovascular-related systems, thereby confounding interpretation of its direct cardiac actions. We generated a cardiomyocyte-specific GPER knockout (KO) mouse model to specifically investigate the functions of GPER in cardiomyocytes. Compared to wild type mice, cardiomyocyte-specific GPER KO mice exhibited adverse alterations in cardiac structure and impaired systolic and diastolic function, as measured by echocardiography. Gene deletion effects on left ventricular dimensions were more profound in male KO mice compared to female KO mice. Analysis of DNA microarray data from isolated cardiomyocytes of wild type and KO mice revealed sex-based differences in gene expression profiles affecting multiple transcriptional networks. Gene Set Enrichment Analysis (GSEA) revealed that mitochondrial genes are enriched in GPER KO females, whereas inflammatory response genes are enriched in GPER KO males, compared to their wild type counterparts of the same sex. The cardiomyocyte-specific GPER KO mouse model provides us with a powerful tool to study the functions of GPER in cardiomyocytes. The gene expression profiles of the GPER KO mice provide foundational information for further study of the mechanisms underlying sex-specific cardioprotection by GPER. Copyright © 2016 Elsevier B.V. All rights reserved.
Lee Hoyong
2006-12-01
Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.
Ryan Joseph F
2011-01-01
Full Text Available Abstract Background Mutations in the Otopetrin 1 gene (Otop1 in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH subtype 1G (Ush1g, both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF, a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq data in mouse and human embryonic stem (ES cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s of Ush1g and Otop in developmental pathways.
Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris
Harindra E. Amarasinghe
2015-07-01
Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.
Rong-Ping Zhang
Full Text Available Skeletal muscle growth and development are highly orchestrated processes involving significant changes in gene expressions. Differences in the location-specific and breed-specific genes and pathways involved have important implications for meat productions and meat quality. Here, RNA-Seq was performed to identify differences in the muscle deposition between two muscle locations and two duck breeds for functional genomics studies. To achieve those goals, skeletal muscle samples were collected from the leg muscle (LM and the pectoral muscle (PM of two genetically different duck breeds, Heiwu duck (H and Peking duck (P, at embryonic 15 days. Functional genomics studies were performed in two experiments: Experiment 1 directly compared the location-specific genes between PM and LM, and Experiment 2 compared the two breeds (H and P at the same developmental stage (embryonic 15 days. Almost 13 million clean reads were generated using Illumina technology (Novogene, Beijing, China on each library, and more than 70% of the reads mapped to the Peking duck (Anas platyrhynchos genome. A total of 168 genes were differentially expressed between the two locations analyzed in Experiment 1, whereas only 8 genes were differentially expressed when comparing the same location between two breeds in Experiment 2. Gene Ontology (GO and the Kyoto Encyclopedia of Genes and Genomes pathways (KEGG were used to functionally annotate DEGs (differentially expression genes. The DEGs identified in Experiment 1 were mainly involved in focal adhesion, the PI3K-Akt signaling pathway and ECM-receptor interaction pathways (corrected P-value<0.05. In Experiment 2, the DEGs were associated with only the ribosome signaling pathway (corrected P-value<0.05. In addition, quantitative real-time PCR was used to confirm 15 of the differentially expressed genes originally detected by RNA-Seq. A comparative transcript analysis of the leg and pectoral muscles of two duck breeds not only
Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.
Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella
2017-10-01
Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S
2012-08-19
Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.
Reverter Antonio
2008-09-01
Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing
Specific-structured lipids: nutritional perspectives and production potentials
Xu, Xuebing; Høy, Carl-Erik; Balchen, Steen
1997-01-01
Structured lipids are referring to any triacylglycerols containing both long chain fatty acids (mostly essential fatty acids) and medium or short chain fatty acids. In case of specific-structured lipids (SSLs), each group of fatty acids locates specifically at sn-2 or -1.3 positions of the glycerol...... backbone. Recently the nutritional perspectives of this kind of lipids attract many interests. This causes an increasing interest in the production of them by lipase-catalyzed interesterification. One of the advantages of lipase method over chemical ones is that SSLs can be produced with particular fatty...
Structural basis for substrate specificities of cellular deoxyribonucleoside kinases
Johansson, K.; Ramaswamy, S.; Ljungcrantz, C.
2001-01-01
Deoxyribonucleoside kinases phosphorylate deoxyribonucleosides and activate a number of medically important nucleoside analogs. Here we report the structure of the Drosophila deoxyribonucleoside kinase with deoxycytidine bound at the nucleoside binding site and that of the human deoxyguanosine ki......; this is apparently due to the presence of Arg 118, which provides favorable hydrogen bonding interactions with the substrate. The two new structures provide an explanation for the substrate specificity of cellular deoxyribonucleoside kinases....
Joshi, Anagha
2014-12-30
Transcriptional hotspots are defined as genomic regions bound by multiple factors. They have been identified recently as cell type specific enhancers regulating developmentally essential genes in many species such as worm, fly and humans. The in-depth analysis of hotspots across multiple cell types in same species still remains to be explored and can bring new biological insights. We therefore collected 108 transcription-related factor (TF) ChIP sequencing data sets in ten murine cell types and classified the peaks in each cell type in three groups according to binding occupancy as singletons (low-occupancy), combinatorials (mid-occupancy) and hotspots (high-occupancy). The peaks in the three groups clustered largely according to the occupancy, suggesting priming of genomic loci for mid occupancy irrespective of cell type. We then characterized hotspots for diverse structural functional properties. The genes neighbouring hotspots had a small overlap with hotspot genes in other cell types and were highly enriched for cell type specific function. Hotspots were enriched for sequence motifs of key TFs in that cell type and more than 90% of hotspots were occupied by pioneering factors. Though we did not find any sequence signature in the three groups, the H3K4me1 binding profile had bimodal peaks at hotspots, distinguishing hotspots from mono-modal H3K4me1 singletons. In ES cells, differentially expressed genes after perturbation of activators were enriched for hotspot genes suggesting hotspots primarily act as transcriptional activator hubs. Finally, we proposed that ES hotspots might be under control of SetDB1 and not DNMT for silencing. Transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes. In ES cells, they are predicted to act as transcriptional activator hubs and might be under SetDB1 control for silencing.
Memory functions reveal structural properties of gene regulatory networks
Perez-Carrasco, Ruben
2018-01-01
Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492
Epigenetic repression of male gametophyte-specific genes in the Arabidopsis sporophyte
Hoffmann, Robert D; Palmgren, Michael Broberg
2013-01-01
Tissue formation, the identity of cells, and the functions they fulfill, are results of gene regulation. The male gametophyte of plants, pollen, is outstanding in this respect as several hundred genes expressed in pollen are not expressed in the sporophyte. How pollen-specific genes are down......-regulated in the sporophyte has yet to be established. In this study, we have performed a bioinformatics analysis of publicly available genome-wide epigenetics data of several sporophytic tissues. By combining this analysis with DNase I footprinting data, we assessed means by which the repression of pollen-specific genes...
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
Simple diazonium chemistry to develop specific gene sensing platforms.
Revenga-Parra, M; García-Mendiola, T; González-Costas, J; González-Romero, E; Marín, A García; Pau, J L; Pariente, F; Lorenzo, E
2014-02-27
A simple strategy for covalent immobilizing DNA sequences, based on the formation of stable diazonized conducting platforms, is described. The electrochemical reduction of 4-nitrobenzenediazonium salt onto screen-printed carbon electrodes (SPCE) in aqueous media gives rise to terminal grafted amino groups. The presence of primary aromatic amines allows the formation of diazonium cations capable to react with the amines present at the DNA capture probe. As a comparison a second strategy based on the binding of aminated DNA capture probes to the developed diazonized conducting platforms through a crosslinking agent was also employed. The resulting DNA sensing platforms were characterized by cyclic voltammetry, electrochemical impedance spectroscopy and spectroscopic ellipsometry. The hybridization event with the complementary sequence was detected using hexaamineruthenium (III) chloride as electrochemical indicator. Finally, they were applied to the analysis of a 145-bp sequence from the human gene MRP3, reaching a detection limit of 210 pg μL(-1). Copyright © 2014 Elsevier B.V. All rights reserved.
Johanna Meier-Soelch
2018-04-01
Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.
Evolutionary constraints shape caste-specific gene expression across 15 ant species.
Morandin, Claire; Mikheyev, Alexander S; Pedersen, Jes Søe; Helanterä, Heikki
2017-05-01
Development of polymorphic phenotypes from similar genomes requires gene expression differences. However, little is known about how morph-specific gene expression patterns vary on a broad phylogenetic scale. We hypothesize that evolution of morph-specific gene expression, and consequently morph-specific phenotypic evolution, may be constrained by gene essentiality and the amount of pleiotropic constraints. Here, we use comparative transcriptomics of queen and worker morphs, that is, castes, from 15 ant species to understand the constraints of morph-biased gene expression. In particular, we investigate how measures of evolutionary constraints at the sequence level (expression level, connectivity, and number of gene ontology [GO] terms) correlate with morph-biased expression. Our results show that genes indeed vary in their potential to become morph-biased. The existence of genes that are constrained in becoming caste-biased potentially limits the evolutionary decoupling of the caste phenotypes, that is, it might result in "caste load" occasioning from antagonistic fitness variation, similarly to sexually antagonistic fitness variation between males and females. On the other hand, we suggest that genes under low constraints are released from antagonistic variation and thus more likely to be co-opted for morph specific use. Overall, our results suggest that the factors that affect sequence evolutionary rates and evolution of plastic expression may largely overlap. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Detection of mutations in genes by specific LNA primers
2001-01-01
acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...
Gene-Specific Demethylation as Targeted Therapy in MDS
2017-07-01
builds on our recent discovery of a novel class of RNAs, the DiRs or DNMT1-interacting RNAs, involved in cell type-specific DNA methylation patterns...causes leading to aberrant DNA methylation remain elusive. This proposal builds on our recent discovery of a novel class of RNAs, the DiRs or DNMT1...remains unknown. Our hypothesis is that the saRNAs might be acting as DiRs-mimicking molecules, and we will investigate whether saRNAs induce
Structural Determinants of Specific Lipid Binding to Potassium Channels
Weingarth, M.H.|info:eu-repo/dai/nl/330985655; Prokofyev, A.; van der Cruijsen, E.A.W.|info:eu-repo/dai/nl/330826743; Nand, D.|info:eu-repo/dai/nl/337731403; Bonvin, A.M.J.J.|info:eu-repo/dai/nl/113691238; Pongs, O.; Baldus, M.|info:eu-repo/dai/nl/314410864
2013-01-01
We have investigated specific lipid binding to the pore domain of potassium channels KcsA and chimeric KcsAKv1.3 on the structural and functional level using extensive coarse-grained and atomistic molecular dynamics simulations, solid-state NMR, and single channel measurements. We show that, while
Perceptual learning is specific to the trained structure of information.
Cohen, Yamit; Daikhin, Luba; Ahissar, Merav
2013-12-01
What do we learn when we practice a simple perceptual task? Many studies have suggested that we learn to refine or better select the sensory representations of the task-relevant dimension. Here we show that learning is specific to the trained structural regularities. Specifically, when this structure is modified after training with a fixed temporal structure, performance regresses to pretraining levels, even when the trained stimuli and task are retained. This specificity raises key questions as to the importance of low-level sensory modifications in the learning process. We trained two groups of participants on a two-tone frequency discrimination task for several days. In one group, a fixed reference tone was consistently presented in the first interval (the second tone was higher or lower), and in the other group the same reference tone was consistently presented in the second interval. When following training, these temporal protocols were switched between groups, performance of both groups regressed to pretraining levels, and further training was needed to attain postlearning performance. ERP measures, taken before and after training, indicated that participants implicitly learned the temporal regularity of the protocol and formed an attentional template that matched the trained structure of information. These results are consistent with Reverse Hierarchy Theory, which posits that even the learning of simple perceptual tasks progresses in a top-down manner, hence can benefit from temporal regularities at the trial level, albeit at the potential cost that learning may be specific to these regularities.
Nicholas Delihas
Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in
Gene expression patterns specific to the regenerating limb of the Mexican axolotl
James R. Monaghan
2012-07-01
Salamander limb regeneration is dependent upon tissue interactions that are local to the amputation site. Communication among limb epidermis, peripheral nerves, and mesenchyme coordinate cell migration, cell proliferation, and tissue patterning to generate a blastema, which will form missing limb structures. An outstanding question is how cross-talk between these tissues gives rise to the regeneration blastema. To identify genes associated with epidermis-nerve-mesenchymal interactions during limb regeneration, we examined histological and transcriptional changes during the first week following injury in the wound epidermis and subjacent cells between three injury types; 1 a flank wound on the side of the animal that will not regenerate a limb, 2 a denervated limb that will not regenerate a limb, and 3 an innervated limb that will regenerate a limb. Early, histological and transcriptional changes were similar between the injury types, presumably because a common wound-healing program is employed across anatomical locations. However, some transcripts were enriched in limbs compared to the flank and are associated with vertebrate limb development. Many of these genes were activated before blastema outgrowth and expressed in specific tissue types including the epidermis, peripheral nerve, and mesenchyme. We also identified a relatively small group of transcripts that were more highly expressed in innervated limbs versus denervated limbs. These transcripts encode for proteins involved in myelination of peripheral nerves, epidermal cell function, and proliferation of mesenchymal cells. Overall, our study identifies limb-specific and nerve-dependent genes that are upstream of regenerative growth, and thus promising candidates for the regulation of blastema formation.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Rymar, S Iu; Isakova, I A; Kuznietsova, L M; Kordium, V A
2006-01-01
The insecticidal crystal proteins of 15 B. thuringiensis strains, isolated in the Crimea territory that are toxical for some Lepidoptera and Colorado potato beetle larvae were identified by PAGE electrophoresis. Ten strains produced the crystal proteins with high molecular weight (> 120 kD). PCR with use of broad specificity primers and DNA of these B. thuringiensis strains as template demonstrated the specific PCR products (1000 bp). Amplified DNA fragments were cloned and sequenced. The nucleotide sequence analysis revealed that the genomes of ten strains of B. thuringiensis carried Cry1B genes, which are responsible for production of the insecticidal crystal proteins with dual specificity. The influence of the solubilization conditions on the structure and toxicity of Cry1B protein for Colorado potato beetle larvae was shown. The dual toxicity of studied B. thuringiensis strains is explained by the Cry1B genes presence in their genomes. These strains may be used to develop the broad specificity bioinsecticides.
Structure and genetics of the O-specific polysaccharide of Escherichia coli O27.
Perepelov, Andrei V; Chen, Tingting; Senchenkova, Sofya N; Filatov, Andrei V; Song, Jingjie; Shashkov, Alexander S; Liu, Bin; Knirel, Yuriy A
2018-02-01
The O-specific polysaccharide (O-antigen) is a part of the lipopolysaccharide on the cell surface of Gram-negative bacteria. The O-polysaccharide was obtained by mild acid hydrolysis of the lipopolysaccharide of Escherichia coli O27 and studied by sugar analysis and Smith degradation along with 1 H and 13 C NMR spectroscopy. The following structure of the branched hexasaccharide repeating unit was established, which is unique among known structures of bacterial polysaccharides:where GlcA is non-stoichiometrically O-acetylated at position 3 (∼22%) or 4 (∼37%). Functions of genes in the O-antigen gene cluster of E. coli O27 were tentatively assigned by comparison with sequences in the available databases and found to be consistent with the O-polysaccharide structure. Copyright © 2017 Elsevier Ltd. All rights reserved.
STRUCTURAL AND DESIGN SPECIFICS OF SPACE GRID SYSTEMS
G. M. Gasii
2017-01-01
Full Text Available The aim of the study is to identify main trends in the development of space grid structures. In order to reach the purpose it is necessary to conduct a review of the known structural concepts, nodal connections and specifics of the space grid structures and to make conclusions on feasibility improvement of the considered structural concepts that make it possible to develop new solutions without disadvantages residing in the analogues. Analysis of papers written by foreign and national scientists and devoted to theoretical, numerical and experimental studies of stress-strain state, influence of different factors on it and geometrical optimization and designing of space grid structures has been conducted in order to achieve the objectives. Space grid structures and, in particular, flat double-layer grid and most frequent nodes have been studied in the paper. The paper contains a short review of the history on development of space grid structures. It has been found that a rapid development of structural designs was caused by scientific and technical progress and, in particular, improvement of physical and mechanical properties of materials, development of calculation methods, application of software systems for simulating behavior of the structure under load, which significantly increased the calculation accuracy and reduced complexity of design. It has been also established that main parameters that have influence on effectiveness of a structural design are geometric dimensions of its modular elements, ratio of its depth to the span. The world experience on development of connection components has been studied in the paper. The paper presents general classification of nodal connections. Main advantages and disadvantages of existing space grid structures are highlighted and it allows to determine possible methods for their improvement. Theoretical research has permitted to establish that the main direction of spatial grid structures improvement
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu
2013-12-01
Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.
Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules
Xiaosheng Wang
2010-03-01
Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Robinson, Claire; Kolb, Andreas F.
2009-01-01
The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene
Inference of cancer-specific gene regulatory networks using soft computing rules.
Wang, Xiaosheng; Gotoh, Osamu
2010-03-24
Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Tissue-specific functional networks for prioritizing phenotype and disease genes.
Yuanfang Guan
Full Text Available Integrated analyses of functional genomics data have enormous potential for identifying phenotype-associated genes. Tissue-specificity is an important aspect of many genetic diseases, reflecting the potentially different roles of proteins and pathways in diverse cell lineages. Accounting for tissue specificity in global integration of functional genomics data is challenging, as "functionality" and "functional relationships" are often not resolved for specific tissue types. We address this challenge by generating tissue-specific functional networks, which can effectively represent the diversity of protein function for more accurate identification of phenotype-associated genes in the laboratory mouse. Specifically, we created 107 tissue-specific functional relationship networks through integration of genomic data utilizing knowledge of tissue-specific gene expression patterns. Cross-network comparison revealed significantly changed genes enriched for functions related to specific tissue development. We then utilized these tissue-specific networks to predict genes associated with different phenotypes. Our results demonstrate that prediction performance is significantly improved through using the tissue-specific networks as compared to the global functional network. We used a testis-specific functional relationship network to predict genes associated with male fertility and spermatogenesis phenotypes, and experimentally confirmed one top prediction, Mbyl1. We then focused on a less-common genetic disease, ataxia, and identified candidates uniquely predicted by the cerebellum network, which are supported by both literature and experimental evidence. Our systems-level, tissue-specific scheme advances over traditional global integration and analyses and establishes a prototype to address the tissue-specific effects of genetic perturbations, diseases and drugs.
Analysis of Gene Expression Variance in Schizophrenia Using Structural Equation Modeling
Anna A. Igolkina
2018-06-01
Full Text Available Schizophrenia (SCZ is a psychiatric disorder of unknown etiology. There is evidence suggesting that aberrations in neurodevelopment are a significant attribute of schizophrenia pathogenesis and progression. To identify biologically relevant molecular abnormalities affecting neurodevelopment in SCZ we used cultured neural progenitor cells derived from olfactory neuroepithelium (CNON cells. Here, we tested the hypothesis that variance in gene expression differs between individuals from SCZ and control groups. In CNON cells, variance in gene expression was significantly higher in SCZ samples in comparison with control samples. Variance in gene expression was enriched in five molecular pathways: serine biosynthesis, PI3K-Akt, MAPK, neurotrophin and focal adhesion. More than 14% of variance in disease status was explained within the logistic regression model (C-value = 0.70 by predictors accounting for gene expression in 69 genes from these five pathways. Structural equation modeling (SEM was applied to explore how the structure of these five pathways was altered between SCZ patients and controls. Four out of five pathways showed differences in the estimated relationships among genes: between KRAS and NF1, and KRAS and SOS1 in the MAPK pathway; between PSPH and SHMT2 in serine biosynthesis; between AKT3 and TSC2 in the PI3K-Akt signaling pathway; and between CRK and RAPGEF1 in the focal adhesion pathway. Our analysis provides evidence that variance in gene expression is an important characteristic of SCZ, and SEM is a promising method for uncovering altered relationships between specific genes thus suggesting affected gene regulation associated with the disease. We identified altered gene-gene interactions in pathways enriched for genes with increased variance in expression in SCZ. These pathways and loci were previously implicated in SCZ, providing further support for the hypothesis that gene expression variance plays important role in the etiology
Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B
2017-11-24
Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.
Analysis of cell-type-specific gene expression during mouse spermatogenesis
Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser
2004-01-01
In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume of s...
Assaf Gottlieb
2017-11-01
Full Text Available Abstract Background Genome-wide association studies are useful for discovering genotype–phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into “gene level” effects. Methods Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression—on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. Results We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Conclusions Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort
Causal gene identification using combinatorial V-structure search.
Cai, Ruichu; Zhang, Zhenjie; Hao, Zhifeng
2013-07-01
With the advances of biomedical techniques in the last decade, the costs of human genomic sequencing and genomic activity monitoring are coming down rapidly. To support the huge genome-based business in the near future, researchers are eager to find killer applications based on human genome information. Causal gene identification is one of the most promising applications, which may help the potential patients to estimate the risk of certain genetic diseases and locate the target gene for further genetic therapy. Unfortunately, existing pattern recognition techniques, such as Bayesian networks, cannot be directly applied to find the accurate causal relationship between genes and diseases. This is mainly due to the insufficient number of samples and the extremely high dimensionality of the gene space. In this paper, we present the first practical solution to causal gene identification, utilizing a new combinatorial formulation over V-Structures commonly used in conventional Bayesian networks, by exploring the combinations of significant V-Structures. We prove the NP-hardness of the combinatorial search problem under a general settings on the significance measure on the V-Structures, and present a greedy algorithm to find sub-optimal results. Extensive experiments show that our proposal is both scalable and effective, particularly with interesting findings on the causal genes over real human genome data. Copyright © 2013 Elsevier Ltd. All rights reserved.
XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD
Shook, Devon; Brouwer, Rachel; de Zeeuw, Patrick; Oranje, Bob; Durston, Sarah
2017-01-01
A single-nucleotide polymorphism (SNP) of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD). This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in
Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.
Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong
2016-05-20
Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.
Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner
2014-12-01
Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q
2014-01-01
Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Non-specific activities of the major herbicide-resistance gene BAR.
Christ, Bastien; Hochstrasser, Ramon; Guyer, Luzia; Francisco, Rita; Aubry, Sylvain; Hörtensteiner, Stefan; Weng, Jing-Ke
2017-12-01
Bialaphos resistance (BAR) and phosphinothricin acetyltransferase (PAT) genes, which convey resistance to the broad-spectrum herbicide phosphinothricin (also known as glufosinate) via N-acetylation, have been globally used in basic plant research and genetically engineered crops 1-4 . Although early in vitro enzyme assays showed that recombinant BAR and PAT exhibit substrate preference toward phosphinothricin over the 20 proteinogenic amino acids 1 , indirect effects of BAR-containing transgenes in planta, including modified amino acid levels, have been seen but without the identification of their direct causes 5,6 . Combining metabolomics, plant genetics and biochemical approaches, we show that transgenic BAR indeed converts two plant endogenous amino acids, aminoadipate and tryptophan, to their respective N-acetylated products in several plant species. We report the crystal structures of BAR, and further delineate structural basis for its substrate selectivity and catalytic mechanism. Through structure-guided protein engineering, we generated several BAR variants that display significantly reduced non-specific activities compared with its wild-type counterpart in vivo. The transgenic expression of enzymes can result in unintended off-target metabolism arising from enzyme promiscuity. Understanding such phenomena at the mechanistic level can facilitate the design of maximally insulated systems featuring heterologously expressed enzymes.
A framework for scalable parameter estimation of gene circuit models using structural information
Kuwahara, Hiroyuki
2013-06-21
Motivation: Systematic and scalable parameter estimation is a key to construct complex gene regulatory models and to ultimately facilitate an integrative systems biology approach to quantitatively understand the molecular mechanisms underpinning gene regulation. Results: Here, we report a novel framework for efficient and scalable parameter estimation that focuses specifically on modeling of gene circuits. Exploiting the structure commonly found in gene circuit models, this framework decomposes a system of coupled rate equations into individual ones and efficiently integrates them separately to reconstruct the mean time evolution of the gene products. The accuracy of the parameter estimates is refined by iteratively increasing the accuracy of numerical integration using the model structure. As a case study, we applied our framework to four gene circuit models with complex dynamics based on three synthetic datasets and one time series microarray data set. We compared our framework to three state-of-the-art parameter estimation methods and found that our approach consistently generated higher quality parameter solutions efficiently. Although many general-purpose parameter estimation methods have been applied for modeling of gene circuits, our results suggest that the use of more tailored approaches to use domain-specific information may be a key to reverse engineering of complex biological systems. The Author 2013.
A framework for scalable parameter estimation of gene circuit models using structural information
Kuwahara, Hiroyuki; Fan, Ming; Wang, Suojin; Gao, Xin
2013-01-01
Motivation: Systematic and scalable parameter estimation is a key to construct complex gene regulatory models and to ultimately facilitate an integrative systems biology approach to quantitatively understand the molecular mechanisms underpinning gene regulation. Results: Here, we report a novel framework for efficient and scalable parameter estimation that focuses specifically on modeling of gene circuits. Exploiting the structure commonly found in gene circuit models, this framework decomposes a system of coupled rate equations into individual ones and efficiently integrates them separately to reconstruct the mean time evolution of the gene products. The accuracy of the parameter estimates is refined by iteratively increasing the accuracy of numerical integration using the model structure. As a case study, we applied our framework to four gene circuit models with complex dynamics based on three synthetic datasets and one time series microarray data set. We compared our framework to three state-of-the-art parameter estimation methods and found that our approach consistently generated higher quality parameter solutions efficiently. Although many general-purpose parameter estimation methods have been applied for modeling of gene circuits, our results suggest that the use of more tailored approaches to use domain-specific information may be a key to reverse engineering of complex biological systems. The Author 2013.
A framework for scalable parameter estimation of gene circuit models using structural information.
Kuwahara, Hiroyuki; Fan, Ming; Wang, Suojin; Gao, Xin
2013-07-01
Systematic and scalable parameter estimation is a key to construct complex gene regulatory models and to ultimately facilitate an integrative systems biology approach to quantitatively understand the molecular mechanisms underpinning gene regulation. Here, we report a novel framework for efficient and scalable parameter estimation that focuses specifically on modeling of gene circuits. Exploiting the structure commonly found in gene circuit models, this framework decomposes a system of coupled rate equations into individual ones and efficiently integrates them separately to reconstruct the mean time evolution of the gene products. The accuracy of the parameter estimates is refined by iteratively increasing the accuracy of numerical integration using the model structure. As a case study, we applied our framework to four gene circuit models with complex dynamics based on three synthetic datasets and one time series microarray data set. We compared our framework to three state-of-the-art parameter estimation methods and found that our approach consistently generated higher quality parameter solutions efficiently. Although many general-purpose parameter estimation methods have been applied for modeling of gene circuits, our results suggest that the use of more tailored approaches to use domain-specific information may be a key to reverse engineering of complex biological systems. http://sfb.kaust.edu.sa/Pages/Software.aspx. Supplementary data are available at Bioinformatics online.
Zhang, R L; Samuelson, D A; Zhang, Z G; Reddy, V N; Shastry, B S
1991-08-01
The congenital hereditary cataracts and microphthalmia in the miniature schnauzer dog are inherited by an autosomal recessive mode. To understand the genetic basis of these diseases, the authors purified and analyzed leukocyte deoxyribonucleic acid (DNA) from affected and normal animals using a candidate gene approach. Because the genes that encode the lens-specific proteins, specifically, alpha, beta, and gamma crystallins and the membrane protein (MP26), are known to maintain the structure and function of the lens, the authors used complimentary DNA (cDNA) fragments that corresponded to the above genes to search for the mutations at their loci in the affected animals. They found no evidence of the gene deletion and rearrangement in any of the five loci. In addition, the hybridizable sequences of the dog DNA to the specific probes for the human chromosome 4 and 18 loci, which are reported to be involved in the abnormality of the human eye, seem to be unaffected. These data support the notion that the hereditary cataracts and microphthalmia in the dog may be associated with genes other than those reported for several animal systems.
Paula Paulo
2012-07-01
Full Text Available This work aimed to evaluate whether ETS transcription factors frequently involved in rearrangements in prostate carcinomas (PCa, namely ERG and ETV1, regulate specific or shared target genes. We performed differential expression analysis on nine normal prostate tissues and 50 PCa enriched for different ETS rearrangements using exon-level expression microarrays, followed by in vitro validation using cell line models. We found specific deregulation of 57 genes in ERG-positive PCa and 15 genes in ETV1-positive PCa, whereas deregulation of 27 genes was shared in both tumor subtypes. We further showed that the expression of seven tumor-associated ERG target genes (PLA1A, CACNA1D, ATP8A2, HLA-DMB, PDE3B, TDRD1, and TMBIM1 and two tumor-associated ETV1 target genes (FKBP10 and GLYATL2 was significantly affected by specific ETS silencing in VCaP and LNCaP cell line models, respectively, whereas the expression of three candidate ERG and ETV1 shared targets (GRPR, KCNH8, and TMEM45B was significantly affected by silencing of either ETS. Interestingly, we demonstrate that the expression of TDRD1, the topmost overexpressed gene of our list of ERG-specific candidate targets, is inversely correlated with the methylation levels of a CpG island found at -66 bp of the transcription start site in PCa and that TDRD1 expression is regulated by direct binding of ERG to the CpG island in VCaP cells. We conclude that ETS transcription factors regulate specific and shared target genes and that TDRD1, FKBP10, and GRPR are promising therapeutic targets and can serve as diagnostic markers for molecular subtypes of PCa harboring specific fusion gene rearrangements.
McKeown, Peter C
2011-08-12
Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs) displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination). We identified these MEGs by developing a bioinformatics tool (GenFrag) which can directly determine the identities of transcript-derived fragments from (i) their size and (ii) which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1 seeds was
Wennblom Trevor J
2011-08-01
Full Text Available Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination. We identified these MEGs by developing a bioinformatics tool (GenFrag which can directly determine the identities of transcript-derived fragments from (i their size and (ii which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1
Comparative Annotation of Viral Genomes with Non-Conserved Gene Structure
de Groot, Saskia; Mailund, Thomas; Hein, Jotun
2007-01-01
Motivation: Detecting genes in viral genomes is a complex task. Due to the biological necessity of them being constrained in length, RNA viruses in particular tend to code in overlapping reading frames. Since one amino acid is encoded by a triplet of nucleic acids, up to three genes may be coded...... allows for coding in unidirectional nested and overlapping reading frames, to annotate two homologous aligned viral genomes. Our method does not insist on conserved gene structure between the two sequences, thus making it applicable for the pairwise comparison of more distantly related sequences. Results...... and HIV2, as well as of two different Hepatitis Viruses, attaining results of ~87% sensitivity and ~98.5% specificity. We subsequently incorporate prior knowledge by "knowing" the gene structure of one sequence and annotating the other conditional on it. Boosting accuracy close to perfect we demonstrate...
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kassir, Yona
2017-01-01
Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.
The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene.
Pharo, Elizabeth A; De Leo, Alison A; Renfree, Marilyn B; Thomson, Peter C; Lefèvre, Christophe M; Nicholas, Kevin R
2012-06-08
The marsupial early lactation protein (ELP) gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A). Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI) protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI)-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1) and early lactation (Phase 2A). The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI), spleen trypsin inhibitor (STI) and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5) genes. Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.
The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene
Pharo Elizabeth A
2012-06-01
Full Text Available Abstract Background The marsupial early lactation protein (ELP gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A. Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Results Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1 and early lactation (Phase 2A. The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI, spleen trypsin inhibitor (STI and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5 genes. Conclusions Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.
Specific genetic modifications of domestic animals by gene targeting and animal cloning
Zhou Jiangfeng
2003-11-01
Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.
Functional understanding of the diverse exon-intron structures of human GPCR genes.
Hammond, Dorothy A; Olman, Victor; Xu, Ying
2014-02-01
The GPCR genes have a variety of exon-intron structures even though their proteins are all structurally homologous. We have examined all human GPCR genes with at least two functional protein isoforms, totaling 199, aiming to gain an understanding of what may have contributed to the large diversity of the exon-intron structures of the GPCR genes. The 199 genes have a total of 808 known protein splicing isoforms with experimentally verified functions. Our analysis reveals that 1301 (80.6%) adjacent exon-exon pairs out of the total of 1,613 in the 199 genes have either exactly one exon skipped or the intron in-between retained in at least one of the 808 protein splicing isoforms. This observation has a statistical significance p-value of 2.051762 * e(-09), assuming that the observed splicing isoforms are independent of the exon-intron structures. Our interpretation of this observation is that the exon boundaries of the GPCR genes are not randomly determined; instead they may be selected to facilitate specific alternative splicing for functional purposes.
Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.
Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin
2016-10-15
Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author
Knowledge Enrichment Analysis for Human Tissue- Specific Genes Uncover New Biological Insights
Gong Xiu-Jun
2012-06-01
Full Text Available The expression and regulation of genes in different tissues are fundamental questions to be answered in biology. Knowledge enrichment analysis for tissue specific (TS and housekeeping (HK genes may help identify their roles in biological process or diseases and gain new biological insights.In this paper, we performed the knowledge enrichment analysis for 17,343 genes in 84 human tissues using Gene Set Enrichment Analysis (GSEA and Hypergeometric Analysis (HA against three biological ontologies: Gene Ontology (GO, KEGG pathways and Disease Ontology (DO respectively.The analyses results demonstrated that the functions of most gene groups are consistent with their tissue origins. Meanwhile three interesting new associations for HK genes and the skeletal muscle tissuegenes are found. Firstly, Hypergeometric analysis against KEGG database for HK genes disclosed that three disease terms (Parkinson’s disease, Huntington’s disease, Alzheimer’s disease are intensively enriched.Secondly, Hypergeometric analysis against the KEGG database for Skeletal Muscle tissue genes shows that two cardiac diseases of “Hypertrophic cardiomyopathy (HCM” and “Arrhythmogenic right ventricular cardiomyopathy (ARVC” are heavily enriched, which are also considered as no relationship with skeletal functions.Thirdly, “Prostate cancer” is intensively enriched in Hypergeometric analysis against the disease ontology (DO for the Skeletal Muscle tissue genes, which is a much unexpected phenomenon.
Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin
2017-12-06
Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these
Waugh Robbie
2010-12-01
Full Text Available Abstract Background Because of its size, allohexaploid nature and high repeat content, the wheat genome has always been perceived as too complex for efficient molecular studies. We recently constructed the first physical map of a wheat chromosome (3B. However gene mapping is still laborious in wheat because of high redundancy between the three homoeologous genomes. In contrast, in the closely related diploid species, barley, numerous gene-based markers have been developed. This study aims at combining the unique genomic resources developed in wheat and barley to decipher the organisation of gene space on wheat chromosome 3B. Results Three dimensional pools of the minimal tiling path of wheat chromosome 3B physical map were hybridised to a barley Agilent 15K expression microarray. This led to the fine mapping of 738 barley orthologous genes on wheat chromosome 3B. In addition, comparative analyses revealed that 68% of the genes identified were syntenic between the wheat chromosome 3B and barley chromosome 3 H and 59% between wheat chromosome 3B and rice chromosome 1, together with some wheat-specific rearrangements. Finally, it indicated an increasing gradient of gene density from the centromere to the telomeres positively correlated with the number of genes clustered in islands on wheat chromosome 3B. Conclusion Our study shows that novel structural genomics resources now available in wheat and barley can be combined efficiently to overcome specific problems of genetic anchoring of physical contigs in wheat and to perform high-resolution comparative analyses with rice for deciphering the organisation of the wheat gene space.
Concordance of gene expression in human protein complexes reveals tissue specificity and pathology
Börnigen, Daniela; Pers, Tune Hannes; Thorrez, Lieven
2013-01-01
Disease-causing variants in human genes usually lead to phenotypes specific to only a few tissues. Here, we present a method for predicting tissue specificity based on quantitative deregulation of protein complexes. The underlying assumption is that the degree of coordinated expression among prot...
Xia Wang
Full Text Available When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives.We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy.Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42 of the unsolved cases.Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases.
David Haase
Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.
Bowen, Joanne M.; Tsykin, Anna; Stringer, Andrea M.; Logan, Richard M.; Gibson, Rachel J.; Keefe, Dorothy M.K.
2010-01-01
Gastrointestinal toxicity remains a significant and dose-limiting complication of cancer treatment. While the pathophysiology is becoming clearer, considerable gaps in the knowledge remain surrounding the timing and site-specific gene changes which occur in response to insult. As such, this study aimed to assess gene expression profiles in a number of regions along the gastrointestinal tract following treatment with the chemotherapy agent, irinotecan, and correlate them with markers of cell death and tissue damage. Data analysis of microarray results found that genes involved in apoptosis, mitogen activated kinase (MAPK) signalling and inflammation were upregulated within 6 h, while genes involved in cell proliferation, wound healing and blood vessel formation were upregulated at later time points up to 72 h. Cell death was significantly increased at 6 and 24 h, and the stomach showed the lowest severity of overt tissue damage. Real time PCR of MAPK signalling pathway genes found that the jejunum and colon had significantly increased expression in a number of genes at 72 h, where as the stomach was unchanged. These results indicate that overall severity of tissue damage may be determined by precisely timed target gene responses specific to each region. Therapeutic targeting of key gene responses at the appropriate time point may prove to be effective for prevention of chemotherapy-induced gastrointestinal damage.
Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Phenotype- and genotype-specific structural alterations in spasmodic dysphonia.
Bianchi, Serena; Battistella, Giovanni; Huddleston, Hailey; Scharf, Rebecca; Fleysher, Lazar; Rumbach, Anna F; Frucht, Steven J; Blitzer, Andrew; Ozelius, Laurie J; Simonyan, Kristina
2017-04-01
Spasmodic dysphonia is a focal dystonia characterized by involuntary spasms in the laryngeal muscles that occur selectively during speaking. Although hereditary trends have been reported in up to 16% of patients, the causative etiology of spasmodic dysphonia is unclear, and the influences of various phenotypes and genotypes on disorder pathophysiology are poorly understood. In this study, we examined structural alterations in cortical gray matter and white matter integrity in relationship to different phenotypes and putative genotypes of spasmodic dysphonia to elucidate the structural component of its complex pathophysiology. Eighty-nine patients with spasmodic dysphonia underwent high-resolution magnetic resonance imaging and diffusion-weighted imaging to examine cortical thickness and white matter fractional anisotropy in adductor versus abductor forms (distinct phenotypes) and in sporadic versus familial cases (distinct genotypes). Phenotype-specific abnormalities were localized in the left sensorimotor cortex and angular gyrus and the white matter bundle of the right superior corona radiata. Genotype-specific alterations were found in the left superior temporal gyrus, supplementary motor area, and the arcuate portion of the left superior longitudinal fasciculus. Our findings suggest that phenotypic differences in spasmodic dysphonia arise at the level of the primary and associative areas of motor control, whereas genotype-related pathophysiological mechanisms may be associated with dysfunction of regions regulating phonological and sensory processing. Identification of structural alterations specific to disorder phenotype and putative genotype provides an important step toward future delineation of imaging markers and potential targets for novel therapeutic interventions for spasmodic dysphonia. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.
Mushroom Lectins: Specificity, Structure and Bioactivity Relevant to Human Disease
Mohamed Ali Abol Hassan
2015-04-01
Full Text Available Lectins are non-immunoglobulin proteins that bind diverse sugar structures with a high degree of selectivity. Lectins play crucial role in various biological processes such as cellular signaling, scavenging of glycoproteins from the circulatory system, cell–cell interactions in the immune system, differentiation and protein targeting to cellular compartments, as well as in host defence mechanisms, inflammation, and cancer. Among all the sources of lectins, plants have been most extensively studied. However, more recently fungal lectins have attracted considerable attention due to their antitumor, antiproliferative and immunomodulatory activities. Given that only 10% of mushroom species are known and have been taxonomically classified, mushrooms represent an enormous unexplored source of potentially useful and novel lectins. In this review we provide an up-to-date summary on the biochemical, molecular and structural properties of mushroom lectins, as well as their versatile applications specifically focusing on mushroom lectin bioactivity.
The hypoxic proteome is influenced by gene-specific changes in mRNA translation
Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.
2005-01-01
Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia
Site-specific selfish genes as tools for the control and genetic engineering of natural populations.
Burt, Austin
2003-05-07
Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.
Gene-Specific-Candidate-Driven Study to decipher Genetic Predisposition to Rotavirus Infection
Kshitija Rane-Yadav
2017-10-01
Full Text Available Recent report of WHO shows 113000 children in India succumb to death due to Rotavirus diarrhea. Lack of knowledge about pathogenesis of virus has led to lack of therapy for severely infected patients. Previous studies have found that, animal rotavirus requires sialyl glycan moieties on cell surface for pathogenesis. Present study states that human rotaviruses also follows same path and this specificity of virus leads to host genetic predisposition for the infection as well as the disease. Two hundred children less than 5 years of age clinically suspected of viral diarrhea were screened for rotavirus infection. EDTA blood was processed for analyzing DNA sequences of various fucosyltransferase genes. Lewis antigens which are secretory form of ABO Histo Blood Group Antigens were correlated with the genotype of patient. Genetics of HBGA secretion, particularly, basis of Leb expression manifested by fucosyltransferase-2 enzyme was studied in healthy individuals and was compared in cases of rotavirus positive and negative diarrhea. Positive clinical isolates with various genotypes were purified from stool samples and gene for VP4 - surface spike protein was sequenced. Using Bioinformatics interphase, three dimensional protein structures were modeled and their functional domains were analyzed. All these modeled proteins were docked with Leb HBGA (Lewis-b Histo Blood Group Antigens using molecular docking software. In present study, to investigate possible association of the rotavirus with host genome, we screened highly suspected genes involved in expression of glycoproteins on enterocytes. This study performed for prevalent Indian strains of rotaviruses provides possible evidence that, VP8 domain of VP4 spike protein utilizes Leb surface antigen for attachment and entry to enterocytes in the intestine. The FUT2 and FUT3 gene has been found to show significant association with the rotavirus infection hence can serve as a biomarker for genetic
Generation of Elf5-Cre knockin mouse strain for trophoblast-specific gene manipulation.
Kong, Shuangbo; Liang, Guixian; Tu, Zhaowei; Chen, Dunjin; Wang, Haibin; Lu, Jinhua
2018-04-01
Placental development is a complex and highly controlled process during which trophoblast stem cells differentiate to various trophoblast subtypes. The early embryonic death of systemic gene knockout models hampers the investigation of these genes that might play important roles during placentation. A trophoblast specific Cre mouse model would be of great help for dissecting out the potential roles of these genes during placental development. For this purpose, we generate a transgenic mouse with the Cre recombinase inserted into the endogenous locus of Elf5 gene that is expressed specifically in placental trophoblast cells. To analyze the specificity and efficiency of Cre recombinase activity in Elf5-Cre mice, we mated Elf5-Cre mice with Rosa26 mT/mG reporter mice, and found that Elf5-Cre transgene is expressed specifically in the trophoectoderm as early as embryonic day 4.5 (E4.5). By E12.5, the activity of Elf5-Cre transgene was detected exclusively in all derivatives of trophoblast lineages, including spongiotrophoblast, giant cells, and labyrinth trophoblasts. In addition, Elf5-Cre transgene was also active during spermatogenesis, from spermatids to mature sperms, which is consistent with the endogenous Elf5 expression in testis. Collectively, our results provide a unique tool to delete specific genes selectively and efficiently in trophoblast lineage during placentation. © 2018 Wiley Periodicals, Inc.
Potential-specific structure at the hematite-electrolyte interface
McBriarty, Martin E.; Stubbs, Joanne; Eng, Peter; Rosso, Kevin M.
2018-02-21
The atomic-scale structure of interfaces between metal oxides and aqueous electrolytes controls their catalytic, geochemical, and corrosion behavior. Measurements that probe these interfaces in situ provide important details of ion and solvent arrangements, but atomically precise structural models do not exist for common oxide-electrolyte interfaces far from equilibrium. Using a novel cell, we measured the structure of the hematite (a-Fe2O3) (110$\\bar{2}$)-electrolyte interface under controlled electrochemical bias using synchrotron crystal truncation rod X ray scattering. At increasingly cathodic potentials, charge-compensating protonation of surface oxygen groups increases the coverage of specifically bound water while adjacent water layers displace outwardly and became disordered. Returning to open circuit potential leaves the surface in a persistent metastable protonation state. The flux of current and ions at applied potential is thus regulated by a unique interfacial electrolyte environment, suggesting that electrical double layer models should be adapted to the dynamically changing interfacial structure far from equilibrium.
Kuraku, Shigehiro; Usuda, Ryo; Kuratani, Shigeru
2005-01-01
The turtle shell is an evolutionary novelty in which the developmental pattern of the ribs is radically modified. In contrast to those of other amniotes, turtle ribs grow laterally into the dorsal dermis to form a carapace. The lateral margin of carapacial primordium is called the carapacial ridge (CR), and is thought to play an essential role in carapace patterning. To reveal the developmental mechanisms underlying this structure, we systematically screened for genes expressed specifically in the CR of the Chinese soft-shelled turtle, Pelodiscus sinensis, using microbead-based differential cDNA analysis and real-time reverse transcription-polymerase chain reaction. We identified orthologs of Sp5, cellular retinoic acid-binding protein-I (CRABP-I), adenomatous polyposis coli down-regulated 1 (APCDD1), and lymphoid enhancer-binding factor-1 (LEF-1). Although these genes are conserved throughout the major vertebrate lineages, comparison of their expression patterns with those in chicken and mouse indicated that these genes have acquired de novo expression in the CR in the turtle lineage. In association with the expression of LEF-1, the nuclear localization of beta-catenin protein was detected in the CR ectoderm, suggesting that the canonical Wnt signaling triggers carapace development. These findings indicate that the acquisition of the turtle shell did not involve the creation of novel genes, but was based on the co-option of pre-existing genes.
Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish
Atsuo Kawahara
2016-05-01
Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.
Guha, Mithu; Saare, Mario; Maslovskaja, Julia; Kisand, Kai; Liiv, Ingrid; Haljasorg, Uku; Tasa, Tõnis; Metspalu, Andres; Milani, Lili; Peterson, Pärt
2017-04-21
The autoimmune regulator (AIRE) protein is the key factor in thymic negative selection of autoreactive T cells by promoting the ectopic expression of tissue-specific genes in the thymic medullary epithelium. Mutations in AIRE cause a monogenic autoimmune disease called autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy. AIRE has been shown to promote DNA breaks via its interaction with topoisomerase 2 (TOP2). In this study, we investigated topoisomerase-induced DNA breaks and chromatin structural alterations in conjunction with AIRE-dependent gene expression. Using RNA sequencing, we found that inhibition of TOP2 religation activity by etoposide in AIRE-expressing cells had a synergistic effect on genes with low expression levels. AIRE-mediated transcription was not only enhanced by TOP2 inhibition but also by the TOP1 inhibitor camptothecin. The transcriptional activation was associated with structural rearrangements in chromatin, notably the accumulation of γH2AX and the exchange of histone H1 with HMGB1 at AIRE target gene promoters. In addition, we found the transcriptional up-regulation to co-occur with the chromatin structural changes within the genomic cluster of carcinoembryonic antigen-like cellular adhesion molecule genes. Overall, our results suggest that the presence of AIRE can trigger molecular events leading to an altered chromatin landscape and the enhanced transcription of low-expressed genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Using a periclinal chimera to unravel layer-specific gene expression in plants.
Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J
2013-09-01
Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.
Reprogramming LCLs to iPSCs Results in Recovery of Donor-Specific Gene Expression Signature.
Samantha M Thomas
2015-05-01
Full Text Available Renewable in vitro cell cultures, such as lymphoblastoid cell lines (LCLs, have facilitated studies that contributed to our understanding of genetic influence on human traits. However, the degree to which cell lines faithfully maintain differences in donor-specific phenotypes is still debated. We have previously reported that standard cell line maintenance practice results in a loss of donor-specific gene expression signatures in LCLs. An alternative to the LCL model is the induced pluripotent stem cell (iPSC system, which carries the potential to model tissue-specific physiology through the use of differentiation protocols. Still, existing LCL banks represent an important source of starting material for iPSC generation, and it is possible that the disruptions in gene regulation associated with long-term LCL maintenance could persist through the reprogramming process. To address this concern, we studied the effect of reprogramming mature LCL cultures from six unrelated donors to iPSCs on the ensuing gene expression patterns within and between individuals. We show that the reprogramming process results in a recovery of donor-specific gene regulatory signatures, increasing the number of genes with a detectable donor effect by an order of magnitude. The proportion of variation in gene expression statistically attributed to donor increases from 6.9% in LCLs to 24.5% in iPSCs (P < 10-15. Since environmental contributions are unlikely to be a source of individual variation in our system of highly passaged cultured cell lines, our observations suggest that the effect of genotype on gene regulation is more pronounced in iPSCs than in LCLs. Our findings indicate that iPSCs can be a powerful model system for studies of phenotypic variation across individuals in general, and the genetic association with variation in gene regulation in particular. We further conclude that LCLs are an appropriate starting material for iPSC generation.
Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells
Soucie, E.L.; Weng, Z.; Geirsdottir, L.; Molawi, K.; Maurizio, J.; Fenouil, R.; Mossadegh-Keller, N.; Gimenez, G.; VanHille, L.; Beniazza, M.; Favret, J.; Berruyer, C.; Perrin, P.; Hacohen, N.; Andrau, J.C.
2016-01-01
Differentiated macrophages can self-renew in tissues and expand long-term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network controlling self-renewal. Single cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down...
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Gene Regulation in Primates Evolves under Tissue-Specific Selection Pressures
Blekhman, Ran; Oshlack, Alicia; Chabot, Adrien E.; Smyth, Gordon K.; Gilad, Yoav
2008-01-01
Author Summary It has long been hypothesized that in addition to structural changes to proteins, changes in gene regulation might underlie many of the anatomic and behavioral differences between humans and other primates. However, to date, there are only a handful of examples of regulatory adaptations in humans. In this work, we present a genome-wide study of gene expression levels in livers, kidneys, and hearts from three species: humans, chimpanzees, and rhesus macaques. These data allowed ...
Combinatorial design of a nanobody that specifically targets structured RNAs.
Cawez, F; Duray, E; Hu, Y; Vandenameele, J; Romão, E; Vincke, C; Dumoulin, M; Galleni, M; Muyldermans, S; Vandevenne, M
2018-04-11
Recent advances in transcriptome sequencing and analysis have revealed the complexity of the human genome. The majority (≈ 98%) of cellular transcripts is not translated into proteins and represents a vast, unchartered world of functional non-coding RNAs (ncRNAs). Most of them adopt a well-defined 3D structure to achieve their biological functions. However, only very few RNA structures are currently available which reflects the challenges associated with RNA crystallization. Nevertheless, these structures would represent a critical step in understanding functions of ncRNAs and their molecular mechanisms in the cell. The overall goal of this study is to develop an innovative and versatile tool to facilitate the functional study and crystallization of structured RNAs (stRNAs). In this work, we have engineered an antibody fragment from camelid heavy-chain antibody (nanobody) able to specifically bind with low nanomolar affinity to stRNA while no binding could be detected for single-stranded DNA/RNA, double-stranded DNA/RNA or a negatively charged protein. However, this nanobody recognizes different and non-related stRNAs, this observation suggests that it binds to an epitope shared by these stRNAs. Finally, our data also show that the binding of the nanobody doesn't alter the secondary structure content of the stRNA as well as its unfolding/refolding processes during heat treatment. This work constitutes a successful proof-of-concept demonstrating that nanobodies can be engineered to recognize RNA-related epitopes. Copyright © 2018. Published by Elsevier Ltd.
Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells.
Soucie, Erinn L; Weng, Ziming; Geirsdóttir, Laufey; Molawi, Kaaweh; Maurizio, Julien; Fenouil, Romain; Mossadegh-Keller, Noushine; Gimenez, Gregory; VanHille, Laurent; Beniazza, Meryam; Favret, Jeremy; Berruyer, Carole; Perrin, Pierre; Hacohen, Nir; Andrau, J-C; Ferrier, Pierre; Dubreuil, Patrice; Sidow, Arend; Sieweke, Michael H
2016-02-12
Differentiated macrophages can self-renew in tissues and expand long term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network that controls self-renewal. Single-cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down-regulation of Maf transcription factors. The network also controls embryonic stem cell self-renewal but is associated with distinct embryonic stem cell-specific enhancers. This indicates that distinct lineage-specific enhancer platforms regulate a shared network of genes that control self-renewal potential in both stem and mature cells. Copyright © 2016, American Association for the Advancement of Science.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Correlations in the population structure of music, genes and language
Brown, Steven; Savage, Patrick E.; Ko, Albert Min-Shan; Stoneking, Mark; Ko, Ying-Chin; Loo, Jun-Hun; Trejaut, Jean A.
2014-01-01
We present, to our knowledge, the first quantitative evidence that music and genes may have coevolved by demonstrating significant correlations between traditional group-level folk songs and mitochondrial DNA variation among nine indigenous populations of Taiwan. These correlations were of comparable magnitude to those between language and genes for the same populations, although music and language were not significantly correlated with one another. An examination of population structure for genetics showed stronger parallels to music than to language. Overall, the results suggest that music might have a sufficient time-depth to retrace ancient population movements and, additionally, that it might be capturing different aspects of population history than language. Music may therefore have the potential to serve as a novel marker of human migrations to complement genes, language and other markers. PMID:24225453
Erica Bree Rosenblum
Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.
Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues
Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.
2010-01-01
MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...
Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter
Wolfgang Boecker
2004-04-01
Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.
Morimoto, Shimpei; Yahara, Koji
2018-03-01
Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential
Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression
Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe
2005-01-01
We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells
Analysis of ribosomal protein gene structures: implications for intron evolution.
2006-03-01
Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.
Evaluation of Sex-Specific Gene Expression in Archived Dried Blood Spots (DBS
Scott Jewell
2012-08-01
Full Text Available Screening newborns for treatable serious conditions is mandated in all US states and many other countries. After screening, Guthrie cards with residual blood (whole spots or portions of spots are typically stored at ambient temperature in many facilities. The potential of archived dried blood spots (DBS for at-birth molecular studies in epidemiological and clinical research is substantial. However, it is also challenging as analytes from DBS may be degraded due to preparation and storage conditions. We previously reported an improved assay for obtaining global RNA gene expression from blood spots. Here, we evaluated sex-specific gene expression and its preservation in DBS using oligonucleotide microarray technology. We found X inactivation-specific transcript (XIST, lysine-specific demethylase 5D (KDM5D (also known as selected cDNA on Y, homolog of mouse (SMCY, uncharacterized LOC729444 (LOC729444, and testis-specific transcript, Y-linked 21 (TTTY21 to be differentially-expressed by sex of the newborn. Our finding that trait-specific RNA gene expression is preserved in unfrozen DBS, demonstrates the technical feasibility of performing molecular genetic profiling using such samples. With millions of DBS potentially available for research, we see new opportunities in using newborn molecular gene expression to better understand molecular pathogenesis of perinatal diseases.
CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo.
Minyan Li
Full Text Available Mammalian spermatogenesis is a highly regulated multistage process of sperm generation. It is hard to uncover the real function of a testis specific gene in vitro since the in vitro model is not yet mature. With the development of the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 system, we can now rapidly generate knockout mouse models of testis specific genes to study the process of spermatogenesis in vivo. SYCP3-like X-linked 2 (SLX2 is a germ cell specific component, which contains a Cor1 domain and belongs to the XLR (X-linked, lymphocyte regulated family. Previous studies suggested that SLX2 might play an important role in mouse spermatogenesis based on its subcellular localization and interacting proteins. However, the function of SLX2 in vivo is still elusive. Here, to investigate the functions of SLX2 in spermatogenesis, we disrupted the Slx2 gene by using the CRISPR/Cas9 system. Since Slx2 is a testis specific X-linked gene, we obtained knockout male mice in the first generation and accelerated the study process. Compared with wild-type mice, Slx2 knockout mice have normal testis and epididymis. Histological observation of testes sections showed that Slx2 knockout affected none of the three main stages of spermatogenesis: mitosis, meiosis and spermiogenesis. In addition, we further confirmed that disruption of Slx2 did not affect the number of spermatogonial stem cells, meiosis progression or XY body formation by immunofluorescence analysis. As spermatogenesis was normal in Slx2 knockout mice, these mice were fertile. Taken together, we showed that Slx2 itself is not an essential gene for mouse spermatogenesis and CRISPR/Cas9 technique could speed up the functional study of testis specific X-linked gene in vivo.
A human-specific de novo protein-coding gene associated with human brain functions.
Chuan-Yun Li
2010-03-01
Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.
Badea, Liviu; Herlea, Vlad; Dima, Simona Olimpia; Dumitrascu, Traian; Popescu, Irinel
2008-01-01
The precise details of pancreatic ductal adenocarcinoma (PDAC) pathogenesis are still insufficiently known, requiring the use of high-throughput methods. However, PDAC is especially difficult to study using microarrays due to its strong desmoplastic reaction, which involves a hyperproliferating stroma that effectively "masks" the contribution of the minoritary neoplastic epithelial cells. Thus it is not clear which of the genes that have been found differentially expressed between normal and whole tumor tissues are due to the tumor epithelia and which simply reflect the differences in cellular composition. To address this problem, laser microdissection studies have been performed, but these have to deal with much smaller tissue sample quantities and therefore have significantly higher experimental noise. In this paper we combine our own large sample whole-tissue study with a previously published smaller sample microdissection study by Grützmann et al. to identify the genes that are specifically overexpressed in PDAC tumor epithelia. The overlap of this list of genes with other microarray studies of pancreatic cancer as well as with the published literature is impressive. Moreover, we find a number of genes whose over-expression appears to be inversely correlated with patient survival: keratin 7, laminin gamma 2, stratifin, platelet phosphofructokinase, annexin A2, MAP4K4 and OACT2 (MBOAT2), which are all specifically upregulated in the neoplastic epithelia, rather than the tumor stroma. We improve on other microarray studies of PDAC by putting together the higher statistical power due to a larger number of samples with information about cell-type specific expression and patient survival.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Cell-Specific PEAR1 Methylation Studies Reveal a Locus that Coordinates Expression of Multiple Genes
Benedetta Izzi
2018-04-01
Full Text Available Chromosomal interactions connect distant enhancers and promoters on the same chromosome, activating or repressing gene expression. PEAR1 encodes the Platelet-Endothelial Aggregation Receptor 1, a contact receptor involved in platelet function and megakaryocyte and endothelial cell proliferation. PEAR1 expression during megakaryocyte differentiation is controlled by DNA methylation at its first CpG island. We identified a PEAR1 cell-specific methylation sensitive region in endothelial cells and megakaryocytes that showed strong chromosomal interactions with ISGL20L2, RRNAD1, MRLP24, HDGF and PRCC, using available promoter capture Hi-C datasets. These genes are involved in ribosome processing, protein synthesis, cell cycle and cell proliferation. We next studied the methylation and expression profile of these five genes in Human Umbilical Vein Endothelial Cells (HUVECs and megakaryocyte precursors. While cell-specific PEAR1 methylation corresponded to variability in expression for four out of five genes, no methylation change was observed in their promoter regions across cell types. Our data suggest that PEAR1 cell-type specific methylation changes may control long distance interactions with other genes. Further studies are needed to show whether such interaction data might be relevant for the genome-wide association data that showed a role for non-coding PEAR1 variants in the same region and platelet function, platelet count and cardiovascular risk.
Dunja Knapp
Full Text Available Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression - early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation.
Wayengera, Misaki
2011-07-22
Infection with HIV, which culminates in the establishment of a latent proviral reservoir, presents formidable challenges for ultimate cure. Building on the hypothesis that ex-vivo or even in-vivo abolition or disruption of HIV-gene/genome-action by target mutagenesis or excision can irreversibly abrogate HIV's innate fitness to replicate and survive, we previously identified the isoschizomeric bacteria restriction enzymes (REases) AcsI and ApoI as potent cleavers of the HIV-pol gene (11 and 9 times in HIV-1 and 2, respectively). However, both enzymes, along with others found to cleave across the entire HIV-1 genome, slice (SX) at palindromic sequences that are prevalent within the human genome and thereby pose the risk of host genome toxicity. A long-term goal in the field of R-M enzymatic therapeutics has thus been to generate synthetic restriction endonucleases with longer recognition sites limited in specificity to HIV. We aimed (i) to assemble and construct zinc finger arrays and nucleases (ZFN) with either proviral-HIV-pol gene or proviral-HIV-1 whole-genome specificity respectively, and (ii) to advance a model for pre-clinically testing lentiviral vectors (LV) that deliver and transduce either ZFN genotype. First, we computationally generated the consensus sequences of (a) 114 dsDNA-binding zinc finger (Zif) arrays (ZFAs or ZifHIV-pol) and (b) two zinc-finger nucleases (ZFNs) which, unlike the AcsI and ApoI homeodomains, possess specificity to >18 base-pair sequences uniquely present within the HIV-pol gene (ZifHIV-polFN). Another 15 ZFNs targeting >18 bp sequences within the complete HIV-1 proviral genome were constructed (ZifHIV-1FN). Second, a model for constructing lentiviral vectors (LVs) that deliver and transduce a diploid copy of either ZifHIV-polFN or ZifHIV-1FN chimeric genes (termed LV- 2xZifHIV-polFN and LV- 2xZifHIV-1FN, respectively) is proposed. Third, two preclinical models for controlled testing of the safety and efficacy of either of these
Play in two societies: pervasiveness of process, specificity of structure.
Bornstein, M H; Haynes, O M; Pascual, L; Painter, K M; Galperín, C
1999-01-01
The present study compared Argentine (N = 39) and U.S. (N = 43) children and their mothers on exploratory, symbolic, and social play and interaction when children were 20 months of age. Patterns of cultural similarity and difference emerged. In both cultures, boys engaged in more exploratory play than girls, and girls engaged in more symbolic play than boys; mothers of boys engaged in more exploratory play than mothers of girls, and mothers of girls engaged in more symbolic play than mothers of boys. Moreover, in both cultures, individual variation in children's exploratory and symbolic play was specifically associated with individual variation in mothers' exploratory and symbolic play, respectively. Between cultures, U.S. children and their mothers engaged in more exploratory play, whereas Argentine children and their mothers engaged in more symbolic play. Moreover, Argentine mothers exceeded U.S. mothers in social play and verbal praise of their children. During an early period of mental and social growth, general developmental processes in play may be pervasive, but dyadic and cultural structures are apparently specific. Overall, Argentine and U.S. dyads utilized different modes of exploration, representation, and interaction--emphasizing "other-directed" acts of pretense versus "functional" and "combinatorial" exploration, for example--and these individual and dyadic allocentric versus idiocentric stresses accord with larger cultural concerns of collectivism versus individualism in the two societies.
Pestov, Nikolay B.; Dmitriev, Ruslan I.; Kostina, Maria B.; Korneenko, Tatyana V.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.
2012-01-01
Highlights: ► Full-length secretory pathway Ca-ATPase (SPCA2) cloned from rat duodenum. ► ATP2C2 gene (encoding SPCA2) exists only in genomes of Tetrapoda. ► Rat and pig SPCA2 are expressed in intestines, lung and some secretory glands. ► Subcellular localization of SPCA2 may depend on tissue type. ► In rat duodenum, SPCA2 is localized in plasma membrane-associated compartments. -- Abstract: Secretory pathway Ca-ATPases are less characterized mammalian calcium pumps than plasma membrane Ca-ATPases and sarco-endoplasmic reticulum Ca-ATPases. Here we report analysis of molecular evolution, alternative splicing, tissue-specific expression and subcellular localization of the second isoform of the secretory pathway Ca-ATPase (SPCA2), the product of the ATP2C2 gene. The primary structure of SPCA2 from rat duodenum deduced from full-length transcript contains 944 amino acid residues, and exhibits 65% sequence identity with known SPCA1. The rat SPCA2 sequence is also highly homologous to putative human protein KIAA0703, however, the latter seems to have an aberrant N-terminus originating from intron 2. The tissue-specificity of SPCA2 expression is different from ubiquitous SPCA1. Rat SPCA2 transcripts were detected predominantly in gastrointestinal tract, lung, trachea, lactating mammary gland, skin and preputial gland. In the newborn pig, the expression profile is very similar with one remarkable exception: porcine bulbourethral gland gave the strongest signal. Upon overexpression in cultured cells, SPCA2 shows an intracellular distribution with remarkable enrichment in Golgi. However, in vivo SPCA2 may be localized in compartments that differ among various tissues: it is intracellular in epidermis, but enriched in plasma membranes of the intestinal epithelium. Analysis of SPCA2 sequences from various vertebrate species argue that ATP2C2 gene radiated from ATP2C1 (encoding SPCA1) during adaptation of tetrapod ancestors to terrestrial habitats.
Digital sorting of complex tissues for cell type-specific gene expression profiles.
Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong
2013-03-07
Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.
Nelle Lambert
2011-03-01
Full Text Available The developmental mechanisms through which the cerebral cortex increased in size and complexity during primate evolution are essentially unknown. To uncover genetic networks active in the developing cerebral cortex, we combined three-dimensional reconstruction of human fetal brains at midgestation and whole genome expression profiling. This novel approach enabled transcriptional characterization of neurons from accurately defined cortical regions containing presumptive Broca and Wernicke language areas, as well as surrounding associative areas. We identified hundreds of genes displaying differential expression between the two regions, but no significant difference in gene expression between left and right hemispheres. Validation by qRTPCR and in situ hybridization confirmed the robustness of our approach and revealed novel patterns of area- and layer-specific expression throughout the developing cortex. Genes differentially expressed between cortical areas were significantly associated with fast-evolving non-coding sequences harboring human-specific substitutions that could lead to divergence in their repertoires of transcription factor binding sites. Strikingly, while some of these sequences were accelerated in the human lineage only, many others were accelerated in chimpanzee and/or mouse lineages, indicating that genes important for cortical development may be particularly prone to changes in transcriptional regulation across mammals. Genes differentially expressed between cortical regions were also enriched for transcriptional targets of FoxP2, a key gene for the acquisition of language abilities in humans. Our findings point to a subset of genes with a unique combination of cortical areal expression and evolutionary patterns, suggesting that they play important roles in the transcriptional network underlying human-specific neural traits.
On the specification of structural equation models for ecological systems
Grace, J.B.; Michael, Anderson T.; Han, O.; Scheiner, S.M.
2010-01-01
The use of structural equation modeling (SEM) is often motivated by its utility for investigating complex networks of relationships, but also because of its promise as a means of representing theoretical concepts using latent variables. In this paper, we discuss characteristics of ecological theory and some of the challenges for proper specification of theoretical ideas in structural equation models (SE models). In our presentation, we describe some of the requirements for classical latent variable models in which observed variables (indicators) are interpreted as the effects of underlying causes. We also describe alternative model specifications in which indicators are interpreted as having causal influences on the theoretical concepts. We suggest that this latter nonclassical specification (which involves another variable type-the composite) will often be appropriate for ecological studies because of the multifaceted nature of our theoretical concepts. In this paper, we employ the use of meta-models to aid the translation of theory into SE models and also to facilitate our ability to relate results back to our theories. We demonstrate our approach by showing how a synthetic theory of grassland biodiversity can be evaluated using SEM and data from a coastal grassland. In this example, the theory focuses on the responses of species richness to abiotic stress and disturbance, both directly and through intervening effects on community biomass. Models examined include both those based on classical forms (where each concept is represented using a single latent variable) and also ones in which the concepts are recognized to be multifaceted and modeled as such. To address the challenge of matching SE models with the conceptual level of our theory, two approaches are illustrated, compositing and aggregation. Both approaches are shown to have merits, with the former being preferable for cases where the multiple facets of a concept have widely differing effects in the
A clade-specific Arabidopsis gene connects primary metabolism and senescence
Plants have to deal with environmental insults as they cannot move to escape from stressful conditions. To do so, they have evolved novel components that respond to the changing environments. A primary example is Qua Quine Starch (QQS, AT3G30720), an Arabidopsis thaliana-specific (orphan) gene that ...
Regulatory regions in the rat lactase-phlorizin hydrolase gene that control cell-specific expression
Verhave, Menno; Krasinski, Stephen D.; Christian, Sara I.; van Schaik, Sandrijn; van den Brink, Gijs R.; Doting, Edwina M. H.; Maas, Saskia M.; Wolthers, Katja C.; Grand, Richard J.; Montgomery, Robert K.
2004-01-01
OBJECTIVES: Lactase-phlorizin hydrolase (LPH) is an enterocyte-specific gene whose expression has been well-characterized, not only developmentally but also along the crypt-villus axis and along the length of the small bowel. Previous studies from the authors' laboratory have demonstrated that 2 kb
Pleiotropic role of growth arrest-specific gene 6 in atherosclerosis
Tjwa, Marc; Moons, Lieve; Lutgens, Esther
2009-01-01
Growth arrest-specific gene 6 (Gas6) belongs to the family of vitamin K-dependent coagulation proteins, but in contrast to its other members, has only a limited role in hemostasis. Instead, Gas6 plays a prominent role in conditions of injury, inflammation and repair. Gas6 amplifies the activation of
Sex-specific gonadal and gene expression changes throughout development in fathead minnow
Although fathead minnows (Pimephales promelas) are commonly used as a model fish in endocrine disruption studies, none have characterized sex-specific baseline expression of genes involved in sex differentiation during development in this species. Using a sex-linked DNA marker t...
Gene expression profiling in autoimmune diseases: chronic inflammation or disease specific patterns?
Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo
2007-01-01
) patients and healthy individuals were specific for the arthritic process or likewise altered in other chronic inflammatory diseases such as chronic autoimmune thyroiditis (Hashimoto's thyroiditis, HT) and inflammatory bowel disease (IBD). Using qPCR for 18 RA-discriminative genes, there were no significant...
Multiple loci with different cancer specificities within the 8q24 gene desert
Ghoussaini, M.; Song, H.; Koessler, T.
2008-01-01
this gene desert were specifically associated with risks of different cancers. One block was solely associated with risk of breast cancer, three others were associated solely with the risk of prostate cancer, and a fifth was associated with the risk of prostate, colorectal, and ovarian cancer...
Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing
2009-03-11
Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene
Day, Karen P; Artzy-Randrup, Yael; Tiedje, Kathryn E; Rougeron, Virginie; Chen, Donald S; Rask, Thomas S; Rorick, Mary M; Migot-Nabias, Florence; Deloron, Philippe; Luty, Adrian J F; Pascual, Mercedes
2017-05-16
Existing theory on competition for hosts between pathogen strains has proposed that immune selection can lead to the maintenance of strain structure consisting of discrete, weakly overlapping antigenic repertoires. This prediction of strain theory has conceptual overlap with fundamental ideas in ecology on niche partitioning and limiting similarity between coexisting species in an ecosystem, which oppose the hypothesis of neutral coexistence. For Plasmodium falciparum , strain theory has been specifically proposed in relation to the major surface antigen of the blood stage, known as Pf EMP1 and encoded by the multicopy multigene family known as the var genes. Deep sampling of the DBLα domain of var genes in the local population of Bakoumba, West Africa, was completed to define whether patterns of repertoire overlap support a role of immune selection under the opposing force of high outcrossing, a characteristic of areas of intense malaria transmission. Using a 454 high-throughput sequencing protocol, we report extremely high diversity of the DBLα domain and a large parasite population with DBLα repertoires structured into nonrandom patterns of overlap. Such population structure, significant for the high diversity of var genes that compose it at a local level, supports the existence of "strains" characterized by distinct var gene repertoires. Nonneutral, frequency-dependent competition would be at play and could underlie these patterns. With a computational experiment that simulates an intervention similar to mass drug administration, we argue that the observed repertoire structure matters for the antigenic var diversity of the parasite population remaining after intervention.
Structure of the human hepatic triglyceride lipase gene
Cai, Shengjian; Wong, D.M.; Chen, Sanhwan; Chan, L.
1989-01-01
The structure of the human hepatic triglyceride lipase gene was determined from multiple cosmid clones. All the exons, exon-intron junctions, and 845 bp of the 5' and 254 bp of the 3' flanking DNA were sequenced. Comparison of the exon sequences to three previously published cDNA sequences revealed differences in the sequence of the codons for residue 133, 193, 202, and 234 that may represent sequence polymorphisms. By primer extension, hepatic lipase mRNA initiates at an adenine 77 bases upstream of the translation initiation site. The hepatic lipase gene spans over 60 kb containing 9 exons and 8 introns, the latter being all located within the region encoding the mature protein. The exons are all of average size (118-234 bp). Exon 1 encodes the signal peptide, exon 4, a region that binds to the lipoprotein substrate, and exon 5, an evolutionarily highly conserved region of potential catalytic function, and exons 6 and 9 encode sequences rich in basic amino acids thought to be important in anchoring the enzyme to the endothelial surface by interacting with acidic domains of the surface glycosaminoglycans. The human lipoprotein lipase gene has been recently reported to have an identical exon-intron organization containing the analogous structural domains. The observations strongly support the common evolutionary origin of these two lipolytic enzymes
K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)
2013-01-01
textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with
Tissue specific promoters improve the localization of radiation-inducible gene expression
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Spelsberg, T.; Hora, J.; Horton, M.; Goldberger, A.; Littlefield, B.; Seelke, R.; Toyoda, H.
1987-01-01
Steroid hormones circulate in the blood and are taken by target cells via complexes with intracellular binding proteins termed receptors, that are hormone and tissue specific. Each receptor binds it specific steroid with very high affinity, having an equilibrium dissociation constant (K/sub d/) in the range of 10 -9 to 10 -10 M. Once bound by their specific steroid hormones, the steroid receptors undergo a conformational change which allows them to bind with high affinity to sites on chromatin, termed nuclear acceptor sites. There are estimated 5,000 to 10,000 of these sites expressed with an equal number not expressed (''masked'') in intact chromatin. The result of the binding to nuclear acceptor sites is an alteration of gene transcription or, in some cases, gene expression as measured by the changing levels of specific RNAs and proteins in that target tissue. Each steroid regulates specific effects on the RNA and protein profiles. The chronology of the above mechanism of action after injection of radiolabelled steroid as is follows: Steroid-receptor complex formation (1 minute), nuclear acceptor sites (2 minutes), effects on RNA synthesis (10 to 30 minutes), and finally the changing protein profiles via changes in protein synthesis and protein turnover (1 to 6 hours). Thus steroid receptors represent one of the first identified intracellular gene regulation proteins. The receptor molecules themselves are regulated by the presence or absence of the steroid molecule
Using Merkel cell polyomavirus specific TCR gene therapy for treatment of Merkel cellcarcinoma
Lyngaa, Rikke Birgitte; Pedersen, Natasja Wulff; Linnemann, C.
2016-01-01
T cell receptor gene-therapy has entered the clinic and shown potential for successful cancer treatment. However, the clinical evaluation has also highlighted the need for selection of truly cancerspecific targets. Merkel cell carcinoma (MCC) is a highly aggressive skin cancer associated with Mer......T cell receptor gene-therapy has entered the clinic and shown potential for successful cancer treatment. However, the clinical evaluation has also highlighted the need for selection of truly cancerspecific targets. Merkel cell carcinoma (MCC) is a highly aggressive skin cancer associated...... with Merkel cell polyomavirus (MCPyV). Due to the clear viral correlation CD8+ T cells specific for viral epitopes could potentially form cancer-specific targets in MCC patients. We have identified MCPyV specific T cells using a high-throughput platform for T-cell enrichment and combinatorial encoding...
Allele-specific gene expression in a wild nonhuman primate population
Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.
2015-01-01
Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779
Giuliani, Alessandro; Tomita, Masaru
2010-01-01
Cell fate decision remarkably generates specific cell differentiation path among the multiple possibilities that can arise through the complex interplay of high-dimensional genome activities. The coordinated action of thousands of genes to switch cell fate decision has indicated the existence of stable attractors guiding the process. However, origins of the intracellular mechanisms that create “cellular attractor” still remain unknown. Here, we examined the collective behavior of genome-wide expressions for neutrophil differentiation through two different stimuli, dimethyl sulfoxide (DMSO) and all-trans-retinoic acid (atRA). To overcome the difficulties of dealing with single gene expression noises, we grouped genes into ensembles and analyzed their expression dynamics in correlation space defined by Pearson correlation and mutual information. The standard deviation of correlation distributions of gene ensembles reduces when the ensemble size is increased following the inverse square root law, for both ensembles chosen randomly from whole genome and ranked according to expression variances across time. Choosing the ensemble size of 200 genes, we show the two probability distributions of correlations of randomly selected genes for atRA and DMSO responses overlapped after 48 hours, defining the neutrophil attractor. Next, tracking the ranked ensembles' trajectories, we noticed that only certain, not all, fall into the attractor in a fractal-like manner. The removal of these genome elements from the whole genomes, for both atRA and DMSO responses, destroys the attractor providing evidence for the existence of specific genome elements (named “genome vehicle”) responsible for the neutrophil attractor. Notably, within the genome vehicles, genes with low or moderate expression changes, which are often considered noisy and insignificant, are essential components for the creation of the neutrophil attractor. Further investigations along with our findings might
Towards the identification of flower-specific genes in Citrus spp
Marcelo Carnier Dornelas
2007-01-01
Full Text Available Citrus sinensis is a perennial woody species, for which genetic approaches to the study of reproductive development are not readily amenable. Here, the usefulness of the CitEST Expressed Sequence Tag (EST database is demonstrated as a reliable new resource for identifying novel genes exclusively related to Citrus reproductive biology. We performed the analysis of an EST dataset of the CitEST Project containing 4,330 flower-derived cDNA sequences. Relying on bioinformatics tools, sequences exclusively present in this flower-derived sequence collection were selected and used for the identification of Citrus putative flower-specific genes. Our analysis revealed several Citrus sequences showing significant similarity to conserved genes known to have flower-specific expression and possessing functions related to flower metabolism and/or reproductive development in diverse plant species. Comparison of the Citrus flower-specific sequences with all available plant peptide sequences unraveled 247 unique transcripts not identified elsewhere within the plant kingdom. Additionally, 49 transcripts, for which no biological function could be attributed by means of sequence comparisons, were found to be conserved among plant species. These results allow further gene expression analysis and possibly novel approaches to the understanding of reproductive development in Citrus.
Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian
2004-01-01
Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341
DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli
Kenyon, C.J.; Walker, G.C.
1988-05-01
Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.
Gene-specific correlation of RNA and protein levels in human cells and tissues
Edfors, Fredrik; Danielsson, Frida; Hallström, Björn M.
2016-01-01
An important issue for molecular biology is to establish whether transcript levels of a given gene can be used as proxies for the corresponding protein levels. Here, we have developed a targeted proteomics approach for a set of human non-secreted proteins based on parallel reaction monitoring...... to measure, at steady-state conditions, absolute protein copy numbers across human tissues and cell lines and compared these levels with the corresponding mRNA levels using transcriptomics. The study shows that the transcript and protein levels do not correlate well unless a gene-specific RNA-to-protein (RTP...
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Linker histones: novel insights into structure-specific recognition of the nucleosome.
Cutter, Amber R; Hayes, Jeffrey J
2017-04-01
Linker histones (H1s) are a primary component of metazoan chromatin, fulfilling numerous functions, both in vitro and in vivo, including stabilizing the wrapping of DNA around the nucleosome, promoting folding and assembly of higher order chromatin structures, influencing nucleosome spacing on DNA, and regulating specific gene expression. However, many molecular details of how H1 binds to nucleosomes and recognizes unique structural features on the nucleosome surface remain undefined. Numerous, confounding studies are complicated not only by experimental limitations, but the use of different linker histone isoforms and nucleosome constructions. This review summarizes the decades of research that has resulted in several models of H1 association with nucleosomes, with a focus on recent advances that suggest multiple modes of H1 interaction in chromatin, while highlighting the remaining questions.
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Horiuchi, Youko
2015-12-23
Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression
Mónica Serrano
2015-04-01
Full Text Available Gene expression during spore development in Bacillus subtilis is controlled by cell type-specific RNA polymerase sigma factors. σFand σE control early stages of development in the forespore and the mother cell, respectively. When, at an intermediate stage in development, the mother cell engulfs the forespore, σF is replaced by σG and σE is replaced by σK. The anti-sigma factor CsfB is produced under the control of σF and binds to and inhibits the auto-regulatory σG, but not σF. A position in region 2.1, occupied by an asparagine in σG and by a glutamate in οF, is sufficient for CsfB discrimination of the two sigmas, and allows it to delay the early to late switch in forespore gene expression. We now show that following engulfment completion, csfB is switched on in the mother cell under the control of σK and that CsfB binds to and inhibits σE but not σK, possibly to facilitate the switch from early to late gene expression. We show that a position in region 2.3 occupied by a conserved asparagine in σE and by a conserved glutamate in σK suffices for discrimination by CsfB. We also show that CsfB prevents activation of σG in the mother cell and the premature σG-dependent activation of σK. Thus, CsfB establishes negative feedback loops that curtail the activity of σE and prevent the ectopic activation of σG in the mother cell. The capacity of CsfB to directly block σE activity may also explain how CsfB plays a role as one of the several mechanisms that prevent σE activation in the forespore. Thus the capacity of CsfB to differentiate between the highly similar σF/σG and σE/σK pairs allows it to rinforce the cell-type specificity of these sigma factors and the transition from early to late development in B. subtilis, and possibly in all sporeformers that encode a CsfB orthologue.
2013-01-01
Background The environment is the likely source of many pathogenic mycobacterial species but detection of mycobacteria by bacteriological tools is generally difficult and time-consuming. Consequently, several molecular targets based on the sequences of housekeeping genes, non-functional RNA and structural ribosomal RNAs have been proposed for the detection and identification of mycobacteria in clinical or environmental samples. While certain of these targets were proposed as specific for this genus, most are prone to false positive results in complex environmental samples that include related, but distinct, bacterial genera. Nowadays the increased number of sequenced genomes and the availability of software for genomic comparison provide tools to develop novel, mycobacteria-specific targets, and the associated molecular probes and primers. Consequently, we conducted an in silico search for proteins exclusive to Mycobacterium spp. genomes in order to design sensitive and specific molecular targets. Results Among the 3989 predicted proteins from M. tuberculosis H37Rv, only 11 proteins showed 80% to 100% of similarity with Mycobacterium spp. genomes, and less than 50% of similarity with genomes of closely related Corynebacterium, Nocardia and Rhodococcus genera. Based on DNA sequence alignments, we designed primer pairs and a probe that specifically detect the atpE gene of mycobacteria, as verified by quantitative real-time PCR on a collection of mycobacteria and non-mycobacterial species. The real-time PCR method we developed was successfully used to detect mycobacteria in tap water and lake samples. Conclusions The results indicate that this real-time PCR method targeting the atpE gene can serve for highly specific detection and precise quantification of Mycobacterium spp. in environmental samples. PMID:24299240
Cell-type-specific gene delivery into neuronal cells in vitro and in vivo
Parveen, Zahida; Mukhtar, Muhammad; Rafi, Mohammed; Wenger, David A.; Siddiqui, Khwaja M.; Siler, Catherine A.; Dietzschold, Bernhard; Pomerantz, Roger J.; Schnell, Matthias J.; Dornburg, Ralph
2003-01-01
The avian retroviruses reticuloendotheliosis virus strain A (REV-A) and spleen necrosis virus (SNV) are not naturally infectious in human cells. However, REV-A-derived viral vectors efficiently infect human cells when they are pseudotyped with envelope proteins displaying targeting ligands specific for human cell-surface receptors. Here we report that vectors containing the gag region of REV-A and pol of SNV can be pseudotyped with the envelope protein of vesicular stomatitis virus (VSV) and the glycoproteins of different rabies virus (RV) strains. Vectors pseudotyped with the envelope protein of the highly neurotropic RV strain CVS-N2c facilitated cell type-specific gene delivery into mouse and human neurons, but did not infect other human cell types. Moreover, when such vector particles were injected into the brain of newborn mice, only neuronal cells were infected in vivo. Cell-type-specific gene delivery into neurons may present quite specific gene therapy approaches for many degenerative diseases of the brain
Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.
2003-01-01
Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.
Dumeige, Laurence; Storey, Caroline; Decourtye, Lyvianne; Nehlich, Melanie; Lhadj, Christophe; Viengchareun, Say; Kappeler, Laurent; Lombès, Marc; Martinerie, Laetitia
2017-01-01
Sex differences have been identified in various biological processes, including hypertension. The mineralocorticoid signaling pathway is an important contributor to early arterial hypertension, however its sex-specific expression has been scarcely studied, particularly with respect to the kidney. Basal systolic blood pressure (SBP) and heart rate (HR) were measured in adult male and female mice. Renal gene expression studies of major players of mineralocorticoid signaling were performed at different developmental stages in male and female mice using reverse transcription quantitative PCR (RT-qPCR), and were compared to those of the same genes in the lung, another mineralocorticoid epithelial target tissue that regulates ion exchange and electrolyte balance. The role of sex hormones in the regulation of these genes was also investigated in differentiated KC3AC1 renal cells. Additionally, renal expression of the 11 β-hydroxysteroid dehydrogenase type 2 (11βHSD2) protein, a regulator of mineralocorticoid specificity, was measured by immunoblotting and its activity was indirectly assessed in the plasma using liquid-chromatography coupled to mass spectrometry in tandem (LC-MSMS) method. SBP and HR were found to be significantly lower in females compared to males. This was accompanied by a sex- and tissue-specific expression profile throughout renal development of the mineralocorticoid target genes serum and glucocorticoid-regulated kinase 1 (Sgk1) and glucocorticoid-induced leucine zipper protein (Gilz), together with Hsd11b2, Finally, the implication of sex hormones in this sex-specific expression profile was demonstrated in vitro, most notably for Gilz mRNA expression. We demonstrate a tissue-specific, sex-dependent and developmentally-regulated pattern of expression of the mineralocorticoid pathway that could have important implications in physiology and pathology. PMID:28230786
Optimal structural inference of signaling pathways from unordered and overlapping gene sets.
Acharya, Lipi R; Judeh, Thair; Wang, Guangdi; Zhu, Dongxiao
2012-02-15
A plethora of bioinformatics analysis has led to the discovery of numerous gene sets, which can be interpreted as discrete measurements emitted from latent signaling pathways. Their potential to infer signaling pathway structures, however, has not been sufficiently exploited. Existing methods accommodating discrete data do not explicitly consider signal cascading mechanisms that characterize a signaling pathway. Novel computational methods are thus needed to fully utilize gene sets and broaden the scope from focusing only on pairwise interactions to the more general cascading events in the inference of signaling pathway structures. We propose a gene set based simulated annealing (SA) algorithm for the reconstruction of signaling pathway structures. A signaling pathway structure is a directed graph containing up to a few hundred nodes and many overlapping signal cascades, where each cascade represents a chain of molecular interactions from the cell surface to the nucleus. Gene sets in our context refer to discrete sets of genes participating in signal cascades, the basic building blocks of a signaling pathway, with no prior information about gene orderings in the cascades. From a compendium of gene sets related to a pathway, SA aims to search for signal cascades that characterize the optimal signaling pathway structure. In the search process, the extent of overlap among signal cascades is used to measure the optimality of a structure. Throughout, we treat gene sets as random samples from a first-order Markov chain model. We evaluated the performance of SA in three case studies. In the first study conducted on 83 KEGG pathways, SA demonstrated a significantly better performance than Bayesian network methods. Since both SA and Bayesian network methods accommodate discrete data, use a 'search and score' network learning strategy and output a directed network, they can be compared in terms of performance and computational time. In the second study, we compared SA and
Controlling nuclear JAKs and STATs for specific gene activation by IFNγ
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.
2011-01-01
Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The
Shimpei Morimoto
2018-03-01
Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after
Community Structure Analysis of Gene Interaction Networks in Duchenne Muscular Dystrophy.
Tejaswini Narayanan
Full Text Available Duchenne Muscular Dystrophy (DMD is an important pathology associated with the human skeletal muscle and has been studied extensively. Gene expression measurements on skeletal muscle of patients afflicted with DMD provides the opportunity to understand the underlying mechanisms that lead to the pathology. Community structure analysis is a useful computational technique for understanding and modeling genetic interaction networks. In this paper, we leverage this technique in combination with gene expression measurements from normal and DMD patient skeletal muscle tissue to study the structure of genetic interactions in the context of DMD. We define a novel framework for transforming a raw dataset of gene expression measurements into an interaction network, and subsequently apply algorithms for community structure analysis for the extraction of topological communities. The emergent communities are analyzed from a biological standpoint in terms of their constituent biological pathways, and an interpretation that draws correlations between functional and structural organization of the genetic interactions is presented. We also compare these communities and associated functions in pathology against those in normal human skeletal muscle. In particular, differential enhancements are observed in the following pathways between pathological and normal cases: Metabolic, Focal adhesion, Regulation of actin cytoskeleton and Cell adhesion, and implication of these mechanisms are supported by prior work. Furthermore, our study also includes a gene-level analysis to identify genes that are involved in the coupling between the pathways of interest. We believe that our results serve to highlight important distinguishing features in the structural/functional organization of constituent biological pathways, as it relates to normal and DMD cases, and provide the mechanistic basis for further biological investigations into specific pathways differently regulated
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)
2016-05-27
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen
2016-01-01
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Li, Honglei; Thiyagarajan, Vengatesen; Qian, Pei Yuan
2010-01-01
Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.
Li, Honglei
2010-06-01
Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.
Retrotransposon hypomethylation in melanoma and expression of a placenta-specific gene.
Erin C Macaulay
Full Text Available In the human placenta, DNA hypomethylation permits the expression of retrotransposon-derived genes that are normally silenced by methylation in somatic tissues. We previously identified hypomethylation of a retrotransposon-derived transcript of the voltage-gated potassium channel gene KCNH5 that is expressed only in human placenta. However, an RNA sequence from this placental-specific transcript has been reported in melanoma. This study examined the promoter methylation and expression of the retrotransposon-derived KCNH5 transcript in 25 melanoma cell lines to determine whether the acquisition of 'placental' epigenetic marks is a feature of melanoma. Methylation and gene expression analysis revealed hypomethylation of this retrotransposon in melanoma cell lines, particularly in those samples that express the placental KCNH5 transcript. Therefore we propose that hypomethylation of the placental-specific KCNH5 promoter is frequently associated with KCNH5 expression in melanoma cells. Our findings show that melanoma can develop hypomethylation of a retrotransposon-derived gene; a characteristic notably shared with the normal placenta.
eap Gene as novel target for specific identification of Staphylococcus aureus.
Hussain, Muzaffar; von Eiff, Christof; Sinha, Bhanu; Joost, Insa; Herrmann, Mathias; Peters, Georg; Becker, Karsten
2008-02-01
The cell surface-associated extracellular adherence protein (Eap) mediates adherence of Staphylococcus aureus to host extracellular matrix components and inhibits inflammation, wound healing, and angiogenesis. A well-characterized collection of S. aureus and non-S. aureus staphylococcal isolates (n = 813) was tested for the presence of the Eap-encoding gene (eap) by PCR to investigate the use of the eap gene as a specific diagnostic tool for identification of S. aureus. Whereas all 597 S. aureus isolates were eap positive, this gene was not detectable in 216 non-S. aureus staphylococcal isolates comprising 47 different species and subspecies of coagulase-negative staphylococci and non-S. aureus coagulase-positive or coagulase-variable staphylococci. Furthermore, non-S. aureus isolates did not express Eap homologs, as verified on the transcriptional and protein levels. Based on these data, the sensitivity and specificity of the newly developed PCR targeting the eap gene were both 100%. Thus, the unique occurrence of Eap in S. aureus offers a promising tool particularly suitable for molecular diagnostics of this pathogen.
Wayengera Misaki
2011-07-01
Full Text Available Abstract Background Infection with HIV, which culminates in the establishment of a latent proviral reservoir, presents formidable challenges for ultimate cure. Building on the hypothesis that ex-vivo or even in-vivo abolition or disruption of HIV-gene/genome-action by target mutagenesis or excision can irreversibly abrogate HIV's innate fitness to replicate and survive, we previously identified the isoschizomeric bacteria restriction enzymes (REases AcsI and ApoI as potent cleavers of the HIV-pol gene (11 and 9 times in HIV-1 and 2, respectively. However, both enzymes, along with others found to cleave across the entire HIV-1 genome, slice (SX at palindromic sequences that are prevalent within the human genome and thereby pose the risk of host genome toxicity. A long-term goal in the field of R-M enzymatic therapeutics has thus been to generate synthetic restriction endonucleases with longer recognition sites limited in specificity to HIV. We aimed (i to assemble and construct zinc finger arrays and nucleases (ZFN with either proviral-HIV-pol gene or proviral-HIV-1 whole-genome specificity respectively, and (ii to advance a model for pre-clinically testing lentiviral vectors (LV that deliver and transduce either ZFN genotype. Methods and Results First, we computationally generated the consensus sequences of (a 114 dsDNA-binding zinc finger (Zif arrays (ZFAs or ZifHIV-pol and (b two zinc-finger nucleases (ZFNs which, unlike the AcsI and ApoI homeodomains, possess specificity to >18 base-pair sequences uniquely present within the HIV-pol gene (ZifHIV-polFN. Another 15 ZFNs targeting >18 bp sequences within the complete HIV-1 proviral genome were constructed (ZifHIV-1FN. Second, a model for constructing lentiviral vectors (LVs that deliver and transduce a diploid copy of either ZifHIV-polFN or ZifHIV-1FN chimeric genes (termed LV- 2xZifHIV-polFN and LV- 2xZifHIV-1FN, respectively is proposed. Third, two preclinical models for controlled testing of
Guide Structures in CD-ROM Dictionaries, with Specific Reference ...
Since the appearance of that article, various academics have written articles and read ... The access and mediostructures of the Microsoft Encarta World English ... structures, inner access structure, inner search path, internet, mediostructure, ...
Crew, Jennifer R.; Falzari, Kanakeshwari; DiMario, Joseph X.
2010-01-01
Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-γ co-activator-1 (PGC-1α) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.
Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Łotocka, Barbara; Wójcik, Magdalena
2015-01-01
The phylogeny of symbiotic genes of Astragalus glycyphyllos L. (liquorice milkvetch) nodule isolates was studied by comparative sequence analysis of nodA, nodC, nodH and nifH loci. In all these genes phylograms, liquorice milkvetch rhizobia (closely related to bacteria of three species, i.e. Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium ciceri) formed one clearly separate cluster suggesting the horizontal transfer of symbiotic genes from a single ancestor to the bacteria being studied. The high sequence similarity of the symbiotic genes of A. glycyphyllos rhizobia (99-100% in the case of nodAC and nifH genes, and 98-99% in the case of nodH one) points to the relatively recent (in evolutionary scale) lateral transfer of these genes. In the nodACH and nifH phylograms, A. glycyphyllos nodule isolates were grouped together with the genus Mesorhizobium species in one monophyletic clade, close to M. ciceri, Mesorhizobium opportunistum and Mesorhizobium australicum symbiovar biserrulae bacteria, which correlates with the close relationship of these rhizobia host plants. Plant tests revealed the narrow host range of A. glycyphyllos rhizobia. They formed effective symbiotic interactions with their native host (A. glycyphyllos) and Amorpha fruticosa but not with 11 other fabacean species. The nodules induced on A. glycyphyllos roots were indeterminate with apical, persistent meristem, an age gradient of nodule tissues and cortical vascular bundles. To reflect the symbiosis-adaptive phenotype of rhizobia, specific for A. glycyphyllos, we propose for these bacteria the new symbiovar "glycyphyllae", based on nodA and nodC genes sequences.
Male germ cell-specific expression of a novel Patched-domain containing gene Ptchd3
Fan Jun; Akabane, Hiroto; Zheng Xuehai; Zhou Xuan; Zhang Li; Liu Qiang; Zhang Yonglian; Yang Jing; Zhu Guozhang
2007-01-01
The Hedgehog (Hh) signaling pathway plays an important role in various biological processes, including pattern formation, cell fate determination, proliferation, and differentiation. Hh function is mediated through its membrane receptor Patched. Herein, we have characterized a novel Patched-domain containing gene Ptchd3 in mouse. Messenger RNA of Ptchd3 was exclusively detected in the testis, and existed in two isoforms Ptchd3a and Ptchd3b. The expression of these two mRNA isoforms was shown to be developmentally regulated in testes, and specifically found in male germ cells. Further analysis revealed that the Ptchd3 protein was located on the midpiece of mouse, rat and human sperm. Collectively, these results indicate that Ptchd3 is a novel male germ cell-specific gene and may be involved in the Hh signaling to regulate sperm development and/or sperm function
HFE gene: Structure, function, mutations, and associated iron abnormalities.
Barton, James C; Edwards, Corwin Q; Acton, Ronald T
2015-12-15
The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.
Yoshikawa, Mamoru; Kojima, Hiromi; Wada, Kota; Tsukidate, Toshiharu; Okada, Naoko; Saito, Hirohisa; Moriyama, Hiroshi
2006-07-01
To investigate the role of fibroblasts in the pathogenesis of cholesteatoma. Tissue specimens were obtained from our patients. Middle ear cholesteatoma-derived fibroblasts (MECFs) and postauricular skin-derived fibroblasts (SFs) as controls were then cultured for a few weeks. These fibroblasts were stimulated with interleukin (IL) 1alpha and/or IL-1beta before gene expression assays. We used the human genome U133A probe array (GeneChip) and real-time polymerase chain reaction to examine and compare the gene expression profiles of the MECFs and SFs. Six patients who had undergone tympanoplasty. The IL-1alpha-regulated genes were classified into 4 distinct clusters on the basis of profiles differentially regulated by SF and MECF using a hierarchical clustering analysis. The messenger RNA expressions of LARC (liver and activation-regulated chemokine), GMCSF (granulocyte-macrophage colony-stimulating factor), epiregulin, ICAM1 (intercellular adhesion molecule 1), and TGFA (transforming growth factor alpha) were more strongly up-regulated by IL-1alpha and/or IL-1beta in MECF than in SF, suggesting that these fibroblasts derived from different tissues retained their typical gene expression profiles. Fibroblasts may play a role in hyperkeratosis of middle ear cholesteatoma by releasing molecules involved in inflammation and epidermal growth. These fibroblasts may retain tissue-specific characteristics presumably controlled by epigenetic mechanisms.
Regulation of Msx genes by a Bmp gradient is essential for neural crest specification.
Tribulo, Celeste; Aybar, Manuel J; Nguyen, Vu H; Mullins, Mary C; Mayor, Roberto
2003-12-01
There is evidence in Xenopus and zebrafish embryos that the neural crest/neural folds are specified at the border of the neural plate by a precise threshold concentration of a Bmp gradient. In order to understand the molecular mechanism by which a gradient of Bmp is able to specify the neural crest, we analyzed how the expression of Bmp targets, the Msx genes, is regulated and the role that Msx genes has in neural crest specification. As Msx genes are directly downstream of Bmp, we analyzed Msx gene expression after experimental modification in the level of Bmp activity by grafting a bead soaked with noggin into Xenopus embryos, by expressing in the ectoderm a dominant-negative Bmp4 or Bmp receptor in Xenopus and zebrafish embryos, and also through Bmp pathway component mutants in the zebrafish. All the results show that a reduction in the level of Bmp activity leads to an increase in the expression of Msx genes in the neural plate border. Interestingly, by reaching different levels of Bmp activity in animal cap ectoderm, we show that a specific concentration of Bmp induces msx1 expression to a level similar to that required to induce neural crest. Our results indicate that an intermediate level of Bmp activity specifies the expression of Msx genes in the neural fold region. In addition, we have analyzed the role that msx1 plays on neural crest specification. As msx1 has a role in dorsoventral pattering, we have carried out conditional gain- and loss-of-function experiments using different msx1 constructs fused to a glucocorticoid receptor element to avoid an early effect of this factor. We show that msx1 expression is able to induce all other early neural crest markers tested (snail, slug, foxd3) at the time of neural crest specification. Furthermore, the expression of a dominant negative of Msx genes leads to the inhibition of all the neural crest markers analyzed. It has been previously shown that snail is one of the earliest genes acting in the neural crest
Brain region-specific altered expression and association of mitochondria-related genes in autism.
Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Matsuzaki, Hideo; Miyachi, Taishi; Yamada, Satoru; Tsujii, Masatsugu; Tsuchiya, Kenji J; Matsumoto, Kaori; Iwata, Yasuhide; Suzuki, Katsuaki; Ichikawa, Hironobu; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio
2012-11-01
Mitochondrial dysfunction (MtD) has been observed in approximately five percent of children with autism spectrum disorders (ASD). MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA). Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG), motor cortex (MC) and thalamus (THL)) from autism patients (n=8) and controls (n=10) were obtained from the Autism Tissue Program (Princeton, NJ, USA). Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct) method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2), neurofilament, light polypeptide (NEFL) and solute carrier family 25, member 27 (SLC25A27) showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066) and SLC25A27 (P = 0.046; Z-score 1.990) showed genetic association with autism in Caucasian and Japanese samples, respectively. The expression of DNAJC19, DNM1L, LRPPRC
Brain region-specific altered expression and association of mitochondria-related genes in autism
Anitha Ayyappan
2012-11-01
Full Text Available Abstract Background Mitochondrial dysfunction (MtD has been observed in approximately five percent of children with autism spectrum disorders (ASD. MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA. Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. Methods For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG, motor cortex (MC and thalamus (THL from autism patients (n=8 and controls (n=10 were obtained from the Autism Tissue Program (Princeton, NJ, USA. Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Results Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2, neurofilament, light polypeptide (NEFL and solute carrier family 25, member 27 (SLC25A27 showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066 and SLC25A27 (P = 0.046; Z-score 1.990 showed genetic association with autism in Caucasian and Japanese samples, respectively. The
In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer
Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi
2013-01-01
Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC
In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer
Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi
2013-10-04
Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.
Tong, Guo-qing; Heng, Boon-chin; Ng, Soon-chye
2007-01-01
This study investigated whether four cumulus-specific genes: follicular stimulating hormone receptor (FSHr), hyaluronan synthase 2 (Has2), prostaglandin synthase 2 (Ptgs2) and steroidogenic acute regulator protein (Star), were correctly reprogrammed to be transcriptionally silent following somatic cell nuclear transfer (SCNT) in a murine model. Cumulus cells of C57×CBA F1 female mouse were injected into enucleated oocytes, followed by activation in 10 µmol/L strontium chloride for 5 h and sub...
Novel Genes Involved in Controlling Specification of Drosophila FMRFamide Neuropeptide Cells.
Bivik, Caroline; Bahrampour, Shahrzad; Ulvklo, Carina; Nilsson, Patrik; Angel, Anna; Fransson, Fredrik; Lundin, Erika; Renhorn, Jakob; Thor, Stefan
2015-08-01
The expression of neuropeptides is often extremely restricted in the nervous system, making them powerful markers for addressing cell specification . In the developing Drosophila ventral nerve cord, only six cells, the Ap4 neurons, of some 10,000 neurons, express the neuropeptide FMRFamide (FMRFa). Each Ap4/FMRFa neuron is the last-born cell generated by an identifiable and well-studied progenitor cell, neuroblast 5-6 (NB5-6T). The restricted expression of FMRFa and the wealth of information regarding its gene regulation and Ap4 neuron specification makes FMRFa a valuable readout for addressing many aspects of neural development, i.e., spatial and temporal patterning cues, cell cycle control, cell specification, axon transport, and retrograde signaling. To this end, we have conducted a forward genetic screen utilizing an Ap4-specific FMRFa-eGFP transgenic reporter as our readout. A total of 9781 EMS-mutated chromosomes were screened for perturbations in FMRFa-eGFP expression, and 611 mutants were identified. Seventy-nine of the strongest mutants were mapped down to the affected gene by deficiency mapping or whole-genome sequencing. We isolated novel alleles for previously known FMRFa regulators, confirming the validity of the screen. In addition, we identified novel essential genes, including several with previously undefined functions in neural development. Our identification of genes affecting most major steps required for successful terminal differentiation of Ap4 neurons provides a comprehensive view of the genetic flow controlling the generation of highly unique neuronal cell types in the developing nervous system. Copyright © 2015 by the Genetics Society of America.
The use of genetic transformation in the study of ovarian-specific gene expression
Manzi, A.; Andone, S.; Rotoli, D.; Capua, M.R.; Gargiulo, G.; Graziani, F.; Malva, C.
1998-01-01
We are using genetic and molecular approaches to understand the mechanisms controlling the establishment of the cellular specificity of expression during oogenesis. Female-sterile mutations have been isolated and the molecular analysis is revealing interesting cell-cell interaction systems that work not only during oogenesis but also at other developmental stages. We will review in this paper our most recent studies on genes involved in ovarian development. (author)
Runko Suzan J
2005-10-01
Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and
The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...
Poos, Kathrin; Smida, Jan; Nathrath, Michaela; Maugg, Doris; Baumhoer, Daniel; Neumann, Anna; Korsching, Eberhard
2014-01-01
Osteosarcoma (OS) is the most common primary bone cancer exhibiting high genomic instability. This genomic instability affects multiple genes and microRNAs to a varying extent depending on patient and tumor subtype. Massive research is ongoing to identify genes including their gene products and microRNAs that correlate with disease progression and might be used as biomarkers for OS. However, the genomic complexity hampers the identification of reliable biomarkers. Up to now, clinico-pathological factors are the key determinants to guide prognosis and therapeutic treatments. Each day, new studies about OS are published and complicate the acquisition of information to support biomarker discovery and therapeutic improvements. Thus, it is necessary to provide a structured and annotated view on the current OS knowledge that is quick and easily accessible to researchers of the field. Therefore, we developed a publicly available database and Web interface that serves as resource for OS-associated genes and microRNAs. Genes and microRNAs were collected using an automated dictionary-based gene recognition procedure followed by manual review and annotation by experts of the field. In total, 911 genes and 81 microRNAs related to 1331 PubMed abstracts were collected (last update: 29 October 2013). Users can evaluate genes and microRNAs according to their potential prognostic and therapeutic impact, the experimental procedures, the sample types, the biological contexts and microRNA target gene interactions. Additionally, a pathway enrichment analysis of the collected genes highlights different aspects of OS progression. OS requires pathways commonly deregulated in cancer but also features OS-specific alterations like deregulated osteoclast differentiation. To our knowledge, this is the first effort of an OS database containing manual reviewed and annotated up-to-date OS knowledge. It might be a useful resource especially for the bone tumor research community, as specific
Recognizing genes and other components of genomic structure
Burks, C. (Los Alamos National Lab., NM (USA)); Myers, E. (Arizona Univ., Tucson, AZ (USA). Dept. of Computer Science); Stormo, G.D. (Colorado Univ., Boulder, CO (USA). Dept. of Molecular, Cellular and Developmental Biology)
1991-01-01
The Aspen Center for Physics (ACP) sponsored a three-week workshop, with 26 scientists participating, from 28 May to 15 June, 1990. The workshop, entitled Recognizing Genes and Other Components of Genomic Structure, focussed on discussion of current needs and future strategies for developing the ability to identify and predict the presence of complex functional units on sequenced, but otherwise uncharacterized, genomic DNA. We addressed the need for computationally-based, automatic tools for synthesizing available data about individual consensus sequences and local compositional patterns into the composite objects (e.g., genes) that are -- as composite entities -- the true object of interest when scanning DNA sequences. The workshop was structured to promote sustained informal contact and exchange of expertise between molecular biologists, computer scientists, and mathematicians. No participant stayed for less than one week, and most attended for two or three weeks. Computers, software, and databases were available for use as electronic blackboards'' and as the basis for collaborative exploration of ideas being discussed and developed at the workshop. 23 refs., 2 tabs.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Structure-Based Design of CSDK4-Specific Inhibitors
Marmorstein, Ronen
2003-01-01
...) are implicated in more than 80% of human neoplasias (Ortega et al., 2002). For example, the gene encoding the CDK4/6 inhibitory protein, p16INK4, is deleted or mutated in the majority of leukemias, bladder cancers and familial melanomas (Roussel, 1999...
Sarah K Meadows
2008-04-01
Full Text Available Previous work has demonstrated the potential for peripheral blood (PB gene expression profiling for the detection of disease or environmental exposures.We have sought to determine the impact of several variables on the PB gene expression profile of an environmental exposure, ionizing radiation, and to determine the specificity of the PB signature of radiation versus other genotoxic stresses. Neither genotype differences nor the time of PB sampling caused any lessening of the accuracy of PB signatures to predict radiation exposure, but sex difference did influence the accuracy of the prediction of radiation exposure at the lowest level (50 cGy. A PB signature of sepsis was also generated and both the PB signature of radiation and the PB signature of sepsis were found to be 100% specific at distinguishing irradiated from septic animals. We also identified human PB signatures of radiation exposure and chemotherapy treatment which distinguished irradiated patients and chemotherapy-treated individuals within a heterogeneous population with accuracies of 90% and 81%, respectively.We conclude that PB gene expression profiles can be identified in mice and humans that are accurate in predicting medical conditions, are specific to each condition and remain highly accurate over time.
In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.
Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi
2013-10-04
Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.
TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.
Adrienne Baillet
Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.
Wlodarski, Tomasz; Kutner, Jan; Towpik, Joanna; Knizewski, Lukasz; Rychlewski, Leszek; Kudlicki, Andrzej; Rowicka, Maga; Dziembowski, Andrzej; Ginalski, Krzysztof
2011-01-01
Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity). Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.
Tomasz Wlodarski
Full Text Available Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity. Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.
Spitznagel Edward
2003-11-01
Full Text Available Abstract Background The assessment of data reproducibility is essential for application of microarray technology to exploration of biological pathways and disease states. Technical variability in data analysis largely depends on signal intensity. Within that context, the reproducibility of individual probe sets has not been hitherto addressed. Results We used an extraordinarily large replicate data set derived from human placental trophoblast to analyze probe-specific contribution to variability of gene expression. We found that signal variability, in addition to being signal-intensity dependant, is probe set-specific. Importantly, we developed a novel method to quantify the contribution of this probe set-specific variability. Furthermore, we devised a formula that incorporates a priori-computed, replicate-based information on probe set- and intensity-specific variability in determination of expression changes even without technical replicates. Conclusion The strategy of incorporating probe set-specific variability is superior to analysis based on arbitrary fold-change thresholds. We recommend its incorporation to any computation of gene expression changes using high-density DNA microarrays. A Java application implementing our T-score is available at http://www.sadovsky.wustl.edu/tscore.html.
Suzan-Monti Marie
2009-05-01
Full Text Available Abstract Background Acanthamoebae polyphaga Mimivirus (APM is the largest known dsDNA virus. The viral particle has a nearly icosahedral structure with an internal capsid shell surrounded with a dense layer of fibrils. A Capsid protein sequence, D13L, was deduced from the APM L425 coding gene and was shown to be the most abundant protein found within the viral particle. However this protein remained poorly characterised until now. A revised protein sequence deposited in a database suggested an additional N-terminal stretch of 142 amino acids missing from the original deduced sequence. This result led us to investigate the L425 gene structure and the biochemical properties of the complete APM major Capsid protein. Results This study describes the full length 3430 bp Capsid coding gene and characterises the 593 amino acids long corresponding Capsid protein 1. The recombinant full length protein allowed the production of a specific monoclonal antibody able to detect the Capsid protein 1 within the viral particle. This protein appeared to be post-translationnally modified by glycosylation and phosphorylation. We proposed a secondary structure prediction of APM Capsid protein 1 compared to the Capsid protein structure of Paramecium Bursaria Chlorella Virus 1, another member of the Nucleo-Cytoplasmic Large DNA virus family. Conclusion The characterisation of the full length L425 Capsid coding gene of Acanthamoebae polyphaga Mimivirus provides new insights into the structure of the main Capsid protein. The production of a full length recombinant protein will be useful for further structural studies.
Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells.
Yan Huang
Full Text Available A recently developed strategy of sequencing alternative polyadenylation (APA sites (SAPAS with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here, we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs and differentiated mouse embryonic fibroblast cells (MEFs as controls. As a result, we obtained 99,944 poly(A sites, approximately 40% of which were newly detected in our experiments. These poly(A sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site
Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells
Lin, Zhuoheng; Feng, Xuyang; Jiang, Xue; Songyang, Zhou; Huang, Junjiu
2015-01-01
A recently developed strategy of sequencing alternative polyadenylation (APA) sites (SAPAS) with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs) maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here), we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS) and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs) and differentiated mouse embryonic fibroblast cells (MEFs) as controls. As a result, we obtained 99,944 poly(A) sites, approximately 40% of which were newly detected in our experiments. These poly(A) sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA) genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A) switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A) site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site profiles and
Novel strong tissue specific promoter for gene expression in human germ cells
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
Haas, B J; Salzberg, S L; Zhu, W; Pertea, M; Allen, J E; Orvis, J; White, O; Buell, C R; Wortman, J R
2007-12-10
EVidenceModeler (EVM) is presented as an automated eukaryotic gene structure annotation tool that reports eukaryotic gene structures as a weighted consensus of all available evidence. EVM, when combined with the Program to Assemble Spliced Alignments (PASA), yields a comprehensive, configurable annotation system that predicts protein-coding genes and alternatively spliced isoforms. Our experiments on both rice and human genome sequences demonstrate that EVM produces automated gene structure annotation approaching the quality of manual curation.
Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.
Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc
2006-02-01
Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.
Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W
2017-09-01
The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
Konstantin Yarygin
Full Text Available The gut microbiota is essentially a multifunctional bioreactor within a human being. The exploration of its enormous metabolic potential provides insights into the mechanisms underlying microbial ecology and interactions with the host. The data obtained using "shotgun" metagenomics capture information about the whole spectrum of microbial functions. However, each new study presenting new sequencing data tends to extract only a little of the information concerning the metabolic potential and often omits specific functions. A meta-analysis of the available data with an emphasis on biomedically relevant gene groups can unveil new global trends in the gut microbiota. As a step toward the reuse of metagenomic data, we developed a method for the quantitative profiling of user-defined groups of genes in human gut metagenomes. This method is based on the quick analysis of a gene coverage matrix obtained by pre-mapping the metagenomic reads to a global gut microbial catalogue. The method was applied to profile the abundance of several gene groups related to antibiotic resistance, phages, biosynthesis clusters and carbohydrate degradation in 784 metagenomes from healthy populations worldwide and patients with inflammatory bowel diseases and obesity. We discovered country-wise functional specifics in gut resistome and virome compositions. The most distinct features of the disease microbiota were found for Crohn's disease, followed by ulcerative colitis and obesity. Profiling of the genes belonging to crAssphage showed that its abundance varied across the world populations and was not associated with clinical status. We demonstrated temporal resilience of crAssphage and the influence of the sample preparation protocol on its detected abundance. Our approach offers a convenient method to add value to accumulated "shotgun" metagenomic data by helping researchers state and assess novel biological hypotheses.
Oliveira, Marcos Antonio; Discola, Karen Fulan; Alves, Simone Vidigal; Netto, Luis Eduardo Soares; Amorim, Gisele Cardoso; Pinheiro, Anderson Sa; Valente, Ana Paula; Almeida, Fabio Ceneviva Lacerda; Medrano, Francisco Javier; Guimaraes, Beatriz Gomes
2006-01-01
Thioredoxin reductases (Trr) are members of the nucleotide pyridine disulfide oxide reductase family, which includes glutathione reductase (Gr), alkyl hydroperoxide reductase F (AhpF) and lipoamide dehydrogenase (Lpd). Constituents of this family are homodimeric flavoproteins containing one redoxactive disulfide and one tightly bound flavin adenine dinucleotide (FAD) per subunit. Trr catalyzes the disulfide reduction of oxidized Thioredoxin (Trx) using nicotinamide adenine dinucleotide phosphate (NADPH) via a FAD molecule and a redox-active cysteine motif. In this context, FAD transfers the reducing equivalents from NADPH molecule to the reactive cysteines and then to the Trx. Trx, Trr and NADPH comprise the Trx system. Trx are low molecular weight proteins (∼12 KDa) which are involved in several thiol-dependent cellular reactions such as synthesis of deoxyribonucleotides, sulphur metabolism, regulation of the gene expression and oxidative stress defenses. Remarkably, Trr - Trx interactions presents high species and organelle specificities. (author)
Xu, Xuebing; Balchen, Steen; Høy, Carl-Erik
1998-01-01
Production of specific-structured lipids (interesterified lipids with a specific structure) by enzymatic interesterification was carried out in a continuous enzyme bed pilot scale reactor. Commercial immobilized lipase (Lipozyme IM) was used and investigations of acyl migration, pressure drop...
Rice Mabel L
2012-11-01
Full Text Available Abstract Children with specific language impairment (SLI are thought to have an inherited form of language impairment that spares other developmental domains. SLI shows strong heritability and recent linkage and association studies have replicated results for candidate genes. Regulatory regions of the genes may be involved. Behavioral growth models of language development of children with SLI reveal that the onset of language is delayed, and the growth trajectories of children with SLI parallel those of younger children without SLI. The rate of language acquisition decelerates in the pre-adolescent period, resulting in immature language levels for the children with SLI that persist into adolescence and beyond. Recent genetic and epigenetic discoveries and models relevant to language impairment are reviewed. T cell regulation of onset, acceleration, and deceleration signaling are described as potential conceptual parallels to the growth timing elements of language acquisition and impairment. A growth signaling disruption (GSD hypothesis is proposed for SLI, which posits that faulty timing mechanisms at the cellular level, intrinsic to neurocortical functioning essential for language onset and growth regulation, are at the core of the growth outcomes of SLI. The GSD highlights the need to document and account for growth patterns over childhood and suggests needed directions for future investigation.
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi
2014-01-01
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2014-07-18
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Structural basis for the site-specific incorporation of lysine derivatives into proteins.
Veronika Flügel
Full Text Available Posttranslational modifications (PTMs of proteins determine their structure-function relationships, interaction partners, as well as their fate in the cell and are crucial for many cellular key processes. For instance chromatin structure and hence gene expression is epigenetically regulated by acetylation or methylation of lysine residues in histones, a phenomenon known as the 'histone code'. Recently it was shown that these lysine residues can furthermore be malonylated, succinylated, butyrylated, propionylated and crotonylated, resulting in significant alteration of gene expression patterns. However the functional implications of these PTMs, which only differ marginally in their chemical structure, is not yet understood. Therefore generation of proteins containing these modified amino acids site specifically is an important tool. In the last decade methods for the translational incorporation of non-natural amino acids using orthogonal aminoacyl-tRNA synthetase (aaRS:tRNAaaCUA pairs were developed. A number of studies show that aaRS can be evolved to use non-natural amino acids and expand the genetic code. Nevertheless the wild type pyrrolysyl-tRNA synthetase (PylRS from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of non-natural amino acids. Here we present structural data on the wild type enzyme in complex with adenylated ε-N-alkynyl-, ε-N-butyryl-, ε-N-crotonyl- and ε-N-propionyl-lysine providing insights into the plasticity of the PylRS active site. This shows that given certain key features in the non-natural amino acid to be incorporated, directed evolution of this enzyme is not necessary for substrate tolerance.
Evaluating bacterial gene-finding HMM structures as probabilistic logic programs
Mørk, Søren; Holmes, Ian
2012-01-01
, a probabilistic dialect of Prolog. Results: We evaluate Hidden Markov Model structures for bacterial protein-coding gene potential, including a simple null model structure, three structures based on existing bacterial gene finders and two novel model structures. We test standard versions as well as ADPH length...
A dual-specificity isoform of the protein kinase inhibitor PKI produced by alternate gene splicing.
Kumar, Priyadarsini; Walsh, Donal A
2002-03-15
We have previously shown that the protein kinase inhibitor beta (PKIbeta) form of the cAMP-dependent protein kinase inhibitor exists in multiple isoforms, some of which are specific inhibitors of the cAMP-dependent protein kinase, whereas others also inhibit the cGMP-dependent enzyme [Kumar, Van Patten and Walsh (1997), J. Biol. Chem. 272, 20011-20020]. We have now demonstrated that the switch from a cAMP-dependent protein kinase (PKA)-specific inhibitor to one with dual specificity arises as a consequence of alternate gene splicing. We have confirmed using bacterially produced pure protein that a single inhibitor species has dual specificity for both PKA and cGMP-dependent protein kinase (PKG), inhibiting each with very high and closely similar inhibitory potencies. The gene splicing converted a protein with 70 amino acids into one of 109 amino acids, and did not change the inhibitory potency to PKA, but changed it from a protein that had no detectable PKG inhibitory activity to one that now inhibited PKG in the nanomolar range.
Bayesian model to detect phenotype-specific genes for copy number data
González Juan R
2012-06-01
Full Text Available Abstract Background An important question in genetic studies is to determine those genetic variants, in particular CNVs, that are specific to different groups of individuals. This could help in elucidating differences in disease predisposition and response to pharmaceutical treatments. We propose a Bayesian model designed to analyze thousands of copy number variants (CNVs where only few of them are expected to be associated with a specific phenotype. Results The model is illustrated by analyzing three major human groups belonging to HapMap data. We also show how the model can be used to determine specific CNVs related to response to treatment in patients diagnosed with ovarian cancer. The model is also extended to address the problem of how to adjust for confounding covariates (e.g., population stratification. Through a simulation study, we show that the proposed model outperforms other approaches that are typically used to analyze this data when analyzing common copy-number polymorphisms (CNPs or complex CNVs. We have developed an R package, called bayesGen, that implements the model and estimating algorithms. Conclusions Our proposed model is useful to discover specific genetic variants when different subgroups of individuals are analyzed. The model can address studies with or without control group. By integrating all data in a unique model we can obtain a list of genes that are associated with a given phenotype as well as a different list of genes that are shared among the different subtypes of cases.
Simmons David K
2012-01-01
Full Text Available Abstract Background Nervous systems are thought to be important to the evolutionary success and diversification of metazoans, yet little is known about the origin of simple nervous systems at the base of the animal tree. Recent data suggest that ctenophores, a group of macroscopic pelagic marine invertebrates, are the most ancient group of animals that possess a definitive nervous system consisting of a distributed nerve net and an apical statocyst. This study reports on details of the evolution of the neural cell type specifying transcription factor family of LIM homeobox containing genes (Lhx, which have highly conserved functions in neural specification in bilaterian animals. Results Using next generation sequencing, the first draft of the genome of the ctenophore Mnemiopsis leidyi has been generated. The Lhx genes in all animals are represented by seven subfamilies (Lhx1/5, Lhx3/4, Lmx, Islet, Lhx2/9, Lhx6/8, and LMO of which four were found to be represented in the ctenophore lineage (Lhx1/5, Lhx3/4, Lmx, and Islet. Interestingly, the ctenophore Lhx gene complement is more similar to the sponge complement (sponges do not possess neurons than to either the cnidarian-bilaterian or placozoan Lhx complements. Using whole mount in situ hybridization, the Lhx gene expression patterns were examined and found to be expressed around the blastopore and in cells that give rise to the apical organ and putative neural sensory cells. Conclusion This research gives us a first look at neural cell type specification in the ctenophore M. leidyi. Within M. leidyi, Lhx genes are expressed in overlapping domains within proposed neural cellular and sensory cell territories. These data suggest that Lhx genes likely played a conserved role in the patterning of sensory cells in the ancestor of sponges and ctenophores, and may provide a link to the expression of Lhx orthologs in sponge larval photoreceptive cells. Lhx genes were later co-opted into patterning more
Upton, Dana C; Unniraman, Shyam
2011-11-01
B cells start their life with low affinity antibodies generated by V(D)J recombination. However, upon detecting a pathogen, the variable (V) region of an immunoglobulin (Ig) gene is mutated approximately 100,000-fold more than the rest of the genome through somatic hypermutation (SHM), resulting in high affinity antibodies. In addition, class switch recombination (CSR) produces antibodies with different effector functions depending on the kind of immune response that is needed for a particular pathogen. Both CSR and SHM are initiated by activation-induced cytidine deaminase (AID), which deaminates cytosine residues in DNA to produce uracils. These uracils are processed by error-prone forms of repair pathways, eventually leading to mutations and recombination. Our current understanding of the molecular details of SHM and CSR come from a combination of studies in mice, primary cells, cell lines, and cell-free experiments. Mouse models remain the gold standard with genetic knockouts showing critical roles for many repair factors (e.g. Ung, Msh2, Msh6, Exo1, and polymerase η). However, not all genes are amenable for knockout studies. For example, knockouts of several double-strand break repair proteins are embryonically lethal or impair B-cell development. Moreover, sometimes the specific function of a protein in SHM or CSR may be masked by more global defects caused by the knockout. In addition, since experiments in mice can be lengthy, altering expression of individual genes in cell lines has become an increasingly popular first step to identifying and characterizing candidate genes. Ramos - a Burkitt lymphoma cell line that constitutively undergoes SHM - has been a popular cell-line model to study SHM. One advantage of Ramos cells is that they have a built-in convenient semi-quantitative measure of SHM. Wild type cells express IgM and, as they pick up mutations, some of the mutations knock out IgM expression. Therefore, assaying IgM loss by fluorescence
Masakiyo, Yoshiaki; Yoshida, Akihiro; Shintani, Yasuyuki; Takahashi, Yusuke; Ansai, Toshihiro; Takehara, Tadamichi
2010-06-01
Prevotella intermedia and Prevotella nigrescens, which are often isolated from periodontal sites, were once considered two different genotypes of P. intermedia. Although the genomic sequence of P. intermedia was determined recently, little is known about the genetic differences between P. intermedia and P. nigrescens. The subtractive hybridization technique is a powerful method for generating a set of DNA fragments differing between two closely related bacterial strains or species. We used subtractive hybridization to identify the DNA regions specific to P. intermedia ATCC 25611 and P. nigrescens ATCC 25261. Using this method, four P. intermedia ATCC 25611-specific and three P. nigrescens ATCC 25261-specific regions were determined. From the species-specific regions, insertion sequence (IS) elements were isolated for P. intermedia. IS elements play an important role in the pathogenicity of bacteria. For the P. intermedia-specific regions, the genes adenine-specific DNA-methyltransferase and 8-amino-7-oxononanoate synthase were isolated. The P. nigrescens-specific region contained a Flavobacterium psychrophilum SprA homologue, a cell-surface protein involved in gliding motility, Prevotella melaninogenica ATCC 25845 glutathione peroxide, and Porphyromonas gingivalis ATCC 33277 leucyl-tRNA synthetase. The results demonstrate that the subtractive hybridization technique was useful for distinguishing between the two closely related species. Furthermore, this technique will contribute to our understanding of the virulence of these species. 2009 Elsevier Ltd. All rights reserved.
Vaiman Daniel
2005-05-01
Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological
Chicken globin gene transcription is cell lineage specific during the time of the switch
Lois, R.; Martinson, H.G.
1989-01-01
Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position
A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.
Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W
2013-05-01
A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.
Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F
2015-10-01
The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cell-Type-Specific Gene Programs of the Normal Human Nephron Define Kidney Cancer Subtypes.
Lindgren, David; Eriksson, Pontus; Krawczyk, Krzysztof; Nilsson, Helén; Hansson, Jennifer; Veerla, Srinivas; Sjölund, Jonas; Höglund, Mattias; Johansson, Martin E; Axelson, Håkan
2017-08-08
Comprehensive transcriptome studies of cancers often rely on corresponding normal tissue samples to serve as a transcriptional reference. In this study, we performed in-depth analyses of normal kidney tissue transcriptomes from the TCGA and demonstrate that the histological variability in cellularity, inherent in the kidney architecture, lead to considerable transcriptional differences between samples. This should be considered when comparing expression profiles of normal and cancerous kidney tissues. We exploited these differences to define renal-cell-specific gene signatures and used these as a framework to analyze renal cell carcinoma (RCC) ontogeny. Chromophobe RCCs express FOXI1-driven genes that define collecting duct intercalated cells, whereas HNF-regulated genes, specific for proximal tubule cells, are an integral part of clear cell and papillary RCC transcriptomes. These networks may be used as a framework for understanding the interplay between genomic changes in RCC subtypes and the lineage-defining regulatory machinery of their non-neoplastic counterparts. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes.
Soto-Feliciano, Yadira M; Bartlebaugh, Jordan M E; Liu, Yunpeng; Sánchez-Rivera, Francisco J; Bhutkar, Arjun; Weintraub, Abraham S; Buenrostro, Jason D; Cheng, Christine S; Regev, Aviv; Jacks, Tyler E; Young, Richard A; Hemann, Michael T
2017-05-15
Developmental and lineage plasticity have been observed in numerous malignancies and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the plant homeodomain finger protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alteration of the chromatin landscape at the transcriptional start sites of B-cell- and T-cell-specific factors. Additionally, Phf6 KO cells show significant down-regulation of genes involved in the development and function of normal B cells, show up-regulation of genes involved in T-cell signaling, and give rise to mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. © 2017 Soto-Feliciano et al.; Published by Cold Spring Harbor Laboratory Press.
Cell-specific prediction and application of drug-induced gene expression profiles.
Hodos, Rachel; Zhang, Ping; Lee, Hao-Chih; Duan, Qiaonan; Wang, Zichen; Clark, Neil R; Ma'ayan, Avi; Wang, Fei; Kidd, Brian; Hu, Jianying; Sontag, David; Dudley, Joel
2018-01-01
Gene expression profiling of in vitro drug perturbations is useful for many biomedical discovery applications including drug repurposing and elucidation of drug mechanisms. However, limited data availability across cell types has hindered our capacity to leverage or explore the cell-specificity of these perturbations. While recent efforts have generated a large number of drug perturbation profiles across a variety of human cell types, many gaps remain in this combinatorial drug-cell space. Hence, we asked whether it is possible to fill these gaps by predicting cell-specific drug perturbation profiles using available expression data from related conditions--i.e. from other drugs and cell types. We developed a computational framework that first arranges existing profiles into a three-dimensional array (or tensor) indexed by drugs, genes, and cell types, and then uses either local (nearest-neighbors) or global (tensor completion) information to predict unmeasured profiles. We evaluate prediction accuracy using a variety of metrics, and find that the two methods have complementary performance, each superior in different regions in the drug-cell space. Predictions achieve correlations of 0.68 with true values, and maintain accurate differentially expressed genes (AUC 0.81). Finally, we demonstrate that the predicted profiles add value for making downstream associations with drug targets and therapeutic classes.
Kushner Brian
2009-02-01
Full Text Available Abstract Background Neuroblastoma (NB tumours have the highest incidence of spontaneous remission, especially among the stage 4s NB subgroup affecting infants. Clinical distinction of stage 4s from lethal stage 4 can be difficult, but critical for therapeutic decisions. The aim of this study was to investigate chromosomal alterations and differential gene expression amongst infant disseminated NB subgroups. Methods Thirty-five NB tumours from patients diagnosed at Results All stage 4s patients underwent spontaneous remission, only 48% stage 4 patients survived despite combined modality therapy. Stage 4 tumours were 90% near-diploid/tetraploid, 44% MYCN amplified, 77% had 1p LOH (50% 1p36, 23% 11q and/or 14q LOH (27% and 47% had 17q gain. Stage 4s were 90% near-triploid, none MYCN amplified and LOH was restricted to 11q. Initial comparison analyses between stage 4s and 4 P P = 0.0054, 91% with higher expression in stage 4. Less definite expression profiles were observed between stage 4s and 4 P P = 0.005 was maintained. Distinct gene expression profiles but no significant association with specific chromosomal region localization was observed between stage 4s and stage 4 Conclusion Specific chromosomal aberrations are associated with distinct gene expression profiles which characterize spontaneously regressing or aggressive infant NB, providing the biological basis for the distinct clinical behaviour.
Johnston, Iain G; Williams, Ben P
2016-02-24
Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species. Copyright © 2016 Elsevier Inc. All rights reserved.
Structure and expression of the human and mouse T4 genes
Maddon, P.J.; Molineaux, S.M.; Maddon, D.F.; Zimmerman, K.A.; Godfrey, M.; Alt, F.W.; Chess, L.; Axel, R.
1987-01-01
The T4 molecule may serve as a T-cell receptor recognizing molecules on the surface of specific target cells and also serves as the receptor for the human immunodeficiency virus. To define the mechanisms of interaction of T4 with the surface of antigen-presenting cells as well as with human immunodeficiency virus, the authors have further analyzed the sequence, structure, and expression of the human and mouse T4 genes. T4 consists of an extracellular segment comprised of a leader sequence followed by four tandem variable-joining (VJ)-like domains, a transmembrane domain, and A cytoplasmic segment. The structural domains of the T4 protein deduced from amino acid sequence are precisely reflected in the intron-exon organization of the gene. Analysis of the expression of the T4 gene indicates that T4 RNA is expressed not only in T lymphocytes, but in B cells, macrophages, and granulocytes. T4 is also expressed in a developmentally regulated manner in specific regions of the brain. It is, therefore, possible that T4 plays a more general role in mediating cell recognition events that are not restricted to the cellular immune response
Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru
2018-01-01
Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around
Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru
2018-01-01
Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD
Escalante Ricardo
2008-01-01
Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Bednár, Branislav; Roller, Ladislav; Čižmár, Daniel; Mitrová, Diana; Žitňan, Dušan
2017-05-01
Allatotropin (AT) and related neuropeptides are widespread bioactive molecules that regulate development, food intake and muscle contractions in insects and other invertebrates. In moths, alternative splicing of the at gene generates three mRNA precursors encoding AT with different combinations of three structurally similar AT-like peptides (ATLI-III). We used in situ hybridization and immunohistochemistry to map the differential expression of these transcripts during the postembryonic development of Bombyx mori. Transcript encoding AT alone was expressed in numerous neurons of the central nervous system and frontal ganglion, whereas transcripts encoding AT with ATLs were produced by smaller specific subgroups of neurons in larval stages. Metamorphosis was associated with considerable developmental changes and sex-specific differences in the expression of all transcripts. The most notable was the appearance of AT/ATL transcripts (1) in the brain lateral neurosecretory cells producing prothoracicotropic hormone; (2) in the male-specific cluster of about 20 neurons in the posterior region of the terminal abdominal ganglion; (3) in the female-specific medial neurons in the abdominal ganglia AG2-7. Immunohistochemical staining showed that these neurons produced a mixture of various neuropeptides and innervated diverse peripheral organs. Our data suggest that AT/ATL neuropeptides are involved in multiple stage- and sex-specific functions during the development of B. mori.
SPECIFIC PROFESSIONAL COMMUNICATION IN THE STRUCTURE OF THE PROFESSIONAL EDUCATOR
Olga Abramova
2012-01-01
Full Text Available The article deals with the specific characteristics of professional communication teachers in the course of his career. Characterized by the basic communication skillsfor professional communication teachers, distinguished social and psychological characteristics of professional educator.
Kassir, Yona; Stuart, David T
2017-01-01
The budding yeast Saccharomyces cerevisiae has a long history as a model organism for studies of meiosis and the cell cycle. The popularity of this yeast as a model is in large part due to the variety of genetic and cytological approaches that can be effectively performed with the cells. Cultures of the cells can be induced to synchronously progress through meiosis and sporulation allowing large-scale gene expression and biochemical studies to be performed. Additionally, the spore tetrads resulting from meiosis make it possible to characterize the haploid products of meiosis allowing investigation of meiotic recombination and chromosome segregation. Here we describe genetic methods for analysis progression of S. cerevisiae through meiosis and sporulation with an emphasis on strategies for the genetic analysis of regulators of meiosis-specific genes.
Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.
Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T
1996-01-01
A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992
Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi
2016-01-01
NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.
Fernández-Vega, Iván; García, Olivia; Crespo, Ainara; Castañón, Sonia; Menéndez, Primitiva; Astudillo, Aurora; Quirós, Luis M
2013-01-01
The expression of a specific set of genes controls the different structures of heparan sulfate proteoglycans (HSPGs), which are involved in the growth, invasion and metastatic properties of cancerous cells. The purpose of this study is to increase knowledge of HSPG alterations in breast cancer. Twenty-three infiltrating ductal adenocarcinomas (IDCs), both metastatic and non-metastatic were studied. A transcriptomic approach to the structure of heparan sulfate (HS) chains was used, employing qPCR to analyze both the expression of the enzymes involved in their biosynthesis and editing, as well as the proteoglycan core proteins. Since some of these proteoglycans can also carry chondroitin sulfate chains, we extended the study to include the genes involved in the biosynthesis of these glycosaminoglycans. Histochemical techniques were also used to analyze tissular expression of particular genes showing significant expression differences, of potential interest. No significant change in transcription was detected in approximately 70% of analyzed genes. However, 13 demonstrated changes in both tumor types (40% showing more intense deregulation in the metastatic), while 5 genes showed changes only in non-metastatic tumors. Changes were related to 3 core proteins: overexpression of syndecan-1 and underexpression of glypican-3 and perlecan. HS synthesis was affected by lower levels of some 3-O-sulfotransferase transcripts, the expression of NDST4 and, only in non metastatic tumors, higher levels of extracellular sulfatases. Furthermore, the expression of chondroitin sulfate also was considerably affected, involving both the synthesis of the saccharidic chains and sulfations at all locations. However, the pro-metastatic enzyme heparanase did not exhibit significant changes in mRNA expression, although in metastatic tumors it appeared related to increased levels of the most stable form of mRNA. Finally, the expression of heparanase 2, which displays anti-metastatic features
Hettne Kristina M
2013-01-01
Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.
Costa, Rodrigo; Gomes, Newton C. M.; Kroegerrecklenfort, Ellen; Opelt, Katja; Berg, Gabriele; Smalla, Kornelia
The Pseudomonas community structure and antagonistic potential in the rhizospheres of strawberry and oilseed rape (host plants of the fungal phytopathogen Verticillium dahliae) were assessed. The use of a new PCR-DGGE system, designed to target Pseudomonas-specific gacA gene fragments in
Amy L Bauer
2010-11-01
Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.
A lepidopteran-specific gene family encoding valine-rich midgut proteins.
Jothini Odman-Naresh
Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran
Milani, Lili; Lundmark, Anders; Nordlund, Jessica
2008-01-01
To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...
Connallon, Tim; Clark, Andrew G
2010-12-01
Sex-biased genes--genes that are differentially expressed within males and females--are nonrandomly distributed across animal genomes, with sex chromosomes and autosomes often carrying markedly different concentrations of male- and female-biased genes. These linkage patterns are often gene- and lineage-dependent, differing between functional genetic categories and between species. Although sex-specific selection is often hypothesized to shape the evolution of sex-linked and autosomal gene content, population genetics theory has yet to account for many of the gene- and lineage-specific idiosyncrasies emerging from the empirical literature. With the goal of improving the connection between evolutionary theory and a rapidly growing body of genome-wide empirical studies, we extend previous population genetics theory of sex-specific selection by developing and analyzing a biologically informed model that incorporates sex linkage, pleiotropy, recombination, and epistasis, factors that are likely to vary between genes and between species. Our results demonstrate that sex-specific selection and sex-specific recombination rates can generate, and are compatible with, the gene- and species-specific linkage patterns reported in the genomics literature. The theory suggests that sexual selection may strongly influence the architectures of animal genomes, as well as the chromosomal distribution of fixed substitutions underlying sexually dimorphic traits. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.
Haplotype specific alteration of diabetes MHC risk by olfactory receptor gene polymorphism.
Jahromi, Mohamed M
2012-12-01
Evidence for genes associated with risk for Type 1 diabetes (T1D) in the extended region of the major histocompatibility complex (MHC) genes is accumulating. The aim of this study was to investigate the association pattern of the extended MHC region with T1D susceptibility to identify effects independent of well established DR/DQ genes. A total of 394 Europid families with T1D were genotyped for the single nucleotide polymorphism (SNP) in the olfactory receptor family 14, subfamily J, member 1 (OR14J1) gene, rs9257691, in the MHC telomeric region. The OR provides "an internal depiction of our external world" through the capture of odorant molecules in the main OR system by several large families of G-protein coupled receptors (GPCR). These receptors transduce and chemosignals into the central nervous system (CNS). This SNP was chosen to identify its association with T1D. Interestingly, OR14J1C allele was significantly associated with T1D that seems to go with DRB1*0401, Χ(2)=10.9, p=0.0003. However, by fixing both genes of DR*0401-DQB1*0302, high risk, the association of T1D with OR14J1C still existed, Χ(2)=7.4, p=0.005. The occurrence of association of the OR14J1C allele with T1D patients with DRB1*401/DQB1*0302 is an independent risk for T1D. As an accumulative report suggests the role of OR in the pathogenesis of diabetic microvascular and other diabetic complications, undoubtedly, this haplotype specific alteration of T1D risk is an independent risk for the disease and can address the promising MHC-linked gene other than DR/DQ. Moreover, there is nothing to hinder for that this might be a signal that identifies the role of OR gene in the pathogenesis of T1D in patients who are prone to diabetic complications. Copyright © 2012. Published by Elsevier B.V.
Sha Xie
2015-12-01
Full Text Available Yan73, a teinturier (dyer grape variety in China, is one of the few Vitis vinifera cultivars with red-coloured berry flesh. To examine the tissue-specific expression of genes associated with berry colour in Yan73, we analysed the differential accumulation of anthocyanins in the skin and flesh tissues of two red-skinned grape varieties with either red (Yan73 or white flesh (Muscat Hamburg based on HPLC-MS analysis, as well as the differential expression of 18 anthocyanin biosynthesis genes in both varieties by quantitative RT-PCR. The results revealed that the transcripts of GST, OMT, AM3, CHS3, UFGT, MYBA1, F3′5′H, F3H1 and LDOX were barely detectable in the white flesh of Muscat Hamburg. In particular, GST, OMT, AM3, CHS3 and F3H1 showed approximately 50-fold downregulation in the white flesh of Muscat Hamburg compared to the red flesh of Yan73. A correlation analysis between the accumulation of different types of anthocyanins and gene expression indicated that the cumulative expression of GST, F3′5′H, LDOX and MYBA1 was more closely associated with the acylated anthocyanins and the 3′5′-OH anthocyanins, while OMT and AM3 were more closely associated with the total anthocyanins and methoxylated anthocyanins. Therefore, the transcripts of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 explained most of the variation in the amount and composition of anthocyanins in skin and flesh of Yan73. The data suggest that the specific localization of anthocyanins in the flesh tissue of Yan73 is most likely due to the tissue-specific expression of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 in the flesh.
Tumor-specific apoptotic gene targeting overcomes radiation resistance in esophageal adenocarcinoma
Chang, Joe Y.; Zhang Xiaochun; Komaki, Ritsuko; Cheung, Rex; Fang Bingliang
2006-01-01
Purpose: To overcome radiation resistance in esophageal adenocarcinoma by tumor-specific apoptotic gene targeting using tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Methods and Materials: Adenoviral vector Ad/TRAIL-F/RGD with a tumor-specific human telomerase reverse transcription promoter was used to transfer TRAIL gene to human esophageal adenocarcinoma and normal human lung fibroblastic cells (NHLF). Activation of apoptosis was analyzed by Western blot, fluorescent activated cell sorting, and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate labeling (TUNEL) assay. A human esophageal adenocarcinoma mouse model was treated with intratumoral injections of Ad/TRAIL-F/RGD plus local radiotherapy. Results: The combination of Ad/TRAIL-F/RGD and radiotherapy increased the cell-killing effect in all esophageal adenocarcinoma cell lines but not in NHLF cells. This combination also significantly reduced clonogenic formation (p < 0.05) and increased sub-G1 deoxyribonucleic acid accumulation in cancer cells (p < 0.05). Activation of apoptosis by Ad/TRAIL-F/RGD plus radiotherapy was demonstrated by activation of caspase-9, caspase-8, and caspase-3 and cleaved poly (adenosine diphosphate-ribose) polymerase in vitro and TUNEL assay in vivo. Combined Ad/TRAIL-F/RGD and radiotherapy dramatically inhibited tumor growth and prolonged mean survival in the esophageal adenocarcinoma model to 31.6 days from 16.7 days for radiotherapy alone and 21.5 days for Ad/TRAIL-F/RGD alone (p < 0.05). Conclusions: The combination of tumor-specific TRAIL gene targeting and radiotherapy enhances the effect of suppressing esophageal adenocarcinoma growth and prolonging survival
Power Deborah M
2010-12-01
Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A; Rathbun, Stephen L; Whitman, William B
2016-01-01
K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley's K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing.
Majoros, William H; Campbell, Michael S; Holt, Carson; DeNardo, Erin K; Ware, Doreen; Allen, Andrew S; Yandell, Mark; Reddy, Timothy E
2017-05-15
The accurate interpretation of genetic variants is critical for characterizing genotype-phenotype associations. Because the effects of genetic variants can depend strongly on their local genomic context, accurate genome annotations are essential. Furthermore, as some variants have the potential to disrupt or alter gene structure, variant interpretation efforts stand to gain from the use of individualized annotations that account for differences in gene structure between individuals or strains. We describe a suite of software tools for identifying possible functional changes in gene structure that may result from sequence variants. ACE ('Assessing Changes to Exons') converts phased genotype calls to a collection of explicit haplotype sequences, maps transcript annotations onto them, detects gene-structure changes and their possible repercussions, and identifies several classes of possible loss of function. Novel transcripts predicted by ACE are commonly supported by spliced RNA-seq reads, and can be used to improve read alignment and transcript quantification when an individual-specific genome sequence is available. Using publicly available RNA-seq data, we show that ACE predictions confirm earlier results regarding the quantitative effects of nonsense-mediated decay, and we show that predicted loss-of-function events are highly concordant with patterns of intolerance to mutations across the human population. ACE can be readily applied to diverse species including animals and plants, making it a broadly useful tool for use in eukaryotic population-based resequencing projects, particularly for assessing the joint impact of all variants at a locus. ACE is written in open-source C ++ and Perl and is available from geneprediction.org/ACE. myandell@genetics.utah.edu or tim.reddy@duke.edu. Supplementary information is available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e
Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil
2017-10-27
Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes
Pierce Levi CT
2009-01-01
Full Text Available Abstract Background Gene rearrangements such as chromosomal translocations have been shown to contribute to cancer development. Human chromosomal fragile sites are regions of the genome especially prone to breakage, and have been implicated in various chromosome abnormalities found in cancer. However, there has been no comprehensive and quantitative examination of the location of fragile sites in relation to all chromosomal aberrations. Results Using up-to-date databases containing all cancer-specific recurrent translocations, we have examined 444 unique pairs of genes involved in these translocations to determine the correlation of translocation breakpoints and fragile sites in the gene pairs. We found that over half (52% of translocation breakpoints in at least one gene of these gene pairs are mapped to fragile sites. Among these, we examined the DNA sequences within and flanking three randomly selected pairs of translocation-prone genes, and found that they exhibit characteristic features of fragile DNA, with frequent AT-rich flexibility islands and the potential of forming highly stable secondary structures. Conclusion Our study is the first to examine gene pairs involved in all recurrent chromosomal translocations observed in tumor cells, and to correlate the location of more than half of breakpoints to positions of known fragile sites. These results provide strong evidence to support a causative role for fragile sites in the generation of cancer-specific chromosomal rearrangements.
Aspects of gene structure and functional regulation of the isozymes of Na,K-ATPase
Jorgensen, P.L.
2001-01-01
genomes, the genes of four alpha-subunit and at least three beta-subunit isoforms of Na,K-ATPase are identified and two gamma-subunits are expressed in kidney. The isoforms combine in a number of Na,K-ATPase isozymes that are expressed in a tissue and cell specific manner. Models of the molecular...... mechanism of regulation of these isozymes have become more reliable due to progress in understanding the three-dimensional protein structure and conformational transitions mediating transfer of energy from the P-domain to intramembrane Na+ and K+ binding sites....
VanEtten, H.
1997-01-01
The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes
VanEtten, H.
1997-06-01
The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes.
On the specification of structural equation models for ecological systems
Grace, James B.; Anderson, T. Michael; Olff, Han; Scheiner, Samuel M.
The use of structural equation modeling (SEM) is often motivated by its utility for investigating complex networks of relationships, but also because of its promise as a means of representing theoretical Concepts using latent variables. In this paper, we discuss characteristics of ecological theory
Zhu, Aijun; Chen, Muyan; Zhang, Xiumei; Storey, Kenneth B
2016-12-05
The sea cucumber, Apostichopus japonicus, is a good model for studying environmentally-induced aestivation by a marine invertebrate. One of the central requirements of aestivation is the repression of energy-expensive cellular processes such as cell cycle progression. The present study identified the gene structure of the cell cycle regulator, cyclin B, and detected the expression levels of this gene over three stages of the annual aestivation-arousal cycle. Furthermore, the DNA methylation characteristics of cyclin B were analyzed in non-aestivation and deep-aestivation stages of sea cucumbers. We found that the cyclin B promoter contains a CpG island, three CCAAT-boxes and three cell cycle gene homology regions (CHRs). Application of qRT-PCR analysis showed significant downregulation of cyclin B transcript levels during deep-aestivation in comparison with non-aestivation in both intestine and longitudinal muscle, and these returned to basal levels after arousal from aestivation. Methylation analysis of the cyclin B core promoter revealed that its methylation level showed significant differences between non-aestivation and deep-aestivation stages (p<0.05) and interestingly, a positive correlation between Cyclin B transcripts expression and methylation levels of the core promoter was also observed. Our findings suggest that cell cycle progression may be reversibly arrested during aestivation as indicated by the changes in cyclin B expression levels and we propose that DNA methylation is one of the regulatory mechanisms involved in cyclin B transcriptional variation. Copyright © 2016 Elsevier B.V. All rights reserved.
GeneViTo: Visualizing gene-product functional and structural features in genomic datasets
Promponas Vasilis J
2003-10-01
Full Text Available Abstract Background The availability of increasing amounts of sequence data from completely sequenced genomes boosts the development of new computational methods for automated genome annotation and comparative genomics. Therefore, there is a need for tools that facilitate the visualization of raw data and results produced by bioinformatics analysis, providing new means for interactive genome exploration. Visual inspection can be used as a basis to assess the quality of various analysis algorithms and to aid in-depth genomic studies. Results GeneViTo is a JAVA-based computer application that serves as a workbench for genome-wide analysis through visual interaction. The application deals with various experimental information concerning both DNA and protein sequences (derived from public sequence databases or proprietary data sources and meta-data obtained by various prediction algorithms, classification schemes or user-defined features. Interaction with a Graphical User Interface (GUI allows easy extraction of genomic and proteomic data referring to the sequence itself, sequence features, or general structural and functional features. Emphasis is laid on the potential comparison between annotation and prediction data in order to offer a supplement to the provided information, especially in cases of "poor" annotation, or an evaluation of available predictions. Moreover, desired information can be output in high quality JPEG image files for further elaboration and scientific use. A compilation of properly formatted GeneViTo input data for demonstration is available to interested readers for two completely sequenced prokaryotes, Chlamydia trachomatis and Methanococcus jannaschii. Conclusions GeneViTo offers an inspectional view of genomic functional elements, concerning data stemming both from database annotation and analysis tools for an overall analysis of existing genomes. The application is compatible with Linux or Windows ME-2000-XP operating
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Regulating expressin of cell and tissue-specific genes by modifying transcription
Beachy, Roger N. [Donald Danforth Plant Science Center, St. Louis, MO (United States); Dai, Shunhong [Donald Danforth Plant Science Center, St. Louis, MO (United States)
2009-12-15
Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Our research supported by this program has led to the identification of rice bZIP transcription factors RF2a, RF2b and RLP1 that play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV) through their interactions with the Box II essential cis element located in the promoter. RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants and to improve biofuel feedstock.
Development of Non-Viral, Trophoblast-Specific Gene Delivery for Placental Therapy.
Noura Abd Ellah
Full Text Available Low birth weight is associated with both short term problems and the fetal programming of adult onset diseases, including an increased risk of obesity, diabetes and cardiovascular disease. Placental insufficiency leading to intrauterine growth restriction (IUGR contributes to the prevalence of diseases with developmental origins. Currently there are no therapies for IUGR or placental insufficiency. To address this and move towards development of an in utero therapy, we employ a nanostructure delivery system complexed with the IGF-1 gene to treat the placenta. IGF-1 is a growth factor critical to achieving appropriate placental and fetal growth. Delivery of genes to a model of human trophoblast and mouse placenta was achieved using a diblock copolymer (pHPMA-b-pDMAEMA complexed to hIGF-1 plasmid DNA under the control of trophoblast-specific promoters (Cyp19a or PLAC1. Transfection efficiency of pEGFP-C1-containing nanocarriers in BeWo cells and non-trophoblast cells was visually assessed via fluorescence microscopy. In vivo transfection and functionality was assessed by direct placental-injection into a mouse model of IUGR. Complexes formed using pHPMA-b-pDMAEMA and CYP19a-923 or PLAC1-modified plasmids induce trophoblast-selective transgene expression in vitro, and placental injection of PLAC1-hIGF-1 produces measurable RNA expression and alleviates IUGR in our mouse model, consequently representing innovative building blocks towards human placental gene therapies.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Nuclear factor 1 regulates adipose tissue-specific expression in the mouse GLUT4 gene
Miura, Shinji; Tsunoda, Nobuyo; Ikeda, Shinobu; Kai, Yuko; Cooke, David W.; Lane, M. Daniel; Ezaki, Osamu
2004-01-01
Previous studies demonstrated that an adipose tissue-specific element(s) (ASE) of the murine GLUT4 gene is located between -551 and -506 in the 5'-flanking sequence and that a high-fat responsive element(s) for down-regulation of the GLUT4 gene is located between bases -701 and -552. A binding site for nuclear factor 1 (NF1), that mediates insulin and cAMP-induced repression of GLUT4 in 3T3-L1 adipocytes is located between bases -700 and -688. To examine the role of NF1 in the regulation of GLUT4 gene expression in white adipose tissues (WAT) in vivo, we created two types of transgenic mice harboring mutated either 5' or 3' half-site of NF1-binding sites in GLUT4 minigene constructs. In both cases, the GLUT4 minigene was not expressed in WAT, while expression was maintained in brown adipose tissue, skeletal muscle, and heart. This was an unexpected finding, since a -551 GLUT4 minigene that did not have the NF1-binding site was expressed in WAT. We propose a model that explains the requirement for both the ASE and the NF1-binding site for expression of GLUT4 in WAT
Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression
Juni eSarkar
2014-07-01
Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.
Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.
Joshee, N; Kisaka, H; Kitagawa, Y
1998-01-01
One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.
Male Specific Gene Expression in Dioecious Phoenix Dactylifera (Date Palm) Tree at Flowering Stage
Al-Ameri, A. A.; Al-Qurainy, F.; Gaafar, A. R. Z.; Khan, S.; Nadeem, M.
2016-01-01
Date palm is a long-living and evergreen important tree in the semiarid regions. Its fruit is rich in carbohydrate and fibres. Transcriptional profiling was compared among male and female trees of dioecious date palm at flowering stage. Male specific genes are expressed at flowering stage which was studied using the cDNA-SCoT marker. We developed sequence characterized amplified region (SCAR) markers of size 253 bp from male tree based on cDNA-SCoT fingerprinting. Further, developed SCAR marker was validated on the independently collected samples of both types of trees at flowering stage. The unique and specific band (253 bp) was amplified from male samples only whereas it was absent from female samples. (author)
Jacob, K K; Sap, J; Stanley, F M
1998-01-01
A physiologically relevant response to insulin, stimulation of prolactin promoter activity in GH4 pituitary cells, was used as an assay to study the specificity of protein-tyrosine phosphatase function. Receptor-like protein-tyrosine phosphatase alpha (RPTPalpha) blocks the effect of insulin...... is specific by two criteria. A number of potential RPTPalpha targets were ruled out by finding (a) that they are not affected or (b) that they are not on the pathway to insulin-increased prolactin-CAT activity. The negative effect of RPTPalpha on insulin activation of the prolactin promoter is not due...... to reduced phosphorylation or kinase activity of the insulin receptor or to reduced phosphorylation of insulin receptor substrate-1 or Shc. Inhibitor studies suggest that insulin-increased prolactin gene expression is mediated by a Ras-like GTPase but is not mitogen-activated protein kinase dependent...
Imaging specific cellular glycan structures using glycosyltransferases via click chemistry.
Wu, Zhengliang L; Person, Anthony D; Anderson, Matthew; Burroughs, Barbara; Tatge, Timothy; Khatri, Kshitij; Zou, Yonglong; Wang, Lianchun; Geders, Todd; Zaia, Joseph; Sackstein, Robert
2018-02-01
Heparan sulfate (HS) is a polysaccharide fundamentally important for biologically activities. T/Tn antigens are universal carbohydrate cancer markers. Here, we report the specific imaging of these carbohydrates using a mesenchymal stem cell line and human umbilical vein endothelial cells (HUVEC). The staining specificities were demonstrated by comparing imaging of different glycans and validated by either removal of target glycans, which results in loss of signal, or installation of target glycans, which results in gain of signal. As controls, representative key glycans including O-GlcNAc, lactosaminyl glycans and hyaluronan were also imaged. HS staining revealed novel architectural features of the extracellular matrix (ECM) of HUVEC cells. Results from T/Tn antigen staining suggest that O-GalNAcylation is a rate-limiting step for O-glycan synthesis. Overall, these highly specific approaches for HS and T/Tn antigen imaging should greatly facilitate the detection and functional characterization of these biologically important glycans. © The Author(s) 2017. Published by Oxford University Press.
Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others
1994-08-01
Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.
Wang Lihua; Zhang Miao; Guo Rui; Shi Shuo; Li Biao
2012-01-01
Objective: To construct a recombinant adenovirus vector containing the human NIS gene with the myosin light chain-2(MLC-2v) gene as the promoter and evaluate its specific expression and feasibility as a reporter gene in cardiomyocytes. Methods: MLC-2v promoter and NIS were subcloned into an adenovirus shuttle vector, and forwarded by homologous recombination in the bacteria BJ5183 containing AdEasy-1 plasmid. Positive recombinant adenovirus vector was selected, packaged and amplified in the HEK293 cells to obtain recombinant adenovirus Ad-MLC-NIS. Ad-cytomegalovirus (CMV)-NIS with cytomegalovirus as the promoter, Ad-MLC without NIS and Ad-NIS without promoter were constructed as the controls. Cardiomyocytes and non-cardiomyocytes were then infected by the adenovirus. The protein expression was tested by Western blot analysis. The function and features of NIS protein were evaluated by dynamic iodide uptake and NaClO 4 iodine uptake inhibition test in vitro. The viability and proliferation of cardiomyocytes after adenovirus transfection and radioiodine incubation were checked by trypan blue staining. Results: Recombinant NIS adenovirus was successfully constructed. Western blot analysis showed that the NIS protein was highly expressed in cardiomyocytes transfected with Ad-MLC-NIS, and all cells transfected with Ad-CMV-NIS. However, in non-cardiomyocytes transfected with Ad-MLC-NIS, little NIS protein was detected. Dynamic iodine uptake tests showed that the peaks of iodide uptake of the three different cell lines (H9C2, A549, U87 cell) transfected with Ad-MLC-NIS were 5844.0, 833.6 and 846.0 counts · min -1 , respectively. The iodide uptake function of H9C2 was inhibited by NaClO 4 . There was almost no change in cell viability and proliferation when the MOI was 100. Conclusions: Ad-MLC-NIS allows myocardial specific expression of an external gene, and the cardiomyocytes with NIS expression are capable of iodine uptake. Further research of NIS as a reporter gene in
Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A
2015-08-01
Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.
Leon French
2017-05-01
Full Text Available Genome-wide expression profiling of the human brain has revealed genes that are differentially expressed across the lifespan. Characterizing these genes adds to our understanding of both normal functions and pathological conditions. Additionally, the specific cell-types that contribute to the motor, sensory and cognitive declines during aging are unclear. Here we test if age-related genes show higher expression in specific neural cell types. Our study leverages data from two sources of murine single-cell expression data and two sources of age-associations from large gene expression studies of postmortem human brain. We used nonparametric gene set analysis to test for age-related enrichment of genes associated with specific cell-types; we also restricted our analyses to specific gene ontology groups. Our analyses focused on a primary pair of single-cell expression data from the mouse visual cortex and age-related human post-mortem gene expression information from the orbitofrontal cortex. Additional pairings that used data from the hippocampus, prefrontal cortex, somatosensory cortex and blood were used to validate and test specificity of our findings. We found robust age-related up-regulation of genes that are highly expressed in oligodendrocytes and astrocytes, while genes highly expressed in layer 2/3 glutamatergic neurons were down-regulated across age. Genes not specific to any neural cell type were also down-regulated, possibly due to the bulk tissue source of the age-related genes. A gene ontology-driven dissection of the cell-type enriched genes highlighted the strong down-regulation of genes involved in synaptic transmission and cell-cell signaling in the Somatostatin (Sst neuron subtype that expresses the cyclin dependent kinase 6 (Cdk6 and in the vasoactive intestinal peptide (Vip neuron subtype expressing myosin binding protein C, slow type (Mybpc1. These findings provide new insights into cell specific susceptibility to normal aging
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Generation of healthy mice from gene-corrected disease-specific induced pluripotent stem cells.
Guangming Wu
2011-07-01
Full Text Available Using the murine model of tyrosinemia type 1 (fumarylacetoacetate hydrolase [FAH] deficiency; FAH⁻/⁻ mice as a paradigm for orphan disorders, such as hereditary metabolic liver diseases, we evaluated fibroblast-derived FAH⁻/⁻-induced pluripotent stem cells (iPS cells as targets for gene correction in combination with the tetraploid embryo complementation method. First, after characterizing the FAH⁻/⁻ iPS cell lines, we aggregated FAH⁻/⁻-iPS cells with tetraploid embryos and obtained entirely FAH⁻/⁻-iPS cell-derived mice that were viable and exhibited the phenotype of the founding FAH⁻/⁻ mice. Then, we transduced FAH cDNA into the FAH⁻/⁻-iPS cells using a third-generation lentiviral vector to generate gene-corrected iPS cells. We could not detect any chromosomal alterations in these cells by high-resolution array CGH analysis, and after their aggregation with tetraploid embryos, we obtained fully iPS cell-derived healthy mice with an astonishing high efficiency for full-term development of up to 63.3%. The gene correction was validated functionally by the long-term survival and expansion of FAH-positive cells of these mice after withdrawal of the rescuing drug NTBC (2-(2-nitro-4-fluoromethylbenzoyl-1,3-cyclohexanedione. Furthermore, our results demonstrate that both a liver-specific promoter (transthyretin, TTR-driven FAH transgene and a strong viral promoter (from spleen focus-forming virus, SFFV-driven FAH transgene rescued the FAH-deficiency phenotypes in the mice derived from the respective gene-corrected iPS cells. In conclusion, our data demonstrate that a lentiviral gene repair strategy does not abrogate the full pluripotent potential of fibroblast-derived iPS cells, and genetic manipulation of iPS cells in combination with tetraploid embryo aggregation provides a practical and rapid approach to evaluate the efficacy of gene correction of human diseases in mouse models.
Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L
2009-07-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1-3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent.
Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc
2016-01-01
Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611
2006-01-01
Full Text Available BACKGROUND: Inadequate oxygen (hypoxia triggers a multifaceted cellular response that has important roles in normal physiology and in many human diseases. A transcription factor, hypoxia-inducible factor (HIF, plays a central role in the hypoxia response; its activity is regulated by the oxygen-dependent degradation of the HIF-1alpha protein. Despite the ubiquity and importance of hypoxia responses, little is known about the variation in the global transcriptional response to hypoxia among different cell types or how this variation might relate to tissue- and cell-specific diseases. METHODS AND FINDINGS: We analyzed the temporal changes in global transcript levels in response to hypoxia in primary renal proximal tubule epithelial cells, breast epithelial cells, smooth muscle cells, and endothelial cells with DNA microarrays. The extent of the transcriptional response to hypoxia was greatest in the renal tubule cells. This heightened response was associated with a uniquely high level of HIF-1alpha RNA in renal cells, and it could be diminished by reducing HIF-1alpha expression via RNA interference. A gene-expression signature of the hypoxia response, derived from our studies of cultured mammary and renal tubular epithelial cells, showed coordinated variation in several human cancers, and was a strong predictor of clinical outcomes in breast and ovarian cancers. In an analysis of a large, published gene-expression dataset from breast cancers, we found that the prognostic information in the hypoxia signature was virtually independent of that provided by the previously reported wound signature and more predictive of outcomes than any of the clinical parameters in current use. CONCLUSIONS: The transcriptional response to hypoxia varies among human cells. Some of this variation is traceable to variation in expression of the HIF1A gene. A gene-expression signature of the cellular response to hypoxia is associated with a significantly poorer prognosis
Wu, Shwu-Yuan; Lee, A-Young; Lai, Hsien-Tsung; Zhang, Hong; Chiang, Cheng-Ming
2013-03-07
Bromodomain-containing protein 4 (Brd4) is an epigenetic reader and transcriptional regulator recently identified as a cancer therapeutic target for acute myeloid leukemia, multiple myeloma, and Burkitt's lymphoma. Although chromatin targeting is a crucial function of Brd4, there is little understanding of how bromodomains that bind acetylated histones are regulated, nor how the gene-specific activity of Brd4 is determined. Via interaction screen and domain mapping, we identified p53 as a functional partner of Brd4. Interestingly, Brd4 association with p53 is modulated by casein kinase II (CK2)-mediated phosphorylation of a conserved acidic region in Brd4 that selectively contacts either a juxtaposed bromodomain or an adjacent basic region to dictate the ability of Brd4 binding to chromatin and also the recruitment of p53 to regulated promoters. The unmasking of bromodomains and activator recruitment, concurrently triggered by the CK2 phospho switch, provide an intriguing mechanism for gene-specific targeting by a universal epigenetic reader. Copyright © 2013 Elsevier Inc. All rights reserved.
Cell type-specific suppression of mechanosensitive genes by audible sound stimulation.
Kumeta, Masahiro; Takahashi, Daiji; Takeyasu, Kunio; Yoshimura, Shige H
2018-01-01
Audible sound is a ubiquitous environmental factor in nature that transmits oscillatory compressional pressure through the substances. To investigate the property of the sound as a mechanical stimulus for cells, an experimental system was set up using 94.0 dB sound which transmits approximately 10 mPa pressure to the cultured cells. Based on research on mechanotransduction and ultrasound effects on cells, gene responses to the audible sound stimulation were analyzed by varying several sound parameters: frequency, wave form, composition, and exposure time. Real-time quantitative PCR analyses revealed a distinct suppressive effect for several mechanosensitive and ultrasound-sensitive genes that were triggered by sounds. The effect was clearly observed in a wave form- and pressure level-specific manner, rather than the frequency, and persisted for several hours. At least two mechanisms are likely to be involved in this sound response: transcriptional control and RNA degradation. ST2 stromal cells and C2C12 myoblasts exhibited a robust response, whereas NIH3T3 cells were partially and NB2a neuroblastoma cells were completely insensitive, suggesting a cell type-specific response to sound. These findings reveal a cell-level systematic response to audible sound and uncover novel relationships between life and sound.
Shihao Li
2013-01-01
Full Text Available The androgenic gland (AG, playing an important role in sex differentiation of male crustacean, is a target candidate to understand the mechanism of male development and to mine male-specific sex markers. An SSH library (designated as male reproduction-related tissues—SSH library, MRT-SSH library for short was constructed using cDNA from tissues located at the basal part of the 5th pereiopods, including AG and part of spermatophore sac, as tester, and the cDNA from the basal part of the 4th pereiopods of these male shrimp as driver. 402 ESTs from the SSH library were sequenced and assembled into 48 contigs and 104 singlets. Twelve contigs and 14 singlets were identified as known genes. The proteins encoded by the identified genes were categorized, according to their proposed functions, into neuropeptide hormone and hormone transporter, RNA posttranscriptional regulation, translation, cell growth and death, metabolism, genetic information processing, signal transduction/transport, or immunity-related proteins. Eleven highly expressed contigs in the SSH library were selected for validation of the MRT-SSH library and screening sex markers of shrimp. One contig, specifically expressed in male shrimp, had a potential to be developed as a transcriptomic sex marker in shrimp.
Utilization of genetic tests: analysis of gene-specific billing in Medicare claims data.
Lynch, Julie A; Berse, Brygida; Dotson, W David; Khoury, Muin J; Coomer, Nicole; Kautter, John
2017-08-01
We examined the utilization of precision medicine tests among Medicare beneficiaries through analysis of gene-specific tier 1 and 2 billing codes developed by the American Medical Association in 2012. We conducted a retrospective cross-sectional study. The primary source of data was 2013 Medicare 100% fee-for-service claims. We identified claims billed for each laboratory test, the number of patients tested, expenditures, and the diagnostic codes indicated for testing. We analyzed variations in testing by patient demographics and region of the country. Pharmacogenetic tests were billed most frequently, accounting for 48% of the expenditures for new codes. The most common indications for testing were breast cancer, long-term use of medications, and disorders of lipid metabolism. There was underutilization of guideline-recommended tumor mutation tests (e.g., epidermal growth factor receptor) and substantial overutilization of a test discouraged by guidelines (methylenetetrahydrofolate reductase). Methodology-based tier 2 codes represented 15% of all claims billed with the new codes. The highest rate of testing per beneficiary was in Mississippi and the lowest rate was in Alaska. Gene-specific billing codes significantly improved our ability to conduct population-level research of precision medicine. Analysis of these data in conjunction with clinical records should be conducted to validate findings.Genet Med advance online publication 26 January 2017.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR
D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)
1996-10-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
The primary structures of two leghemoglobin genes from soybean
Hyldig-Nielsen, J J; Jensen, E O; Paludan, K
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences which interrupt the two coding sequences in identical positions. The 5' and 3' flanking sequences in both genes contain conserved sequences similar...
Region-specific expression of mitochondrial complex I genes during murine brain development.
Stefanie Wirtz
Full Text Available Mutations in the nuclear encoded subunits of mitochondrial complex I (NADH:ubiquinone oxidoreductase may cause circumscribed cerebral lesions ranging from degeneration of the striatal and brainstem gray matter (Leigh syndrome to leukodystrophy. We hypothesized that such pattern of regional pathology might be due to local differences in the dependence on complex I function. Using in situ hybridization we investigated the relative expression of 33 nuclear encoded complex I subunits in different brain regions of the mouse at E11.5, E17.5, P1, P11, P28 and adult (12 weeks. With respect to timing and relative intensity of complex I gene expression we found a highly variant pattern in different regions during development. High average expression levels were detected in periods of intense neurogenesis. In cerebellar Purkinje and in hippocampal CA1/CA3 pyramidal neurons we found a second even higher peak during the period of synaptogenesis and maturation. The extraordinary dependence of these structures on complex I gene expression during synaptogenesis is in accord with our recent findings that gamma oscillations--known to be associated with higher cognitive functions of the mammalian brain--strongly depend on the complex I activity. However, with the exception of the mesencephalon, we detected only average complex I expression levels in the striatum and basal ganglia, which does not explain the exquisite vulnerability of these structures in mitochondrial disorders.
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang
2012-06-15
Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication
Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.
Vacchi-Suzzi, Caterina; Hahne, Florian; Scheubel, Philippe; Marcellin, Magali; Dubost, Valerie; Westphal, Magdalena; Boeglen, Catherine; Büchmann-Møller, Stine; Cheung, Ming Sin; Cordier, André; De Benedetto, Christopher; Deurinck, Mark; Frei, Moritz; Moulin, Pierre; Oakeley, Edward; Grenet, Olivier; Grevot, Armelle; Stull, Robert; Theil, Diethilde; Moggs, Jonathan G; Marrer, Estelle; Couttet, Philippe
2013-01-01
MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves) in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*). The relative abundance of myocardium-enriched (miR-1) and valve-enriched (miR-125b-5p and miR-204) microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.
Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.
Caterina Vacchi-Suzzi
Full Text Available MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744 and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*. The relative abundance of myocardium-enriched (miR-1 and valve-enriched (miR-125b-5p and miR-204 microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.
Structure and chromosomal localization of the human lymphotoxin gene
Nedwin, G.E.; Jarrett-Nedwin, J.; Smith, D.H.; Naylor, S.L.; Sakaguchi, A.Y.; Goeddel, D.V.; Gray, P.W.
1987-01-01
The authors have isolated, sequenced, and determined the chromosomal localization of the gene encoding human lymphotoxin (LT). The single copy gene was isolated from a human genomic library using a /sup 32/P-labeled 116 bp synthetic DNA fragment whose sequence was based on the NH/sub 2/-terminal amino acid sequence of LT. The gene spans 3 kb of DNA and is interrupted by three intervening sequences. The LT gene is located on human chromosome 6, as determined by Southern blot analysis of human-murine hybrid DNA. Putative transcriptional control regions and areas of homology with the promoters of interferon and other genes are identified
Sibao Wang
2011-06-01
Full Text Available An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta cuticle, M. robertsii up-regulates a gene (Mest1 that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta, while virulence to grasshoppers (Melanoplus femurrubrum was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.
Structural analysis of the α subunit of Na(+)/K(+) ATPase genes in invertebrates.
Thabet, Rahma; Rouault, J-D; Ayadi, Habib; Leignel, Vincent
2016-01-01
The Na(+)/K(+) ATPase is a ubiquitous pump coordinating the transport of Na(+) and K(+) across the membrane of cells and its role is fundamental to cellular functions. It is heteromer in eukaryotes including two or three subunits (α, β and γ which is specific to the vertebrates). The catalytic functions of the enzyme have been attributed to the α subunit. Several complete α protein sequences are available, but only few gene structures were characterized. We identified the genomic sequences coding the α-subunit of the Na(+)/K(+) ATPase, from the whole-genome shotgun contigs (WGS), NCBI Genomes (chromosome), Genomic Survey Sequences (GSS) and High Throughput Genomic Sequences (HTGS) databases across distinct phyla. One copy of the α subunit gene was found in Annelida, Arthropoda, Cnidaria, Echinodermata, Hemichordata, Mollusca, Placozoa, Porifera, Platyhelminthes, Urochordata, but the nematodes seem to possess 2 to 4 copies. The number of introns varied from 0 (Platyhelminthes) to 26 (Porifera); and their localization and length are also highly variable. Molecular phylogenies (Maximum Likelihood and Maximum Parsimony methods) showed some clusters constituted by (Chordata/(Echinodermata/Hemichordata)) or (Plathelminthes/(Annelida/Mollusca)) and a basal position for Porifera. These structural analyses increase our knowledge about the evolutionary events of the α subunit genes in the invertebrates. Copyright © 2016 Elsevier Inc. All rights reserved.
Gu, Y R; Li, M Z; Zhang, K; Chen, L; Jiang, A A; Wang, J Y; Li, X W
2011-08-01
To normalize a set of quantitative real-time PCR (q-PCR) data, it is essential to determine an optimal number/set of housekeeping genes, as the abundance of housekeeping genes can vary across tissues or cells during different developmental stages, or even under certain environmental conditions. In this study, of the 20 commonly used endogenous control genes, 13, 18 and 17 genes exhibited credible stability in 56 different tissues, 10 types of adipose tissue and five types of muscle tissue, respectively. Our analysis clearly showed that three optimal housekeeping genes are adequate for an accurate normalization, which correlated well with the theoretical optimal number (r ≥ 0.94). In terms of economical and experimental feasibility, we recommend the use of the three most stable housekeeping genes for calculating the normalization factor. Based on our results, the three most stable housekeeping genes in all analysed samples (TOP2B, HSPCB and YWHAZ) are recommended for accurate normalization of q-PCR data. We also suggest that two different sets of housekeeping genes are appropriate for 10 types of adipose tissue (the HSPCB, ALDOA and GAPDH genes) and five types of muscle tissue (the TOP2B, HSPCB and YWHAZ genes), respectively. Our report will serve as a valuable reference for other studies aimed at measuring tissue-specific mRNA abundance in porcine samples. © 2011 Blackwell Verlag GmbH.
Yushin Yazaki
2015-04-01
Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.
Greenblatt, Marc S.; Brody, Lawrence C.; Foulkes, William D.; Genuardi, Maurizio; Hofstra, Robert M. W.; Olivier, Magali; Plon, Sharon E.; Sijmons, Rolf H.; Sinilnikova, Olga; Spurdle, Amanda B.
2008-01-01
Locus-specific databases (LSDBs) are curated collections of sequence variants in genes associated with disease. LSDBs of cancer-related genes often serve as a critical resource to researchers, diagnostic laboratories, clinicians, and others in the cancer genetics community. LSDBs are poised to play
Rohini Garg
Full Text Available DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases, namely Methyltransferase (MET, Chromomethylase (CMT and Domains Rearranged Methyltransferase (DRM, which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2 subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes.
Mckeown, P.C.; Laouielle-Duprat, S.; Prins, J.C.P.; Wolff, de P.; Schmid, M.W.; Donoghue, M.T.; Fort, A.; Duszynska, D.; Comte, A.; Lao, N.T.; Wennblom, T.J.; Smant, G.; Köhler, C.; Grossniklaus, U.; Spillane, C.
2011-01-01
Background: Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized
Selective visualization of gene structure with ultraviolet light
Wang, Z.; Becker, M.M.
1988-01-01
The ability of the ultraviolet (UV) footprinting technique to detect chromatin has been investigated in vitro. Two basic types of chromatin, a phased nucleosome and a phased nucleosome containing a phased H1 protein, have been reconstituted onto a cloned 5S ribosomal RNA gene from sea urchin. The histone-DNA interactions in each complex have been probed with exonuclease III, DNase I, dimethyl sulfate, and UV light. Whereas DNase I and exonuclease III readily detect interactions between histones and DNA, UV light and dimethyl sulfate do not. In contrast to histone-DNA interactions, we demonstrate that intimate sequence-specific contacts between the same sea urchin 5S DNA and the Xenopus laevis transcription factor IIIA (TFIIIA) are readily detected with UV light. Since the sensitivity of UV light for TFIIIA contacts is similar to its sensitivity for other regulatory protein-DNA contacts, these studies demonstrate the feasibility of using UV light to selectively visualize regulatory protein-DNA interactions in vivo with little or no interference from histone-DNA interactions
Yuan Xin Goay
2016-01-01
Full Text Available Salmonella Typhi (S. Typhi causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39 and 100% specificity (0/72. The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien
2016-01-01
Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Li, Yao; Chan, Lawrence; Nguyen, Huy V; Tsang, Stephen H
2016-01-01
Interest in generating human induced pluripotent stem (iPS) cells for stem cell modeling of diseases has overtaken that of patient-specific human embryonic stem cells due to the ethical, technical, and political concerns associated with the latter. In ophthalmology, researchers are currently using iPS cells to explore various applications, including: (1) modeling of retinal diseases using patient-specific iPS cells; (2) autologous transplantation of differentiated retinal cells that undergo gene correction at the iPS cell stage via gene editing tools (e.g., CRISPR/Cas9, TALENs and ZFNs); and (3) autologous transplantation of patient-specific iPS-derived retinal cells treated with gene therapy. In this review, we will discuss the uses of patient-specific iPS cells for differentiating into retinal pigment epithelium (RPE) cells, uncovering disease pathophysiology, and developing new treatments such as gene therapy and cell replacement therapy via autologous transplantation.
Simon Lecoutre
2017-08-01
Conclusions: Consistent with the DOHaD hypothesis, persistent epigenetic remodeling occurs at regulatory regions especially within intergenic sequences, linked to higher leptin gene expression in adult HF offspring in a depot-specific manner.
Skeletal muscle gene expression in response to resistance exercise: sex specific regulation
Burant Charles F
2010-11-01
Full Text Available Abstract Background The molecular mechanisms underlying the sex differences in human muscle morphology and function remain to be elucidated. The sex differences in the skeletal muscle transcriptome in both the resting state and following anabolic stimuli, such as resistance exercise (RE, might provide insight to the contributors of sexual dimorphism of muscle phenotypes. We used microarrays to profile the transcriptome of the biceps brachii of young men and women who underwent an acute unilateral RE session following 12 weeks of progressive training. Bilateral muscle biopsies were obtained either at an early (4 h post-exercise or late recovery (24 h post-exercise time point. Muscle transcription profiles were compared in the resting state between men (n = 6 and women (n = 8, and in response to acute RE in trained exercised vs. untrained non-exercised control muscle for each sex and time point separately (4 h post-exercise, n = 3 males, n = 4 females; 24 h post-exercise, n = 3 males, n = 4 females. A logistic regression-based method (LRpath, following Bayesian moderated t-statistic (IMBT, was used to test gene functional groups and biological pathways enriched with differentially expressed genes. Results This investigation identified extensive sex differences present in the muscle transcriptome at baseline and following acute RE. In the resting state, female muscle had a greater transcript abundance of genes involved in fatty acid oxidation and gene transcription/translation processes. After strenuous RE at the same relative intensity, the time course of the transcriptional modulation was sex-dependent. Males experienced prolonged changes while females exhibited a rapid restoration. Most of the biological processes involved in the RE-induced transcriptional regulation were observed in both males and females, but sex specificity was suggested for several signaling pathways including activation of notch signaling and TGF-beta signaling in females
Carlsbecker, Annelie; Sundström, Jens; Tandre, Karolina; Englund, Marie; Kvarnheden, Anders; Johanson, Urban; Engström, Peter
2003-01-01
Transcription factors encoded by different members of the MADS-box gene family have evolved central roles in the regulation of reproductive organ development in the flowering plants, the angiosperms. Development of the stamens and carpels, the pollen- and seed-bearing organs, involves the B- and C-organ-identity MADS-box genes. B- and C-type gene orthologs with activities specifically in developing pollen- and seed-bearing organs are also present in the distantly related gymnosperms: the conifers and the gnetophytes. We now report on the characterization of DAL10, a novel MADS-box gene from the conifer Norway spruce, which unlike the B- and C-type conifer genes shows no distinct orthology relationship to any angiosperm gene or clade in phylogenetic analyses. Like the B- and C-type genes, it is active specifically in developing pollen cones and seed cones. In situ RNA localization experiments show DAL10 to be expressed in the cone axis, which carry the microsporophylls of the young pollen cone. In contrast, in the seed cone it is expressed both in the cone axis and in the bracts, which subtend the ovuliferous scales. Expression data and the phenotype of transgenic Arabidopsis plants expressing DAL10 suggest that the gene may act upstream to or in concert with the B- and C-type genes in the establishment of reproductive identity of developing cones.
Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah
2012-06-01
Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.
Actinide-specific complexing agents: their structural and solution chemistry
Raymond, K.N.; Freeman, G.E.; Kappel, M.J.
1983-07-01
The synthesis of a series of tetracatecholate ligands designed to be specific for Pu(IV) and other actinide(IV) ions has been achieved. Although these compounds are very effective as in vivo plutonium removal agents, potentiometric and voltammetric data indicate that at neutral pH full complexation of the Pu(IV) ion by all four catecholate groups does not occur. Spectroscopic results indicate that the tetracatecholates, 3,4,3-LICAMS and 3,4,3-LICAMC, complex Am(III). The Am(IV)/(III)-catecholate couple (where catecholate = 3,4,3-LICAMS or 3,4,3-LICAMC) is not observed, but may not be observable due to the large currents associated with ligand oxidation. However, within the potential range where ligand oxidation does not occur, these experiments indicate that the reduction potential of free Am(IV)/(III) is probably greater than or equal to + 2.6 V vs NHE or higher. Proof of the complexation of americium in the trivalent oxidation state by 3,4,3-LICAMS and 3,4,3-LICAMC elimates the possibility of tetracatholates stabilizing Am(IV) in vivo
The Okhansk Meteorite: Specifics of Composition, Structure, and Genesis
A.I. Bakhtin
2016-12-01
Full Text Available The Okhansk meteorite fell on August 18, 1887 near the village of Tabor, about 15 km away from the town of Okhansk in Perm province and weighed 186.5 kg (the total weight of collected fragments, according to P.I. Krotov, was more than 245 kg. The shock wave from the meteorite entry knocked down animals and riders on horses. Despite the fact that it was significantly stronger than that caused by the Chelyabinsk meteorite of 2013, all information about this meteorite has completely erased from people's memory. It has been shown that the meteorite is an ordinary olivine-bronzite chondrite. Its main silicate minerals are olivine, bronzite, plagioclase, and diopside. The main ore minerals are kamacite and troilite. The meteorite contains silicate glass in large amounts. The analysis of the composition and structure of the Okhansk meteorite has demonstrated that it was formed at the early stages of accretion of the melted substance of the protosolar nebula without undergoing endogenous, temperature, or pressure changes.
Anne Gabory
Full Text Available Males and females responses to gestational overnutrition set the stage for subsequent sex-specific differences in adult onset non communicable diseases. Placenta, as a widely recognized programming agent, contibutes to the underlying processes. According to our previous findings, a high-fat diet during gestation triggers sex-specific epigenetic alterations within CpG and throughout the genome, together with the deregulation of clusters of imprinted genes. We further investigated the impact of diet and sex on placental histology, transcriptomic and epigenetic signatures in mice. Both basal gene expression and response to maternal high-fat diet were sexually dimorphic in whole placentas. Numerous genes showed sexually dimorphic expression, but only 11 genes regardless of the diet. In line with the key role of genes belonging to the sex chromosomes, 3 of these genes were Y-specific and 3 were X-specific. Amongst all the genes that were differentially expressed under a high-fat diet, only 16 genes were consistently affected in both males and females. The differences were not only quantitative but remarkably qualitative. The biological functions and networks of genes dysregulated differed markedly between the sexes. Seven genes of the epigenetic machinery were dysregulated, due to effects of diet, sex or both, including the Y- and X-linked histone demethylase paralogues Kdm5c and Kdm5d, which could mark differently male and female epigenomes. The DNA methyltransferase cofactor Dnmt3l gene expression was affected, reminiscent of our previous observation of changes in global DNA methylation. Overall, this striking sexual dimorphism of programming trajectories impose a considerable revision of the current dietary interventions protocols.
Dos Santos, Helena G; Siltberg-Liberles, Jessica
2016-09-19
One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Use of tiling array data and RNA secondary structure predictions to identify noncoding RNA genes
Weile, Christian; Gardner, Paul P; Hedegaard, Mads M
2007-01-01
neuroblastoma cell line SK-N-AS. Using this strategy, we identify thousands of human candidate RNA genes. To further verify the expression of these genes, we focused on candidate genes that had a stable hairpin structures or a high level of covariance. Using northern blotting, we verify the expression of 2 out...
Muramoto, Hiroki; Yagi, Shintaro; Hirabayashi, Keiji; Sato, Shinya; Ohgane, Jun; Tanaka, Satoshi; Shiota, Kunio
2010-08-01
Embryonic stem cells (ESCs) have a distinctive epigenome, which includes their genome-wide DNA methylation modification status, as represented by the ESC-specific hypomethylation of tissue-dependent and differentially methylated regions (T-DMRs) of Pou5f1 and Nanog. Here, we conducted a genome-wide investigation of sequence characteristics associated with T-DMRs that were differentially methylated between ESCs and somatic cells, by focusing on transposable elements including short interspersed elements (SINEs), long interspersed elements (LINEs) and long terminal repeats (LTRs). We found that hypomethylated T-DMRs were predominantly present in SINE-rich/LINE-poor genomic loci. The enrichment for SINEs spread over 300 kb in cis and there existed SINE-rich genomic domains spreading continuously over 1 Mb, which contained multiple hypomethylated T-DMRs. The characterization of sequence information showed that the enriched SINEs were relatively CpG rich and belonged to specific subfamilies. A subset of the enriched SINEs were hypomethylated T-DMRs in ESCs at Dppa3 gene locus, although SINEs are overall methylated in both ESCs and the liver. In conclusion, we propose that SINE enrichment is the genomic property of regions harboring hypomethylated T-DMRs in ESCs, which is a novel aspect of the ESC-specific epigenomic information.
Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.
Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E
2016-11-01
Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.
Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R
1995-09-01
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II
Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression
Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..
2000-02-01
Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.
Chi Zhang
Full Text Available Osterix (Osx is an osteoblast-specific transcription factor required for osteoblast differentiation from mesenchymal stem cells. In Osx knock-out mice, no bone formation occurs. The vitamin D receptor (VDR is a member of the nuclear hormone receptor superfamily that regulates target gene transcription to ensure appropriate control of calcium homeostasis and bone development. Here, we provide several lines of evidence that show that the VDR gene is a target for transcriptional regulation by Osx in osteoblasts. For example, calvaria obtained from Osx-null embryos displayed dramatic reductions in VDR expression compared to wild-type calvaria. Stable overexpression of Osx stimulated VDR expression in C2C12 mesenchymal cells. Inhibition of Osx expression by siRNA led to downregulation of VDR. In contrast, Osx levels remained unchanged in osteoblasts in VDR-null mice. Mechanistic approaches using transient transfection assays showed that Osx directly activated a 1 kb fragment of the VDR promoter in a dose-dependent manner. To define the region of the VDR promoter that was responsive to Osx, a series of VDR promoter deletion mutants were examined and the minimal Osx-responsive region was refined to the proximal 120 bp of the VDR promoter. Additional point mutants were used to identify two GC-rich regions that were responsible for VDR promoter activation by Osx. Chromatin immunoprecipitation assays demonstrated that endogenous Osx was associated with the native VDR promoter in primary osteoblasts in vivo. Cumulatively, these data strongly support a direct regulatory role for Osx in VDR gene expression. They further provide new insight into potential mechanisms and pathways that Osx controls in osteoblasts and during the process of osteoblastic cell differentiation.
The structure of an unusual leghemoglobin gene from soybean
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1983-01-01
A clone containing an unusual leghemoglobin (Lb) gene was isolated from a soybean DNA library present in Charon 4A phage. DNA sequence analysis revealed that the isolated Lb gene has three intervening sequences (IVS-1, IVS-2 and IVS-3) located in the same positions as those found in other Lb gene...... is mutated in two regions which seem to be important for transcription. It is, therefore, tentatively suggested that the isolated Lb gene is non-functional, and consequently is an Lb pseudogene. Udgivelsesdato: 1983-null...
Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene.
Mollereau, C; Simons, M J; Soularue, P; Liners, F; Vassart, G; Meunier, J C; Parmentier, M
1996-08-06
Nociceptin (orphanin FQ), the newly discovered natural agonist of opioid receptor-like (ORL1) receptor, is a neuropeptide that is endowed with pronociceptive activity in vivo. Nociceptin is derived from a larger precursor, prepronociceptin (PPNOC), whose human, mouse, and rat genes we have now isolated. The PPNOC gene is highly conserved in the three species and displays organizational features that are strikingly similar to those of the genes of preproenkephalin, preprodynorphin, and preproopiomelanocortin, the precursors to endogenous opioid peptides, suggesting the four genes belong to the same family-i.e., have a common evolutionary origin. The PPNOC gene encodes a single copy of nociceptin as well as of other peptides whose sequence is strictly conserved across murine and human species; hence it is likely to be neurophysiologically significant. Northern blot analysis shows that the PPNOC gene is predominantly transcribed in the central nervous system (brain and spinal cord) and, albeit weakly, in the ovary, the sole peripheral organ expressing the gene. By using a radiation hybrid cell line panel, the PPNOC gene was mapped to the short arm of human chromosome 8 (8p21), between sequence-tagged site markers WI-5833 and WI-1172, in close proximity of the locus encoding the neurofilament light chain NEFL. Analysis of yeast artificial chromosome clones belonging to the WC8.4 contig covering the 8p21 region did not allow to detect the presence of the gene on these yeast artificial chromosomes, suggesting a gap in the coverage within this contig.
Yu, Xiao-Jing; Zheng, Hong-Kun; Wang, Jun
2006-01-01
related species as outgroup, it is difficult to identify human-lineage-specific changes, which is critical in delineating the biological uniqueness of humans. In this study, we conducted phylogeny-based analyses of 2633 human brain-expressed genes using rhesus macaque as the outgroup. We identified 47...... candidate genes showing strong evidence of positive selection in the human lineage. Genes with maximal expression in the brain showed a higher evolutionary rate in human than in chimpanzee. We observed that many immune-defense-related genes were under strong positive selection, and this trend was more...
Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens
Ederli, Luisa
2015-02-20
We investigated whether the Arabidopsis flower evolved protective measures to increase reproductive success. Firstly, analyses of available transcriptome data show that the most highly expressed transcripts in the closed sepal (stage 12) are enriched in genes with roles in responses to chemical stimuli and cellular metabolic processes. At stage 15, there is enrichment in transcripts with a role in responses to biotic stimuli. Comparative analyses between the sepal and petal in the open flower mark an over-representation of transcripts with a role in responses to stress and catalytic activity. Secondly, the content of the biotic defense-associated phytohormone salicylic acid (SA) in sepals and petals is significantly higher than in leaves. To understand whether the high levels of stress responsive transcripts and the higher SA content affect defense, wild-type plants (Col-0) and transgenic plants defective in SA accumulation (nahG) were challenged with the biotrophic fungus Golovinomyces cichoracearum, the causal agent of powdery mildew, and the necrotrophic fungus Botrytis cinerea. NahG leaves were more sensitive than those of Col-0, suggesting that in leaves SA has a role in the defense against biotrophs. In contrast, sepals and petals of both genotypes were resistant to G. cichoracearum, indicating that in the flower, resistance to the biotrophic pathogen is not critically dependent on SA, but likely dependent on the up-regulation of stress-responsive genes. Since sepals and petals of both genotypes are equally susceptible to B. cinerea, we conclude that neither stress-response genes nor increased SA accumulation offers protection against the necrotrophic pathogen. These results are interpreted in the light of the distinctive role of the flower and we propose that in the early stages, the sepal may act as a chemical defense barrier of the developing reproductive structures against biotrophic pathogens.
In vitro assembly of a prohead-like structure of the Rhodobacter capsulatus gene transfer agent
Spano, Anthony J.; Chen, Frank S.; Goodman, Benjamin E.; Sabat, Agnes E.; Simon, Martha N.; Wall, Joseph S.; Correia, John J.; McIvor, Wilson; Newcomb, William W.; Brown, Jay C.; Schnur, Joel M.; Lebedev, Nikolai
2007-01-01
The gene transfer agent (GTA) is a phage-like particle capable of exchanging double-stranded DNA fragments between cells of the photosynthetic bacterium Rhodobacter capsulatus. Here we show that the major capsid protein of GTA, expressed in E. coli, can be assembled into prohead-like structures in the presence of calcium ions in vitro. Transmission electron microscopy (TEM) of uranyl acetate staining material and thin sections of glutaraldehyde-fixed material demonstrates that these associates have spherical structures with diameters in the range of 27-35 nm. The analysis of scanning TEM images revealed particles of mass ∼ 4.3 MDa, representing 101 ± 11 copies of the monomeric subunit. The establishment of this simple and rapid method to form prohead-like particles permits the GTA system to be used for genome manipulation within the photosynthetic bacterium, for specific targeted drug delivery, and for the construction of biologically based distributed autonomous sensors for environmental monitoring
A novel CpG island set identifies tissue-specific methylation at developmental gene loci.
Robert Illingworth
2008-01-01
Full Text Available CpG islands (CGIs are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.
Parent-of-origin dependent gene-specific knock down in mouse embryos
Iqbal, Khursheed; Kues, Wilfried A.; Niemann, Heiner
2007-01-01
In mice hemizygous for the Oct4-GFP transgene, the F1 embryos show parent-of-origin dependent expression of the marker gene. F1 embryos with a maternally derived OG2 allele (OG2 mat /-) express GFP in the oocyte and during preimplantation development until the blastocyst stage indicating a maternal and embryonic expression pattern. F1-embryos with a paternally inherited OG2 allele (OG2 pat /-) express GFP from the 4- to 8-cell stage onwards showing only embryonic expression. This allows to study allele specific knock down of GFP expression. RNA interference (RNAi) was highly efficient in embryos with the paternally inherited GFP allele, whereas embryos with the maternally inherited GFP allele showed a delayed and less stringent suppression, indicating that the initial levels of the target transcript and the half life of the protein affect RNAi efficacy. RT-PCR analysis revealed only minimum of GFP mRNA. These results have implications for studies of gene silencing in mammalian embryos
Yun-Fu Liu
2013-08-01
Full Text Available The NLRP12 (NLR family, pyrin domain containing 12 serves as a suppressor factor in the inflammatory response and protects the host against inflammation-induced damage. In the present study, we aimed to study the polymorphisms of NLRP12 gene and its association with susceptibility to non-specific digestive disorder (NSDD in rabbits. We re-sequenced the entire coding region of the rabbit NLRP12 gene and detected a total of 19 SNPs containing 14 synonymous and five non-synonymous variations. Among them, the coding SNP (c.1682A>G, which would carry a potential functional implication, was subsequently subjected to genotyping for case-control association study (272 cases and 267 controls. The results revealed that allele A was significantly protective against NSDD with an odds ratio value of 0.884 (95% confidence interval, 0.788 to 0.993; p = 0.038. We also experimentally induced NSDD in growing rabbits by feeding a fibre-deficient diet and subsequently investigated NLRP12 mRNA expression. The mRNA expression of NLRP12 in healthy status was significantly higher than that in severe NSDD (p = 0.0016. The highest expression was observed in individuals carrying the protective genotype AA (p = 0.0108. These results suggested that NLRP12 was significantly associated with the NSDD in rabbits. However, the precise molecular mechanism of NLRP12 involving in the development of rabbit NSDD requires further research.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.
Mohamed I Husseiny
Full Text Available The onset of metabolic dysregulation in type 1 diabetes (T1D occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy.
Model-specific selection of molecular targets for heart failure gene therapy
Katz, Michael G.; Fargnoli, Anthony S.; Tomasulo, Catherine E.; Pritchette, Louella A.; Bridges, Charles R.
2013-01-01
Heart failure (HF) is a complex multifaceted problem of abnormal ventricular function and structure. In recent years, new information has been accumulated allowing for a more detailed understanding of the cellular and molecular alterations that are the underpinnings of diverse causes of HF, including myocardial ischemia, pressure-overload, volume-overload or intrinsic cardiomyopathy. Modern pharmacological approaches to treat HF have had a significant impact on the course of the disease, although they do not reverse the underlying pathological state of the heart. Therefore gene-based therapy holds a great potential as a targeted treatment for cardiovascular diseases. Here, we survey the relative therapeutic efficacy of genetic modulation of β-adrenergic receptor signaling, Ca2+ handling proteins and angiogenesis in the most common extrinsic models of HF. PMID:21954055
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Hering, Thomas M.; Kazmi, Najam H.; Huynh, Tru D.; Kollar, John; Xu, Laura; Hunyady, Aaron B.; Johnstone, Brian
2004-01-01
As part of a study to identify novel transcriptional regulators of chondrogenesis-related gene expression, we have cloned and characterized cDNA for zinc-finger protein 470 (ZNF470), the human ortholog of which encodes a 717 amino acid residue protein containing 17 Cys 2 His 2 zinc-finger domains, as well as KRAB-A and KRAB-B motifs. The cDNA library used to isolate the initial ZNF470 clone was prepared from human bone marrow-derived mesenchymal progenitor cells at an intermediate stage of chondrogenic differentiation. We have determined the intron-exon structure of the human ZNF470 gene, which has been mapped to a zinc-finger cluster in a known imprinted region of human chromosome 19q13.4. ZNF470 is expressed at high levels in human testis and is expressed at low or undetectible levels in other adult tissues. Human ZNF470 expressed in mammalian cells as an EGFP fusion protein localizes predominantly to the nucleus, consistent with a role in transcriptional regulation. ZNF470, analyzed by quantitative real time PCR, was transiently expressed before the maximal expression of COL2A1 during chondrogenic differentiation in vitro. We have also characterized the bovine ortholog of human ZNF470, which encodes a 508 amino acid residue protein having 10 zinc-finger domains. A bovine ZNF470 cDNA clone was used to examine expression of ZNF470 in bovine articular chondrocytes treated with retinoic acid to stimulate dedifferentiation. Bovine ZNF470 expression was undetectable in freshly isolated bovine articular chondrocytes, but was dramatically upregulated in dedifferentiated retinoic acid-treated chondrocytes. These results, in two model systems, suggest a possible role for ZNF470 in the regulation of chondrogenesis-specific gene expression
Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung
2017-12-01
Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.
Wang, S-N; Shan, S; Zheng, Y; Peng, Y; Lu, Z-Y; Yang, Y-Q; Li, R-J; Zhang, Y-J; Guo, Y-Y
2017-08-01
Odorant receptors (ORs) expressed in the antennae of parasitoid wasps are responsible for detection of various lipophilic airborne molecules. In the present study, 107 novel OR genes were identified from Microplitis mediator antennal transcriptome data. Phylogenetic analysis of the set of OR genes from M. mediator and Microplitis demolitor revealed that M. mediator OR (MmedOR) genes can be classified into different subfamilies, and the majority of MmedORs in each subfamily shared high sequence identities and clear orthologous relationships to M. demolitor ORs. Within a subfamily, six MmedOR genes, MmedOR98, 124, 125, 126, 131 and 155, shared a similar gene structure and were tightly linked in the genome. To evaluate whether the clustered MmedOR genes share common regulatory features, the transcription profile and expression characteristics of the six closely related OR genes were investigated in M. mediator. Rapid amplification of cDNA ends-PCR experiments revealed that the OR genes within the cluster were transcribed as single mRNAs, and a bicistronic mRNA for two adjacent genes (MmedOR124 and MmedOR98) was also detected in female antennae by reverse transcription PCR. In situ hybridization experiments indicated that each OR gene within the cluster was expressed in a different number of cells. Moreover, there was no co-expression of the two highly related OR genes, MmedOR124 and MmedOR98, which appeared to be individually expressed in a distinct population of neurons. Overall, there were distinct expression profiles of closely related MmedOR genes from the same cluster in M. mediator. These data provide a basic understanding of the olfactory coding in parasitoid wasps. © 2017 The Royal Entomological Society.
Characterization of chicken riboflavin carrier protein gene structure ...
The chicken riboflavin carrier protein (RCP) is an estrogen induced egg yolk and white protein. Eggs from hens which have a splice mutation in RCP gene fail to hatch, indicating an absolute requirement of RCP for the transport of riboflavin to the oocyte. In order to understand the mechanism of regulation of this gene by ...
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
Smith, Frank W; Jockusch, Elizabeth L
2014-11-01
The establishment of segment identity is a key developmental process that allows for divergence along the anteroposterior body axis in arthropods. In Drosophila, the identity of a segment is determined by the complement of Hox genes it expresses. In many contexts, Hox transcription factors require the protein products of extradenticle (exd) and homothorax (hth) as cofactors to perform their identity specification functions. In holometabolous insects, segment identity may be specified twice, during embryogenesis and metamorphosis. To glean insight into the relationship between embryonic and metamorphic segmental identity specification, we have compared these processes in the flour beetle Tribolium castaneum, which develops ventral appendages during embryogenesis that later metamorphose into adult appendages with distinct morphologies. At metamorphosis, comparisons of RNAi phenotypes indicate that Hox genes function jointly with Tc-hth and Tc-exd to specify several region-specific aspects of the adult body wall. On the other hand, Hox genes specify appendage identities along the anteroposterior axis independently of Tc-hth/Tc-exd and Tc-hth/Tc-exd specify proximal vs. distal identity within appendages independently of Hox genes during this stage. During embryogenesis, Tc-hth and Tc-exd play a broad role in the segmentation process and are required for specification of body wall identities in the thorax; however, contrasting with results from other species, we did not obtain homeotic transformations of embryonic appendages in response to Tc-hth or Tc-exd RNAi. In general, the homeotic effects of interference with the function of Hox genes and Tc-hth/Tc-exd during metamorphosis did not match predictions based on embryonic roles of these genes. Comparing metamorphic patterning in T. castaneum to embryonic and post-embryonic development in hemimetabolous insects suggests that holometabolous metamorphosis combines patterning processes of both late embryogenesis and
Feizi, Amir; Gatto, Francesco; Uhlén, Mathias
2017-01-01
Protein secretory pathway in eukaryal cells is responsible for delivering functional secretory proteins. The dysfunction of this pathway causes a range of important human diseases from congenital disorders to cancer. Despite the piled-up knowledge on the molecular biology and biochemistry level...... in specific gene families of the secretory pathway. We also inspected the potential functional link between detected extreme genes and the corresponding tissues enriched secretome. As a result, the detected extreme genes showed correlation with the enrichment of the nature and number of specific post......-translational modifications in each tissue's secretome. Our findings conciliate both the housekeeping and tissue-specific nature of the protein secretory pathway, which we attribute to a fine-tuned regulation of defined gene families to support the diversity of secreted proteins and their modifications....
The genomic structure of the DMBT1 gene
Mollenhauer, J; Holmskov, U; Wiemann, S
1999-01-01
Increasing evidence has accumulated for an involvement of the inactivation of tumour suppressor genes at chromosome 10q in the carcinogenesis of brain tumours, melanomas, and carcinomas of the lung, the prostate, the pancreas, and the endometrium. The gene DMBT1 (Deleted in Malignant Brain Tumours...... 1) is located at chromosome 10q25.3-q26.1, within one of the putative intervals for tumour suppressor genes. DMBT1 is a member of the scavenger-receptor cysteine-rich (SRCR) superfamily and displays homozygous deletions or lack of expression in glioblastoma multiforme, medulloblastoma......, and in gastrointestinal and lung cancers. Based on these properties, DMBT1 has been proposed to be a candidate tumour suppressor gene. We have determined the genomic sequence of DMBT1 to allow analyses of mutations. The gene has at least 54 exons that span a genomic region of about 80 kb. We have identified a putative...
Genome-wide identification of structural variants in genes encoding drug targets
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Relationships among msx gene structure and function in zebrafish and other vertebrates.
Ekker, M; Akimenko, M A; Allende, M L; Smith, R; Drouin, G; Langille, R M; Weinberg, E S; Westerfield, M
1997-10-01
The zebrafish genome contains at least five msx homeobox genes, msxA, msxB, msxC, msxD, and the newly isolated msxE. Although these genes share structural features common to all Msx genes, phylogenetic analyses of protein sequences indicate that the msx genes from zebrafish are not orthologous to the Msx1 and Msx2 genes of mammals, birds, and amphibians. The zebrafish msxB and msxC are more closely related to each other and to the mouse Msx3. Similarly, although the combinatorial expression of the zebrafish msx genes in the embryonic dorsal neuroectoderm, visceral arches, fins, and sensory organs suggests functional similarities with the Msx genes of other vertebrates, differences in the expression patterns preclude precise assignment of orthological relationships. Distinct duplication events may have given rise to the msx genes of modern fish and other vertebrate lineages whereas many aspects of msx gene functions during embryonic development have been preserved.
Ruan, Jiapeng [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Mouveaux, Thomas [Université Lille Nord de France, (France); Light, Samuel H.; Minasov, George; Anderson, Wayne F. [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Tomavo, Stanislas [Université Lille Nord de France, (France); Ngô, Huân M., E-mail: h-ngo@northwestern.edu [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); BrainMicro LLC, 21 Pendleton Street, New Haven, CT 06511 (United States)
2015-03-01
The second crystal structure of a parasite protein preferentially enriched in the brain cyst of T. gondii has been solved at 2.75 Å resolution. Bradyzoite enolase 1 is reported to have differential functions as a glycolytic enzyme and a transcriptional regulator in bradyzoites. In addition to catalyzing a central step in glycolysis, enolase assumes a remarkably diverse set of secondary functions in different organisms, including transcription regulation as documented for the oncogene c-Myc promoter-binding protein 1. The apicomplexan parasite Toxoplasma gondii differentially expresses two nuclear-localized, plant-like enolases: enolase 1 (TgENO1) in the latent bradyzoite cyst stage and enolase 2 (TgENO2) in the rapidly replicative tachyzoite stage. A 2.75 Å resolution crystal structure of bradyzoite enolase 1, the second structure to be reported of a bradyzoite-specific protein in Toxoplasma, captures an open conformational state and reveals that distinctive plant-like insertions are located on surface loops. The enolase 1 structure reveals that a unique residue, Glu164, in catalytic loop 2 may account for the lower activity of this cyst-stage isozyme. Recombinant TgENO1 specifically binds to a TTTTCT DNA motif present in the cyst matrix antigen 1 (TgMAG1) gene promoter as demonstrated by gel retardation. Furthermore, direct physical interactions of both nuclear TgENO1 and TgENO2 with the TgMAG1 gene promoter are demonstrated in vivo using chromatin immunoprecipitation (ChIP) assays. Structural and biochemical studies reveal that T. gondii enolase functions are multifaceted, including the coordination of gene regulation in parasitic stage development. Enolase 1 provides a potential lead in the design of drugs against Toxoplasma brain cysts.
Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui
2011-05-01
Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Minerva Camacho-Nuez
2017-11-01
Full Text Available Abstract Background Bovine babesiosis is a tick-borne disease caused by the protozoan parasites of the genus Babesia. In their host vector, Babesia spp. undergo sexual reproduction. Therefore, the development of sexual stages and the subsequent formation of the zygote are essential for the parasite to invade the intestinal cells of the vector tick and continue its life-cycle. HAP2/GCS1 is a protein identified in plants, protozoan parasites and other organisms that has an important role during membrane fusion in fertilization processes. The identification and characterization of HAP-2 protein in Babesia would be very significant to understand the biology of the parasite and to develop a transmission-blocking vaccine in the future. Results To isolate and sequence the hap2 gene DNA from an infected bovine with Babesia bigemina was purified. The hap2 gene was amplified, cloned and sequenced. The sequences of hap2 from four geographically different strains showed high conservation at the amino acid level, including the typical structure with a signal peptide and the HAP2/GSC domain. Antisera anti-HAP2 against the conserved extracellular region of the HAP2 amino acid sequence were obtained from rabbits. The expression of hap2 in the host and vector tissues was analyzed by using semi-quantitative RT-PCR, and the protein was examined by western blot and immunofluorescence. Based on the RT-PCR and WB results, HAP2 is expressed in both, sexual stages induced in vitro, and in infected ticks as well. We did not detect any expression in asexual erythrocytic stages of B. bigemina, relevantly anti-HAP2 specific antibodies were able to block zygotes formation in vitro. Conclusion Babesia bigemina HAP2 is expressed only in tick-infecting stages, and specific antibodies block zygote formation. Further studies regarding the function of HAP2 during tick infection may provide new insights into the molecular mechanisms of sexual reproduction of the parasite.
Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian
2012-05-01
To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.
de Krom, Mariken; van der Schouw, Yvonne T.; Hendriks, Judith; Ophoff, Roel A.; van Gils, Carla H.; Stolk, Ronald P.; Grobbee, Diederick E.; Adan, Roger
Obesity has a heritable component; however, the heterogeneity of obesity complicates dissection of its genetic background. In this study, we therefore focused on eating patterns as specific traits within obesity. These traits have a heritable component; genes associated with a specific eating
Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary
2014-11-25
The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot
Kali D Saxton-Shaw
Full Text Available O'nyong nyong virus (ONNV and Chikungunya virus (CHIKV are two closely related alphaviruses with very different infection patterns in the mosquito, Anopheles gambiae. ONNV is the only alphavirus transmitted by anopheline mosquitoes, but specific molecular determinants of infection of this unique vector specificity remain unidentified. Fifteen distinct chimeric viruses were constructed to evaluate both structural and non-structural regions of the genome and infection patterns were determined through artificial infectious feeds in An. gambiae with each of these chimeras. Only one region, non-structural protein 3 (nsP3, was sufficient to up-regulate infection to rates similar to those seen with parental ONNV. When ONNV non-structural protein 3 (nsP3 replaced nsP3 from CHIKV virus in one of the chimeric viruses, infection rates in An. gambiae went from 0% to 63.5%. No other single gene or viral region addition was able to restore infection rates. Thus, we have shown that a non-structural genome element involved in viral replication is a major element involved in ONNV's unique vector specificity.
Karimi, Ashkan; Milewicz, Dianna M
2016-01-01
The medial layer of the aorta confers elasticity and strength to the aortic wall and is composed of alternating layers of smooth muscle cells (SMCs) and elastic fibres. The SMC elastin-contractile unit is a structural unit that links the elastin fibres to the SMCs and is characterized by the following: (1) layers of elastin fibres that are surrounded by microfibrils; (2) microfibrils that bind to the integrin receptors in focal adhesions on the cell surface of the SMCs; and (3) SMC contractile filaments that are linked to the focal adhesions on the inner side of the membrane. The genes that are altered to cause thoracic aortic aneurysms and aortic dissections encode proteins involved in the structure or function of the SMC elastin-contractile unit. Included in this gene list are the genes encoding protein that are structural components of elastin fibres and microfibrils, FBN1, MFAP5, ELN, and FBLN4. Also included are genes that encode structural proteins in the SMC contractile unit, including ACTA2, which encodes SMC-specific α-actin and MYH11, which encodes SMC-specific myosin heavy chain, along with MYLK and PRKG1, which encode kinases that control SMC contraction. Finally, mutations in the gene encoding the protein linking integrin receptors to the contractile filaments, FLNA, also predispose to thoracic aortic disease. Thus, these data suggest that functional SMC elastin-contractile units are important for maintaining the structural integrity of the aorta. Copyright © 2016 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.
Gerhard Fuka
Full Text Available BACKGROUND: ETV6/RUNX1 (E/R (also known as TEL/AML1 is the most frequent gene fusion in childhood acute lymphoblastic leukemia (ALL and also most likely the crucial factor for disease initiation; its role in leukemia propagation and maintenance, however, remains largely elusive. To address this issue we performed a shRNA-mediated knock-down (KD of the E/R fusion gene and investigated the ensuing consequences on genome-wide gene expression patterns and deducible regulatory functions in two E/R-positive leukemic cell lines. FINDINGS: Microarray analyses identified 777 genes whose expression was substantially altered. Although approximately equal proportions were either up- (KD-UP or down-regulated (KD-DOWN, the effects on biological processes and pathways differed considerably. The E/R KD-UP set was significantly enriched for genes included in the "cell activation", "immune response", "apoptosis", "signal transduction" and "development and differentiation" categories, whereas in the E/R KD-DOWN set only the "PI3K/AKT/mTOR signaling" and "hematopoietic stem cells" categories became evident. Comparable expression signatures obtained from primary E/R-positive ALL samples underline the relevance of these pathways and molecular functions. We also validated six differentially expressed genes representing the categories "stem cell properties", "B-cell differentiation", "immune response", "cell adhesion" and "DNA damage" with RT-qPCR. CONCLUSION: Our analyses provide the first preliminary evidence that the continuous expression of the E/R fusion gene interferes with key regulatory functions that shape the biology of this leukemia subtype. E/R may thus indeed constitute the essential driving force for the propagation and maintenance of the leukemic process irrespective of potential consequences of associated secondary changes. Finally, these findings may also provide a valuable source of potentially attractive therapeutic targets.
A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function
Jingjing Zhai
2016-12-01
Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.
Hemarajata, P; Gao, C; Pflughoeft, K J; Thomas, C M; Saulnier, D M; Spinler, J K; Versalovic, J
2013-12-01
Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes that were highly expressed during the stationary phase of growth, when TNF suppression is most potent. One such gene was found to be a regulator of genes involved in histidine-histamine metabolism by this probiotic species. During the course of these studies, this gene was renamed the Lactobacillus reuteri-specific immunoregulatory (rsiR) gene. The rsiR gene is essential for human TNF suppression by L. reuteri and expression of the histidine decarboxylase (hdc) gene cluster on the L. reuteri chromosome. Inactivation of rsiR resulted in diminished TNF suppression in vitro and reduced anti-inflammatory effects in vivo in a trinitrobenzene sulfonic acid (TNBS)-induced mouse model of acute colitis. A L. reuteri strain lacking an intact rsiR gene was unable to suppress colitis and resulted in greater concentrations of serum amyloid A (SAA) in the bloodstream of affected animals. The PhdcAB promoter region targeted by rsiR was defined by reporter gene experiments. These studies support the presence of a regulatory gene, rsiR, which modulates the expression of a gene cluster known to mediate immunoregulation by probiotics at the transcriptional level. These findings may point the way toward new strategies for controlling gene expression in probiotics by dietary interventions or microbiome manipulation.
CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.
Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng
2017-06-16
Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng
2017-11-13
The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly
Spontaneous Pancreatitis Caused by Tissue-Specific Gene Ablation of Hhex in MiceSummary
Mark J. Ferreira
2015-09-01
Full Text Available Background & Aims: Perturbations in pancreatic ductal bicarbonate secretion cause chronic pancreatitis. The physiologic mechanism of ductal secretion is known, but its transcriptional control is not. We determine the role of the transcription factor hematopoietically expressed homeobox protein (Hhex in ductal secretion and pancreatitis. Methods: We derived mice with pancreas-specific, Cre-mediated Hhex gene ablation to determine the requirement of Hhex in the pancreatic duct in early life and in adult stages. Histologic and immunostaining analyses were used to detect the presence of pathology. Pancreatic primary ductal cells were isolated to discover differentially expressed transcripts upon acute Hhex ablation on a cell autonomous level. Results: Hhex protein was detected throughout the embryonic and adult ductal trees. Ablation of Hhex in pancreatic progenitors resulted in postnatal ductal ectasia associated with acinar-to-ductal metaplasia, a progressive phenotype that ultimately resulted in chronic pancreatitis. Hhex ablation in adult mice, however, did not cause any detectable pathology. Ductal ectasia in young mice did not result from perturbation of expression of Hnf6, Hnf1β, or the primary cilia genes. RNA-seq analysis of Hhex-ablated pancreatic primary ductal cells showed mRNA levels of the G-protein coupled receptor natriuretic peptide receptor 3 (Npr3, implicated in paracrine signaling, up-regulated by 4.70-fold. Conclusions: Although Hhex is dispensable for ductal cell function in the adult, ablation of Hhex in pancreatic progenitors results in pancreatitis. Our data highlight the critical role of Hhex in maintaining ductal homeostasis in early life and support ductal hypersecretion as a novel etiology of pediatric chronic pancreatitis. Keywords: Npr3, Pancreatic Ducts, Primary Cilia
Quantitative analysis of gene-specific DNA damage in human spermatozoa
Sawyer, Dennis E.; Mercer, Belinda G.; Wiklendt, Agnieszka M.; Aitken, R. John
2003-01-01
Recent studies have suggested that human spermatozoa are highly susceptible to DNA damage induced by oxidative stress. However, a detailed analysis of the precise nature of this damage and the extent to which it affects the mitochondrial and nuclear genomes has not been reported. To induce DNA damage, human spermatozoa were treated in vitro with hydrogen peroxide (H 2 O 2 ; 0-5 mM) or iron (as Fe(II)SO 4 , 0-500 μM). Quantitative PCR (QPCR) was used to measure DNA damage in individual nuclear genes (hprt, β-pol and β-globin) and mitochondrial DNA. Single strand breaks were also assessed by alkaline gel electrophoresis. H 2 O 2 was found to be genotoxic toward spermatozoa at concentrations as high as 1.25 mM, but DNA damage was not detected in these cells with lower concentrations of H 2 O 2 . The mitochondrial genome of human spermatozoa was significantly (P 2 O 2 -induced DNA damage than the nuclear genome. However, both nDNA and mtDNA in human spermatozoa were significantly (P<0.001) more resistant to damage than DNA from a variety of cell lines of germ cell and myoblastoid origin. Interestingly, significant DNA damage was also not detected in human spermatozoa treated with iron. These studies report, for the first time, quantitative measurements of DNA damage in specific genes of male germ cells, and challenge the commonly held belief that human spermatozoa are particularly vulnerable to DNA damage
Structure and expression of the chicken calmodulin I gene
Ye, Q; Berchtold, M W
1997-01-01
The chicken calmodulin I (CaMI) gene has been isolated and characterized on the level of cDNA and genomic DNA. The deduced amino acid (aa) sequence is identical to the one of chicken CaMII which consists of 148 aa. The CaMI gene contains six exons. Its intron/exon organization is identical...... to that of the chicken CaMII and the CaMI and CaMIII genes of rat and human. Expression of the CaMI gene was detected in all chicken tissues examined, although at varying levels. The gene is transcribed into four mRNAs of 0.8, 1.4, 1.7 and 4.4 kb as determined by Northern blot analysis. Our results demonstrate...... that the "multigene-one-protein" principle of CaM synthesis is not only applicable to mammals whose CaM is encoded by three different genes, but also to chickens....
Location-specific epigenetic regulation of the metallothionein 3 gene in esophageal adenocarcinomas.
Dunfa Peng
Full Text Available Metallothionein 3 (MT3 maintains intracellular metal homeostasis and protects against reactive oxygen species (ROS-induced DNA damage. In this study, we investigated the epigenetic alterations and gene expression of the MT3 gene in esophageal adenocarcinomas (EACs.Using quantitative bisulfite pyrosequencing, we detected unique DNA methylation profiles in the MT3 promoter region. The CpG nucleotides from -372 to -306 from the transcription start site (TSS were highly methylated in tumor (n = 64 and normal samples (n = 51, whereas CpG nucleotides closest to the TSS (-4 and +3 remained unmethylated in all normal and most tumor samples. Conversely, CpG nucleotides in two regions (from -139 to -49 and +296 to +344 were significantly hypermethylated in EACs as compared to normal samples [FDR3.0]. The DNA methylation levels from -127 to -8 CpG sites showed the strongest correlation with MT3 gene expression (r = -0.4, P<0.0001. Moreover, the DNA hypermethylation from -127 to -8 CpG sites significantly correlated with advanced tumor stages and lymph node metastasis (P = 0.005 and P = 0.0313, respectively. The ChIP analysis demonstrated a more repressive histone modification (H3K9me2 and less active histone modifications (H3K4me2, H3K9ace in OE33 cells than in FLO-1 cells; concordant with the presence of higher DNA methylation levels and silencing of MT3 expression in OE33 as compared to FLO-1 cells. Treatment of OE33 cells with 5-Aza-deoxycitidine restored MT3 expression with demethylation of its promoter region and reversal of the histone modifications towards active histone marks.In summary, EACs are characterized by frequent epigenetic silencing of MT3. The choice of specific regions in the CpG island is a critical step in determining the functional role and prognostic value of DNA methylation in cancer cells.
Ribal María
2008-06-01
Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.
van Dijl, J M; Jong, de Anne; Smith, H; Bron, Sierd; Venema, G
1991-01-01
This paper describes an attempt to clone the Bacillus licheniformis lep gene, encoding signal peptidase, using the Salmonella typhimurium lep gene as a hybridization probe. Although a hybridizing fragment was obtained, DNA sequence analysis indicated that it did not contain the lep gene. Instead,
Juan Diego Gaitán-Espitia
Full Text Available The complete sequences of three mitochondrial genomes from the land snail Cornu aspersum were determined. The mitogenome has a length of 14050 bp, and it encodes 13 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes. It also includes nine small intergene spacers, and a large AT-rich intergenic spacer. The intra-specific divergence analysis revealed that COX1 has the lower genetic differentiation, while the most divergent genes were NADH1, NADH3 and NADH4. With the exception of Euhadra herklotsi, the structural comparisons showed the same gene order within the family Helicidae, and nearly identical gene organization to that found in order Pulmonata. Phylogenetic reconstruction recovered Basommatophora as polyphyletic group, whereas Eupulmonata and Pulmonata as paraphyletic groups. Bayesian and Maximum Likelihood analyses showed that C. aspersum is a close relative of Cepaea nemoralis, and with the other Helicidae species form a sister group of Albinaria caerulea, supporting the monophyly of the Stylommatophora clade.
Carrière, Marie; Tranchant, Isabelle; Niore, Pierre-Antoine; Byk, Gerardo; Mignet, Nathalie; Escriou, Virginie; Scherman, Daniel; Herscovici, Jean
2002-01-01
The rationale design aimed at the enhancement of cationic lipid mediated gene transfer is discussed. These improvements are based on the straight evaluation of the structure-activity relationship and on the introduction of new structures. Much attention have been given to the supramolecular structures of the lipid/DNA complexes, to the effect of serum on gene transfer and to the intracellular trafficking of the lipoplexes. Finally new avenue using reducible cationic lipids has been discussed.
Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki
2006-01-01
Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes
Minson, A C; Darby, G K; Wildy, P
1979-11-01
Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.
Tan, Aik Choon; Fan, Jian-Bing; Karikari, Collins; Bibikova, Marina; Garcia, Eliza Wickham; Zhou, Lixin; Barker, David; Serre, David; Feldmann, Georg; Hruban, Ralph H.; Klein, Alison P.; Goggins, Michael; Couch, Fergus J.; Hudson, Thomas J.; Winslow, Raimond L.
2007-01-01
Physiologic allele-specific expression (ASE) in germline tissues occurs during random X-chromosome inactivation1 and in genomic imprinting,2 wherein the two alleles of a gene in a heterozygous individual are not expressed equally. Recent studies have confirmed the existence of ASE in apparently non-imprinted autosomal genes;3–14 however, the extent of ASE in the human genome is unknown. We explored ASE in lymphoblastoid cell lines of 145 individuals using an oligonucleotide array based assay....
Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas
2018-01-01
Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177
Roumans, Nadia J T; Vink, Roel G; Gielen, Marij
2015-01-01
The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159 m.......40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner....
Adenovirus structural protein IIIa is involved in the serotype specificity of viral DNA packaging.
Ma, Hsin-Chieh; Hearing, Patrick
2011-08-01
The packaging of the adenovirus (Ad) genome into a capsid displays serotype specificity. This specificity has been attributed to viral packaging proteins, the IVa2 protein and the L1-52/55K protein. We previously found that the Ad17 L1-52/55K protein was not able to complement the growth of an Ad5 L1-52/55K mutant virus, whereas two other Ad17 packaging proteins, IVa2 and L4-22K, could complement the growth of Ad5 viruses with mutations in the respective genes. In this report, we investigated why the Ad17 L1-52/55K protein was not able to complement the Ad5 L1-52/55K mutant virus. We demonstrate that the Ad17 L1-52/55K protein binds to the Ad5 IVa2 protein in vitro and the Ad5 packaging domain in vivo, activities previously associated with packaging function. The Ad17 L1-52/55K protein also associates with empty Ad5 capsids. Interestingly, we find that the Ad17 L1-52/55K protein is able to complement the growth of an Ad5 L1-52/55K mutant virus in conjunction with the Ad17 structural protein IIIa. The same result was found with the L1-52/55K and IIIa proteins of several other Ad serotypes, including Ad3 and Ad4. The Ad17 IIIa protein associates with empty Ad5 capsids. Consistent with the complementation results, we find that the IIIa protein interacts with the L1-52/55K protein in vitro and associates with the viral packaging domain in vivo. These results underscore the complex nature of virus assembly and genome encapsidation and provide a new model for how the viral genome may tether to the empty capsid during the encapsidation process.
Jiang, Mei; Gao, Zhengliang; Wang, Jian; Nurminsky, Dmitry I
2018-01-01
To analyze transcription factors involved in gene regulation by testis-specific TAF (tTAF), tTAF-dependent promoters were mapped and analyzed in silico. Core promoters show decreased AT content, paucity of classical promoter motifs, and enrichment with translation control element CAAAATTY. Scanning of putative regulatory regions for known position frequency matrices identified 19 transcription regulators possibly contributing to tTAF-driven gene expression. Decreased male fertility associated with mutation in one of the regulators, Acj6, indicates its involvement in male reproduction. Transcriptome study of testes from male mutants for tTAF, Acj6, and previously characterized tTAF-interacting factor Modulo implies the existence of a regulatory hierarchy of tTAF, Modulo and Acj6, in which Modulo and/or Acj6 regulate one-third of tTAF-dependent genes. © 2017 Federation of European Biochemical Societies.
Futahashi Ryo
2012-05-01
Full Text Available Abstract Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern as a young larva, and switches to a green camouflage coloration (cryptic pattern in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes
Structural Basis of Histone Demethylase KDM6B Histone 3 Lysine 27 Specificity
Jones, Sarah E; Olsen, Lars; Gajhede, Michael
2018-01-01
KDM subfamily 6 enzymes KDM6A and KDM6B specifically catalyze demethylation of di- and trimethylated lysine on histone 3 lysine 27 (H3K27me3/2) and play an important role in repression of developmental genes. Despite identical amino acid sequence in the immediate surroundings of H3K9me3/2 (ARKS...
Jennifer Ferguson
Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.
New genes often acquire male-specific functions but rarely become essential in Drosophila.
Kondo, Shu; Vedanayagam, Jeffrey; Mohammed, Jaaved; Eizadshenass, Sogol; Kan, Lijuan; Pang, Nan; Aradhya, Rajaguru; Siepel, Adam; Steinhauer, Josefa; Lai, Eric C
2017-09-15
Relatively little is known about the in vivo functions of newly emerging genes, especially in metazoans. Although prior RNAi studies reported prevalent lethality among young gene knockdowns, our phylogenomic analyses reveal that young Drosophila genes are frequently restricted to the nonessential male reproductive system. We performed large-scale CRISPR/Cas9 mutagenesis of "conserved, essential" and "young, RNAi-lethal" genes and broadly confirmed the lethality of the former but the viability of the latter. Nevertheless, certain young gene mutants exhibit defective spermatogenesis and/or male sterility. Moreover, we detected widespread signatures of positive selection on young male-biased genes. Thus, young genes have a preferential impact on male reproductive system function. © 2017 Kondo et al.; Published by Cold Spring Harbor Laboratory Press.
Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong
2018-03-01
Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.
Population structure of barley landrace populations and gene-flow with modern varieties.
Elisa Bellucci
Full Text Available Landraces are heterogeneous plant varieties that are reproduced by farmers as populations that are subject to both artificial and natural selection. Landraces are distinguished by farmers due to their specific traits, and different farmers often grow different populations of the same landrace. We used simple sequence repeats (SSRs to analyse 12 barley landrace populations from Sardinia from two collections spanning 10 years. We analysed the population structure, and compared the population diversity of the landraces that were collected at field level (population. We used a representative pool of barley varieties for diversity comparisons and to analyse the effects of gene flow from modern varieties. We found that the Sardinian landraces are a distinct gene pool from those of both two-row and six-row barley varieties. There is also a low, but significant, mean level and population-dependent level of introgression from the modern varieties into the Sardinian landraces. Moreover, we show that the Sardinian landraces have the same level of gene diversity as the representative sample of modern commercial varieties grown in Italy in the last decades, even within population level. Thus, these populations represent crucial sources of germplasm that will be useful for crop improvement and for population genomics studies and association mapping, to identify genes, loci and genome regions responsible for adaptive variations. Our data also suggest that landraces are a source of valuable germplasm for sustainable agriculture in the context of future climate change, and that in-situ conservation strategies based on farmer use can preserve the genetic identity of landraces while allowing adaptation to local environments.
Li, Min; Zhang, Jiayi; Liu, Qing; Wang, Jianxin; Wu, Fang-Xiang
2014-01-01
Predicting disease-related genes is one of the most important tasks in bioinformatics and systems biology. With the advances in high-throughput techniques, a large number of protein-protein interactions are available, which make it possible to identify disease-related genes at the network level. However, network-based identification of disease-related genes is still a challenge as the considerable false-positives are still existed in the current available protein interaction networks (PIN). Considering the fact that the majority of genetic disorders tend to manifest only in a single or a few tissues, we constructed tissue-specific networks (TSN) by integrating PIN and tissue-specific data. We further weighed the constructed tissue-specific network (WTSN) by using DNA methylation as it plays an irreplaceable role in the development of complex diseases. A PageRank-based method was developed to identify disease-related genes from the constructed networks. To validate the effectiveness of the proposed method, we constructed PIN, weighted PIN (WPIN), TSN, WTSN for colon cancer and leukemia, respectively. The experimental results on colon cancer and leukemia show that the combination of tissue-specific data and DNA methylation can help to identify disease-related genes more accurately. Moreover, the PageRank-based method was effective to predict disease-related genes on the case studies of colon cancer and leukemia. Tissue-specific data and DNA methylation are two important factors to the study of human diseases. The same method implemented on the WTSN can achieve better results compared to those being implemented on original PIN, WPIN, or TSN. The PageRank-based method outperforms degree centrality-based method for identifying disease-related genes from WTSN.
Nagymihály, Marianna
2017-04-13
The formation of symbiotic nodule cells in Medicago truncatula is driven by successive endoreduplication cycles and transcriptional reprogramming in different temporal waves including the activation of more than 600 cysteine-rich NCR genes expressed only in nodules. We show here that the transcriptional waves correlate with growing ploidy levels and have investigated how the epigenome changes during endoreduplication cycles. Differential DNA methylation was found in only a small subset of symbiotic nodule-specific genes, including more than half of the NCR genes, whereas in most genes DNA methylation was unaffected by the ploidy levels and was independent of the genes\\' active or repressed state. On the other hand, expression of nodule-specific genes correlated with ploidy-dependent opening of the chromatin as well as, in a subset of tested genes, with reduced H3K27me3 levels combined with enhanced H3K9ac levels. Our results suggest that endoreduplication-dependent epigenetic changes contribute to transcriptional reprogramming in the differentiation of symbiotic cells.
Jill A. McKay
2016-10-01
Full Text Available Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or “programme”, the fetus for its anticipated post-natal environment. The mechanisms r