Directory of Open Access Journals (Sweden)
Silvia Dal Santo
Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the
Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library
Directory of Open Access Journals (Sweden)
Eddy Edward M
2007-07-01
Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.
Directory of Open Access Journals (Sweden)
David eRoquis
2014-07-01
Full Text Available Schistosoma mansoni is a parasitic plathyhelminth responsible for intestinal schistosomiasis (or bilharziasis, a disease affecting 67 million people worldwide and causing an important economic burden. The schistosomicides hycanthone, and its later proxy oxamniquine, were widely used for treatments in endemic areas during the 20th century. Recently, the mechanism of action, as well as the genetic origin of a stably and Mendelian inherited resistance for both drugs was elucidated in two strains. However, several observations suggested early on that alternative mechanisms might exist, by which resistance could be induced for these two drugs in sensitive lines of schistosomes. This induced resistance appeared rapidly, within the first generation, but was metastable (not stably inherited. Epigenetic inheritance could explain such a phenomenon and we therefore re-analyzed the historical data with our current knowledge of epigenetics. In addition, we performed new experiments such as ChIP-seq on hycanthone treated worms. We found distinct chromatin structure changes between sensitive worms and induced resistant worms from the same strain. No specific pathway was discovered, but genes in which chromatin structure modification were observed are mostly associated with transport and catabolism, which makes sense in the context of the elimination of the drug. Specific differences were observed in the repetitive compartment of the genome. We finally describe what types of experiments are needed to understand the complexity of heritability that can be based on genetic and/or epigenetic mechanisms for drug resistance in schistosomes.
Sizova, Olga V; Shashkov, Alexander S; Kondakova, Anna N; Knirel, Yuriy A; Shaikhutdinova, Rima Z; Ivanov, Sergei A; Kislichkina, Angelina A; Kadnikova, Lidia A; Bogun, Aleksandr G; Dentovskaya, Svetlana V
2018-05-02
Lipopolysaccharide was isolated from bacteria Yersinia intermedia H9-36/83 (O:17) and degraded with mild acid to give an O-specific polysaccharide, which was isolated by GPC on Sephadex G-50 and studied by sugar analysis and 1D and 2D NMR spectroscopy. The polysaccharide was found to contain 3-deoxy-3-[(R)-3-hydroxybutanoylamino]-d-fucose (d-Fuc3NR3Hb) and the following structure of the heptasaccharide repeating unit was established: The structure established is consistent with the gene content of the O-antigen gene cluster. The O-polysaccharide structure and gene cluster of Y. intermedia are related to those of Hafnia alvei 1211 and Escherichia coli O:103. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T
1993-12-01
CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.
Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana
2011-01-01
Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species
Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs.
Directory of Open Access Journals (Sweden)
Chen Xie
2012-09-01
Full Text Available Tinkering with pre-existing genes has long been known as a major way to create new genes. Recently, however, motherless protein-coding genes have been found to have emerged de novo from ancestral non-coding DNAs. How these genes originated is not well addressed to date. Here we identified 24 hominoid-specific de novo protein-coding genes with precise origination timing in vertebrate phylogeny. Strand-specific RNA-Seq analyses were performed in five rhesus macaque tissues (liver, prefrontal cortex, skeletal muscle, adipose, and testis, which were then integrated with public transcriptome data from human, chimpanzee, and rhesus macaque. On the basis of comparing the RNA expression profiles in the three species, we found that most of the hominoid-specific de novo protein-coding genes encoded polyadenylated non-coding RNAs in rhesus macaque or chimpanzee with a similar transcript structure and correlated tissue expression profile. According to the rule of parsimony, the majority of these hominoid-specific de novo protein-coding genes appear to have acquired a regulated transcript structure and expression profile before acquiring coding potential. Interestingly, although the expression profile was largely correlated, the coding genes in human often showed higher transcriptional abundance than their non-coding counterparts in rhesus macaque. The major findings we report in this manuscript are robust and insensitive to the parameters used in the identification and analysis of de novo genes. Our results suggest that at least a portion of long non-coding RNAs, especially those with active and regulated transcription, may serve as a birth pool for protein-coding genes, which are then further optimized at the transcriptional level.
A gene regulatory network armature for T-lymphocyte specification
Energy Technology Data Exchange (ETDEWEB)
Fung, Elizabeth-sharon [Los Alamos National Laboratory
2008-01-01
Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.
Gene specific actions of thyroid hormone receptor subtypes.
Directory of Open Access Journals (Sweden)
Jean Z Lin
Full Text Available There are two homologous thyroid hormone (TH receptors (TRs α and β, which are members of the nuclear hormone receptor (NR family. While TRs regulate different processes in vivo and other highly related NRs regulate distinct gene sets, initial studies of TR action revealed near complete overlaps in their actions at the level of individual genes. Here, we assessed the extent that TRα and TRβ differ in target gene regulation by comparing effects of equal levels of stably expressed exogenous TRs +/- T(3 in two cell backgrounds (HepG2 and HeLa. We find that hundreds of genes respond to T(3 or to unliganded TRs in both cell types, but were not able to detect verifiable examples of completely TR subtype-specific gene regulation. TR actions are, however, far from identical and we detect TR subtype-specific effects on global T(3 response kinetics in HepG2 cells and many examples of TR subtype specificity at the level of individual genes, including effects on magnitude of response to TR +/- T(3, TR regulation patterns and T(3 dose response. Cycloheximide (CHX treatment confirms that at least some differential effects involve verifiable direct TR target genes. TR subtype/gene-specific effects emerge in the context of widespread variation in target gene response and we suggest that gene-selective effects on mechanism of TR action highlight differences in TR subtype function that emerge in the environment of specific genes. We propose that differential TR actions could influence physiologic and pharmacologic responses to THs and selective TR modulators (STRMs.
Characterization of a novel autophagy-specific gene, ATG29
International Nuclear Information System (INIS)
Kawamata, Tomoko; Kamada, Yoshiaki; Suzuki, Kuninori; Kuboshima, Norihiro; Akimatsu, Hiroshi; Ota, Shinichi; Ohsumi, Mariko; Ohsumi, Yoshinori
2005-01-01
Autophagy is a process whereby cytoplasmic proteins and organelles are sequestered for bulk degradation in the vacuole/lysosome. At present, 16 ATG genes have been found that are essential for autophagosome formation in the yeast Saccharomyces cerevisiae. Most of these genes are also involved in the cytoplasm to vacuole transport pathway, which shares machinery with autophagy. Most Atg proteins are colocalized at the pre-autophagosomal structure (PAS), from which the autophagosome is thought to originate, but the precise mechanism of autophagy remains poorly understood. During a genetic screen aimed to obtain novel gene(s) required for autophagy, we identified a novel ORF, ATG29/YPL166w. atg29Δ cells were sensitive to starvation and induction of autophagy was severely retarded. However, the Cvt pathway operated normally. Therefore, ATG29 is an ATG gene specifically required for autophagy. Additionally, an Atg29-GFP fusion protein was observed to localize to the PAS. From these results, we propose that Atg29 functions in autophagosome formation at the PAS in collaboration with other Atg proteins
2013-01-01
Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the
Proudhon, D; Wei, J; Briat, J; Theil, E C
1996-03-01
Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may
General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD
Directory of Open Access Journals (Sweden)
Chen Xiaoheng
2017-01-01
Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.
Functional understanding of the diverse exon-intron structures of human GPCR genes.
Hammond, Dorothy A; Olman, Victor; Xu, Ying
2014-02-01
The GPCR genes have a variety of exon-intron structures even though their proteins are all structurally homologous. We have examined all human GPCR genes with at least two functional protein isoforms, totaling 199, aiming to gain an understanding of what may have contributed to the large diversity of the exon-intron structures of the GPCR genes. The 199 genes have a total of 808 known protein splicing isoforms with experimentally verified functions. Our analysis reveals that 1301 (80.6%) adjacent exon-exon pairs out of the total of 1,613 in the 199 genes have either exactly one exon skipped or the intron in-between retained in at least one of the 808 protein splicing isoforms. This observation has a statistical significance p-value of 2.051762 * e(-09), assuming that the observed splicing isoforms are independent of the exon-intron structures. Our interpretation of this observation is that the exon boundaries of the GPCR genes are not randomly determined; instead they may be selected to facilitate specific alternative splicing for functional purposes.
Comparative Annotation of Viral Genomes with Non-Conserved Gene Structure
DEFF Research Database (Denmark)
de Groot, Saskia; Mailund, Thomas; Hein, Jotun
2007-01-01
Motivation: Detecting genes in viral genomes is a complex task. Due to the biological necessity of them being constrained in length, RNA viruses in particular tend to code in overlapping reading frames. Since one amino acid is encoded by a triplet of nucleic acids, up to three genes may be coded...... allows for coding in unidirectional nested and overlapping reading frames, to annotate two homologous aligned viral genomes. Our method does not insist on conserved gene structure between the two sequences, thus making it applicable for the pairwise comparison of more distantly related sequences. Results...... and HIV2, as well as of two different Hepatitis Viruses, attaining results of ~87% sensitivity and ~98.5% specificity. We subsequently incorporate prior knowledge by "knowing" the gene structure of one sequence and annotating the other conditional on it. Boosting accuracy close to perfect we demonstrate...
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
TiGER: a database for tissue-specific gene expression and regulation.
Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang
2008-06-09
Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.
TiGER: A database for tissue-specific gene expression and regulation
Directory of Open Access Journals (Sweden)
Zack Donald J
2008-06-01
Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.
Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas
2016-05-01
Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Hepatocyte specific expression of human cloned genes
Energy Technology Data Exchange (ETDEWEB)
Cortese, R
1986-01-01
A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.
Directory of Open Access Journals (Sweden)
Benjamin Mayne
2016-10-01
Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.
Exploring the potential relevance of human-specific genes to complex disease
Directory of Open Access Journals (Sweden)
Cooper David N
2011-01-01
Full Text Available Abstract Although human disease genes generally tend to be evolutionarily more ancient than non-disease genes, complex disease genes appear to be represented more frequently than Mendelian disease genes among genes of more recent evolutionary origin. It is therefore proposed that the analysis of human-specific genes might provide new insights into the genetics of complex disease. Cross-comparison with the Human Gene Mutation Database (http://www.hgmd.org revealed a number of examples of disease-causing and disease-associated mutations in putatively human-specific genes. A sizeable proportion of these were missense polymorphisms associated with complex disease. Since both human-specific genes and genes associated with complex disease have often experienced particularly rapid rates of evolutionary change, either due to weaker purifying selection or positive selection, it is proposed that a significant number of human-specific genes may play a role in complex disease.
Tissue-specific functional networks for prioritizing phenotype and disease genes.
Directory of Open Access Journals (Sweden)
Yuanfang Guan
Full Text Available Integrated analyses of functional genomics data have enormous potential for identifying phenotype-associated genes. Tissue-specificity is an important aspect of many genetic diseases, reflecting the potentially different roles of proteins and pathways in diverse cell lineages. Accounting for tissue specificity in global integration of functional genomics data is challenging, as "functionality" and "functional relationships" are often not resolved for specific tissue types. We address this challenge by generating tissue-specific functional networks, which can effectively represent the diversity of protein function for more accurate identification of phenotype-associated genes in the laboratory mouse. Specifically, we created 107 tissue-specific functional relationship networks through integration of genomic data utilizing knowledge of tissue-specific gene expression patterns. Cross-network comparison revealed significantly changed genes enriched for functions related to specific tissue development. We then utilized these tissue-specific networks to predict genes associated with different phenotypes. Our results demonstrate that prediction performance is significantly improved through using the tissue-specific networks as compared to the global functional network. We used a testis-specific functional relationship network to predict genes associated with male fertility and spermatogenesis phenotypes, and experimentally confirmed one top prediction, Mbyl1. We then focused on a less-common genetic disease, ataxia, and identified candidates uniquely predicted by the cerebellum network, which are supported by both literature and experimental evidence. Our systems-level, tissue-specific scheme advances over traditional global integration and analyses and establishes a prototype to address the tissue-specific effects of genetic perturbations, diseases and drugs.
Genome-scale analysis of positional clustering of mouse testis-specific genes
Directory of Open Access Journals (Sweden)
Lee Bernett TK
2005-01-01
Full Text Available Abstract Background Genes are not randomly distributed on a chromosome as they were thought even after removal of tandem repeats. The positional clustering of co-expressed genes is known in prokaryotes and recently reported in several eukaryotic organisms such as Caenorhabditis elegans, Drosophila melanogaster, and Homo sapiens. In order to further investigate the mode of tissue-specific gene clustering in higher eukaryotes, we have performed a genome-scale analysis of positional clustering of the mouse testis-specific genes. Results Our computational analysis shows that a large proportion of testis-specific genes are clustered in groups of 2 to 5 genes in the mouse genome. The number of clusters is much higher than expected by chance even after removal of tandem repeats. Conclusion Our result suggests that testis-specific genes tend to cluster on the mouse chromosomes. This provides another piece of evidence for the hypothesis that clusters of tissue-specific genes do exist.
Directory of Open Access Journals (Sweden)
Reverter Antonio
2008-09-01
Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing
A framework for scalable parameter estimation of gene circuit models using structural information
Kuwahara, Hiroyuki
2013-06-21
Motivation: Systematic and scalable parameter estimation is a key to construct complex gene regulatory models and to ultimately facilitate an integrative systems biology approach to quantitatively understand the molecular mechanisms underpinning gene regulation. Results: Here, we report a novel framework for efficient and scalable parameter estimation that focuses specifically on modeling of gene circuits. Exploiting the structure commonly found in gene circuit models, this framework decomposes a system of coupled rate equations into individual ones and efficiently integrates them separately to reconstruct the mean time evolution of the gene products. The accuracy of the parameter estimates is refined by iteratively increasing the accuracy of numerical integration using the model structure. As a case study, we applied our framework to four gene circuit models with complex dynamics based on three synthetic datasets and one time series microarray data set. We compared our framework to three state-of-the-art parameter estimation methods and found that our approach consistently generated higher quality parameter solutions efficiently. Although many general-purpose parameter estimation methods have been applied for modeling of gene circuits, our results suggest that the use of more tailored approaches to use domain-specific information may be a key to reverse engineering of complex biological systems. The Author 2013.
A framework for scalable parameter estimation of gene circuit models using structural information
Kuwahara, Hiroyuki; Fan, Ming; Wang, Suojin; Gao, Xin
2013-01-01
Motivation: Systematic and scalable parameter estimation is a key to construct complex gene regulatory models and to ultimately facilitate an integrative systems biology approach to quantitatively understand the molecular mechanisms underpinning gene regulation. Results: Here, we report a novel framework for efficient and scalable parameter estimation that focuses specifically on modeling of gene circuits. Exploiting the structure commonly found in gene circuit models, this framework decomposes a system of coupled rate equations into individual ones and efficiently integrates them separately to reconstruct the mean time evolution of the gene products. The accuracy of the parameter estimates is refined by iteratively increasing the accuracy of numerical integration using the model structure. As a case study, we applied our framework to four gene circuit models with complex dynamics based on three synthetic datasets and one time series microarray data set. We compared our framework to three state-of-the-art parameter estimation methods and found that our approach consistently generated higher quality parameter solutions efficiently. Although many general-purpose parameter estimation methods have been applied for modeling of gene circuits, our results suggest that the use of more tailored approaches to use domain-specific information may be a key to reverse engineering of complex biological systems. The Author 2013.
MADS-box gene evolution - structure and transcription patterns
DEFF Research Database (Denmark)
Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin
2002-01-01
Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...
Directory of Open Access Journals (Sweden)
Nicholas Delihas
Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in
Gene Composer in a structural genomics environment
International Nuclear Information System (INIS)
Lorimer, Don; Raymond, Amy; Mixon, Mark; Burgin, Alex; Staker, Bart; Stewart, Lance
2011-01-01
For structural biology applications, protein-construct engineering is guided by comparative sequence analysis and structural information, which allow the researcher to better define domain boundaries for terminal deletions and nonconserved regions for surface mutants. A database software application called Gene Composer has been developed to facilitate construct design. The structural genomics effort at the Seattle Structural Genomics Center for Infectious Disease (SSGCID) requires the manipulation of large numbers of amino-acid sequences and the underlying DNA sequences which are to be cloned into expression vectors. To improve efficiency in high-throughput protein structure determination, a database software package, Gene Composer, has been developed which facilitates the information-rich design of protein constructs and their underlying gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bioinformatics steps used in modern structure-guided protein engineering and synthetic gene engineering. An example of the structure determination of H1N1 RNA-dependent RNA polymerase PB2 subunit is given
Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing
2009-03-11
Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene
Discovery of cancer common and specific driver gene sets
2017-01-01
Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295
Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng
2016-05-01
Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
A framework for scalable parameter estimation of gene circuit models using structural information.
Kuwahara, Hiroyuki; Fan, Ming; Wang, Suojin; Gao, Xin
2013-07-01
Systematic and scalable parameter estimation is a key to construct complex gene regulatory models and to ultimately facilitate an integrative systems biology approach to quantitatively understand the molecular mechanisms underpinning gene regulation. Here, we report a novel framework for efficient and scalable parameter estimation that focuses specifically on modeling of gene circuits. Exploiting the structure commonly found in gene circuit models, this framework decomposes a system of coupled rate equations into individual ones and efficiently integrates them separately to reconstruct the mean time evolution of the gene products. The accuracy of the parameter estimates is refined by iteratively increasing the accuracy of numerical integration using the model structure. As a case study, we applied our framework to four gene circuit models with complex dynamics based on three synthetic datasets and one time series microarray data set. We compared our framework to three state-of-the-art parameter estimation methods and found that our approach consistently generated higher quality parameter solutions efficiently. Although many general-purpose parameter estimation methods have been applied for modeling of gene circuits, our results suggest that the use of more tailored approaches to use domain-specific information may be a key to reverse engineering of complex biological systems. http://sfb.kaust.edu.sa/Pages/Software.aspx. Supplementary data are available at Bioinformatics online.
Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J
2013-05-01
FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.
Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.
Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K
1989-10-01
Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)
Structure and expression of the human and mouse T4 genes
International Nuclear Information System (INIS)
Maddon, P.J.; Molineaux, S.M.; Maddon, D.F.; Zimmerman, K.A.; Godfrey, M.; Alt, F.W.; Chess, L.; Axel, R.
1987-01-01
The T4 molecule may serve as a T-cell receptor recognizing molecules on the surface of specific target cells and also serves as the receptor for the human immunodeficiency virus. To define the mechanisms of interaction of T4 with the surface of antigen-presenting cells as well as with human immunodeficiency virus, the authors have further analyzed the sequence, structure, and expression of the human and mouse T4 genes. T4 consists of an extracellular segment comprised of a leader sequence followed by four tandem variable-joining (VJ)-like domains, a transmembrane domain, and A cytoplasmic segment. The structural domains of the T4 protein deduced from amino acid sequence are precisely reflected in the intron-exon organization of the gene. Analysis of the expression of the T4 gene indicates that T4 RNA is expressed not only in T lymphocytes, but in B cells, macrophages, and granulocytes. T4 is also expressed in a developmentally regulated manner in specific regions of the brain. It is, therefore, possible that T4 plays a more general role in mediating cell recognition events that are not restricted to the cellular immune response
Dissecting specific and global transcriptional regulation of bacterial gene expression
Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe
Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an
Description of electrophoretic loci and tissue specific gene ...
African Journals Online (AJOL)
Protein electrophoresis was used to study the distributions and tissue specificity of gene expression of enzymes encoded by 42 loci in Rhinolophus clivosus and R. landeri, the genetically most divergent of the ten species of southern African horseshoe bats. No differences in gene expression were found between R.
Neuronal type-specific gene expression profiling and laser-capture microdissection.
Pietersen, Charmaine Y; Lim, Maribel P; Macey, Laurel; Woo, Tsung-Ung W; Sonntag, Kai C
2011-01-01
The human brain is an exceptionally heterogeneous structure. In order to gain insight into the neurobiological basis of neural circuit disturbances in various neurologic or psychiatric diseases, it is often important to define the molecular cascades that are associated with these disturbances in a neuronal type-specific manner. This can be achieved by the use of laser microdissection, in combination with molecular techniques such as gene expression profiling. To identify neurons in human postmortem brain tissue, one can use the inherent properties of the neuron, such as pigmentation and morphology or its structural composition through immunohistochemistry (IHC). Here, we describe the isolation of homogeneous neuronal cells and high-quality RNA from human postmortem brain material using a combination of rapid IHC, Nissl staining, or simple morphology with Laser-Capture Microdissection (LCM) or Laser Microdissection (LMD).
Microarray meta-analysis to explore abiotic stress-specific gene expression patterns in Arabidopsis.
Shen, Po-Chih; Hour, Ai-Ling; Liu, Li-Yu Daisy
2017-12-01
Abiotic stresses are the major limiting factors that affect plant growth, development, yield and final quality. Deciphering the underlying mechanisms of plants' adaptations to stresses using few datasets might overlook the different aspects of stress tolerance in plants, which might be simultaneously and consequently operated in the system. Fortunately, the accumulated microarray expression data offer an opportunity to infer abiotic stress-specific gene expression patterns through meta-analysis. In this study, we propose to combine microarray gene expression data under control, cold, drought, heat, and salt conditions and determined modules (gene sets) of genes highly associated with each other according to the observed expression data. By analyzing the expression variations of the Eigen genes from different conditions, we had identified two, three, and five gene modules as cold-, heat-, and salt-specific modules, respectively. Most of the cold- or heat-specific modules were differentially expressed to a particular degree in shoot samples, while most of the salt-specific modules were differentially expressed to a particular degree in root samples. A gene ontology (GO) analysis on the stress-specific modules suggested that the gene modules exclusively enriched stress-related GO terms and that different genes under the same GO terms may be alternatively disturbed in different conditions. The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search. Our protocols study the specificity of the gene modules that were specifically activated under a particular type of abiotic stress. The biplot can also assist to visualize the stress-specific gene modules. In conclusion, our approach has the potential to further elucidate mechanisms in plants and beneficial for future experiments design under different abiotic stresses.
Directory of Open Access Journals (Sweden)
Clark Taane G
2010-04-01
Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes
Evolutionary constraints shape caste-specific gene expression across 15 ant species.
Morandin, Claire; Mikheyev, Alexander S; Pedersen, Jes Søe; Helanterä, Heikki
2017-05-01
Development of polymorphic phenotypes from similar genomes requires gene expression differences. However, little is known about how morph-specific gene expression patterns vary on a broad phylogenetic scale. We hypothesize that evolution of morph-specific gene expression, and consequently morph-specific phenotypic evolution, may be constrained by gene essentiality and the amount of pleiotropic constraints. Here, we use comparative transcriptomics of queen and worker morphs, that is, castes, from 15 ant species to understand the constraints of morph-biased gene expression. In particular, we investigate how measures of evolutionary constraints at the sequence level (expression level, connectivity, and number of gene ontology [GO] terms) correlate with morph-biased expression. Our results show that genes indeed vary in their potential to become morph-biased. The existence of genes that are constrained in becoming caste-biased potentially limits the evolutionary decoupling of the caste phenotypes, that is, it might result in "caste load" occasioning from antagonistic fitness variation, similarly to sexually antagonistic fitness variation between males and females. On the other hand, we suggest that genes under low constraints are released from antagonistic variation and thus more likely to be co-opted for morph specific use. Overall, our results suggest that the factors that affect sequence evolutionary rates and evolution of plastic expression may largely overlap. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C
2013-06-01
Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.
Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.
Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong
2016-05-20
Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.
Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne
2017-08-01
Activation of G protein-coupled estrogen receptor (GPER) by its agonist, G1, protects the heart from stressors such as pressure-overload, ischemia, a high-salt diet, estrogen loss, and aging, in various male and female animal models. Due to nonspecific effects of G1, the exact functions of cardiac GPER cannot be concluded from studies using systemic G1 administration. Moreover, global knockdown of GPER affects glucose homeostasis, blood pressure, and many other cardiovascular-related systems, thereby confounding interpretation of its direct cardiac actions. We generated a cardiomyocyte-specific GPER knockout (KO) mouse model to specifically investigate the functions of GPER in cardiomyocytes. Compared to wild type mice, cardiomyocyte-specific GPER KO mice exhibited adverse alterations in cardiac structure and impaired systolic and diastolic function, as measured by echocardiography. Gene deletion effects on left ventricular dimensions were more profound in male KO mice compared to female KO mice. Analysis of DNA microarray data from isolated cardiomyocytes of wild type and KO mice revealed sex-based differences in gene expression profiles affecting multiple transcriptional networks. Gene Set Enrichment Analysis (GSEA) revealed that mitochondrial genes are enriched in GPER KO females, whereas inflammatory response genes are enriched in GPER KO males, compared to their wild type counterparts of the same sex. The cardiomyocyte-specific GPER KO mouse model provides us with a powerful tool to study the functions of GPER in cardiomyocytes. The gene expression profiles of the GPER KO mice provide foundational information for further study of the mechanisms underlying sex-specific cardioprotection by GPER. Copyright © 2016 Elsevier B.V. All rights reserved.
Structure and genetics of the O-specific polysaccharide of Escherichia coli O27.
Perepelov, Andrei V; Chen, Tingting; Senchenkova, Sofya N; Filatov, Andrei V; Song, Jingjie; Shashkov, Alexander S; Liu, Bin; Knirel, Yuriy A
2018-02-01
The O-specific polysaccharide (O-antigen) is a part of the lipopolysaccharide on the cell surface of Gram-negative bacteria. The O-polysaccharide was obtained by mild acid hydrolysis of the lipopolysaccharide of Escherichia coli O27 and studied by sugar analysis and Smith degradation along with 1 H and 13 C NMR spectroscopy. The following structure of the branched hexasaccharide repeating unit was established, which is unique among known structures of bacterial polysaccharides:where GlcA is non-stoichiometrically O-acetylated at position 3 (∼22%) or 4 (∼37%). Functions of genes in the O-antigen gene cluster of E. coli O27 were tentatively assigned by comparison with sequences in the available databases and found to be consistent with the O-polysaccharide structure. Copyright © 2017 Elsevier Ltd. All rights reserved.
Identification of the two rotavirus genes determining neutralization specificities
International Nuclear Information System (INIS)
Offit, P.A.; Blavat, G.
1986-01-01
Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities
Identification of the two rotavirus genes determining neutralization specificities
Energy Technology Data Exchange (ETDEWEB)
Offit, P.A.; Blavat, G.
1986-01-01
Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.
Directory of Open Access Journals (Sweden)
Rong-Ping Zhang
Full Text Available Skeletal muscle growth and development are highly orchestrated processes involving significant changes in gene expressions. Differences in the location-specific and breed-specific genes and pathways involved have important implications for meat productions and meat quality. Here, RNA-Seq was performed to identify differences in the muscle deposition between two muscle locations and two duck breeds for functional genomics studies. To achieve those goals, skeletal muscle samples were collected from the leg muscle (LM and the pectoral muscle (PM of two genetically different duck breeds, Heiwu duck (H and Peking duck (P, at embryonic 15 days. Functional genomics studies were performed in two experiments: Experiment 1 directly compared the location-specific genes between PM and LM, and Experiment 2 compared the two breeds (H and P at the same developmental stage (embryonic 15 days. Almost 13 million clean reads were generated using Illumina technology (Novogene, Beijing, China on each library, and more than 70% of the reads mapped to the Peking duck (Anas platyrhynchos genome. A total of 168 genes were differentially expressed between the two locations analyzed in Experiment 1, whereas only 8 genes were differentially expressed when comparing the same location between two breeds in Experiment 2. Gene Ontology (GO and the Kyoto Encyclopedia of Genes and Genomes pathways (KEGG were used to functionally annotate DEGs (differentially expression genes. The DEGs identified in Experiment 1 were mainly involved in focal adhesion, the PI3K-Akt signaling pathway and ECM-receptor interaction pathways (corrected P-value<0.05. In Experiment 2, the DEGs were associated with only the ribosome signaling pathway (corrected P-value<0.05. In addition, quantitative real-time PCR was used to confirm 15 of the differentially expressed genes originally detected by RNA-Seq. A comparative transcript analysis of the leg and pectoral muscles of two duck breeds not only
Study on Fusion Protein and Its gene in Baculovirus Specificity
International Nuclear Information System (INIS)
Nemr, W.A.H.
2012-01-01
Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at
Zhang, R L; Samuelson, D A; Zhang, Z G; Reddy, V N; Shastry, B S
1991-08-01
The congenital hereditary cataracts and microphthalmia in the miniature schnauzer dog are inherited by an autosomal recessive mode. To understand the genetic basis of these diseases, the authors purified and analyzed leukocyte deoxyribonucleic acid (DNA) from affected and normal animals using a candidate gene approach. Because the genes that encode the lens-specific proteins, specifically, alpha, beta, and gamma crystallins and the membrane protein (MP26), are known to maintain the structure and function of the lens, the authors used complimentary DNA (cDNA) fragments that corresponded to the above genes to search for the mutations at their loci in the affected animals. They found no evidence of the gene deletion and rearrangement in any of the five loci. In addition, the hybridizable sequences of the dog DNA to the specific probes for the human chromosome 4 and 18 loci, which are reported to be involved in the abnormality of the human eye, seem to be unaffected. These data support the notion that the hereditary cataracts and microphthalmia in the dog may be associated with genes other than those reported for several animal systems.
Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.
Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella
2017-10-01
Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Karimi, Ashkan; Milewicz, Dianna M
2016-01-01
The medial layer of the aorta confers elasticity and strength to the aortic wall and is composed of alternating layers of smooth muscle cells (SMCs) and elastic fibres. The SMC elastin-contractile unit is a structural unit that links the elastin fibres to the SMCs and is characterized by the following: (1) layers of elastin fibres that are surrounded by microfibrils; (2) microfibrils that bind to the integrin receptors in focal adhesions on the cell surface of the SMCs; and (3) SMC contractile filaments that are linked to the focal adhesions on the inner side of the membrane. The genes that are altered to cause thoracic aortic aneurysms and aortic dissections encode proteins involved in the structure or function of the SMC elastin-contractile unit. Included in this gene list are the genes encoding protein that are structural components of elastin fibres and microfibrils, FBN1, MFAP5, ELN, and FBLN4. Also included are genes that encode structural proteins in the SMC contractile unit, including ACTA2, which encodes SMC-specific α-actin and MYH11, which encodes SMC-specific myosin heavy chain, along with MYLK and PRKG1, which encode kinases that control SMC contraction. Finally, mutations in the gene encoding the protein linking integrin receptors to the contractile filaments, FLNA, also predispose to thoracic aortic disease. Thus, these data suggest that functional SMC elastin-contractile units are important for maintaining the structural integrity of the aorta. Copyright © 2016 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.
Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu
2013-12-01
Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.
Directory of Open Access Journals (Sweden)
Jin-Sung Hong
2013-09-01
Full Text Available Polygalacturonase (PG gene is a typical gene family present in eukaryotes. Forty-nine PGs were mined from the genomes of Neurospora crassa and five Aspergillus species. The PGs were classified into 3 clades such as clade 1 for rhamno-PGs, clade 2 for exo-PGs and clade 3 for exo- and endo-PGs, which were further grouped into 13 sub-clades based on the polypeptide sequence similarity. In gene structure analysis, a total of 124 introns were present in 44 genes and five genes lacked introns to give an average of 2.5 introns per gene. Intron phase distribution was 64.5% for phase 0, 21.8% for phase 1, and 13.7% for phase 2, respectively. The introns varied in their sequences and their lengths ranged from 20 bp to 424 bp with an average of 65.9 bp, which is approximately half the size of introns in other fungal genes. There were 29 homologous intron blocks and 26 of those were sub-clade specific. Intron losses were counted in 18 introns in which no obvious phase preference for intron loss was observed. Eighteen introns were placed at novel positions, which is considerably higher than those of plant PGs. In an evolutionary sense both intron loss and gain must have taken place for shaping the current PGs in these fungi. Together with the small intron size, low conservation of homologous intron blocks and higher number of novel introns, PGs of fungal species seem to have recently undergone highly dynamic evolution.
International Nuclear Information System (INIS)
Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng
2005-01-01
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases
Community Structure Analysis of Gene Interaction Networks in Duchenne Muscular Dystrophy.
Directory of Open Access Journals (Sweden)
Tejaswini Narayanan
Full Text Available Duchenne Muscular Dystrophy (DMD is an important pathology associated with the human skeletal muscle and has been studied extensively. Gene expression measurements on skeletal muscle of patients afflicted with DMD provides the opportunity to understand the underlying mechanisms that lead to the pathology. Community structure analysis is a useful computational technique for understanding and modeling genetic interaction networks. In this paper, we leverage this technique in combination with gene expression measurements from normal and DMD patient skeletal muscle tissue to study the structure of genetic interactions in the context of DMD. We define a novel framework for transforming a raw dataset of gene expression measurements into an interaction network, and subsequently apply algorithms for community structure analysis for the extraction of topological communities. The emergent communities are analyzed from a biological standpoint in terms of their constituent biological pathways, and an interpretation that draws correlations between functional and structural organization of the genetic interactions is presented. We also compare these communities and associated functions in pathology against those in normal human skeletal muscle. In particular, differential enhancements are observed in the following pathways between pathological and normal cases: Metabolic, Focal adhesion, Regulation of actin cytoskeleton and Cell adhesion, and implication of these mechanisms are supported by prior work. Furthermore, our study also includes a gene-level analysis to identify genes that are involved in the coupling between the pathways of interest. We believe that our results serve to highlight important distinguishing features in the structural/functional organization of constituent biological pathways, as it relates to normal and DMD cases, and provide the mechanistic basis for further biological investigations into specific pathways differently regulated
Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil
2017-10-27
Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes
Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris
Directory of Open Access Journals (Sweden)
Harindra E. Amarasinghe
2015-07-01
Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.
Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A
2015-08-01
Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.
Epigenetic repression of male gametophyte-specific genes in the Arabidopsis sporophyte
DEFF Research Database (Denmark)
Hoffmann, Robert D; Palmgren, Michael Broberg
2013-01-01
Tissue formation, the identity of cells, and the functions they fulfill, are results of gene regulation. The male gametophyte of plants, pollen, is outstanding in this respect as several hundred genes expressed in pollen are not expressed in the sporophyte. How pollen-specific genes are down......-regulated in the sporophyte has yet to be established. In this study, we have performed a bioinformatics analysis of publicly available genome-wide epigenetics data of several sporophytic tissues. By combining this analysis with DNase I footprinting data, we assessed means by which the repression of pollen-specific genes...
Analysis of Gene Expression Variance in Schizophrenia Using Structural Equation Modeling
Directory of Open Access Journals (Sweden)
Anna A. Igolkina
2018-06-01
Full Text Available Schizophrenia (SCZ is a psychiatric disorder of unknown etiology. There is evidence suggesting that aberrations in neurodevelopment are a significant attribute of schizophrenia pathogenesis and progression. To identify biologically relevant molecular abnormalities affecting neurodevelopment in SCZ we used cultured neural progenitor cells derived from olfactory neuroepithelium (CNON cells. Here, we tested the hypothesis that variance in gene expression differs between individuals from SCZ and control groups. In CNON cells, variance in gene expression was significantly higher in SCZ samples in comparison with control samples. Variance in gene expression was enriched in five molecular pathways: serine biosynthesis, PI3K-Akt, MAPK, neurotrophin and focal adhesion. More than 14% of variance in disease status was explained within the logistic regression model (C-value = 0.70 by predictors accounting for gene expression in 69 genes from these five pathways. Structural equation modeling (SEM was applied to explore how the structure of these five pathways was altered between SCZ patients and controls. Four out of five pathways showed differences in the estimated relationships among genes: between KRAS and NF1, and KRAS and SOS1 in the MAPK pathway; between PSPH and SHMT2 in serine biosynthesis; between AKT3 and TSC2 in the PI3K-Akt signaling pathway; and between CRK and RAPGEF1 in the focal adhesion pathway. Our analysis provides evidence that variance in gene expression is an important characteristic of SCZ, and SEM is a promising method for uncovering altered relationships between specific genes thus suggesting affected gene regulation associated with the disease. We identified altered gene-gene interactions in pathways enriched for genes with increased variance in expression in SCZ. These pathways and loci were previously implicated in SCZ, providing further support for the hypothesis that gene expression variance plays important role in the etiology
DEFF Research Database (Denmark)
Larsen, P.F.; Eg Nielsen, Einar; Hansen, M.M.
2013-01-01
Recent genetic analyses of candidate genes and gene expression in marine fishes have provided evidence of local adaptation in response to environmental differences, despite the lack of strong signals of population structure from conventional neutral genetic markers. In this study expression...... in flounder. In gill tissue a plastic response to salinity treatments was observed with general up-regulation of these genes concomitant with higher salinity. For liver tissue a population specific expression differences was observed with lower expression at simulated non-native compared to native salinities...... in high gene flow marine fishes. © 2013 The Genetics Society of Korea...
Heritable and lineage-specific gene knockdown in zebrafish embryo.
Directory of Open Access Journals (Sweden)
Mei Dong
Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.
Optimal structural inference of signaling pathways from unordered and overlapping gene sets.
Acharya, Lipi R; Judeh, Thair; Wang, Guangdi; Zhu, Dongxiao
2012-02-15
A plethora of bioinformatics analysis has led to the discovery of numerous gene sets, which can be interpreted as discrete measurements emitted from latent signaling pathways. Their potential to infer signaling pathway structures, however, has not been sufficiently exploited. Existing methods accommodating discrete data do not explicitly consider signal cascading mechanisms that characterize a signaling pathway. Novel computational methods are thus needed to fully utilize gene sets and broaden the scope from focusing only on pairwise interactions to the more general cascading events in the inference of signaling pathway structures. We propose a gene set based simulated annealing (SA) algorithm for the reconstruction of signaling pathway structures. A signaling pathway structure is a directed graph containing up to a few hundred nodes and many overlapping signal cascades, where each cascade represents a chain of molecular interactions from the cell surface to the nucleus. Gene sets in our context refer to discrete sets of genes participating in signal cascades, the basic building blocks of a signaling pathway, with no prior information about gene orderings in the cascades. From a compendium of gene sets related to a pathway, SA aims to search for signal cascades that characterize the optimal signaling pathway structure. In the search process, the extent of overlap among signal cascades is used to measure the optimality of a structure. Throughout, we treat gene sets as random samples from a first-order Markov chain model. We evaluated the performance of SA in three case studies. In the first study conducted on 83 KEGG pathways, SA demonstrated a significantly better performance than Bayesian network methods. Since both SA and Bayesian network methods accommodate discrete data, use a 'search and score' network learning strategy and output a directed network, they can be compared in terms of performance and computational time. In the second study, we compared SA and
XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD
Directory of Open Access Journals (Sweden)
Devon Shook
2017-12-01
Full Text Available A single-nucleotide polymorphism (SNP of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD. This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in children with and without ADHD. We collected 279 longitudinal T1-weighted structural images and DNA from 58 children with ADHD and 64 typically developing (TD children matched for age, IQ, and gender. Groups were divided by the XKR4 rs2939678 SNP into A-allele carriers versus subjects homozygous for the G-allele. Cerebellar lobular volumes were segmented into 35 regions of interest using MAGeTBrain, an automated multi-atlas segmentation pipeline for anatomical MRI, and statistically analyzed using linear mixed models. We found decreased gray matter (GM volumes in ADHD compared to TD children in bilateral lobules VIIIA, left VIIIB, right VIIB, and vermis VI. Furthermore, we found a linear age by gene interaction in left lobule VIIB where subjects homozygous for the G-allele showed a decrease in volume over time compared to A-allele carriers. We further found quadratic age × gene and age × diagnosis interactions in left lobule IV. Subjects homozygous for the G-allele (the genotype overtransmitted in ADHD showed more suppressed, almost flat quadratic growth curves compared to A-allele carriers, similar to individuals with ADHD compared to controls. However, there was no interaction between genotype and diagnosis, suggesting that any effects of this SNP on cerebellar development are not specific to the disorder.
XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD.
Shook, Devon; Brouwer, Rachel; de Zeeuw, Patrick; Oranje, Bob; Durston, Sarah
2017-01-01
A single-nucleotide polymorphism (SNP) of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD). This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in children with and without ADHD. We collected 279 longitudinal T1-weighted structural images and DNA from 58 children with ADHD and 64 typically developing (TD) children matched for age, IQ, and gender. Groups were divided by the XKR4 rs2939678 SNP into A-allele carriers versus subjects homozygous for the G-allele. Cerebellar lobular volumes were segmented into 35 regions of interest using MAGeTBrain, an automated multi-atlas segmentation pipeline for anatomical MRI, and statistically analyzed using linear mixed models. We found decreased gray matter (GM) volumes in ADHD compared to TD children in bilateral lobules VIIIA, left VIIIB, right VIIB, and vermis VI. Furthermore, we found a linear age by gene interaction in left lobule VIIB where subjects homozygous for the G-allele showed a decrease in volume over time compared to A-allele carriers. We further found quadratic age × gene and age × diagnosis interactions in left lobule IV. Subjects homozygous for the G-allele (the genotype overtransmitted in ADHD) showed more suppressed, almost flat quadratic growth curves compared to A-allele carriers, similar to individuals with ADHD compared to controls. However, there was no interaction between genotype and diagnosis, suggesting that any effects of this SNP on cerebellar development are not specific to the disorder.
Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin
2017-12-06
Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these
Joshi, Anagha
2014-12-30
Transcriptional hotspots are defined as genomic regions bound by multiple factors. They have been identified recently as cell type specific enhancers regulating developmentally essential genes in many species such as worm, fly and humans. The in-depth analysis of hotspots across multiple cell types in same species still remains to be explored and can bring new biological insights. We therefore collected 108 transcription-related factor (TF) ChIP sequencing data sets in ten murine cell types and classified the peaks in each cell type in three groups according to binding occupancy as singletons (low-occupancy), combinatorials (mid-occupancy) and hotspots (high-occupancy). The peaks in the three groups clustered largely according to the occupancy, suggesting priming of genomic loci for mid occupancy irrespective of cell type. We then characterized hotspots for diverse structural functional properties. The genes neighbouring hotspots had a small overlap with hotspot genes in other cell types and were highly enriched for cell type specific function. Hotspots were enriched for sequence motifs of key TFs in that cell type and more than 90% of hotspots were occupied by pioneering factors. Though we did not find any sequence signature in the three groups, the H3K4me1 binding profile had bimodal peaks at hotspots, distinguishing hotspots from mono-modal H3K4me1 singletons. In ES cells, differentially expressed genes after perturbation of activators were enriched for hotspot genes suggesting hotspots primarily act as transcriptional activator hubs. Finally, we proposed that ES hotspots might be under control of SetDB1 and not DNMT for silencing. Transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes. In ES cells, they are predicted to act as transcriptional activator hubs and might be under SetDB1 control for silencing.
Directory of Open Access Journals (Sweden)
Hettne Kristina M
2013-01-01
Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.
DEFF Research Database (Denmark)
Hansen, Kasper Lage; Hansen, Niclas Tue; Karlberg, Erik, Olof, Linnart
2008-01-01
to be overexpressed in the normal tissues where defects cause pathology. In contrast, cancer genes and complexes were not overexpressed in the tissues from which the tumors emanate. We specifically identified a complex involved in XY sex reversal that is testis-specific and down-regulated in ovaries. We also......Heritable diseases are caused by germ-line mutations that, despite tissuewide presence, often lead to tissue-specific pathology. Here, we make a systematic analysis of the link between tissue-specific gene expression and pathological manifestations in many human diseases and cancers. Diseases were...
Gene program-specific regulation of PGC-1{alpha} activity
DEFF Research Database (Denmark)
Schmidt, Søren F; Mandrup, Susanne
2011-01-01
Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)
2007-07-01
As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.
Repressor-mediated tissue-specific gene expression in plants
Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA
2009-02-17
Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.
Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Rymar, S Iu; Isakova, I A; Kuznietsova, L M; Kordium, V A
2006-01-01
The insecticidal crystal proteins of 15 B. thuringiensis strains, isolated in the Crimea territory that are toxical for some Lepidoptera and Colorado potato beetle larvae were identified by PAGE electrophoresis. Ten strains produced the crystal proteins with high molecular weight (> 120 kD). PCR with use of broad specificity primers and DNA of these B. thuringiensis strains as template demonstrated the specific PCR products (1000 bp). Amplified DNA fragments were cloned and sequenced. The nucleotide sequence analysis revealed that the genomes of ten strains of B. thuringiensis carried Cry1B genes, which are responsible for production of the insecticidal crystal proteins with dual specificity. The influence of the solubilization conditions on the structure and toxicity of Cry1B protein for Colorado potato beetle larvae was shown. The dual toxicity of studied B. thuringiensis strains is explained by the Cry1B genes presence in their genomes. These strains may be used to develop the broad specificity bioinsecticides.
Kuraku, Shigehiro; Usuda, Ryo; Kuratani, Shigeru
2005-01-01
The turtle shell is an evolutionary novelty in which the developmental pattern of the ribs is radically modified. In contrast to those of other amniotes, turtle ribs grow laterally into the dorsal dermis to form a carapace. The lateral margin of carapacial primordium is called the carapacial ridge (CR), and is thought to play an essential role in carapace patterning. To reveal the developmental mechanisms underlying this structure, we systematically screened for genes expressed specifically in the CR of the Chinese soft-shelled turtle, Pelodiscus sinensis, using microbead-based differential cDNA analysis and real-time reverse transcription-polymerase chain reaction. We identified orthologs of Sp5, cellular retinoic acid-binding protein-I (CRABP-I), adenomatous polyposis coli down-regulated 1 (APCDD1), and lymphoid enhancer-binding factor-1 (LEF-1). Although these genes are conserved throughout the major vertebrate lineages, comparison of their expression patterns with those in chicken and mouse indicated that these genes have acquired de novo expression in the CR in the turtle lineage. In association with the expression of LEF-1, the nuclear localization of beta-catenin protein was detected in the CR ectoderm, suggesting that the canonical Wnt signaling triggers carapace development. These findings indicate that the acquisition of the turtle shell did not involve the creation of novel genes, but was based on the co-option of pre-existing genes.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Non-specific activities of the major herbicide-resistance gene BAR.
Christ, Bastien; Hochstrasser, Ramon; Guyer, Luzia; Francisco, Rita; Aubry, Sylvain; Hörtensteiner, Stefan; Weng, Jing-Ke
2017-12-01
Bialaphos resistance (BAR) and phosphinothricin acetyltransferase (PAT) genes, which convey resistance to the broad-spectrum herbicide phosphinothricin (also known as glufosinate) via N-acetylation, have been globally used in basic plant research and genetically engineered crops 1-4 . Although early in vitro enzyme assays showed that recombinant BAR and PAT exhibit substrate preference toward phosphinothricin over the 20 proteinogenic amino acids 1 , indirect effects of BAR-containing transgenes in planta, including modified amino acid levels, have been seen but without the identification of their direct causes 5,6 . Combining metabolomics, plant genetics and biochemical approaches, we show that transgenic BAR indeed converts two plant endogenous amino acids, aminoadipate and tryptophan, to their respective N-acetylated products in several plant species. We report the crystal structures of BAR, and further delineate structural basis for its substrate selectivity and catalytic mechanism. Through structure-guided protein engineering, we generated several BAR variants that display significantly reduced non-specific activities compared with its wild-type counterpart in vivo. The transgenic expression of enzymes can result in unintended off-target metabolism arising from enzyme promiscuity. Understanding such phenomena at the mechanistic level can facilitate the design of maximally insulated systems featuring heterologously expressed enzymes.
Guha, Mithu; Saare, Mario; Maslovskaja, Julia; Kisand, Kai; Liiv, Ingrid; Haljasorg, Uku; Tasa, Tõnis; Metspalu, Andres; Milani, Lili; Peterson, Pärt
2017-04-21
The autoimmune regulator (AIRE) protein is the key factor in thymic negative selection of autoreactive T cells by promoting the ectopic expression of tissue-specific genes in the thymic medullary epithelium. Mutations in AIRE cause a monogenic autoimmune disease called autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy. AIRE has been shown to promote DNA breaks via its interaction with topoisomerase 2 (TOP2). In this study, we investigated topoisomerase-induced DNA breaks and chromatin structural alterations in conjunction with AIRE-dependent gene expression. Using RNA sequencing, we found that inhibition of TOP2 religation activity by etoposide in AIRE-expressing cells had a synergistic effect on genes with low expression levels. AIRE-mediated transcription was not only enhanced by TOP2 inhibition but also by the TOP1 inhibitor camptothecin. The transcriptional activation was associated with structural rearrangements in chromatin, notably the accumulation of γH2AX and the exchange of histone H1 with HMGB1 at AIRE target gene promoters. In addition, we found the transcriptional up-regulation to co-occur with the chromatin structural changes within the genomic cluster of carcinoembryonic antigen-like cellular adhesion molecule genes. Overall, our results suggest that the presence of AIRE can trigger molecular events leading to an altered chromatin landscape and the enhanced transcription of low-expressed genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Conservation and sex-specific splicing of the doublesex gene
Indian Academy of Sciences (India)
Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the ...
Freedom of expression: cell-type-specific gene profiling.
Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H
2014-01-01
Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Vaiman Daniel
2005-05-01
Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological
Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q
2014-01-01
Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.
Towards the identification of flower-specific genes in Citrus spp
Directory of Open Access Journals (Sweden)
Marcelo Carnier Dornelas
2007-01-01
Full Text Available Citrus sinensis is a perennial woody species, for which genetic approaches to the study of reproductive development are not readily amenable. Here, the usefulness of the CitEST Expressed Sequence Tag (EST database is demonstrated as a reliable new resource for identifying novel genes exclusively related to Citrus reproductive biology. We performed the analysis of an EST dataset of the CitEST Project containing 4,330 flower-derived cDNA sequences. Relying on bioinformatics tools, sequences exclusively present in this flower-derived sequence collection were selected and used for the identification of Citrus putative flower-specific genes. Our analysis revealed several Citrus sequences showing significant similarity to conserved genes known to have flower-specific expression and possessing functions related to flower metabolism and/or reproductive development in diverse plant species. Comparison of the Citrus flower-specific sequences with all available plant peptide sequences unraveled 247 unique transcripts not identified elsewhere within the plant kingdom. Additionally, 49 transcripts, for which no biological function could be attributed by means of sequence comparisons, were found to be conserved among plant species. These results allow further gene expression analysis and possibly novel approaches to the understanding of reproductive development in Citrus.
Analysis of cell-type-specific gene expression during mouse spermatogenesis
DEFF Research Database (Denmark)
Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser
2004-01-01
In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume of s...
Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.
Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc
2006-02-01
Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.
Specific gene mutations induced by heavy ions
International Nuclear Information System (INIS)
Freeling, M.; Karoly, C.W.; Cheng, D.S.K.
1980-01-01
This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens
Injury, inflammation and the emergence of human specific genes
2016-07-12
genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate
K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)
2013-01-01
textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with
Gene expression patterns specific to the regenerating limb of the Mexican axolotl
Directory of Open Access Journals (Sweden)
James R. Monaghan
2012-07-01
Salamander limb regeneration is dependent upon tissue interactions that are local to the amputation site. Communication among limb epidermis, peripheral nerves, and mesenchyme coordinate cell migration, cell proliferation, and tissue patterning to generate a blastema, which will form missing limb structures. An outstanding question is how cross-talk between these tissues gives rise to the regeneration blastema. To identify genes associated with epidermis-nerve-mesenchymal interactions during limb regeneration, we examined histological and transcriptional changes during the first week following injury in the wound epidermis and subjacent cells between three injury types; 1 a flank wound on the side of the animal that will not regenerate a limb, 2 a denervated limb that will not regenerate a limb, and 3 an innervated limb that will regenerate a limb. Early, histological and transcriptional changes were similar between the injury types, presumably because a common wound-healing program is employed across anatomical locations. However, some transcripts were enriched in limbs compared to the flank and are associated with vertebrate limb development. Many of these genes were activated before blastema outgrowth and expressed in specific tissue types including the epidermis, peripheral nerve, and mesenchyme. We also identified a relatively small group of transcripts that were more highly expressed in innervated limbs versus denervated limbs. These transcripts encode for proteins involved in myelination of peripheral nerves, epidermal cell function, and proliferation of mesenchymal cells. Overall, our study identifies limb-specific and nerve-dependent genes that are upstream of regenerative growth, and thus promising candidates for the regulation of blastema formation.
Evaluating bacterial gene-finding HMM structures as probabilistic logic programs
DEFF Research Database (Denmark)
Mørk, Søren; Holmes, Ian
2012-01-01
, a probabilistic dialect of Prolog. Results: We evaluate Hidden Markov Model structures for bacterial protein-coding gene potential, including a simple null model structure, three structures based on existing bacterial gene finders and two novel model structures. We test standard versions as well as ADPH length...
Directory of Open Access Journals (Sweden)
Raymond A Clarke
Full Text Available The prostate cancer antigen 3 (PCA3/DD3 gene is a highly specific biomarker upregulated in prostate cancer (PCa. In order to understand the importance of PCA3 in PCa we investigated the organization and evolution of the PCA3 gene locus.We have employed cDNA synthesis, RTPCR and DNA sequencing to identify 4 new transcription start sites, 4 polyadenylation sites and 2 new differentially spliced exons in an extended form of PCA3. Primers designed from these novel PCA3 exons greatly improve RT-PCR based discrimination between PCa, PCa metastases and BPH specimens. Comparative genomic analyses demonstrated that PCA3 has only recently evolved in an anti-sense orientation within a second gene, BMCC1/PRUNE2. BMCC1 has been shown previously to interact with RhoA and RhoC, determinants of cellular transformation and metastasis, respectively. Using RT-PCR we demonstrated that the longer BMCC1-1 isoform - like PCA3 - is upregulated in PCa tissues and metastases and in PCa cell lines. Furthermore PCA3 and BMCC1-1 levels are responsive to dihydrotestosterone treatment.Upregulation of two new PCA3 isoforms in PCa tissues improves discrimination between PCa and BPH. The functional relevance of this specificity is now of particular interest given PCA3's overlapping association with a second gene BMCC1, a regulator of Rho signalling. Upregulation of PCA3 and BMCC1 in PCa has potential for improved diagnosis.
Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.
Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis
2017-06-08
A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.
Testis-Specific Histone Variant H3t Gene Is Essential for Entry into Spermatogenesis
Directory of Open Access Journals (Sweden)
Jun Ueda
2017-01-01
Full Text Available Cellular differentiation is associated with dynamic chromatin remodeling in establishing a cell-type-specific epigenomic landscape. Here, we find that mouse testis-specific and replication-dependent histone H3 variant H3t is essential for very early stages of spermatogenesis. H3t gene deficiency leads to azoospermia because of the loss of haploid germ cells. When differentiating spermatogonia emerge in normal spermatogenesis, H3t appears and replaces the canonical H3 proteins. Structural and biochemical analyses reveal that H3t-containing nucleosomes are more flexible than the canonical nucleosomes. Thus, by incorporating H3t into the genome during spermatogonial differentiation, male germ cells are able to enter meiosis and beyond.
[Production, specificity and structure of immunoglobulins].
Goujard, C; Delfraissy, J F
1991-03-21
Immunoglobulin is a key factor of the immune response resulting from B-cell activation and associated with T-cell stimulation. Because of its structure, this antibody has a dual function: it specifically recognizes the inducer antigen in the variable region and eliminates it by a constant portion which is responsible for effector properties. Surface immunoglobulin, therefore, is the B-cell antigen receptor; it differs from the T-cell receptor in that it recognizes the antigen unbound to the major istocompatibility complex; binding the antigen results in direct signal transduction first in the cytoplasm, then in the nucleus. This receptor can be secreted in the body: it is made up of circulating immunoglobulins. Human immunoglobulins are divided into 5 classes, each of them with its own response kinetics, distribution and functions. The variability of the antibody response accounts for a genetic organization involving numerous genes which may be associated with each other, or mutate, or recombine during maturation of the lymphocytes. Altogether, this system has a theoretical capacity of response to three hundred million different antigens.
Energy Technology Data Exchange (ETDEWEB)
Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))
1990-08-01
Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.
Directory of Open Access Journals (Sweden)
Suzan-Monti Marie
2009-05-01
Full Text Available Abstract Background Acanthamoebae polyphaga Mimivirus (APM is the largest known dsDNA virus. The viral particle has a nearly icosahedral structure with an internal capsid shell surrounded with a dense layer of fibrils. A Capsid protein sequence, D13L, was deduced from the APM L425 coding gene and was shown to be the most abundant protein found within the viral particle. However this protein remained poorly characterised until now. A revised protein sequence deposited in a database suggested an additional N-terminal stretch of 142 amino acids missing from the original deduced sequence. This result led us to investigate the L425 gene structure and the biochemical properties of the complete APM major Capsid protein. Results This study describes the full length 3430 bp Capsid coding gene and characterises the 593 amino acids long corresponding Capsid protein 1. The recombinant full length protein allowed the production of a specific monoclonal antibody able to detect the Capsid protein 1 within the viral particle. This protein appeared to be post-translationnally modified by glycosylation and phosphorylation. We proposed a secondary structure prediction of APM Capsid protein 1 compared to the Capsid protein structure of Paramecium Bursaria Chlorella Virus 1, another member of the Nucleo-Cytoplasmic Large DNA virus family. Conclusion The characterisation of the full length L425 Capsid coding gene of Acanthamoebae polyphaga Mimivirus provides new insights into the structure of the main Capsid protein. The production of a full length recombinant protein will be useful for further structural studies.
Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.
Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M
1989-01-01
Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...
Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.
Directory of Open Access Journals (Sweden)
Quan Li
Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.
International Nuclear Information System (INIS)
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Energy Technology Data Exchange (ETDEWEB)
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Allele-specific gene expression in a wild nonhuman primate population
Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.
2015-01-01
Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779
Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B
2017-11-24
Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.
Directory of Open Access Journals (Sweden)
Yushin Yazaki
2015-04-01
Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.
Kassir, Yona
2017-01-01
Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.
Causal gene identification using combinatorial V-structure search.
Cai, Ruichu; Zhang, Zhenjie; Hao, Zhifeng
2013-07-01
With the advances of biomedical techniques in the last decade, the costs of human genomic sequencing and genomic activity monitoring are coming down rapidly. To support the huge genome-based business in the near future, researchers are eager to find killer applications based on human genome information. Causal gene identification is one of the most promising applications, which may help the potential patients to estimate the risk of certain genetic diseases and locate the target gene for further genetic therapy. Unfortunately, existing pattern recognition techniques, such as Bayesian networks, cannot be directly applied to find the accurate causal relationship between genes and diseases. This is mainly due to the insufficient number of samples and the extremely high dimensionality of the gene space. In this paper, we present the first practical solution to causal gene identification, utilizing a new combinatorial formulation over V-Structures commonly used in conventional Bayesian networks, by exploring the combinations of significant V-Structures. We prove the NP-hardness of the combinatorial search problem under a general settings on the significance measure on the V-Structures, and present a greedy algorithm to find sub-optimal results. Extensive experiments show that our proposal is both scalable and effective, particularly with interesting findings on the causal genes over real human genome data. Copyright © 2013 Elsevier Ltd. All rights reserved.
Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah
2012-06-01
Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.
Inference of cancer-specific gene regulatory networks using soft computing rules.
Wang, Xiaosheng; Gotoh, Osamu
2010-03-24
Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Directory of Open Access Journals (Sweden)
Kali D Saxton-Shaw
Full Text Available O'nyong nyong virus (ONNV and Chikungunya virus (CHIKV are two closely related alphaviruses with very different infection patterns in the mosquito, Anopheles gambiae. ONNV is the only alphavirus transmitted by anopheline mosquitoes, but specific molecular determinants of infection of this unique vector specificity remain unidentified. Fifteen distinct chimeric viruses were constructed to evaluate both structural and non-structural regions of the genome and infection patterns were determined through artificial infectious feeds in An. gambiae with each of these chimeras. Only one region, non-structural protein 3 (nsP3, was sufficient to up-regulate infection to rates similar to those seen with parental ONNV. When ONNV non-structural protein 3 (nsP3 replaced nsP3 from CHIKV virus in one of the chimeric viruses, infection rates in An. gambiae went from 0% to 63.5%. No other single gene or viral region addition was able to restore infection rates. Thus, we have shown that a non-structural genome element involved in viral replication is a major element involved in ONNV's unique vector specificity.
Variations in CCL3L gene cluster sequence and non-specific gene copy numbers
Directory of Open Access Journals (Sweden)
Edberg Jeffrey C
2010-03-01
Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.
Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.
Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin
2016-10-15
Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
Evaluation of Sex-Specific Gene Expression in Archived Dried Blood Spots (DBS
Directory of Open Access Journals (Sweden)
Scott Jewell
2012-08-01
Full Text Available Screening newborns for treatable serious conditions is mandated in all US states and many other countries. After screening, Guthrie cards with residual blood (whole spots or portions of spots are typically stored at ambient temperature in many facilities. The potential of archived dried blood spots (DBS for at-birth molecular studies in epidemiological and clinical research is substantial. However, it is also challenging as analytes from DBS may be degraded due to preparation and storage conditions. We previously reported an improved assay for obtaining global RNA gene expression from blood spots. Here, we evaluated sex-specific gene expression and its preservation in DBS using oligonucleotide microarray technology. We found X inactivation-specific transcript (XIST, lysine-specific demethylase 5D (KDM5D (also known as selected cDNA on Y, homolog of mouse (SMCY, uncharacterized LOC729444 (LOC729444, and testis-specific transcript, Y-linked 21 (TTTY21 to be differentially-expressed by sex of the newborn. Our finding that trait-specific RNA gene expression is preserved in unfrozen DBS, demonstrates the technical feasibility of performing molecular genetic profiling using such samples. With millions of DBS potentially available for research, we see new opportunities in using newborn molecular gene expression to better understand molecular pathogenesis of perinatal diseases.
Retrotransposon hypomethylation in melanoma and expression of a placenta-specific gene.
Directory of Open Access Journals (Sweden)
Erin C Macaulay
Full Text Available In the human placenta, DNA hypomethylation permits the expression of retrotransposon-derived genes that are normally silenced by methylation in somatic tissues. We previously identified hypomethylation of a retrotransposon-derived transcript of the voltage-gated potassium channel gene KCNH5 that is expressed only in human placenta. However, an RNA sequence from this placental-specific transcript has been reported in melanoma. This study examined the promoter methylation and expression of the retrotransposon-derived KCNH5 transcript in 25 melanoma cell lines to determine whether the acquisition of 'placental' epigenetic marks is a feature of melanoma. Methylation and gene expression analysis revealed hypomethylation of this retrotransposon in melanoma cell lines, particularly in those samples that express the placental KCNH5 transcript. Therefore we propose that hypomethylation of the placental-specific KCNH5 promoter is frequently associated with KCNH5 expression in melanoma cells. Our findings show that melanoma can develop hypomethylation of a retrotransposon-derived gene; a characteristic notably shared with the normal placenta.
Directory of Open Access Journals (Sweden)
Haisheng Nie
Full Text Available BACKGROUND: The chicken is an important agricultural and avian-model species. A survey of gene expression in a range of different tissues will provide a benchmark for understanding expression levels under normal physiological conditions in birds. With expression data for birds being very scant, this benchmark is of particular interest for comparative expression analysis among various terrestrial vertebrates. METHODOLOGY/PRINCIPAL FINDINGS: We carried out a gene expression survey in eight major chicken tissues using whole genome microarrays. A global picture of gene expression is presented for the eight tissues, and tissue specific as well as common gene expression were identified. A Gene Ontology (GO term enrichment analysis showed that tissue-specific genes are enriched with GO terms reflecting the physiological functions of the specific tissue, and housekeeping genes are enriched with GO terms related to essential biological functions. Comparisons of structural genomic features between tissue-specific genes and housekeeping genes show that housekeeping genes are more compact. Specifically, coding sequence and particularly introns are shorter than genes that display more variation in expression between tissues, and in addition intergenic space was also shorter. Meanwhile, housekeeping genes are more likely to co-localize with other abundantly or highly expressed genes on the same chromosomal regions. Furthermore, comparisons of gene expression in a panel of five common tissues between birds, mammals and amphibians showed that the expression patterns across tissues are highly similar for orthologous genes compared to random gene pairs within each pair-wise comparison, indicating a high degree of functional conservation in gene expression among terrestrial vertebrates. CONCLUSIONS: The housekeeping genes identified in this study have shorter gene length, shorter coding sequence length, shorter introns, and shorter intergenic regions, there seems
Structure and expression of thyroglobulin gene
Energy Technology Data Exchange (ETDEWEB)
Vassart, G; Brocas, H; Christophe, D; de Martynoff, G; Leriche, A; Mercken, L; Pohl, V; van Heuverswyn, B [Institut de Recherche Interdisciplinaire en Biologie Humaine et Nucleaire (IRIBHN), Faculte de Medecine, Universite libre de Bruxelles, Campus Hopital Erasme, Brussels (Belgium)
1982-01-01
Thyroglobulin is composed of two 300000 dalton polypeptide chains, translated from an 8000 base mRNA. Preparation of a full length cDNA and its cloning in E. coli have lead to the demonstration that the polypeptides of thyroglobulin protomers were identical. Used as molecular probes, the cloned cDNA allowed the isolation of a fragment of thyroglobulin gene. Electron microscopic studies have demonstrated that this gene contains more than 90 % intronic material separating small size exons (<200 bp). Sequencing of bovine thyroglobulin structural gene is in progress. Preliminary results show evidence for the existence of repetitive segments. Availability of cloned DNA complementary to bovine and human thyroglobulin mRNA allows the study of genetic defects of thyroglobulin gene expression in the human and in various animal models.
Directory of Open Access Journals (Sweden)
Assaf Gottlieb
2017-11-01
Full Text Available Abstract Background Genome-wide association studies are useful for discovering genotype–phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into “gene level” effects. Methods Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression—on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. Results We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Conclusions Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort
Linker histones: novel insights into structure-specific recognition of the nucleosome.
Cutter, Amber R; Hayes, Jeffrey J
2017-04-01
Linker histones (H1s) are a primary component of metazoan chromatin, fulfilling numerous functions, both in vitro and in vivo, including stabilizing the wrapping of DNA around the nucleosome, promoting folding and assembly of higher order chromatin structures, influencing nucleosome spacing on DNA, and regulating specific gene expression. However, many molecular details of how H1 binds to nucleosomes and recognizes unique structural features on the nucleosome surface remain undefined. Numerous, confounding studies are complicated not only by experimental limitations, but the use of different linker histone isoforms and nucleosome constructions. This review summarizes the decades of research that has resulted in several models of H1 association with nucleosomes, with a focus on recent advances that suggest multiple modes of H1 interaction in chromatin, while highlighting the remaining questions.
Generation of Elf5-Cre knockin mouse strain for trophoblast-specific gene manipulation.
Kong, Shuangbo; Liang, Guixian; Tu, Zhaowei; Chen, Dunjin; Wang, Haibin; Lu, Jinhua
2018-04-01
Placental development is a complex and highly controlled process during which trophoblast stem cells differentiate to various trophoblast subtypes. The early embryonic death of systemic gene knockout models hampers the investigation of these genes that might play important roles during placentation. A trophoblast specific Cre mouse model would be of great help for dissecting out the potential roles of these genes during placental development. For this purpose, we generate a transgenic mouse with the Cre recombinase inserted into the endogenous locus of Elf5 gene that is expressed specifically in placental trophoblast cells. To analyze the specificity and efficiency of Cre recombinase activity in Elf5-Cre mice, we mated Elf5-Cre mice with Rosa26 mT/mG reporter mice, and found that Elf5-Cre transgene is expressed specifically in the trophoectoderm as early as embryonic day 4.5 (E4.5). By E12.5, the activity of Elf5-Cre transgene was detected exclusively in all derivatives of trophoblast lineages, including spongiotrophoblast, giant cells, and labyrinth trophoblasts. In addition, Elf5-Cre transgene was also active during spermatogenesis, from spermatids to mature sperms, which is consistent with the endogenous Elf5 expression in testis. Collectively, our results provide a unique tool to delete specific genes selectively and efficiently in trophoblast lineage during placentation. © 2018 Wiley Periodicals, Inc.
Evaluating bacterial gene-finding HMM structures as probabilistic logic programs.
Mørk, Søren; Holmes, Ian
2012-03-01
Probabilistic logic programming offers a powerful way to describe and evaluate structured statistical models. To investigate the practicality of probabilistic logic programming for structure learning in bioinformatics, we undertook a simplified bacterial gene-finding benchmark in PRISM, a probabilistic dialect of Prolog. We evaluate Hidden Markov Model structures for bacterial protein-coding gene potential, including a simple null model structure, three structures based on existing bacterial gene finders and two novel model structures. We test standard versions as well as ADPH length modeling and three-state versions of the five model structures. The models are all represented as probabilistic logic programs and evaluated using the PRISM machine learning system in terms of statistical information criteria and gene-finding prediction accuracy, in two bacterial genomes. Neither of our implementations of the two currently most used model structures are best performing in terms of statistical information criteria or prediction performances, suggesting that better-fitting models might be achievable. The source code of all PRISM models, data and additional scripts are freely available for download at: http://github.com/somork/codonhmm. Supplementary data are available at Bioinformatics online.
A human-specific de novo protein-coding gene associated with human brain functions.
Directory of Open Access Journals (Sweden)
Chuan-Yun Li
2010-03-01
Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.
Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner
2014-12-01
Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Using a periclinal chimera to unravel layer-specific gene expression in plants.
Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J
2013-09-01
Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.
2013-01-01
Background The environment is the likely source of many pathogenic mycobacterial species but detection of mycobacteria by bacteriological tools is generally difficult and time-consuming. Consequently, several molecular targets based on the sequences of housekeeping genes, non-functional RNA and structural ribosomal RNAs have been proposed for the detection and identification of mycobacteria in clinical or environmental samples. While certain of these targets were proposed as specific for this genus, most are prone to false positive results in complex environmental samples that include related, but distinct, bacterial genera. Nowadays the increased number of sequenced genomes and the availability of software for genomic comparison provide tools to develop novel, mycobacteria-specific targets, and the associated molecular probes and primers. Consequently, we conducted an in silico search for proteins exclusive to Mycobacterium spp. genomes in order to design sensitive and specific molecular targets. Results Among the 3989 predicted proteins from M. tuberculosis H37Rv, only 11 proteins showed 80% to 100% of similarity with Mycobacterium spp. genomes, and less than 50% of similarity with genomes of closely related Corynebacterium, Nocardia and Rhodococcus genera. Based on DNA sequence alignments, we designed primer pairs and a probe that specifically detect the atpE gene of mycobacteria, as verified by quantitative real-time PCR on a collection of mycobacteria and non-mycobacterial species. The real-time PCR method we developed was successfully used to detect mycobacteria in tap water and lake samples. Conclusions The results indicate that this real-time PCR method targeting the atpE gene can serve for highly specific detection and precise quantification of Mycobacterium spp. in environmental samples. PMID:24299240
Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter
Directory of Open Access Journals (Sweden)
Wolfgang Boecker
2004-04-01
Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.
Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules
Directory of Open Access Journals (Sweden)
Xiaosheng Wang
2010-03-01
Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression
International Nuclear Information System (INIS)
Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe
2005-01-01
We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells
Directory of Open Access Journals (Sweden)
Suegene Noh
2016-02-01
Full Text Available In the Allonemobius socius complex of crickets, reproductive isolation is primarily accomplished via postmating prezygotic barriers. We tested seven protein-coding genes expressed in the male ejaculate for patterns of evolution consistent with a putative role as postmating prezygotic isolation genes. Our recently diverged species generally lacked sequence variation. As a result, ω-based tests were only mildly successful. Some of our genes showed evidence of elevated ω values on the internal branches of gene trees. In a couple of genes, these internal branches coincided with both species branching events of the species tree, between A. fasciatus and the other two species, and between A. socius and A. sp. nov. Tex. In comparison, more successful approaches were those that took advantage of the varying degrees of lineage sorting and allele sharing among our young species. These approaches were particularly powerful within the contact zone. Among the genes we tested we found genes with genealogies that indicated relatively advanced degrees of lineage sorting across both allopatric and contact zone alleles. Within a contact zone between two members of the species complex, only a subset of genes maintained allelic segregation despite evidence of ongoing gene flow in other genes. The overlap in these analyses was arginine kinase (AK and apolipoprotein A-1 binding protein (APBP. These genes represent two of the first examples of sperm maturation, capacitation, and motility proteins with fixed non-synonymous substitutions between species-specific alleles that may lead to postmating prezygotic isolation. Both genes express ejaculate proteins transferred to females during copulation and were previously identified through comparative proteomics. We discuss the potential function of these genes in the context of the specific postmating prezygotic isolation phenotype among our species, namely conspecific sperm precedence and the superior ability of
Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues
Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.
2010-01-01
MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...
Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.
Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro
2018-05-03
Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.
Directory of Open Access Journals (Sweden)
David Haase
Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.
Directory of Open Access Journals (Sweden)
M Ghasemi
2017-05-01
Full Text Available Introduction: Salmonellosis is an infection caused by eating contaminated food with Salmonella, and it can occur in humans and other animals. Salmonella has acquired the ability to create the infection due to the presence of several virulence genes. One of the virulence genes of salmonella is sipC gene that coding the SipC protein. The aim of this study was creating the gene cassette to genetically engineered Salmonella enteritidis in the specific region of the sipC gene. Methods: In this study, after DNA extraction from Salmonella, the upstream and downstream regions of the sipC gene was amplified based on PCR method. The PCR products were cloned with T/A cloning method and they were inserted into the pGEM vector. In order to generate the final gene cassette, each of the upstream and downstream regions of the sipC gene was subcloned into the pET32 vector, and cloning accuracy was assessed by PCR and enzyme digestion methods. Results: Amplification of the 320 bp upstream and 206 bp downstream of sipC gene was successful by PCR method. T/A cloning of these fragments were caused the formation of two pGEM-up and pGEM-down recombinant vectors. Results that were confirmed the sub-cloning accuracy indicate the formation of the final pET32-up-down gene cassette. Conclusion: The generated gene cassette in this study was considered as a multi-purpose cassette that is able to specific gene manipulation of Salmonella sipC gene by homologous recombination matched. This gene cassette has the necessary potential for sipC gene deletion or insertion of any useful gene instead of sipC gene.
Novel Genes Involved in Controlling Specification of Drosophila FMRFamide Neuropeptide Cells.
Bivik, Caroline; Bahrampour, Shahrzad; Ulvklo, Carina; Nilsson, Patrik; Angel, Anna; Fransson, Fredrik; Lundin, Erika; Renhorn, Jakob; Thor, Stefan
2015-08-01
The expression of neuropeptides is often extremely restricted in the nervous system, making them powerful markers for addressing cell specification . In the developing Drosophila ventral nerve cord, only six cells, the Ap4 neurons, of some 10,000 neurons, express the neuropeptide FMRFamide (FMRFa). Each Ap4/FMRFa neuron is the last-born cell generated by an identifiable and well-studied progenitor cell, neuroblast 5-6 (NB5-6T). The restricted expression of FMRFa and the wealth of information regarding its gene regulation and Ap4 neuron specification makes FMRFa a valuable readout for addressing many aspects of neural development, i.e., spatial and temporal patterning cues, cell cycle control, cell specification, axon transport, and retrograde signaling. To this end, we have conducted a forward genetic screen utilizing an Ap4-specific FMRFa-eGFP transgenic reporter as our readout. A total of 9781 EMS-mutated chromosomes were screened for perturbations in FMRFa-eGFP expression, and 611 mutants were identified. Seventy-nine of the strongest mutants were mapped down to the affected gene by deficiency mapping or whole-genome sequencing. We isolated novel alleles for previously known FMRFa regulators, confirming the validity of the screen. In addition, we identified novel essential genes, including several with previously undefined functions in neural development. Our identification of genes affecting most major steps required for successful terminal differentiation of Ap4 neurons provides a comprehensive view of the genetic flow controlling the generation of highly unique neuronal cell types in the developing nervous system. Copyright © 2015 by the Genetics Society of America.
Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish
Directory of Open Access Journals (Sweden)
Atsuo Kawahara
2016-05-01
Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.
Directory of Open Access Journals (Sweden)
Yuan Xin Goay
2016-01-01
Full Text Available Salmonella Typhi (S. Typhi causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39 and 100% specificity (0/72. The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien
2016-01-01
Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Directory of Open Access Journals (Sweden)
Dasgupta Dipayan
2005-05-01
Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.
Directory of Open Access Journals (Sweden)
Leon French
2017-05-01
Full Text Available Genome-wide expression profiling of the human brain has revealed genes that are differentially expressed across the lifespan. Characterizing these genes adds to our understanding of both normal functions and pathological conditions. Additionally, the specific cell-types that contribute to the motor, sensory and cognitive declines during aging are unclear. Here we test if age-related genes show higher expression in specific neural cell types. Our study leverages data from two sources of murine single-cell expression data and two sources of age-associations from large gene expression studies of postmortem human brain. We used nonparametric gene set analysis to test for age-related enrichment of genes associated with specific cell-types; we also restricted our analyses to specific gene ontology groups. Our analyses focused on a primary pair of single-cell expression data from the mouse visual cortex and age-related human post-mortem gene expression information from the orbitofrontal cortex. Additional pairings that used data from the hippocampus, prefrontal cortex, somatosensory cortex and blood were used to validate and test specificity of our findings. We found robust age-related up-regulation of genes that are highly expressed in oligodendrocytes and astrocytes, while genes highly expressed in layer 2/3 glutamatergic neurons were down-regulated across age. Genes not specific to any neural cell type were also down-regulated, possibly due to the bulk tissue source of the age-related genes. A gene ontology-driven dissection of the cell-type enriched genes highlighted the strong down-regulation of genes involved in synaptic transmission and cell-cell signaling in the Somatostatin (Sst neuron subtype that expresses the cyclin dependent kinase 6 (Cdk6 and in the vasoactive intestinal peptide (Vip neuron subtype expressing myosin binding protein C, slow type (Mybpc1. These findings provide new insights into cell specific susceptibility to normal aging
eap Gene as novel target for specific identification of Staphylococcus aureus.
Hussain, Muzaffar; von Eiff, Christof; Sinha, Bhanu; Joost, Insa; Herrmann, Mathias; Peters, Georg; Becker, Karsten
2008-02-01
The cell surface-associated extracellular adherence protein (Eap) mediates adherence of Staphylococcus aureus to host extracellular matrix components and inhibits inflammation, wound healing, and angiogenesis. A well-characterized collection of S. aureus and non-S. aureus staphylococcal isolates (n = 813) was tested for the presence of the Eap-encoding gene (eap) by PCR to investigate the use of the eap gene as a specific diagnostic tool for identification of S. aureus. Whereas all 597 S. aureus isolates were eap positive, this gene was not detectable in 216 non-S. aureus staphylococcal isolates comprising 47 different species and subspecies of coagulase-negative staphylococci and non-S. aureus coagulase-positive or coagulase-variable staphylococci. Furthermore, non-S. aureus isolates did not express Eap homologs, as verified on the transcriptional and protein levels. Based on these data, the sensitivity and specificity of the newly developed PCR targeting the eap gene were both 100%. Thus, the unique occurrence of Eap in S. aureus offers a promising tool particularly suitable for molecular diagnostics of this pathogen.
Digital sorting of complex tissues for cell type-specific gene expression profiles.
Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong
2013-03-07
Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.
Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A; Rathbun, Stephen L; Whitman, William B
2016-01-01
K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley's K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing.
Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke
2016-02-15
The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis
The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene.
Pharo, Elizabeth A; De Leo, Alison A; Renfree, Marilyn B; Thomson, Peter C; Lefèvre, Christophe M; Nicholas, Kevin R
2012-06-08
The marsupial early lactation protein (ELP) gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A). Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI) protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI)-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1) and early lactation (Phase 2A). The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI), spleen trypsin inhibitor (STI) and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5) genes. Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.
L.J. Niedernhofer (Laura); J. Essers (Jeroen); G. Weeda (Geert); H.B. Beverloo (Berna); J. de Wit (Jan); M. Muijtjens (Manja); H. Odijk (Hanny); J.H.J. Hoeijmakers (Jan); R. Kanaar (Roland)
2001-01-01
textabstractThe Ercc1-Xpf heterodimer, a highly conserved structure-specific endonuclease, functions in multiple DNA repair pathways that are pivotal for maintaining genome stability, including nucleotide excision repair, interstrand crosslink repair and homologous recombination. Erccl-Xpf incises
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Controlling nuclear JAKs and STATs for specific gene activation by IFNγ
International Nuclear Information System (INIS)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.
2011-01-01
Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The
Directory of Open Access Journals (Sweden)
Pierce Levi CT
2009-01-01
Full Text Available Abstract Background Gene rearrangements such as chromosomal translocations have been shown to contribute to cancer development. Human chromosomal fragile sites are regions of the genome especially prone to breakage, and have been implicated in various chromosome abnormalities found in cancer. However, there has been no comprehensive and quantitative examination of the location of fragile sites in relation to all chromosomal aberrations. Results Using up-to-date databases containing all cancer-specific recurrent translocations, we have examined 444 unique pairs of genes involved in these translocations to determine the correlation of translocation breakpoints and fragile sites in the gene pairs. We found that over half (52% of translocation breakpoints in at least one gene of these gene pairs are mapped to fragile sites. Among these, we examined the DNA sequences within and flanking three randomly selected pairs of translocation-prone genes, and found that they exhibit characteristic features of fragile DNA, with frequent AT-rich flexibility islands and the potential of forming highly stable secondary structures. Conclusion Our study is the first to examine gene pairs involved in all recurrent chromosomal translocations observed in tumor cells, and to correlate the location of more than half of breakpoints to positions of known fragile sites. These results provide strong evidence to support a causative role for fragile sites in the generation of cancer-specific chromosomal rearrangements.
Wlodarski, Tomasz; Kutner, Jan; Towpik, Joanna; Knizewski, Lukasz; Rychlewski, Leszek; Kudlicki, Andrzej; Rowicka, Maga; Dziembowski, Andrzej; Ginalski, Krzysztof
2011-01-01
Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity). Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.
Directory of Open Access Journals (Sweden)
Tomasz Wlodarski
Full Text Available Methylation is one of the most common chemical modifications of biologically active molecules and it occurs in all life forms. Its functional role is very diverse and involves many essential cellular processes, such as signal transduction, transcriptional control, biosynthesis, and metabolism. Here, we provide further insight into the enzymatic methylation in S. cerevisiae by conducting a comprehensive structural and functional survey of all the methyltransferases encoded in its genome. Using distant homology detection and fold recognition, we found that the S. cerevisiae methyltransferome comprises 86 MTases (53 well-known and 33 putative with unknown substrate specificity. Structural classification of their catalytic domains shows that these enzymes may adopt nine different folds, the most common being the Rossmann-like. We also analyzed the domain architecture of these proteins and identified several new domain contexts. Interestingly, we found that the majority of MTase genes are periodically expressed during yeast metabolic cycle. This finding, together with calculated isoelectric point, fold assignment and cellular localization, was used to develop a novel approach for predicting substrate specificity. Using this approach, we predicted the general substrates for 24 of 33 putative MTases and confirmed these predictions experimentally in both cases tested. Finally, we show that, in S. cerevisiae, methylation is carried out by 34 RNA MTases, 32 protein MTases, eight small molecule MTases, three lipid MTases, and nine MTases with still unknown substrate specificity.
Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells.
Soucie, Erinn L; Weng, Ziming; Geirsdóttir, Laufey; Molawi, Kaaweh; Maurizio, Julien; Fenouil, Romain; Mossadegh-Keller, Noushine; Gimenez, Gregory; VanHille, Laurent; Beniazza, Meryam; Favret, Jeremy; Berruyer, Carole; Perrin, Pierre; Hacohen, Nir; Andrau, J-C; Ferrier, Pierre; Dubreuil, Patrice; Sidow, Arend; Sieweke, Michael H
2016-02-12
Differentiated macrophages can self-renew in tissues and expand long term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network that controls self-renewal. Single-cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down-regulation of Maf transcription factors. The network also controls embryonic stem cell self-renewal but is associated with distinct embryonic stem cell-specific enhancers. This indicates that distinct lineage-specific enhancer platforms regulate a shared network of genes that control self-renewal potential in both stem and mature cells. Copyright © 2016, American Association for the Advancement of Science.
Energy Technology Data Exchange (ETDEWEB)
Ruan, Jiapeng [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Mouveaux, Thomas [Université Lille Nord de France, (France); Light, Samuel H.; Minasov, George; Anderson, Wayne F. [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Tomavo, Stanislas [Université Lille Nord de France, (France); Ngô, Huân M., E-mail: h-ngo@northwestern.edu [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); BrainMicro LLC, 21 Pendleton Street, New Haven, CT 06511 (United States)
2015-03-01
The second crystal structure of a parasite protein preferentially enriched in the brain cyst of T. gondii has been solved at 2.75 Å resolution. Bradyzoite enolase 1 is reported to have differential functions as a glycolytic enzyme and a transcriptional regulator in bradyzoites. In addition to catalyzing a central step in glycolysis, enolase assumes a remarkably diverse set of secondary functions in different organisms, including transcription regulation as documented for the oncogene c-Myc promoter-binding protein 1. The apicomplexan parasite Toxoplasma gondii differentially expresses two nuclear-localized, plant-like enolases: enolase 1 (TgENO1) in the latent bradyzoite cyst stage and enolase 2 (TgENO2) in the rapidly replicative tachyzoite stage. A 2.75 Å resolution crystal structure of bradyzoite enolase 1, the second structure to be reported of a bradyzoite-specific protein in Toxoplasma, captures an open conformational state and reveals that distinctive plant-like insertions are located on surface loops. The enolase 1 structure reveals that a unique residue, Glu164, in catalytic loop 2 may account for the lower activity of this cyst-stage isozyme. Recombinant TgENO1 specifically binds to a TTTTCT DNA motif present in the cyst matrix antigen 1 (TgMAG1) gene promoter as demonstrated by gel retardation. Furthermore, direct physical interactions of both nuclear TgENO1 and TgENO2 with the TgMAG1 gene promoter are demonstrated in vivo using chromatin immunoprecipitation (ChIP) assays. Structural and biochemical studies reveal that T. gondii enolase functions are multifaceted, including the coordination of gene regulation in parasitic stage development. Enolase 1 provides a potential lead in the design of drugs against Toxoplasma brain cysts.
Carlsbecker, Annelie; Sundström, Jens; Tandre, Karolina; Englund, Marie; Kvarnheden, Anders; Johanson, Urban; Engström, Peter
2003-01-01
Transcription factors encoded by different members of the MADS-box gene family have evolved central roles in the regulation of reproductive organ development in the flowering plants, the angiosperms. Development of the stamens and carpels, the pollen- and seed-bearing organs, involves the B- and C-organ-identity MADS-box genes. B- and C-type gene orthologs with activities specifically in developing pollen- and seed-bearing organs are also present in the distantly related gymnosperms: the conifers and the gnetophytes. We now report on the characterization of DAL10, a novel MADS-box gene from the conifer Norway spruce, which unlike the B- and C-type conifer genes shows no distinct orthology relationship to any angiosperm gene or clade in phylogenetic analyses. Like the B- and C-type genes, it is active specifically in developing pollen cones and seed cones. In situ RNA localization experiments show DAL10 to be expressed in the cone axis, which carry the microsporophylls of the young pollen cone. In contrast, in the seed cone it is expressed both in the cone axis and in the bracts, which subtend the ovuliferous scales. Expression data and the phenotype of transgenic Arabidopsis plants expressing DAL10 suggest that the gene may act upstream to or in concert with the B- and C-type genes in the establishment of reproductive identity of developing cones.
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Waugh Robbie
2010-12-01
Full Text Available Abstract Background Because of its size, allohexaploid nature and high repeat content, the wheat genome has always been perceived as too complex for efficient molecular studies. We recently constructed the first physical map of a wheat chromosome (3B. However gene mapping is still laborious in wheat because of high redundancy between the three homoeologous genomes. In contrast, in the closely related diploid species, barley, numerous gene-based markers have been developed. This study aims at combining the unique genomic resources developed in wheat and barley to decipher the organisation of gene space on wheat chromosome 3B. Results Three dimensional pools of the minimal tiling path of wheat chromosome 3B physical map were hybridised to a barley Agilent 15K expression microarray. This led to the fine mapping of 738 barley orthologous genes on wheat chromosome 3B. In addition, comparative analyses revealed that 68% of the genes identified were syntenic between the wheat chromosome 3B and barley chromosome 3 H and 59% between wheat chromosome 3B and rice chromosome 1, together with some wheat-specific rearrangements. Finally, it indicated an increasing gradient of gene density from the centromere to the telomeres positively correlated with the number of genes clustered in islands on wheat chromosome 3B. Conclusion Our study shows that novel structural genomics resources now available in wheat and barley can be combined efficiently to overcome specific problems of genetic anchoring of physical contigs in wheat and to perform high-resolution comparative analyses with rice for deciphering the organisation of the wheat gene space.
Cell-type-specific gene delivery into neuronal cells in vitro and in vivo
International Nuclear Information System (INIS)
Parveen, Zahida; Mukhtar, Muhammad; Rafi, Mohammed; Wenger, David A.; Siddiqui, Khwaja M.; Siler, Catherine A.; Dietzschold, Bernhard; Pomerantz, Roger J.; Schnell, Matthias J.; Dornburg, Ralph
2003-01-01
The avian retroviruses reticuloendotheliosis virus strain A (REV-A) and spleen necrosis virus (SNV) are not naturally infectious in human cells. However, REV-A-derived viral vectors efficiently infect human cells when they are pseudotyped with envelope proteins displaying targeting ligands specific for human cell-surface receptors. Here we report that vectors containing the gag region of REV-A and pol of SNV can be pseudotyped with the envelope protein of vesicular stomatitis virus (VSV) and the glycoproteins of different rabies virus (RV) strains. Vectors pseudotyped with the envelope protein of the highly neurotropic RV strain CVS-N2c facilitated cell type-specific gene delivery into mouse and human neurons, but did not infect other human cell types. Moreover, when such vector particles were injected into the brain of newborn mice, only neuronal cells were infected in vivo. Cell-type-specific gene delivery into neurons may present quite specific gene therapy approaches for many degenerative diseases of the brain
Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile
2011-07-01
Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the
Directory of Open Access Journals (Sweden)
Philippe Ganot
2011-07-01
Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both
Specific genetic modifications of domestic animals by gene targeting and animal cloning
Directory of Open Access Journals (Sweden)
Zhou Jiangfeng
2003-11-01
Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.
Directory of Open Access Journals (Sweden)
Xia Wang
Full Text Available When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives.We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy.Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42 of the unsolved cases.Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases.
Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz
2012-01-01
The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887
Directory of Open Access Journals (Sweden)
Manuella Nóbrega Dourado
2012-01-01
Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.
Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz
2012-01-01
The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.
Gene Regulation in Primates Evolves under Tissue-Specific Selection Pressures
Blekhman, Ran; Oshlack, Alicia; Chabot, Adrien E.; Smyth, Gordon K.; Gilad, Yoav
2008-01-01
Author Summary It has long been hypothesized that in addition to structural changes to proteins, changes in gene regulation might underlie many of the anatomic and behavioral differences between humans and other primates. However, to date, there are only a handful of examples of regulatory adaptations in humans. In this work, we present a genome-wide study of gene expression levels in livers, kidneys, and hearts from three species: humans, chimpanzees, and rhesus macaques. These data allowed ...
Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung
2017-12-01
Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.
XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD
Shook, Devon; Brouwer, Rachel; de Zeeuw, Patrick; Oranje, Bob; Durston, Sarah
2017-01-01
A single-nucleotide polymorphism (SNP) of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD). This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in
Glass, Edmund R; Dozmorov, Mikhail G
2016-10-06
The goal of many human disease-oriented studies is to detect molecular mechanisms different between healthy controls and patients. Yet, commonly used gene expression measurements from blood samples suffer from variability of cell composition. This variability hinders the detection of differentially expressed genes and is often ignored. Combined with cell counts, heterogeneous gene expression may provide deeper insights into the gene expression differences on the cell type-specific level. Published computational methods use linear regression to estimate cell type-specific differential expression, and a global cutoff to judge significance, such as False Discovery Rate (FDR). Yet, they do not consider many artifacts hidden in high-dimensional gene expression data that may negatively affect linear regression. In this paper we quantify the parameter space affecting the performance of linear regression (sensitivity of cell type-specific differential expression detection) on a per-gene basis. We evaluated the effect of sample sizes, cell type-specific proportion variability, and mean squared error on sensitivity of cell type-specific differential expression detection using linear regression. Each parameter affected variability of cell type-specific expression estimates and, subsequently, the sensitivity of differential expression detection. We provide the R package, LRCDE, which performs linear regression-based cell type-specific differential expression (deconvolution) detection on a gene-by-gene basis. Accounting for variability around cell type-specific gene expression estimates, it computes per-gene t-statistics of differential detection, p-values, t-statistic-based sensitivity, group-specific mean squared error, and several gene-specific diagnostic metrics. The sensitivity of linear regression-based cell type-specific differential expression detection differed for each gene as a function of mean squared error, per group sample sizes, and variability of the proportions
National Research Council Canada - National Science Library
Curiel, David T; Siegal, Gene; Wang, Minghui
2007-01-01
...) to achieve efficient and selective gene transfer to target tumor cells. Proposed herein is a strategy to modify one candidate vector, recombinant adenovirus, such that it embodies the requisite properties of efficacy and specificity...
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Energy Technology Data Exchange (ETDEWEB)
Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others
1994-08-01
Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.
Directory of Open Access Journals (Sweden)
Lee Hoyong
2006-12-01
Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
Novel strong tissue specific promoter for gene expression in human germ cells
Directory of Open Access Journals (Sweden)
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc
2016-01-01
Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies
DEFF Research Database (Denmark)
Milani, Lili; Lundmark, Anders; Nordlund, Jessica
2008-01-01
To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...
The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene
Directory of Open Access Journals (Sweden)
Pharo Elizabeth A
2012-06-01
Full Text Available Abstract Background The marsupial early lactation protein (ELP gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A. Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Results Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1 and early lactation (Phase 2A. The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI, spleen trypsin inhibitor (STI and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5 genes. Conclusions Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.
Gene structure, phylogeny and expression profile of the sucrose ...
Indian Academy of Sciences (India)
Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.
Crystal Structure and Substrate Specificity of PTPN12
Directory of Open Access Journals (Sweden)
Hui Li
2016-05-01
Full Text Available PTPN12 is an important tumor suppressor that plays critical roles in various physiological processes. However, the molecular basis underlying the substrate specificity of PTPN12 remains uncertain. Here, enzymological and crystallographic studies have enabled us to identify two distinct structural features that are crucial determinants of PTPN12 substrate specificity: the pY+1 site binding pocket and specific basic charged residues along its surface loops. Key structurally plastic regions and specific residues in PTPN12 enabled recognition of different HER2 phosphorylation sites and regulated specific PTPN12 functions. In addition, the structure of PTPN12 revealed a CDK2 phosphorylation site in a specific PTPN12 loop. Taken together, our results not only provide the working mechanisms of PTPN12 for desphosphorylation of its substrates but will also help in designing specific inhibitors of PTPN12.
Specific Gene Loci of Clinical Pseudomonas putida Isolates.
Directory of Open Access Journals (Sweden)
Lázaro Molina
Full Text Available Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host's immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria.
Reprogramming LCLs to iPSCs Results in Recovery of Donor-Specific Gene Expression Signature.
Directory of Open Access Journals (Sweden)
Samantha M Thomas
2015-05-01
Full Text Available Renewable in vitro cell cultures, such as lymphoblastoid cell lines (LCLs, have facilitated studies that contributed to our understanding of genetic influence on human traits. However, the degree to which cell lines faithfully maintain differences in donor-specific phenotypes is still debated. We have previously reported that standard cell line maintenance practice results in a loss of donor-specific gene expression signatures in LCLs. An alternative to the LCL model is the induced pluripotent stem cell (iPSC system, which carries the potential to model tissue-specific physiology through the use of differentiation protocols. Still, existing LCL banks represent an important source of starting material for iPSC generation, and it is possible that the disruptions in gene regulation associated with long-term LCL maintenance could persist through the reprogramming process. To address this concern, we studied the effect of reprogramming mature LCL cultures from six unrelated donors to iPSCs on the ensuing gene expression patterns within and between individuals. We show that the reprogramming process results in a recovery of donor-specific gene regulatory signatures, increasing the number of genes with a detectable donor effect by an order of magnitude. The proportion of variation in gene expression statistically attributed to donor increases from 6.9% in LCLs to 24.5% in iPSCs (P < 10-15. Since environmental contributions are unlikely to be a source of individual variation in our system of highly passaged cultured cell lines, our observations suggest that the effect of genotype on gene regulation is more pronounced in iPSCs than in LCLs. Our findings indicate that iPSCs can be a powerful model system for studies of phenotypic variation across individuals in general, and the genetic association with variation in gene regulation in particular. We further conclude that LCLs are an appropriate starting material for iPSC generation.
Directory of Open Access Journals (Sweden)
Paula Paulo
2012-07-01
Full Text Available This work aimed to evaluate whether ETS transcription factors frequently involved in rearrangements in prostate carcinomas (PCa, namely ERG and ETV1, regulate specific or shared target genes. We performed differential expression analysis on nine normal prostate tissues and 50 PCa enriched for different ETS rearrangements using exon-level expression microarrays, followed by in vitro validation using cell line models. We found specific deregulation of 57 genes in ERG-positive PCa and 15 genes in ETV1-positive PCa, whereas deregulation of 27 genes was shared in both tumor subtypes. We further showed that the expression of seven tumor-associated ERG target genes (PLA1A, CACNA1D, ATP8A2, HLA-DMB, PDE3B, TDRD1, and TMBIM1 and two tumor-associated ETV1 target genes (FKBP10 and GLYATL2 was significantly affected by specific ETS silencing in VCaP and LNCaP cell line models, respectively, whereas the expression of three candidate ERG and ETV1 shared targets (GRPR, KCNH8, and TMEM45B was significantly affected by silencing of either ETS. Interestingly, we demonstrate that the expression of TDRD1, the topmost overexpressed gene of our list of ERG-specific candidate targets, is inversely correlated with the methylation levels of a CpG island found at -66 bp of the transcription start site in PCa and that TDRD1 expression is regulated by direct binding of ERG to the CpG island in VCaP cells. We conclude that ETS transcription factors regulate specific and shared target genes and that TDRD1, FKBP10, and GRPR are promising therapeutic targets and can serve as diagnostic markers for molecular subtypes of PCa harboring specific fusion gene rearrangements.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Structural analysis of the α subunit of Na(+)/K(+) ATPase genes in invertebrates.
Thabet, Rahma; Rouault, J-D; Ayadi, Habib; Leignel, Vincent
2016-01-01
The Na(+)/K(+) ATPase is a ubiquitous pump coordinating the transport of Na(+) and K(+) across the membrane of cells and its role is fundamental to cellular functions. It is heteromer in eukaryotes including two or three subunits (α, β and γ which is specific to the vertebrates). The catalytic functions of the enzyme have been attributed to the α subunit. Several complete α protein sequences are available, but only few gene structures were characterized. We identified the genomic sequences coding the α-subunit of the Na(+)/K(+) ATPase, from the whole-genome shotgun contigs (WGS), NCBI Genomes (chromosome), Genomic Survey Sequences (GSS) and High Throughput Genomic Sequences (HTGS) databases across distinct phyla. One copy of the α subunit gene was found in Annelida, Arthropoda, Cnidaria, Echinodermata, Hemichordata, Mollusca, Placozoa, Porifera, Platyhelminthes, Urochordata, but the nematodes seem to possess 2 to 4 copies. The number of introns varied from 0 (Platyhelminthes) to 26 (Porifera); and their localization and length are also highly variable. Molecular phylogenies (Maximum Likelihood and Maximum Parsimony methods) showed some clusters constituted by (Chordata/(Echinodermata/Hemichordata)) or (Plathelminthes/(Annelida/Mollusca)) and a basal position for Porifera. These structural analyses increase our knowledge about the evolutionary events of the α subunit genes in the invertebrates. Copyright © 2016 Elsevier Inc. All rights reserved.
The structure of the human interferon alpha/beta receptor gene.
Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G
1992-02-05
Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
International Nuclear Information System (INIS)
Bowen, Joanne M.; Tsykin, Anna; Stringer, Andrea M.; Logan, Richard M.; Gibson, Rachel J.; Keefe, Dorothy M.K.
2010-01-01
Gastrointestinal toxicity remains a significant and dose-limiting complication of cancer treatment. While the pathophysiology is becoming clearer, considerable gaps in the knowledge remain surrounding the timing and site-specific gene changes which occur in response to insult. As such, this study aimed to assess gene expression profiles in a number of regions along the gastrointestinal tract following treatment with the chemotherapy agent, irinotecan, and correlate them with markers of cell death and tissue damage. Data analysis of microarray results found that genes involved in apoptosis, mitogen activated kinase (MAPK) signalling and inflammation were upregulated within 6 h, while genes involved in cell proliferation, wound healing and blood vessel formation were upregulated at later time points up to 72 h. Cell death was significantly increased at 6 and 24 h, and the stomach showed the lowest severity of overt tissue damage. Real time PCR of MAPK signalling pathway genes found that the jejunum and colon had significantly increased expression in a number of genes at 72 h, where as the stomach was unchanged. These results indicate that overall severity of tissue damage may be determined by precisely timed target gene responses specific to each region. Therapeutic targeting of key gene responses at the appropriate time point may prove to be effective for prevention of chemotherapy-induced gastrointestinal damage.
Auvray, Frédéric; Coddeville, Michèle; Ordonez, Romy Catoira; Ritzenthaler, Paul
1999-01-01
The temperate phage mv4 integrates its genome into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus by site-specific recombination within the 3′ end of a tRNASer gene. Recombination is catalyzed by the phage-encoded integrase and occurs between the phage attP site and the bacterial attB site. In this study, we show that the mv4 integrase functions in vivo in Escherichia coli and we characterize the bacterial attB site with a site-specific recombination test involving compatible plasmids carrying the recombination sites. The importance of particular nucleotides within the attB sequence was determined by site-directed mutagenesis. The structure of the attB site was found to be simple but rather unusual. A 16-bp DNA fragment was sufficient for function. Unlike most genetic elements that integrate their DNA into tRNA genes, none of the dyad symmetry elements of the tRNASer gene were present within the minimal attB site. No inverted repeats were detected within this site either, in contrast to the lambda site-specific recombination model. PMID:10572145
Li, Min; Zhang, Jiayi; Liu, Qing; Wang, Jianxin; Wu, Fang-Xiang
2014-01-01
Predicting disease-related genes is one of the most important tasks in bioinformatics and systems biology. With the advances in high-throughput techniques, a large number of protein-protein interactions are available, which make it possible to identify disease-related genes at the network level. However, network-based identification of disease-related genes is still a challenge as the considerable false-positives are still existed in the current available protein interaction networks (PIN). Considering the fact that the majority of genetic disorders tend to manifest only in a single or a few tissues, we constructed tissue-specific networks (TSN) by integrating PIN and tissue-specific data. We further weighed the constructed tissue-specific network (WTSN) by using DNA methylation as it plays an irreplaceable role in the development of complex diseases. A PageRank-based method was developed to identify disease-related genes from the constructed networks. To validate the effectiveness of the proposed method, we constructed PIN, weighted PIN (WPIN), TSN, WTSN for colon cancer and leukemia, respectively. The experimental results on colon cancer and leukemia show that the combination of tissue-specific data and DNA methylation can help to identify disease-related genes more accurately. Moreover, the PageRank-based method was effective to predict disease-related genes on the case studies of colon cancer and leukemia. Tissue-specific data and DNA methylation are two important factors to the study of human diseases. The same method implemented on the WTSN can achieve better results compared to those being implemented on original PIN, WPIN, or TSN. The PageRank-based method outperforms degree centrality-based method for identifying disease-related genes from WTSN.
LENUS (Irish Health Repository)
McKeown, Peter C
2011-08-12
Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs) displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination). We identified these MEGs by developing a bioinformatics tool (GenFrag) which can directly determine the identities of transcript-derived fragments from (i) their size and (ii) which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1 seeds was
Directory of Open Access Journals (Sweden)
Wennblom Trevor J
2011-08-01
Full Text Available Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination. We identified these MEGs by developing a bioinformatics tool (GenFrag which can directly determine the identities of transcript-derived fragments from (i their size and (ii which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo.
Directory of Open Access Journals (Sweden)
Minyan Li
Full Text Available Mammalian spermatogenesis is a highly regulated multistage process of sperm generation. It is hard to uncover the real function of a testis specific gene in vitro since the in vitro model is not yet mature. With the development of the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 system, we can now rapidly generate knockout mouse models of testis specific genes to study the process of spermatogenesis in vivo. SYCP3-like X-linked 2 (SLX2 is a germ cell specific component, which contains a Cor1 domain and belongs to the XLR (X-linked, lymphocyte regulated family. Previous studies suggested that SLX2 might play an important role in mouse spermatogenesis based on its subcellular localization and interacting proteins. However, the function of SLX2 in vivo is still elusive. Here, to investigate the functions of SLX2 in spermatogenesis, we disrupted the Slx2 gene by using the CRISPR/Cas9 system. Since Slx2 is a testis specific X-linked gene, we obtained knockout male mice in the first generation and accelerated the study process. Compared with wild-type mice, Slx2 knockout mice have normal testis and epididymis. Histological observation of testes sections showed that Slx2 knockout affected none of the three main stages of spermatogenesis: mitosis, meiosis and spermiogenesis. In addition, we further confirmed that disruption of Slx2 did not affect the number of spermatogonial stem cells, meiosis progression or XY body formation by immunofluorescence analysis. As spermatogenesis was normal in Slx2 knockout mice, these mice were fertile. Taken together, we showed that Slx2 itself is not an essential gene for mouse spermatogenesis and CRISPR/Cas9 technique could speed up the functional study of testis specific X-linked gene in vivo.
Directory of Open Access Journals (Sweden)
Escalante Ricardo
2008-01-01
Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.
Directory of Open Access Journals (Sweden)
Futahashi Ryo
2012-05-01
Full Text Available Abstract Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern as a young larva, and switches to a green camouflage coloration (cryptic pattern in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes
Directory of Open Access Journals (Sweden)
Dunja Knapp
Full Text Available Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression - early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation.
Directory of Open Access Journals (Sweden)
Conforto Tara L
2012-04-01
Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.
Directory of Open Access Journals (Sweden)
Anne Gabory
Full Text Available Males and females responses to gestational overnutrition set the stage for subsequent sex-specific differences in adult onset non communicable diseases. Placenta, as a widely recognized programming agent, contibutes to the underlying processes. According to our previous findings, a high-fat diet during gestation triggers sex-specific epigenetic alterations within CpG and throughout the genome, together with the deregulation of clusters of imprinted genes. We further investigated the impact of diet and sex on placental histology, transcriptomic and epigenetic signatures in mice. Both basal gene expression and response to maternal high-fat diet were sexually dimorphic in whole placentas. Numerous genes showed sexually dimorphic expression, but only 11 genes regardless of the diet. In line with the key role of genes belonging to the sex chromosomes, 3 of these genes were Y-specific and 3 were X-specific. Amongst all the genes that were differentially expressed under a high-fat diet, only 16 genes were consistently affected in both males and females. The differences were not only quantitative but remarkably qualitative. The biological functions and networks of genes dysregulated differed markedly between the sexes. Seven genes of the epigenetic machinery were dysregulated, due to effects of diet, sex or both, including the Y- and X-linked histone demethylase paralogues Kdm5c and Kdm5d, which could mark differently male and female epigenomes. The DNA methyltransferase cofactor Dnmt3l gene expression was affected, reminiscent of our previous observation of changes in global DNA methylation. Overall, this striking sexual dimorphism of programming trajectories impose a considerable revision of the current dietary interventions protocols.
Structural basis for the site-specific incorporation of lysine derivatives into proteins.
Directory of Open Access Journals (Sweden)
Veronika Flügel
Full Text Available Posttranslational modifications (PTMs of proteins determine their structure-function relationships, interaction partners, as well as their fate in the cell and are crucial for many cellular key processes. For instance chromatin structure and hence gene expression is epigenetically regulated by acetylation or methylation of lysine residues in histones, a phenomenon known as the 'histone code'. Recently it was shown that these lysine residues can furthermore be malonylated, succinylated, butyrylated, propionylated and crotonylated, resulting in significant alteration of gene expression patterns. However the functional implications of these PTMs, which only differ marginally in their chemical structure, is not yet understood. Therefore generation of proteins containing these modified amino acids site specifically is an important tool. In the last decade methods for the translational incorporation of non-natural amino acids using orthogonal aminoacyl-tRNA synthetase (aaRS:tRNAaaCUA pairs were developed. A number of studies show that aaRS can be evolved to use non-natural amino acids and expand the genetic code. Nevertheless the wild type pyrrolysyl-tRNA synthetase (PylRS from Methanosarcina mazei readily accepts a number of lysine derivatives as substrates. This enzyme can further be engineered by mutagenesis to utilize a range of non-natural amino acids. Here we present structural data on the wild type enzyme in complex with adenylated ε-N-alkynyl-, ε-N-butyryl-, ε-N-crotonyl- and ε-N-propionyl-lysine providing insights into the plasticity of the PylRS active site. This shows that given certain key features in the non-natural amino acid to be incorporated, directed evolution of this enzyme is not necessary for substrate tolerance.
Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W
2017-09-01
The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.
International Nuclear Information System (INIS)
Pestov, Nikolay B.; Dmitriev, Ruslan I.; Kostina, Maria B.; Korneenko, Tatyana V.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.
2012-01-01
Highlights: ► Full-length secretory pathway Ca-ATPase (SPCA2) cloned from rat duodenum. ► ATP2C2 gene (encoding SPCA2) exists only in genomes of Tetrapoda. ► Rat and pig SPCA2 are expressed in intestines, lung and some secretory glands. ► Subcellular localization of SPCA2 may depend on tissue type. ► In rat duodenum, SPCA2 is localized in plasma membrane-associated compartments. -- Abstract: Secretory pathway Ca-ATPases are less characterized mammalian calcium pumps than plasma membrane Ca-ATPases and sarco-endoplasmic reticulum Ca-ATPases. Here we report analysis of molecular evolution, alternative splicing, tissue-specific expression and subcellular localization of the second isoform of the secretory pathway Ca-ATPase (SPCA2), the product of the ATP2C2 gene. The primary structure of SPCA2 from rat duodenum deduced from full-length transcript contains 944 amino acid residues, and exhibits 65% sequence identity with known SPCA1. The rat SPCA2 sequence is also highly homologous to putative human protein KIAA0703, however, the latter seems to have an aberrant N-terminus originating from intron 2. The tissue-specificity of SPCA2 expression is different from ubiquitous SPCA1. Rat SPCA2 transcripts were detected predominantly in gastrointestinal tract, lung, trachea, lactating mammary gland, skin and preputial gland. In the newborn pig, the expression profile is very similar with one remarkable exception: porcine bulbourethral gland gave the strongest signal. Upon overexpression in cultured cells, SPCA2 shows an intracellular distribution with remarkable enrichment in Golgi. However, in vivo SPCA2 may be localized in compartments that differ among various tissues: it is intracellular in epidermis, but enriched in plasma membranes of the intestinal epithelium. Analysis of SPCA2 sequences from various vertebrate species argue that ATP2C2 gene radiated from ATP2C1 (encoding SPCA1) during adaptation of tetrapod ancestors to terrestrial habitats.
Costa, Rodrigo; Gomes, Newton C. M.; Kroegerrecklenfort, Ellen; Opelt, Katja; Berg, Gabriele; Smalla, Kornelia
The Pseudomonas community structure and antagonistic potential in the rhizospheres of strawberry and oilseed rape (host plants of the fungal phytopathogen Verticillium dahliae) were assessed. The use of a new PCR-DGGE system, designed to target Pseudomonas-specific gacA gene fragments in
Connallon, Tim; Clark, Andrew G
2010-12-01
Sex-biased genes--genes that are differentially expressed within males and females--are nonrandomly distributed across animal genomes, with sex chromosomes and autosomes often carrying markedly different concentrations of male- and female-biased genes. These linkage patterns are often gene- and lineage-dependent, differing between functional genetic categories and between species. Although sex-specific selection is often hypothesized to shape the evolution of sex-linked and autosomal gene content, population genetics theory has yet to account for many of the gene- and lineage-specific idiosyncrasies emerging from the empirical literature. With the goal of improving the connection between evolutionary theory and a rapidly growing body of genome-wide empirical studies, we extend previous population genetics theory of sex-specific selection by developing and analyzing a biologically informed model that incorporates sex linkage, pleiotropy, recombination, and epistasis, factors that are likely to vary between genes and between species. Our results demonstrate that sex-specific selection and sex-specific recombination rates can generate, and are compatible with, the gene- and species-specific linkage patterns reported in the genomics literature. The theory suggests that sexual selection may strongly influence the architectures of animal genomes, as well as the chromosomal distribution of fixed substitutions underlying sexually dimorphic traits. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Day, Karen P; Artzy-Randrup, Yael; Tiedje, Kathryn E; Rougeron, Virginie; Chen, Donald S; Rask, Thomas S; Rorick, Mary M; Migot-Nabias, Florence; Deloron, Philippe; Luty, Adrian J F; Pascual, Mercedes
2017-05-16
Existing theory on competition for hosts between pathogen strains has proposed that immune selection can lead to the maintenance of strain structure consisting of discrete, weakly overlapping antigenic repertoires. This prediction of strain theory has conceptual overlap with fundamental ideas in ecology on niche partitioning and limiting similarity between coexisting species in an ecosystem, which oppose the hypothesis of neutral coexistence. For Plasmodium falciparum , strain theory has been specifically proposed in relation to the major surface antigen of the blood stage, known as Pf EMP1 and encoded by the multicopy multigene family known as the var genes. Deep sampling of the DBLα domain of var genes in the local population of Bakoumba, West Africa, was completed to define whether patterns of repertoire overlap support a role of immune selection under the opposing force of high outcrossing, a characteristic of areas of intense malaria transmission. Using a 454 high-throughput sequencing protocol, we report extremely high diversity of the DBLα domain and a large parasite population with DBLα repertoires structured into nonrandom patterns of overlap. Such population structure, significant for the high diversity of var genes that compose it at a local level, supports the existence of "strains" characterized by distinct var gene repertoires. Nonneutral, frequency-dependent competition would be at play and could underlie these patterns. With a computational experiment that simulates an intervention similar to mass drug administration, we argue that the observed repertoire structure matters for the antigenic var diversity of the parasite population remaining after intervention.
A clade-specific Arabidopsis gene connects primary metabolism and senescence
Plants have to deal with environmental insults as they cannot move to escape from stressful conditions. To do so, they have evolved novel components that respond to the changing environments. A primary example is Qua Quine Starch (QQS, AT3G30720), an Arabidopsis thaliana-specific (orphan) gene that ...
Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro
Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.
2015-01-01
The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241
Structural similarity and category-specificity
DEFF Research Database (Denmark)
Gerlach, Christian; Law, Ian; Paulson, Olaf B
2004-01-01
It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Smith, Frank W; Jockusch, Elizabeth L
2014-11-01
The establishment of segment identity is a key developmental process that allows for divergence along the anteroposterior body axis in arthropods. In Drosophila, the identity of a segment is determined by the complement of Hox genes it expresses. In many contexts, Hox transcription factors require the protein products of extradenticle (exd) and homothorax (hth) as cofactors to perform their identity specification functions. In holometabolous insects, segment identity may be specified twice, during embryogenesis and metamorphosis. To glean insight into the relationship between embryonic and metamorphic segmental identity specification, we have compared these processes in the flour beetle Tribolium castaneum, which develops ventral appendages during embryogenesis that later metamorphose into adult appendages with distinct morphologies. At metamorphosis, comparisons of RNAi phenotypes indicate that Hox genes function jointly with Tc-hth and Tc-exd to specify several region-specific aspects of the adult body wall. On the other hand, Hox genes specify appendage identities along the anteroposterior axis independently of Tc-hth/Tc-exd and Tc-hth/Tc-exd specify proximal vs. distal identity within appendages independently of Hox genes during this stage. During embryogenesis, Tc-hth and Tc-exd play a broad role in the segmentation process and are required for specification of body wall identities in the thorax; however, contrasting with results from other species, we did not obtain homeotic transformations of embryonic appendages in response to Tc-hth or Tc-exd RNAi. In general, the homeotic effects of interference with the function of Hox genes and Tc-hth/Tc-exd during metamorphosis did not match predictions based on embryonic roles of these genes. Comparing metamorphic patterning in T. castaneum to embryonic and post-embryonic development in hemimetabolous insects suggests that holometabolous metamorphosis combines patterning processes of both late embryogenesis and
CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.
Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng
2017-06-16
Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Poos, Kathrin; Smida, Jan; Nathrath, Michaela; Maugg, Doris; Baumhoer, Daniel; Neumann, Anna; Korsching, Eberhard
2014-01-01
Osteosarcoma (OS) is the most common primary bone cancer exhibiting high genomic instability. This genomic instability affects multiple genes and microRNAs to a varying extent depending on patient and tumor subtype. Massive research is ongoing to identify genes including their gene products and microRNAs that correlate with disease progression and might be used as biomarkers for OS. However, the genomic complexity hampers the identification of reliable biomarkers. Up to now, clinico-pathological factors are the key determinants to guide prognosis and therapeutic treatments. Each day, new studies about OS are published and complicate the acquisition of information to support biomarker discovery and therapeutic improvements. Thus, it is necessary to provide a structured and annotated view on the current OS knowledge that is quick and easily accessible to researchers of the field. Therefore, we developed a publicly available database and Web interface that serves as resource for OS-associated genes and microRNAs. Genes and microRNAs were collected using an automated dictionary-based gene recognition procedure followed by manual review and annotation by experts of the field. In total, 911 genes and 81 microRNAs related to 1331 PubMed abstracts were collected (last update: 29 October 2013). Users can evaluate genes and microRNAs according to their potential prognostic and therapeutic impact, the experimental procedures, the sample types, the biological contexts and microRNA target gene interactions. Additionally, a pathway enrichment analysis of the collected genes highlights different aspects of OS progression. OS requires pathways commonly deregulated in cancer but also features OS-specific alterations like deregulated osteoclast differentiation. To our knowledge, this is the first effort of an OS database containing manual reviewed and annotated up-to-date OS knowledge. It might be a useful resource especially for the bone tumor research community, as specific
Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.
2003-01-01
Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.
Pleiotropic role of growth arrest-specific gene 6 in atherosclerosis
Tjwa, Marc; Moons, Lieve; Lutgens, Esther
2009-01-01
Growth arrest-specific gene 6 (Gas6) belongs to the family of vitamin K-dependent coagulation proteins, but in contrast to its other members, has only a limited role in hemostasis. Instead, Gas6 plays a prominent role in conditions of injury, inflammation and repair. Gas6 amplifies the activation of
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
International Nuclear Information System (INIS)
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi
2014-01-01
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Energy Technology Data Exchange (ETDEWEB)
Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2014-07-18
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Knowledge Enrichment Analysis for Human Tissue- Specific Genes Uncover New Biological Insights
Directory of Open Access Journals (Sweden)
Gong Xiu-Jun
2012-06-01
Full Text Available The expression and regulation of genes in different tissues are fundamental questions to be answered in biology. Knowledge enrichment analysis for tissue specific (TS and housekeeping (HK genes may help identify their roles in biological process or diseases and gain new biological insights.In this paper, we performed the knowledge enrichment analysis for 17,343 genes in 84 human tissues using Gene Set Enrichment Analysis (GSEA and Hypergeometric Analysis (HA against three biological ontologies: Gene Ontology (GO, KEGG pathways and Disease Ontology (DO respectively.The analyses results demonstrated that the functions of most gene groups are consistent with their tissue origins. Meanwhile three interesting new associations for HK genes and the skeletal muscle tissuegenes are found. Firstly, Hypergeometric analysis against KEGG database for HK genes disclosed that three disease terms (Parkinson’s disease, Huntington’s disease, Alzheimer’s disease are intensively enriched.Secondly, Hypergeometric analysis against the KEGG database for Skeletal Muscle tissue genes shows that two cardiac diseases of “Hypertrophic cardiomyopathy (HCM” and “Arrhythmogenic right ventricular cardiomyopathy (ARVC” are heavily enriched, which are also considered as no relationship with skeletal functions.Thirdly, “Prostate cancer” is intensively enriched in Hypergeometric analysis against the disease ontology (DO for the Skeletal Muscle tissue genes, which is a much unexpected phenomenon.
Bryson, Steve; Thomson, Christy A; Risnes, Louise F; Dasgupta, Somnath; Smith, Kenneth; Schrader, John W; Pai, Emil F
2016-06-01
The human Ab response to certain pathogens is oligoclonal, with preferred IgV genes being used more frequently than others. A pair of such preferred genes, IGVK3-11 and IGVH3-30, contributes to the generation of protective Abs directed against the 23F serotype of the pneumonococcal capsular polysaccharide of Streptococcus pneumoniae and against the AD-2S1 peptide of the gB membrane protein of human CMV. Structural analyses of Fab fragments of mAbs 023.102 and pn132p2C05 in complex with portions of the 23F polysaccharide revealed five germline-encoded residues in contact with the key component, l-rhamnose. In the case of the AD-2S1 peptide, the KE5 Fab fragment complex identified nine germline-encoded contact residues. Two of these germline-encoded residues, Arg91L and Trp94L, contact both the l-rhamnose and the AD-2S1 peptide. Comparison of the respective paratopes that bind to carbohydrate and protein reveals that stochastic diversity in both CDR3 loops alone almost exclusively accounts for their divergent specificity. Combined evolutionary pressure by human CMV and the 23F serotype of S. pneumoniae acted on the IGVK3-11 and IGVH3-30 genes as demonstrated by the multiple germline-encoded amino acids that contact both l-rhamnose and AD-2S1 peptide. Copyright © 2016 by The American Association of Immunologists, Inc.
Comparative genomics of the relationship between gene structure and expression
Ren, X.
2006-01-01
The relationship between the structure of genes and their expression is a relatively new aspect of genome organization and regulation. With more genome sequences and expression data becoming available, bioinformatics approaches can help the further elucidation of the relationships between gene
International Nuclear Information System (INIS)
Robinson, G.S.
1989-01-01
The focus of this dissertation is to determine what role(s) the extracellular matrix and expression of certain cytoskeletal genes play in the regulation of hepatocyte growth and the maintenance of a differential state. The expression of several cytoskeletal and liver-specific genes was examined during liver regeneration and in hepatocyte cultures maintained in a hormonally-defined, serum-free medium and plated on two different matrices: rat tail collagen and the EHS matrix. During liver regeneration and in hepatocytes cultured on rat tail collagen, there was a dramatic increase in tubulin mRNA levels coincident with but not linked to DNA synthesis. The message levels for other cytoskeletal genes similarly increased, while a decrease was observed in the mRNA levels of the liver-specific genes, serum albumin and alpha 1 inhibitor III. Hepatocytes cultured on the EHS matrix resulted in the maintenance of low levels of cytoskeletal gene expression and high levels of liver-specific gene expression, similar to that observed in the normal liver. Results from subcellar fractionation and two-dimensional gel electrophoresis of 35 S-labelled proteins paralleled the results seen at the mRNA level. Preliminary work suggests that microtubule organization may play a role in the expression of the liver-specific genes which encode secreted proteins. These studies, which compare hepatocytes cultured on collagen or the EHS matrix gel, reveal that both cell-cell and cell-matrix interactions play a major role in the maintenance of the differential phenotype in hepatocytes
Regulation of Msx genes by a Bmp gradient is essential for neural crest specification.
Tribulo, Celeste; Aybar, Manuel J; Nguyen, Vu H; Mullins, Mary C; Mayor, Roberto
2003-12-01
There is evidence in Xenopus and zebrafish embryos that the neural crest/neural folds are specified at the border of the neural plate by a precise threshold concentration of a Bmp gradient. In order to understand the molecular mechanism by which a gradient of Bmp is able to specify the neural crest, we analyzed how the expression of Bmp targets, the Msx genes, is regulated and the role that Msx genes has in neural crest specification. As Msx genes are directly downstream of Bmp, we analyzed Msx gene expression after experimental modification in the level of Bmp activity by grafting a bead soaked with noggin into Xenopus embryos, by expressing in the ectoderm a dominant-negative Bmp4 or Bmp receptor in Xenopus and zebrafish embryos, and also through Bmp pathway component mutants in the zebrafish. All the results show that a reduction in the level of Bmp activity leads to an increase in the expression of Msx genes in the neural plate border. Interestingly, by reaching different levels of Bmp activity in animal cap ectoderm, we show that a specific concentration of Bmp induces msx1 expression to a level similar to that required to induce neural crest. Our results indicate that an intermediate level of Bmp activity specifies the expression of Msx genes in the neural fold region. In addition, we have analyzed the role that msx1 plays on neural crest specification. As msx1 has a role in dorsoventral pattering, we have carried out conditional gain- and loss-of-function experiments using different msx1 constructs fused to a glucocorticoid receptor element to avoid an early effect of this factor. We show that msx1 expression is able to induce all other early neural crest markers tested (snail, slug, foxd3) at the time of neural crest specification. Furthermore, the expression of a dominant negative of Msx genes leads to the inhibition of all the neural crest markers analyzed. It has been previously shown that snail is one of the earliest genes acting in the neural crest
Human-Specific Endogenous Retroviruses
Directory of Open Access Journals (Sweden)
Anton Buzdin
2007-01-01
Full Text Available This review focuses on a small family of human-specific genomic repetitive elements, presented by 134 members that shaped ~330 kb of the human DNA. Although modest in terms of its copy number, this group appeared to modify the human genome activity by endogenizing ~50 functional copies of viral genes that may have important implications in the immune response, cancer progression, and antiretroviral host defense. A total of 134 potential promoters and enhancers have been added to the human DNA, about 50% of them in the close gene vicinity and 22% in gene introns. For 60 such human-specific promoters, their activity was confirmed by in vivo assays, with the transcriptional level varying ~1000-fold from hardly detectable to as high as ~3% of β-actin transcript level. New polyadenylation signals have been provided to four human RNAs, and a number of potential antisense regulators of known human genes appeared due to human-specific retroviral insertional activity. This information is given here in the context of other major genomic changes underlining differences between human and chimpanzee DNAs. Finally, a comprehensive database, is available for download, of human-specific and polymorphic endogenous retroviruses is presented, which encompasses the data on their genomic localization, primary structure, encoded viral genes, human gene neighborhood, transcriptional activity, and methylation status.
Majoros, William H; Campbell, Michael S; Holt, Carson; DeNardo, Erin K; Ware, Doreen; Allen, Andrew S; Yandell, Mark; Reddy, Timothy E
2017-05-15
The accurate interpretation of genetic variants is critical for characterizing genotype-phenotype associations. Because the effects of genetic variants can depend strongly on their local genomic context, accurate genome annotations are essential. Furthermore, as some variants have the potential to disrupt or alter gene structure, variant interpretation efforts stand to gain from the use of individualized annotations that account for differences in gene structure between individuals or strains. We describe a suite of software tools for identifying possible functional changes in gene structure that may result from sequence variants. ACE ('Assessing Changes to Exons') converts phased genotype calls to a collection of explicit haplotype sequences, maps transcript annotations onto them, detects gene-structure changes and their possible repercussions, and identifies several classes of possible loss of function. Novel transcripts predicted by ACE are commonly supported by spliced RNA-seq reads, and can be used to improve read alignment and transcript quantification when an individual-specific genome sequence is available. Using publicly available RNA-seq data, we show that ACE predictions confirm earlier results regarding the quantitative effects of nonsense-mediated decay, and we show that predicted loss-of-function events are highly concordant with patterns of intolerance to mutations across the human population. ACE can be readily applied to diverse species including animals and plants, making it a broadly useful tool for use in eukaryotic population-based resequencing projects, particularly for assessing the joint impact of all variants at a locus. ACE is written in open-source C ++ and Perl and is available from geneprediction.org/ACE. myandell@genetics.utah.edu or tim.reddy@duke.edu. Supplementary information is available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e
Phylogenetic and structural diversity in the feline leukemia virus env gene.
Directory of Open Access Journals (Sweden)
Shinya Watanabe
Full Text Available Feline leukemia virus (FeLV belongs to the genus Gammaretrovirus, and causes a variety of neoplastic and non-neoplastic diseases in cats. Alteration of viral env sequences is thought to be associated with disease specificity, but the way in which genetic diversity of FeLV contributes to the generation of such variants in nature is poorly understood. We isolated FeLV env genes from naturally infected cats in Japan and analyzed the evolutionary dynamics of these genes. Phylogenetic reconstructions separated our FeLV samples into three distinct genetic clusters, termed Genotypes I, II, and III. Genotype I is a major genetic cluster and can be further classified into Clades 1-7 in Japan. Genotypes were correlated with geographical distribution; Genotypes I and II were distributed within Japan, whilst FeLV samples from outside Japan belonged to Genotype III. These results may be due to geographical isolation of FeLVs in Japan. The observed structural diversity of the FeLV env gene appears to be caused primarily by mutation, deletion, insertion and recombination, and these variants may be generated de novo in individual cats. FeLV interference assay revealed that FeLV genotypes did not correlate with known FeLV receptor subgroups. We have identified the genotypes which we consider to be reliable for evaluating phylogenetic relationships of FeLV, which embrace the high structural diversity observed in our sample. Overall, these findings extend our understanding of Gammaretrovirus evolutionary patterns in the field, and may provide a useful basis for assessing the emergence of novel strains and understanding the molecular mechanisms of FeLV transmission in cats.
Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.
Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T
1996-01-01
A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992
Structuring Formal Requirements Specifications for Reuse and Product Families
Heimdahl, Mats P. E.
2001-01-01
In this project we have investigated how formal specifications should be structured to allow for requirements reuse, product family engineering, and ease of requirements change, The contributions of this work include (1) a requirements specification methodology specifically targeted for critical avionics applications, (2) guidelines for how to structure state-based specifications to facilitate ease of change and reuse, and (3) examples from the avionics domain demonstrating the proposed approach.
Energy Technology Data Exchange (ETDEWEB)
Pestov, Nikolay B., E-mail: korn@mail.ibch.ru [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Dmitriev, Ruslan I.; Kostina, Maria B. [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Korneenko, Tatyana V. [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Shakhparonov, Mikhail I. [Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871 (Russian Federation); Modyanov, Nikolai N., E-mail: nikolai.modyanov@utoledo.edu [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States)
2012-01-27
Highlights: Black-Right-Pointing-Pointer Full-length secretory pathway Ca-ATPase (SPCA2) cloned from rat duodenum. Black-Right-Pointing-Pointer ATP2C2 gene (encoding SPCA2) exists only in genomes of Tetrapoda. Black-Right-Pointing-Pointer Rat and pig SPCA2 are expressed in intestines, lung and some secretory glands. Black-Right-Pointing-Pointer Subcellular localization of SPCA2 may depend on tissue type. Black-Right-Pointing-Pointer In rat duodenum, SPCA2 is localized in plasma membrane-associated compartments. -- Abstract: Secretory pathway Ca-ATPases are less characterized mammalian calcium pumps than plasma membrane Ca-ATPases and sarco-endoplasmic reticulum Ca-ATPases. Here we report analysis of molecular evolution, alternative splicing, tissue-specific expression and subcellular localization of the second isoform of the secretory pathway Ca-ATPase (SPCA2), the product of the ATP2C2 gene. The primary structure of SPCA2 from rat duodenum deduced from full-length transcript contains 944 amino acid residues, and exhibits 65% sequence identity with known SPCA1. The rat SPCA2 sequence is also highly homologous to putative human protein KIAA0703, however, the latter seems to have an aberrant N-terminus originating from intron 2. The tissue-specificity of SPCA2 expression is different from ubiquitous SPCA1. Rat SPCA2 transcripts were detected predominantly in gastrointestinal tract, lung, trachea, lactating mammary gland, skin and preputial gland. In the newborn pig, the expression profile is very similar with one remarkable exception: porcine bulbourethral gland gave the strongest signal. Upon overexpression in cultured cells, SPCA2 shows an intracellular distribution with remarkable enrichment in Golgi. However, in vivo SPCA2 may be localized in compartments that differ among various tissues: it is intracellular in epidermis, but enriched in plasma membranes of the intestinal epithelium. Analysis of SPCA2 sequences from various vertebrate species argue that ATP2C2
Memory functions reveal structural properties of gene regulatory networks
Perez-Carrasco, Ruben
2018-01-01
Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492
Concordance of gene expression in human protein complexes reveals tissue specificity and pathology
DEFF Research Database (Denmark)
Börnigen, Daniela; Pers, Tune Hannes; Thorrez, Lieven
2013-01-01
Disease-causing variants in human genes usually lead to phenotypes specific to only a few tissues. Here, we present a method for predicting tissue specificity based on quantitative deregulation of protein complexes. The underlying assumption is that the degree of coordinated expression among prot...
Badea, Liviu; Herlea, Vlad; Dima, Simona Olimpia; Dumitrascu, Traian; Popescu, Irinel
2008-01-01
The precise details of pancreatic ductal adenocarcinoma (PDAC) pathogenesis are still insufficiently known, requiring the use of high-throughput methods. However, PDAC is especially difficult to study using microarrays due to its strong desmoplastic reaction, which involves a hyperproliferating stroma that effectively "masks" the contribution of the minoritary neoplastic epithelial cells. Thus it is not clear which of the genes that have been found differentially expressed between normal and whole tumor tissues are due to the tumor epithelia and which simply reflect the differences in cellular composition. To address this problem, laser microdissection studies have been performed, but these have to deal with much smaller tissue sample quantities and therefore have significantly higher experimental noise. In this paper we combine our own large sample whole-tissue study with a previously published smaller sample microdissection study by Grützmann et al. to identify the genes that are specifically overexpressed in PDAC tumor epithelia. The overlap of this list of genes with other microarray studies of pancreatic cancer as well as with the published literature is impressive. Moreover, we find a number of genes whose over-expression appears to be inversely correlated with patient survival: keratin 7, laminin gamma 2, stratifin, platelet phosphofructokinase, annexin A2, MAP4K4 and OACT2 (MBOAT2), which are all specifically upregulated in the neoplastic epithelia, rather than the tumor stroma. We improve on other microarray studies of PDAC by putting together the higher statistical power due to a larger number of samples with information about cell-type specific expression and patient survival.
Using Merkel cell polyomavirus specific TCR gene therapy for treatment of Merkel cellcarcinoma
DEFF Research Database (Denmark)
Lyngaa, Rikke Birgitte; Pedersen, Natasja Wulff; Linnemann, C.
2016-01-01
T cell receptor gene-therapy has entered the clinic and shown potential for successful cancer treatment. However, the clinical evaluation has also highlighted the need for selection of truly cancerspecific targets. Merkel cell carcinoma (MCC) is a highly aggressive skin cancer associated with Mer......T cell receptor gene-therapy has entered the clinic and shown potential for successful cancer treatment. However, the clinical evaluation has also highlighted the need for selection of truly cancerspecific targets. Merkel cell carcinoma (MCC) is a highly aggressive skin cancer associated...... with Merkel cell polyomavirus (MCPyV). Due to the clear viral correlation CD8+ T cells specific for viral epitopes could potentially form cancer-specific targets in MCC patients. We have identified MCPyV specific T cells using a high-throughput platform for T-cell enrichment and combinatorial encoding...
Nagymihály, Marianna
2017-04-13
The formation of symbiotic nodule cells in Medicago truncatula is driven by successive endoreduplication cycles and transcriptional reprogramming in different temporal waves including the activation of more than 600 cysteine-rich NCR genes expressed only in nodules. We show here that the transcriptional waves correlate with growing ploidy levels and have investigated how the epigenome changes during endoreduplication cycles. Differential DNA methylation was found in only a small subset of symbiotic nodule-specific genes, including more than half of the NCR genes, whereas in most genes DNA methylation was unaffected by the ploidy levels and was independent of the genes\\' active or repressed state. On the other hand, expression of nodule-specific genes correlated with ploidy-dependent opening of the chromatin as well as, in a subset of tested genes, with reduced H3K27me3 levels combined with enhanced H3K9ac levels. Our results suggest that endoreduplication-dependent epigenetic changes contribute to transcriptional reprogramming in the differentiation of symbiotic cells.
Tumor-specific apoptotic gene targeting overcomes radiation resistance in esophageal adenocarcinoma
International Nuclear Information System (INIS)
Chang, Joe Y.; Zhang Xiaochun; Komaki, Ritsuko; Cheung, Rex; Fang Bingliang
2006-01-01
Purpose: To overcome radiation resistance in esophageal adenocarcinoma by tumor-specific apoptotic gene targeting using tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Methods and Materials: Adenoviral vector Ad/TRAIL-F/RGD with a tumor-specific human telomerase reverse transcription promoter was used to transfer TRAIL gene to human esophageal adenocarcinoma and normal human lung fibroblastic cells (NHLF). Activation of apoptosis was analyzed by Western blot, fluorescent activated cell sorting, and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate labeling (TUNEL) assay. A human esophageal adenocarcinoma mouse model was treated with intratumoral injections of Ad/TRAIL-F/RGD plus local radiotherapy. Results: The combination of Ad/TRAIL-F/RGD and radiotherapy increased the cell-killing effect in all esophageal adenocarcinoma cell lines but not in NHLF cells. This combination also significantly reduced clonogenic formation (p < 0.05) and increased sub-G1 deoxyribonucleic acid accumulation in cancer cells (p < 0.05). Activation of apoptosis by Ad/TRAIL-F/RGD plus radiotherapy was demonstrated by activation of caspase-9, caspase-8, and caspase-3 and cleaved poly (adenosine diphosphate-ribose) polymerase in vitro and TUNEL assay in vivo. Combined Ad/TRAIL-F/RGD and radiotherapy dramatically inhibited tumor growth and prolonged mean survival in the esophageal adenocarcinoma model to 31.6 days from 16.7 days for radiotherapy alone and 21.5 days for Ad/TRAIL-F/RGD alone (p < 0.05). Conclusions: The combination of tumor-specific TRAIL gene targeting and radiotherapy enhances the effect of suppressing esophageal adenocarcinoma growth and prolonging survival
Pydiura, Nikolay; Pirko, Yaroslav; Galinousky, Dmitry; Postovoitova, Anastasiia; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2018-06-08
Flax (Linum usitatissimum L.) is a valuable food and fiber crop cultivated for its quality fiber and seed oil. α-, β-, γ-tubulins and actins are the main structural proteins of the cytoskeleton. α- and γ-tubulin and actin genes have not been characterized yet in the flax genome. In this study, we have identified 6 α-tubulin genes, 13 β-tubulin genes, 2 γ-tubulin genes, and 15 actin genes in the flax genome and analysed the phylogenetic relationships between flax and A. thaliana tubulin and actin genes. Six α-tubulin genes are represented by 3 paralogous pairs, among 13 β-tubulin genes 7 different isotypes can be distinguished, 6 of which are encoded by two paralogous genes each. γ-tubulin is represented by a paralogous pair of genes one of which may be not functional. Fifteen actin genes represent 7 paralogous pairs - 7 actin isotypes and a sequentially duplicated copy of one of the genes of one of the isotypes. Exon-intron structure analysis has shown intron length polymorphism within the β-tubulin genes and intron number variation among the α-tubulin gene: 3 or 4 introns are found in two or four genes, respectively. Intron positioning occurs at conservative sites, as observed in numerous other plant species. Flax actin genes show both intron length polymorphisms and variation in the number of intron that may be 2 or 3. These data will be useful to support further studies on the specificity, functioning, regulation and evolution of the flax cytoskeleton proteins. This article is protected by copyright. All rights reserved.
Directory of Open Access Journals (Sweden)
Rohini Garg
Full Text Available DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases, namely Methyltransferase (MET, Chromomethylase (CMT and Domains Rearranged Methyltransferase (DRM, which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2 subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes.
Cell-specific prediction and application of drug-induced gene expression profiles.
Hodos, Rachel; Zhang, Ping; Lee, Hao-Chih; Duan, Qiaonan; Wang, Zichen; Clark, Neil R; Ma'ayan, Avi; Wang, Fei; Kidd, Brian; Hu, Jianying; Sontag, David; Dudley, Joel
2018-01-01
Gene expression profiling of in vitro drug perturbations is useful for many biomedical discovery applications including drug repurposing and elucidation of drug mechanisms. However, limited data availability across cell types has hindered our capacity to leverage or explore the cell-specificity of these perturbations. While recent efforts have generated a large number of drug perturbation profiles across a variety of human cell types, many gaps remain in this combinatorial drug-cell space. Hence, we asked whether it is possible to fill these gaps by predicting cell-specific drug perturbation profiles using available expression data from related conditions--i.e. from other drugs and cell types. We developed a computational framework that first arranges existing profiles into a three-dimensional array (or tensor) indexed by drugs, genes, and cell types, and then uses either local (nearest-neighbors) or global (tensor completion) information to predict unmeasured profiles. We evaluate prediction accuracy using a variety of metrics, and find that the two methods have complementary performance, each superior in different regions in the drug-cell space. Predictions achieve correlations of 0.68 with true values, and maintain accurate differentially expressed genes (AUC 0.81). Finally, we demonstrate that the predicted profiles add value for making downstream associations with drug targets and therapeutic classes.
Li, Yao; Chan, Lawrence; Nguyen, Huy V; Tsang, Stephen H
2016-01-01
Interest in generating human induced pluripotent stem (iPS) cells for stem cell modeling of diseases has overtaken that of patient-specific human embryonic stem cells due to the ethical, technical, and political concerns associated with the latter. In ophthalmology, researchers are currently using iPS cells to explore various applications, including: (1) modeling of retinal diseases using patient-specific iPS cells; (2) autologous transplantation of differentiated retinal cells that undergo gene correction at the iPS cell stage via gene editing tools (e.g., CRISPR/Cas9, TALENs and ZFNs); and (3) autologous transplantation of patient-specific iPS-derived retinal cells treated with gene therapy. In this review, we will discuss the uses of patient-specific iPS cells for differentiating into retinal pigment epithelium (RPE) cells, uncovering disease pathophysiology, and developing new treatments such as gene therapy and cell replacement therapy via autologous transplantation.
Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A
2015-09-02
Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wayengera Misaki
2011-07-01
Full Text Available Abstract Background Infection with HIV, which culminates in the establishment of a latent proviral reservoir, presents formidable challenges for ultimate cure. Building on the hypothesis that ex-vivo or even in-vivo abolition or disruption of HIV-gene/genome-action by target mutagenesis or excision can irreversibly abrogate HIV's innate fitness to replicate and survive, we previously identified the isoschizomeric bacteria restriction enzymes (REases AcsI and ApoI as potent cleavers of the HIV-pol gene (11 and 9 times in HIV-1 and 2, respectively. However, both enzymes, along with others found to cleave across the entire HIV-1 genome, slice (SX at palindromic sequences that are prevalent within the human genome and thereby pose the risk of host genome toxicity. A long-term goal in the field of R-M enzymatic therapeutics has thus been to generate synthetic restriction endonucleases with longer recognition sites limited in specificity to HIV. We aimed (i to assemble and construct zinc finger arrays and nucleases (ZFN with either proviral-HIV-pol gene or proviral-HIV-1 whole-genome specificity respectively, and (ii to advance a model for pre-clinically testing lentiviral vectors (LV that deliver and transduce either ZFN genotype. Methods and Results First, we computationally generated the consensus sequences of (a 114 dsDNA-binding zinc finger (Zif arrays (ZFAs or ZifHIV-pol and (b two zinc-finger nucleases (ZFNs which, unlike the AcsI and ApoI homeodomains, possess specificity to >18 base-pair sequences uniquely present within the HIV-pol gene (ZifHIV-polFN. Another 15 ZFNs targeting >18 bp sequences within the complete HIV-1 proviral genome were constructed (ZifHIV-1FN. Second, a model for constructing lentiviral vectors (LVs that deliver and transduce a diploid copy of either ZifHIV-polFN or ZifHIV-1FN chimeric genes (termed LV- 2xZifHIV-polFN and LV- 2xZifHIV-1FN, respectively is proposed. Third, two preclinical models for controlled testing of
Wayengera, Misaki
2011-07-22
Infection with HIV, which culminates in the establishment of a latent proviral reservoir, presents formidable challenges for ultimate cure. Building on the hypothesis that ex-vivo or even in-vivo abolition or disruption of HIV-gene/genome-action by target mutagenesis or excision can irreversibly abrogate HIV's innate fitness to replicate and survive, we previously identified the isoschizomeric bacteria restriction enzymes (REases) AcsI and ApoI as potent cleavers of the HIV-pol gene (11 and 9 times in HIV-1 and 2, respectively). However, both enzymes, along with others found to cleave across the entire HIV-1 genome, slice (SX) at palindromic sequences that are prevalent within the human genome and thereby pose the risk of host genome toxicity. A long-term goal in the field of R-M enzymatic therapeutics has thus been to generate synthetic restriction endonucleases with longer recognition sites limited in specificity to HIV. We aimed (i) to assemble and construct zinc finger arrays and nucleases (ZFN) with either proviral-HIV-pol gene or proviral-HIV-1 whole-genome specificity respectively, and (ii) to advance a model for pre-clinically testing lentiviral vectors (LV) that deliver and transduce either ZFN genotype. First, we computationally generated the consensus sequences of (a) 114 dsDNA-binding zinc finger (Zif) arrays (ZFAs or ZifHIV-pol) and (b) two zinc-finger nucleases (ZFNs) which, unlike the AcsI and ApoI homeodomains, possess specificity to >18 base-pair sequences uniquely present within the HIV-pol gene (ZifHIV-polFN). Another 15 ZFNs targeting >18 bp sequences within the complete HIV-1 proviral genome were constructed (ZifHIV-1FN). Second, a model for constructing lentiviral vectors (LVs) that deliver and transduce a diploid copy of either ZifHIV-polFN or ZifHIV-1FN chimeric genes (termed LV- 2xZifHIV-polFN and LV- 2xZifHIV-1FN, respectively) is proposed. Third, two preclinical models for controlled testing of the safety and efficacy of either of these
Zhou, Xionghui; Liu, Juan
2014-01-01
Although many methods have been proposed to reconstruct gene regulatory network, most of them, when applied in the sample-based data, can not reveal the gene regulatory relations underlying the phenotypic change (e.g. normal versus cancer). In this paper, we adopt phenotype as a variable when constructing the gene regulatory network, while former researches either neglected it or only used it to select the differentially expressed genes as the inputs to construct the gene regulatory network. To be specific, we integrate phenotype information with gene expression data to identify the gene dependency pairs by using the method of conditional mutual information. A gene dependency pair (A,B) means that the influence of gene A on the phenotype depends on gene B. All identified gene dependency pairs constitute a directed network underlying the phenotype, namely gene dependency network. By this way, we have constructed gene dependency network of breast cancer from gene expression data along with two different phenotype states (metastasis and non-metastasis). Moreover, we have found the network scale free, indicating that its hub genes with high out-degrees may play critical roles in the network. After functional investigation, these hub genes are found to be biologically significant and specially related to breast cancer, which suggests that our gene dependency network is meaningful. The validity has also been justified by literature investigation. From the network, we have selected 43 discriminative hubs as signature to build the classification model for distinguishing the distant metastasis risks of breast cancer patients, and the result outperforms those classification models with published signatures. In conclusion, we have proposed a promising way to construct the gene regulatory network by using sample-based data, which has been shown to be effective and accurate in uncovering the hidden mechanism of the biological process and identifying the gene signature for
Directory of Open Access Journals (Sweden)
Erica Bree Rosenblum
Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.
Directory of Open Access Journals (Sweden)
Sibao Wang
2011-06-01
Full Text Available An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta cuticle, M. robertsii up-regulates a gene (Mest1 that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta, while virulence to grasshoppers (Melanoplus femurrubrum was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.
Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas
2018-01-01
Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5
Energy Technology Data Exchange (ETDEWEB)
Haas, B J; Salzberg, S L; Zhu, W; Pertea, M; Allen, J E; Orvis, J; White, O; Buell, C R; Wortman, J R
2007-12-10
EVidenceModeler (EVM) is presented as an automated eukaryotic gene structure annotation tool that reports eukaryotic gene structures as a weighted consensus of all available evidence. EVM, when combined with the Program to Assemble Spliced Alignments (PASA), yields a comprehensive, configurable annotation system that predicts protein-coding genes and alternatively spliced isoforms. Our experiments on both rice and human genome sequences demonstrate that EVM produces automated gene structure annotation approaching the quality of manual curation.
DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Kenyon, C.J.; Walker, G.C.
1988-05-01
Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.
Weterings, K; Schrauwen, J; Wullems, G; Twell, D
1995-07-01
Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Directory of Open Access Journals (Sweden)
Zhang Michael Q
2011-05-01
Full Text Available Abstract Background Gene expression is regulated at both the DNA sequence level and through modification of chromatin. However, the effect of chromatin on tissue/cell-type specific gene regulation (TCSR is largely unknown. In this paper, we present a method to elucidate the relationship between histone modification/variation (HMV and TCSR. Results A classifier for differentiating CD4+ T cell-specific genes from housekeeping genes using HMV data was built. We found HMV in both promoter and gene body regions to be predictive of genes which are targets of TCSR. For example, the histone modification types H3K4me3 and H3K27ac were identified as the most predictive for CpG-related promoters, whereas H3K4me3 and H3K79me3 were the most predictive for nonCpG-related promoters. However, genes targeted by TCSR can be predicted using other type of HMVs as well. Such redundancy implies that multiple type of underlying regulatory elements, such as enhancers or intragenic alternative promoters, which can regulate gene expression in a tissue/cell-type specific fashion, may be marked by the HMVs. Finally, we show that the predictive power of HMV for TCSR is not limited to protein-coding genes in CD4+ T cells, as we successfully predicted TCSR targeted genes in muscle cells, as well as microRNA genes with expression specific to CD4+ T cells, by the same classifier which was trained on HMV data of protein-coding genes in CD4+ T cells. Conclusion We have begun to understand the HMV patterns that guide gene expression in both tissue/cell-type specific and ubiquitous manner.
Directory of Open Access Journals (Sweden)
Liliya eEuro
2015-02-01
Full Text Available The accuracy of mitochondrial protein synthesis is dependent on the coordinated action of nuclear-encoded mitochondrial aminoacyl-tRNA synthetases (mtARSs and the mitochondrial DNA-encoded tRNAs. The recent advances in whole-exome sequencing have revealed the importance of the mtARS proteins for mitochondrial pathophysiology since nearly every nuclear gene for mtARS (out of 19 is now recognized as a disease gene for mitochondrial disease. Typically, defects in each mtARS have been identified in one tissue-specific disease, most commonly affecting the brain, or in one syndrome. However, mutations in the AARS2 gene for mitochondrial alanyl-tRNA synthetase (mtAlaRS have been reported both in patients with infantile-onset cardiomyopathy and in patients with childhood to adulthood-onset leukoencephalopathy. We present here an investigation of the effects of the described mutations on the structure of the synthetase, in an effort to understand the tissue-specific outcomes of the different mutations.The mtAlaRS differs from the other mtARSs because in addition to the aminoacylation domain, it has a conserved editing domain for deacylating tRNAs that have been mischarged with incorrect amino acids. We show that the cardiomyopathy phenotype results from a single allele, causing an amino acid change p.R592W in the editing domain of AARS2, whereas the leukodystrophy mutations are located in other domains of the synthetase. Nevertheless, our structural analysis predicts that all mutations reduce the aminoacylation activity of the synthetase, because all mtAlaRS domains contribute to tRNA binding for aminoacylation. According to our model, the cardiomyopathy mutations severely compromise aminoacylation whereas partial activity is retained by the mutation combinations found in the leukodystrophy patients. These predictions provide a hypothesis for the molecular basis of the distinct tissue-specific phenotypic outcomes.
Directory of Open Access Journals (Sweden)
Simerjeet Kaur
Full Text Available Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix stands for the respective genome. Sequence analyses of the CESA proteins from wheat and their orthologs from barley, maize, rice, and several dicot species (Arabidopsis, beet, cotton, poplar, potato, rose gum and soybean revealed motifs unique to monocots (Poales or dicots. Novel structural motifs CQIC and SVICEXWFA were identified, which distinguished the CESAs involved in the formation of primary and secondary cell wall (PCW and SCW in all the species. We also identified several new motifs specific to monocots or dicots. The conserved motifs identified in this study possibly play functional roles specific to PCW or SCW formation. The new insights from this study advance our knowledge about the structure, function and evolution of the CesA family in plants in general and wheat in particular. This information will be useful in improving culm strength to reduce lodging or alter wall composition to improve biofuel production.
Morimoto, Shimpei; Yahara, Koji
2018-03-01
Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential
Establishing gene models from the Pinus pinaster genome using gene capture and BAC sequencing.
Seoane-Zonjic, Pedro; Cañas, Rafael A; Bautista, Rocío; Gómez-Maldonado, Josefa; Arrillaga, Isabel; Fernández-Pozo, Noé; Claros, M Gonzalo; Cánovas, Francisco M; Ávila, Concepción
2016-02-27
In the era of DNA throughput sequencing, assembling and understanding gymnosperm mega-genomes remains a challenge. Although drafts of three conifer genomes have recently been published, this number is too low to understand the full complexity of conifer genomes. Using techniques focused on specific genes, gene models can be established that can aid in the assembly of gene-rich regions, and this information can be used to compare genomes and understand functional evolution. In this study, gene capture technology combined with BAC isolation and sequencing was used as an experimental approach to establish de novo gene structures without a reference genome. Probes were designed for 866 maritime pine transcripts to sequence genes captured from genomic DNA. The gene models were constructed using GeneAssembler, a new bioinformatic pipeline, which reconstructed over 82% of the gene structures, and a high proportion (85%) of the captured gene models contained sequences from the promoter regulatory region. In a parallel experiment, the P. pinaster BAC library was screened to isolate clones containing genes whose cDNA sequence were already available. BAC clones containing the asparagine synthetase, sucrose synthase and xyloglucan endotransglycosylase gene sequences were isolated and used in this study. The gene models derived from the gene capture approach were compared with the genomic sequences derived from the BAC clones. This combined approach is a particularly efficient way to capture the genomic structures of gene families with a small number of members. The experimental approach used in this study is a valuable combined technique to study genomic gene structures in species for which a reference genome is unavailable. It can be used to establish exon/intron boundaries in unknown gene structures, to reconstruct incomplete genes and to obtain promoter sequences that can be used for transcriptional studies. A bioinformatics algorithm (GeneAssembler) is also provided as a
Automatic generation of gene finders for eukaryotic species
DEFF Research Database (Denmark)
Terkelsen, Kasper Munch; Krogh, A.
2006-01-01
and quality of reliable gene annotation grows. Results We present a procedure, Agene, that automatically generates a species-specific gene predictor from a set of reliable mRNA sequences and a genome. We apply a Hidden Markov model (HMM) that implements explicit length distribution modelling for all gene......Background The number of sequenced eukaryotic genomes is rapidly increasing. This means that over time it will be hard to keep supplying customised gene finders for each genome. This calls for procedures to automatically generate species-specific gene finders and to re-train them as the quantity...... structure blocks using acyclic discrete phase type distributions. The state structure of the each HMM is generated dynamically from an array of sub-models to include only gene features represented in the training set. Conclusion Acyclic discrete phase type distributions are well suited to model sequence...
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
Energy Technology Data Exchange (ETDEWEB)
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)
2016-05-27
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
International Nuclear Information System (INIS)
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen
2016-01-01
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang
2012-06-15
Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication
Aspects of gene structure and functional regulation of the isozymes of Na,K-ATPase
DEFF Research Database (Denmark)
Jorgensen, P.L.
2001-01-01
genomes, the genes of four alpha-subunit and at least three beta-subunit isoforms of Na,K-ATPase are identified and two gamma-subunits are expressed in kidney. The isoforms combine in a number of Na,K-ATPase isozymes that are expressed in a tissue and cell specific manner. Models of the molecular...... mechanism of regulation of these isozymes have become more reliable due to progress in understanding the three-dimensional protein structure and conformational transitions mediating transfer of energy from the P-domain to intramembrane Na+ and K+ binding sites....
Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii.
Jacobson, M R; Brigle, K E; Bennett, L T; Setterquist, R A; Wilson, M S; Cash, V L; Beynon, J; Newton, W E; Dean, D R
1989-01-01
Determination of a 28,793-base-pair DNA sequence of a region from the Azotobacter vinelandii genome that includes and flanks the nitrogenase structural gene region was completed. This information was used to revise the previously proposed organization of the major nif cluster. The major nif cluster from A. vinelandii encodes 15 nif-specific genes whose products bear significant structural identity to the corresponding nif-specific gene products from Klebsiella pneumoniae. These genes include ...
Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian
2004-01-01
Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341
Directory of Open Access Journals (Sweden)
Spitznagel Edward
2003-11-01
Full Text Available Abstract Background The assessment of data reproducibility is essential for application of microarray technology to exploration of biological pathways and disease states. Technical variability in data analysis largely depends on signal intensity. Within that context, the reproducibility of individual probe sets has not been hitherto addressed. Results We used an extraordinarily large replicate data set derived from human placental trophoblast to analyze probe-specific contribution to variability of gene expression. We found that signal variability, in addition to being signal-intensity dependant, is probe set-specific. Importantly, we developed a novel method to quantify the contribution of this probe set-specific variability. Furthermore, we devised a formula that incorporates a priori-computed, replicate-based information on probe set- and intensity-specific variability in determination of expression changes even without technical replicates. Conclusion The strategy of incorporating probe set-specific variability is superior to analysis based on arbitrary fold-change thresholds. We recommend its incorporation to any computation of gene expression changes using high-density DNA microarrays. A Java application implementing our T-score is available at http://www.sadovsky.wustl.edu/tscore.html.
Heendeniya, Ravindra G; Yu, Peiqiang
2017-03-20
Alfalfa ( Medicago sativa L.) genotypes transformed with Lc-bHLH and Lc transcription genes were developed with the intention of stimulating proanthocyanidin synthesis in the aerial parts of the plant. To our knowledge, there are no studies on the effect of single-gene and two-gene transformation on chemical functional groups and molecular structure changes in these plants. The objective of this study was to use advanced molecular spectroscopy with multivariate chemometrics to determine chemical functional group intensity and molecular structure changes in alfalfa plants when co-expressing Lc-bHLH and C1-MYB transcriptive flavanoid regulatory genes in comparison with non-transgenic (NT) and AC Grazeland (ACGL) genotypes. The results showed that compared to NT genotype, the presence of double genes ( Lc and C1 ) increased ratios of both the area and peak height of protein structural Amide I/II and the height ratio of α-helix to β-sheet. In carbohydrate-related spectral analysis, the double gene-transformed alfalfa genotypes exhibited lower peak heights at 1370, 1240, 1153, and 1020 cm -1 compared to the NT genotype. Furthermore, the effect of double gene transformation on carbohydrate molecular structure was clearly revealed in the principal component analysis of the spectra. In conclusion, single or double transformation of Lc and C1 genes resulted in changing functional groups and molecular structure related to proteins and carbohydrates compared to the NT alfalfa genotype. The current study provided molecular structural information on the transgenic alfalfa plants and provided an insight into the impact of transgenes on protein and carbohydrate properties and their molecular structure's changes.
Cell-Specific PEAR1 Methylation Studies Reveal a Locus that Coordinates Expression of Multiple Genes
Directory of Open Access Journals (Sweden)
Benedetta Izzi
2018-04-01
Full Text Available Chromosomal interactions connect distant enhancers and promoters on the same chromosome, activating or repressing gene expression. PEAR1 encodes the Platelet-Endothelial Aggregation Receptor 1, a contact receptor involved in platelet function and megakaryocyte and endothelial cell proliferation. PEAR1 expression during megakaryocyte differentiation is controlled by DNA methylation at its first CpG island. We identified a PEAR1 cell-specific methylation sensitive region in endothelial cells and megakaryocytes that showed strong chromosomal interactions with ISGL20L2, RRNAD1, MRLP24, HDGF and PRCC, using available promoter capture Hi-C datasets. These genes are involved in ribosome processing, protein synthesis, cell cycle and cell proliferation. We next studied the methylation and expression profile of these five genes in Human Umbilical Vein Endothelial Cells (HUVECs and megakaryocyte precursors. While cell-specific PEAR1 methylation corresponded to variability in expression for four out of five genes, no methylation change was observed in their promoter regions across cell types. Our data suggest that PEAR1 cell-type specific methylation changes may control long distance interactions with other genes. Further studies are needed to show whether such interaction data might be relevant for the genome-wide association data that showed a role for non-coding PEAR1 variants in the same region and platelet function, platelet count and cardiovascular risk.
Dumeige, Laurence; Storey, Caroline; Decourtye, Lyvianne; Nehlich, Melanie; Lhadj, Christophe; Viengchareun, Say; Kappeler, Laurent; Lombès, Marc; Martinerie, Laetitia
2017-01-01
Sex differences have been identified in various biological processes, including hypertension. The mineralocorticoid signaling pathway is an important contributor to early arterial hypertension, however its sex-specific expression has been scarcely studied, particularly with respect to the kidney. Basal systolic blood pressure (SBP) and heart rate (HR) were measured in adult male and female mice. Renal gene expression studies of major players of mineralocorticoid signaling were performed at different developmental stages in male and female mice using reverse transcription quantitative PCR (RT-qPCR), and were compared to those of the same genes in the lung, another mineralocorticoid epithelial target tissue that regulates ion exchange and electrolyte balance. The role of sex hormones in the regulation of these genes was also investigated in differentiated KC3AC1 renal cells. Additionally, renal expression of the 11 β-hydroxysteroid dehydrogenase type 2 (11βHSD2) protein, a regulator of mineralocorticoid specificity, was measured by immunoblotting and its activity was indirectly assessed in the plasma using liquid-chromatography coupled to mass spectrometry in tandem (LC-MSMS) method. SBP and HR were found to be significantly lower in females compared to males. This was accompanied by a sex- and tissue-specific expression profile throughout renal development of the mineralocorticoid target genes serum and glucocorticoid-regulated kinase 1 (Sgk1) and glucocorticoid-induced leucine zipper protein (Gilz), together with Hsd11b2, Finally, the implication of sex hormones in this sex-specific expression profile was demonstrated in vitro, most notably for Gilz mRNA expression. We demonstrate a tissue-specific, sex-dependent and developmentally-regulated pattern of expression of the mineralocorticoid pathway that could have important implications in physiology and pathology. PMID:28230786
Directory of Open Access Journals (Sweden)
Juan Diego Gaitán-Espitia
Full Text Available The complete sequences of three mitochondrial genomes from the land snail Cornu aspersum were determined. The mitogenome has a length of 14050 bp, and it encodes 13 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes. It also includes nine small intergene spacers, and a large AT-rich intergenic spacer. The intra-specific divergence analysis revealed that COX1 has the lower genetic differentiation, while the most divergent genes were NADH1, NADH3 and NADH4. With the exception of Euhadra herklotsi, the structural comparisons showed the same gene order within the family Helicidae, and nearly identical gene organization to that found in order Pulmonata. Phylogenetic reconstruction recovered Basommatophora as polyphyletic group, whereas Eupulmonata and Pulmonata as paraphyletic groups. Bayesian and Maximum Likelihood analyses showed that C. aspersum is a close relative of Cepaea nemoralis, and with the other Helicidae species form a sister group of Albinaria caerulea, supporting the monophyly of the Stylommatophora clade.
Directory of Open Access Journals (Sweden)
Rebeccah J Katzenberger
Full Text Available To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE. The TCE functions in the 5' untranslated region of Mst(3CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and
Katzenberger, Rebeccah J; Rach, Elizabeth A; Anderson, Ashley K; Ohler, Uwe; Wassarman, David A
2012-01-01
To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE). The TCE functions in the 5' untranslated region of Mst(3)CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp) genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID) subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and understanding the
Bayesian model to detect phenotype-specific genes for copy number data
Directory of Open Access Journals (Sweden)
González Juan R
2012-06-01
Full Text Available Abstract Background An important question in genetic studies is to determine those genetic variants, in particular CNVs, that are specific to different groups of individuals. This could help in elucidating differences in disease predisposition and response to pharmaceutical treatments. We propose a Bayesian model designed to analyze thousands of copy number variants (CNVs where only few of them are expected to be associated with a specific phenotype. Results The model is illustrated by analyzing three major human groups belonging to HapMap data. We also show how the model can be used to determine specific CNVs related to response to treatment in patients diagnosed with ovarian cancer. The model is also extended to address the problem of how to adjust for confounding covariates (e.g., population stratification. Through a simulation study, we show that the proposed model outperforms other approaches that are typically used to analyze this data when analyzing common copy-number polymorphisms (CNPs or complex CNVs. We have developed an R package, called bayesGen, that implements the model and estimating algorithms. Conclusions Our proposed model is useful to discover specific genetic variants when different subgroups of individuals are analyzed. The model can address studies with or without control group. By integrating all data in a unique model we can obtain a list of genes that are associated with a given phenotype as well as a different list of genes that are shared among the different subtypes of cases.
Directory of Open Access Journals (Sweden)
Hong Lu
Full Text Available Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown.To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage.Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small
Sex-specific gonadal and gene expression changes throughout development in fathead minnow
Although fathead minnows (Pimephales promelas) are commonly used as a model fish in endocrine disruption studies, none have characterized sex-specific baseline expression of genes involved in sex differentiation during development in this species. Using a sex-linked DNA marker t...
Structure and chromosomal localization of the human renal kallikrein gene
International Nuclear Information System (INIS)
Evans, B.A.; Yun, Z.X.; Close, J.A.
1988-01-01
Glandular kallikreins are a family of proteases encoded by a variable number of genes in different mammalian species. In all species examined, however, one particular kallikrein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. This kallikrein is found in the kidney, pancreas, and salivary gland, showing a unique pattern of tissue-specific expression relative to other members of the family. The authors have isolated a genomic clone carrying the human renal kallikrein gene and compared the nucleotide sequence of its promoter region with those of the mouse renal kallikrein gene and another mouse kallikrein gene expressed in a distinct cell type. They find four sequence elements conserved between renal kallikrein genes from the two species. They have also shown that the human gene is localized to 19q13, a position analogous to that of the kallikrein gene family on mouse chromosome 7
Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells
Soucie, E.L.; Weng, Z.; Geirsdottir, L.; Molawi, K.; Maurizio, J.; Fenouil, R.; Mossadegh-Keller, N.; Gimenez, G.; VanHille, L.; Beniazza, M.; Favret, J.; Berruyer, C.; Perrin, P.; Hacohen, N.; Andrau, J.C.
2016-01-01
Differentiated macrophages can self-renew in tissues and expand long-term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network controlling self-renewal. Single cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down...
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Directory of Open Access Journals (Sweden)
Ryan Joseph F
2011-01-01
Full Text Available Abstract Background Mutations in the Otopetrin 1 gene (Otop1 in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH subtype 1G (Ush1g, both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF, a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq data in mouse and human embryonic stem (ES cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s of Ush1g and Otop in developmental pathways.
Gene expression profiling in autoimmune diseases: chronic inflammation or disease specific patterns?
DEFF Research Database (Denmark)
Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo
2007-01-01
) patients and healthy individuals were specific for the arthritic process or likewise altered in other chronic inflammatory diseases such as chronic autoimmune thyroiditis (Hashimoto's thyroiditis, HT) and inflammatory bowel disease (IBD). Using qPCR for 18 RA-discriminative genes, there were no significant...
Firnhaber, Christopher; Hammarlund, Marc
2013-11-01
Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.
Li, Honglei; Thiyagarajan, Vengatesen; Qian, Pei Yuan
2010-01-01
Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.
Li, Honglei
2010-06-01
Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.
WebScipio: An online tool for the determination of gene structures using protein sequences
Directory of Open Access Journals (Sweden)
Waack Stephan
2008-09-01
Full Text Available Abstract Background Obtaining the gene structure for a given protein encoding gene is an important step in many analyses. A software suited for this task should be readily accessible, accurate, easy to handle and should provide the user with a coherent representation of the most probable gene structure. It should be rigorous enough to optimise features on the level of single bases and at the same time flexible enough to allow for cross-species searches. Results WebScipio, a web interface to the Scipio software, allows a user to obtain the corresponding coding sequence structure of a here given a query protein sequence that belongs to an already assembled eukaryotic genome. The resulting gene structure is presented in various human readable formats like a schematic representation, and a detailed alignment of the query and the target sequence highlighting any discrepancies. WebScipio can also be used to identify and characterise the gene structures of homologs in related organisms. In addition, it offers a web service for integration with other programs. Conclusion WebScipio is a tool that allows users to get a high-quality gene structure prediction from a protein query. It offers more than 250 eukaryotic genomes that can be searched and produces predictions that are close to what can be achieved by manual annotation, for in-species and cross-species searches alike. WebScipio is freely accessible at http://www.webscipio.org.
Identification of Enzyme Genes Using Chemical Structure Alignments of Substrate-Product Pairs.
Moriya, Yuki; Yamada, Takuji; Okuda, Shujiro; Nakagawa, Zenichi; Kotera, Masaaki; Tokimatsu, Toshiaki; Kanehisa, Minoru; Goto, Susumu
2016-03-28
Although there are several databases that contain data on many metabolites and reactions in biochemical pathways, there is still a big gap in the numbers between experimentally identified enzymes and metabolites. It is supposed that many catalytic enzyme genes are still unknown. Although there are previous studies that estimate the number of candidate enzyme genes, these studies required some additional information aside from the structures of metabolites such as gene expression and order in the genome. In this study, we developed a novel method to identify a candidate enzyme gene of a reaction using the chemical structures of the substrate-product pair (reactant pair). The proposed method is based on a search for similar reactant pairs in a reference database and offers ortholog groups that possibly mediate the given reaction. We applied the proposed method to two experimentally validated reactions. As a result, we confirmed that the histidine transaminase was correctly identified. Although our method could not directly identify the asparagine oxo-acid transaminase, we successfully found the paralog gene most similar to the correct enzyme gene. We also applied our method to infer candidate enzyme genes in the mesaconate pathway. The advantage of our method lies in the prediction of possible genes for orphan enzyme reactions where any associated gene sequences are not determined yet. We believe that this approach will facilitate experimental identification of genes for orphan enzymes.
Directory of Open Access Journals (Sweden)
Nelle Lambert
2011-03-01
Full Text Available The developmental mechanisms through which the cerebral cortex increased in size and complexity during primate evolution are essentially unknown. To uncover genetic networks active in the developing cerebral cortex, we combined three-dimensional reconstruction of human fetal brains at midgestation and whole genome expression profiling. This novel approach enabled transcriptional characterization of neurons from accurately defined cortical regions containing presumptive Broca and Wernicke language areas, as well as surrounding associative areas. We identified hundreds of genes displaying differential expression between the two regions, but no significant difference in gene expression between left and right hemispheres. Validation by qRTPCR and in situ hybridization confirmed the robustness of our approach and revealed novel patterns of area- and layer-specific expression throughout the developing cortex. Genes differentially expressed between cortical areas were significantly associated with fast-evolving non-coding sequences harboring human-specific substitutions that could lead to divergence in their repertoires of transcription factor binding sites. Strikingly, while some of these sequences were accelerated in the human lineage only, many others were accelerated in chimpanzee and/or mouse lineages, indicating that genes important for cortical development may be particularly prone to changes in transcriptional regulation across mammals. Genes differentially expressed between cortical regions were also enriched for transcriptional targets of FoxP2, a key gene for the acquisition of language abilities in humans. Our findings point to a subset of genes with a unique combination of cortical areal expression and evolutionary patterns, suggesting that they play important roles in the transcriptional network underlying human-specific neural traits.
Directory of Open Access Journals (Sweden)
Shimpei Morimoto
2018-03-01
Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after
Biedler, James K.; Qi, Yumin; Pledger, David; Macias, Vanessa M.; James, Anthony A.; Tu, Zhijian
2014-01-01
Anopheles stephensi is a principal vector of urban malaria on the Indian subcontinent and an emerging model for molecular and genetic studies of mosquito biology. To enhance our understanding of female mosquito reproduction, and to develop new tools for basic research and for genetic strategies to control mosquito-borne infectious diseases, we identified 79 genes that displayed previtellogenic germline-specific expression based on RNA-Seq data generated from 11 life stage–specific and sex-specific samples. Analysis of this gene set provided insights into the biology and evolution of female reproduction. Promoters from two of these candidates, vitellogenin receptor and nanos, were used in independent transgenic cassettes for the expression of artificial microRNAs against suspected mosquito maternal-effect genes, discontinuous actin hexagon and myd88. We show these promoters have early germline-specific expression and demonstrate 73% and 42% knockdown of myd88 and discontinuous actin hexagon mRNA in ovaries 48 hr after blood meal, respectively. Additionally, we demonstrate maternal-specific delivery of mRNA and protein to progeny embryos. We discuss the application of this system of maternal delivery of mRNA/miRNA/protein in research on mosquito reproduction and embryonic development, and for the development of a gene drive system based on maternal-effect dominant embryonic arrest. PMID:25480960
Specificity of Structural Assessment of Knowledge
Trumpower, David L.; Sharara, Harold; Goldsmith, Timothy E.
2010-01-01
This study examines the specificity of information provided by structural assessment of knowledge (SAK). SAK is a technique which uses the Pathfinder scaling algorithm to transform ratings of concept relatedness into network representations (PFnets) of individuals' knowledge. Inferences about individuals' overall domain knowledge based on the…
Gene-Specific-Candidate-Driven Study to decipher Genetic Predisposition to Rotavirus Infection
Directory of Open Access Journals (Sweden)
Kshitija Rane-Yadav
2017-10-01
Full Text Available Recent report of WHO shows 113000 children in India succumb to death due to Rotavirus diarrhea. Lack of knowledge about pathogenesis of virus has led to lack of therapy for severely infected patients. Previous studies have found that, animal rotavirus requires sialyl glycan moieties on cell surface for pathogenesis. Present study states that human rotaviruses also follows same path and this specificity of virus leads to host genetic predisposition for the infection as well as the disease. Two hundred children less than 5 years of age clinically suspected of viral diarrhea were screened for rotavirus infection. EDTA blood was processed for analyzing DNA sequences of various fucosyltransferase genes. Lewis antigens which are secretory form of ABO Histo Blood Group Antigens were correlated with the genotype of patient. Genetics of HBGA secretion, particularly, basis of Leb expression manifested by fucosyltransferase-2 enzyme was studied in healthy individuals and was compared in cases of rotavirus positive and negative diarrhea. Positive clinical isolates with various genotypes were purified from stool samples and gene for VP4 - surface spike protein was sequenced. Using Bioinformatics interphase, three dimensional protein structures were modeled and their functional domains were analyzed. All these modeled proteins were docked with Leb HBGA (Lewis-b Histo Blood Group Antigens using molecular docking software. In present study, to investigate possible association of the rotavirus with host genome, we screened highly suspected genes involved in expression of glycoproteins on enterocytes. This study performed for prevalent Indian strains of rotaviruses provides possible evidence that, VP8 domain of VP4 spike protein utilizes Leb surface antigen for attachment and entry to enterocytes in the intestine. The FUT2 and FUT3 gene has been found to show significant association with the rotavirus infection hence can serve as a biomarker for genetic
Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng
2017-11-13
The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly
Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong
2018-03-01
Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.
Johnston, Iain G; Williams, Ben P
2016-02-24
Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Jenssen, Håvard; Mehrabian, Mohadeseh; Kyani, Anahita
2012-01-01
Defining the role of calcitonin gene-related peptide in migraine pathogenesis could lead to the application of calcitonin gene-related peptide antagonists as novel migraine therapeutics. In this work, quantitative structure-activity relationship modeling of biological activities of a large range...... of calcitonin gene-related peptide antagonists was performed using a panel of physicochemical descriptors. The computational studies evaluated different variable selection techniques and demonstrated shuffling stepwise multiple linear regression to be superior over genetic algorithm-multiple linear regression....... The linear quantitative structure-activity relationship model revealed better statistical parameters of cross-validation in comparison with the non-linear support vector regression technique. Implementing only five peptide descriptors into this linear quantitative structure-activity relationship model...
Kidney-specific Sonoporation-mediated Gene Transfer.
Ishida, Ryo; Kami, Daisuke; Kusaba, Tetsuro; Kirita, Yuhei; Kishida, Tsunao; Mazda, Osam; Adachi, Takaomi; Gojo, Satoshi
2016-02-01
Sonoporation can deliver agents to target local organs by systemic administration, while decreasing the associated risk of adverse effects. Sonoporation has been used for a variety of materials and in a variety of organs. Herein, we demonstrated that local sonoporation to the kidney can offer highly efficient transfer of oligonucleotides, which were systemically administrated to the tubular epithelium with high specificity. Ultrasonic wave irradiation to the kidney collapsed the microbubbles and transiently affected the glomerular filtration barrier and increased glomerular permeability. Oligonucleotides were passed through the barrier all at once and were absorbed throughout the tubular epithelium. Tumor necrosis factor alpha (TNFα), which plays a central role in renal ischemia-reperfusion injury, was targeted using small interfering RNA (siRNA) with renal sonoporation in a murine model. The reduction of TNFα expression after single gene transfer significantly inhibited the expression of kidney injury markers, suggesting that systemic administration of siRNA under temporary and local sonoporation could be applicable in the clinical setting of ischemic acute kidney injury.
Kaneko-Ishino, Tomoko; Ishino, Fumitoshi
2015-01-01
Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is "mammalian-specific genomic functions", a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of "mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons", based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes.
Specific-structured lipids: nutritional perspectives and production potentials
DEFF Research Database (Denmark)
Xu, Xuebing; Høy, Carl-Erik; Balchen, Steen
1997-01-01
Structured lipids are referring to any triacylglycerols containing both long chain fatty acids (mostly essential fatty acids) and medium or short chain fatty acids. In case of specific-structured lipids (SSLs), each group of fatty acids locates specifically at sn-2 or -1.3 positions of the glycerol...... backbone. Recently the nutritional perspectives of this kind of lipids attract many interests. This causes an increasing interest in the production of them by lipase-catalyzed interesterification. One of the advantages of lipase method over chemical ones is that SSLs can be produced with particular fatty...
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Structure of the human hepatic triglyceride lipase gene
International Nuclear Information System (INIS)
Cai, Shengjian; Wong, D.M.; Chen, Sanhwan; Chan, L.
1989-01-01
The structure of the human hepatic triglyceride lipase gene was determined from multiple cosmid clones. All the exons, exon-intron junctions, and 845 bp of the 5' and 254 bp of the 3' flanking DNA were sequenced. Comparison of the exon sequences to three previously published cDNA sequences revealed differences in the sequence of the codons for residue 133, 193, 202, and 234 that may represent sequence polymorphisms. By primer extension, hepatic lipase mRNA initiates at an adenine 77 bases upstream of the translation initiation site. The hepatic lipase gene spans over 60 kb containing 9 exons and 8 introns, the latter being all located within the region encoding the mature protein. The exons are all of average size (118-234 bp). Exon 1 encodes the signal peptide, exon 4, a region that binds to the lipoprotein substrate, and exon 5, an evolutionarily highly conserved region of potential catalytic function, and exons 6 and 9 encode sequences rich in basic amino acids thought to be important in anchoring the enzyme to the endothelial surface by interacting with acidic domains of the surface glycosaminoglycans. The human lipoprotein lipase gene has been recently reported to have an identical exon-intron organization containing the analogous structural domains. The observations strongly support the common evolutionary origin of these two lipolytic enzymes
Directory of Open Access Journals (Sweden)
Zhi Zou
Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.
In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer
Energy Technology Data Exchange (ETDEWEB)
Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi
2013-10-04
Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.
In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer
International Nuclear Information System (INIS)
Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi
2013-01-01
Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
International Nuclear Information System (INIS)
Reue, K.; Leff, T.; Breslow, J.L.
1988-01-01
Apolipoprotein CIII (apoCIII) is a major protein constituent of triglyceride-rich lipoproteins and is synthesized primarily in the liver. Cis-acting DNA elements required for liver-specific apoCIII gene transcription were identified with transient expression assays in the human hepatoma (HepG2) and epithelial carcinoma (HeLa) cell lines. In liver cells, 821 nucleotides of the human apoCIII gene 5'-flanking sequence were required for maximum levels of gene expression, while the proximal 110 nucleotides alone were sufficient. No expression was observed in similar studies with HeLa cells. The level of expression was modulated by a combination of positive and negative cis-acting sequences, which interact with distinct sets of proteins from liver and HeLa cell nuclear extracts. The proximal positive regulatory region shares homology with similarly located sequences of other genes strongly expressed in the liver, including α 1 -antitrypsin and other apolipoprotein genes. The negative regulatory region is striking homologous to the human β-interferon gene regulatory element. The distal positive region shares homology with some viral enhancers and has properties of a tissue-specific enhancer. The regulation of the apoCIII gene is complex but shares features with other genes, suggesting shuffling of regulatory elements as a common mechanism for cell type-specific gene expression
Zhang, Yun; Liu, Xiaomei; Zhang, Jinju; Zhang, Chun
2016-09-01
To develop a site-specific integration strategy for CAR-T engineering by using a non-viral vector dependent on adeno-associated viral (AAV) genome, which tends to be integrated into AAVS1 site with the help of its Rep proteins. AAV-dependent vectors were produced in Sf9 cells. Structural analyses revealed the vector as covalently close-ended, linear duplex molecules, which was termed "CELiD" DNA. A plasmid CMV-Rep was constructed to express the integrases Rep78 and Rep68. Jurkat cells were co-electroporated with "CELiD" DNA and plasmid CMV-Rep in order to specifically integrate CAR gene into AAVS1 site. We examined 71 stably transfected Jurkat clones by nested PCR, sequencing and southern blotting, of which 30 clones bore CAR gene within AAVS1 site. The site-specific integration efficiency was nearly 42.2 %. The AAV-dependent vector preferentially integrated CAR into AAVS1 site, which could be further used in human T cell modification and enhance the security of CAR-T therapy.
Improvisation in evolution of genes and genomes: whose structure is it anyway?
Shakhnovich, Boris E; Shakhnovich, Eugene I
2008-06-01
Significant progress has been made in recent years in a variety of seemingly unrelated fields such as sequencing, protein structure prediction, and high-throughput transcriptomics and metabolomics. At the same time, new microscopic models have been developed that made it possible to analyze the evolution of genes and genomes from first principles. The results from these efforts enable, for the first time, a comprehensive insight into the evolution of complex systems and organisms on all scales--from sequences to organisms and populations. Every newly sequenced genome uncovers new genes, families, and folds. Where do these new genes come from? How do gene duplication and subsequent divergence of sequence and structure affect the fitness of the organism? What role does regulation play in the evolution of proteins and folds? Emerging synergism between data and modeling provides first robust answers to these questions.
A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.
Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W
2013-05-01
A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.
Oh, Dongha
2010-09-10
The genome of Thellungiella parvula, a halophytic relative of Arabidopsis (Arabidopsis thaliana), is being assembled using Roche-454 sequencing. Analyses of a 10-Mb scaffold revealed synteny with Arabidopsis, with recombination and inversion and an uneven distribution of repeat sequences. T. parvula genome structure and DNA sequences were compared with orthologous regions from Arabidopsis and publicly available bacterial artificial chromosome sequences from Thellungiella salsuginea (previously Thellungiella halophila). The three-way comparison of sequences, from one abiotic stress-sensitive species and two tolerant species, revealed extensive sequence conservation and microcolinearity, but grouping Thellungiella species separately from Arabidopsis. However, the T. parvula segments are distinguished from their T. salsuginea counterparts by a pronounced paucity of repeat sequences, resulting in a 30% shorter DNA segment with essentially the same gene content in T. parvula. Among the genes is SALT OVERLY SENSITIVE1 (SOS1), a sodium/proton antiporter, which represents an essential component of plant salinity stress tolerance. Although the SOS1 coding region is highly conserved among all three species, the promoter regions show conservation only between the two Thellungiella species. Comparative transcript analyses revealed higher levels of basal as well as salt-induced SOS1 expression in both Thellungiella species as compared with Arabidopsis. The Thellungiella species and other halophytes share conserved pyrimidine-rich 5\\' untranslated region proximal regions of SOS1 that are missing in Arabidopsis. Completion of the genome structure of T. parvula is expected to highlight distinctive genetic elements underlying the extremophile lifestyle of this species. © American Society of Plant Biologists.
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
The hypoxic proteome is influenced by gene-specific changes in mRNA translation
International Nuclear Information System (INIS)
Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.
2005-01-01
Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Dos Santos, Helena G; Siltberg-Liberles, Jessica
2016-09-19
One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J
2015-10-01
FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental
Isolation and identification of differentially expressed genes between ...
African Journals Online (AJOL)
Plants have evolved sophisticated molecular defense mechanisms in order to survive disease conditions. So far, a number of pathogen resistance (R) genes have been reported in plants. These R genes are thought to be involved in activating the signals that lead to disease resistance. The structural specificity of R genes ...
Directory of Open Access Journals (Sweden)
Qiang Zhang
Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.
Directory of Open Access Journals (Sweden)
Sandra J Kuhlman
2008-04-01
Full Text Available We describe a method that combines Cre-recombinase knockin mice and viral-mediated gene transfer to genetically label and functionally manipulate specific neuron types in the mouse brain. We engineered adeno-associated viruses (AAVs that express GFP, dsRedExpress, or channelrhodopsin (ChR2 upon Cre/loxP recombination-mediated removal of a transcription-translation STOP cassette. Fluorescent labeling was sufficient to visualize neuronal structures with synaptic resolution in vivo, and ChR2 expression allowed light activation of neuronal spiking. The structural dynamics of a specific class of neocortical neuron, the parvalbumin-containing (Pv fast-spiking GABAergic interneuron, was monitored over the course of a week. We found that although the majority of Pv axonal boutons were stable in young adults, bouton additions and subtractions on axonal shafts were readily observed at a rate of 10.10% and 9.47%, respectively, over 7 days. Our results indicate that Pv inhibitory circuits maintain the potential for structural re-wiring in post-adolescent cortex. With the generation of an increasing number of Cre knockin mice and because viral transfection can be delivered to defined brain regions at defined developmental stages, this strategy represents a general method to systematically visualize the structure and manipulate the function of different cell types in the mouse brain.
Horiuchi, Youko
2015-12-23
Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression
PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes.
Soto-Feliciano, Yadira M; Bartlebaugh, Jordan M E; Liu, Yunpeng; Sánchez-Rivera, Francisco J; Bhutkar, Arjun; Weintraub, Abraham S; Buenrostro, Jason D; Cheng, Christine S; Regev, Aviv; Jacks, Tyler E; Young, Richard A; Hemann, Michael T
2017-05-15
Developmental and lineage plasticity have been observed in numerous malignancies and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the plant homeodomain finger protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alteration of the chromatin landscape at the transcriptional start sites of B-cell- and T-cell-specific factors. Additionally, Phf6 KO cells show significant down-regulation of genes involved in the development and function of normal B cells, show up-regulation of genes involved in T-cell signaling, and give rise to mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. © 2017 Soto-Feliciano et al.; Published by Cold Spring Harbor Laboratory Press.
International Nuclear Information System (INIS)
Fernández-Vega, Iván; García, Olivia; Crespo, Ainara; Castañón, Sonia; Menéndez, Primitiva; Astudillo, Aurora; Quirós, Luis M
2013-01-01
The expression of a specific set of genes controls the different structures of heparan sulfate proteoglycans (HSPGs), which are involved in the growth, invasion and metastatic properties of cancerous cells. The purpose of this study is to increase knowledge of HSPG alterations in breast cancer. Twenty-three infiltrating ductal adenocarcinomas (IDCs), both metastatic and non-metastatic were studied. A transcriptomic approach to the structure of heparan sulfate (HS) chains was used, employing qPCR to analyze both the expression of the enzymes involved in their biosynthesis and editing, as well as the proteoglycan core proteins. Since some of these proteoglycans can also carry chondroitin sulfate chains, we extended the study to include the genes involved in the biosynthesis of these glycosaminoglycans. Histochemical techniques were also used to analyze tissular expression of particular genes showing significant expression differences, of potential interest. No significant change in transcription was detected in approximately 70% of analyzed genes. However, 13 demonstrated changes in both tumor types (40% showing more intense deregulation in the metastatic), while 5 genes showed changes only in non-metastatic tumors. Changes were related to 3 core proteins: overexpression of syndecan-1 and underexpression of glypican-3 and perlecan. HS synthesis was affected by lower levels of some 3-O-sulfotransferase transcripts, the expression of NDST4 and, only in non metastatic tumors, higher levels of extracellular sulfatases. Furthermore, the expression of chondroitin sulfate also was considerably affected, involving both the synthesis of the saccharidic chains and sulfations at all locations. However, the pro-metastatic enzyme heparanase did not exhibit significant changes in mRNA expression, although in metastatic tumors it appeared related to increased levels of the most stable form of mRNA. Finally, the expression of heparanase 2, which displays anti-metastatic features
Structure models of G72, the product of a susceptibility gene to schizophrenia.
Kato, Yusuke; Fukui, Kiyoshi
2017-02-01
The G72 gene is one of the most susceptible genes to schizophrenia and is contained exclusively in the genomes of primates. The product of the G72 gene modulates the activity of D-amino acid oxidase (DAO) and is a small protein prone to aggregate, which hampers its structural studies. In addition, lack of a known structure of a homologue makes it difficult to use the homology modelling method for the prediction of the structure. Thus, we first developed a hybrid ab initio approach for small proteins prior to the prediction of the structure of G72. The approach uses three known ab initio algorithms. To evaluate the hybrid approach, we tested our prediction of the structure of the amino acid sequences whose structures were already solved and compared the predicted structures with the experimentally solved structures. Based on these comparisons, the average accuracy of our approach was calculated to be ∼5 Å. We then applied the approach to the sequence of G72 and successfully predicted the structures of the N- and C-terminal domains (ND and CD, respectively) of G72. The predicted structures of ND and CD were similar to membrane-bound proteins and adaptor proteins, respectively. © The Authors 2016. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Recognizing genes and other components of genomic structure
Energy Technology Data Exchange (ETDEWEB)
Burks, C. (Los Alamos National Lab., NM (USA)); Myers, E. (Arizona Univ., Tucson, AZ (USA). Dept. of Computer Science); Stormo, G.D. (Colorado Univ., Boulder, CO (USA). Dept. of Molecular, Cellular and Developmental Biology)
1991-01-01
The Aspen Center for Physics (ACP) sponsored a three-week workshop, with 26 scientists participating, from 28 May to 15 June, 1990. The workshop, entitled Recognizing Genes and Other Components of Genomic Structure, focussed on discussion of current needs and future strategies for developing the ability to identify and predict the presence of complex functional units on sequenced, but otherwise uncharacterized, genomic DNA. We addressed the need for computationally-based, automatic tools for synthesizing available data about individual consensus sequences and local compositional patterns into the composite objects (e.g., genes) that are -- as composite entities -- the true object of interest when scanning DNA sequences. The workshop was structured to promote sustained informal contact and exchange of expertise between molecular biologists, computer scientists, and mathematicians. No participant stayed for less than one week, and most attended for two or three weeks. Computers, software, and databases were available for use as electronic blackboards'' and as the basis for collaborative exploration of ideas being discussed and developed at the workshop. 23 refs., 2 tabs.
International Nuclear Information System (INIS)
Spelsberg, T.; Hora, J.; Horton, M.; Goldberger, A.; Littlefield, B.; Seelke, R.; Toyoda, H.
1987-01-01
Steroid hormones circulate in the blood and are taken by target cells via complexes with intracellular binding proteins termed receptors, that are hormone and tissue specific. Each receptor binds it specific steroid with very high affinity, having an equilibrium dissociation constant (K/sub d/) in the range of 10 -9 to 10 -10 M. Once bound by their specific steroid hormones, the steroid receptors undergo a conformational change which allows them to bind with high affinity to sites on chromatin, termed nuclear acceptor sites. There are estimated 5,000 to 10,000 of these sites expressed with an equal number not expressed (''masked'') in intact chromatin. The result of the binding to nuclear acceptor sites is an alteration of gene transcription or, in some cases, gene expression as measured by the changing levels of specific RNAs and proteins in that target tissue. Each steroid regulates specific effects on the RNA and protein profiles. The chronology of the above mechanism of action after injection of radiolabelled steroid as is follows: Steroid-receptor complex formation (1 minute), nuclear acceptor sites (2 minutes), effects on RNA synthesis (10 to 30 minutes), and finally the changing protein profiles via changes in protein synthesis and protein turnover (1 to 6 hours). Thus steroid receptors represent one of the first identified intracellular gene regulation proteins. The receptor molecules themselves are regulated by the presence or absence of the steroid molecule
Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.
Vacchi-Suzzi, Caterina; Hahne, Florian; Scheubel, Philippe; Marcellin, Magali; Dubost, Valerie; Westphal, Magdalena; Boeglen, Catherine; Büchmann-Møller, Stine; Cheung, Ming Sin; Cordier, André; De Benedetto, Christopher; Deurinck, Mark; Frei, Moritz; Moulin, Pierre; Oakeley, Edward; Grenet, Olivier; Grevot, Armelle; Stull, Robert; Theil, Diethilde; Moggs, Jonathan G; Marrer, Estelle; Couttet, Philippe
2013-01-01
MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves) in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*). The relative abundance of myocardium-enriched (miR-1) and valve-enriched (miR-125b-5p and miR-204) microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.
Heart structure-specific transcriptomic atlas reveals conserved microRNA-mRNA interactions.
Directory of Open Access Journals (Sweden)
Caterina Vacchi-Suzzi
Full Text Available MicroRNAs are short non-coding RNAs that regulate gene expression at the post-transcriptional level and play key roles in heart development and cardiovascular diseases. Here, we have characterized the expression and distribution of microRNAs across eight cardiac structures (left and right ventricles, apex, papillary muscle, septum, left and right atrium and valves in rat, Beagle dog and cynomolgus monkey using microRNA sequencing. Conserved microRNA signatures enriched in specific heart structures across these species were identified for cardiac valve (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744 and myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*. The relative abundance of myocardium-enriched (miR-1 and valve-enriched (miR-125b-5p and miR-204 microRNAs was confirmed using in situ hybridization. MicroRNA-mRNA interactions potentially relevant for cardiac functions were explored using anti-correlation expression analysis and microRNA target prediction algorithms. Interactions between miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2 were identified and experimentally investigated in human pulmonary smooth muscle cells and luciferase reporter assays. In conclusion, we have generated a high-resolution heart structure-specific mRNA/microRNA expression atlas for three mammalian species that provides a novel resource for investigating novel microRNA regulatory circuits involved in cardiac molecular physiopathology.
DEFF Research Database (Denmark)
Nielsen, O; Friis, T; Kjaerulff, S
1996-01-01
Cells of Schizosaccharomyces pombe undergo mating and meiosis when starved for a nitrogen source. In this process a P and and M cell first mate to generate a diploid zygote, which subsequently enters meiosis and sporulates. The P mating type is controlled by the mat1-Pc gene at the mating type lo...... cerevisiae MCM1. The Mat1-Pc protein contains a motif characteristic for proteins that interact with MADS-box factors, suggesting that Mat-Pc and Map1 may form a heterodimer that activates the P-specific map3 gene....
DEFF Research Database (Denmark)
Feizi, Amir; Gatto, Francesco; Uhlén, Mathias
2017-01-01
Protein secretory pathway in eukaryal cells is responsible for delivering functional secretory proteins. The dysfunction of this pathway causes a range of important human diseases from congenital disorders to cancer. Despite the piled-up knowledge on the molecular biology and biochemistry level...... in specific gene families of the secretory pathway. We also inspected the potential functional link between detected extreme genes and the corresponding tissues enriched secretome. As a result, the detected extreme genes showed correlation with the enrichment of the nature and number of specific post......-translational modifications in each tissue's secretome. Our findings conciliate both the housekeeping and tissue-specific nature of the protein secretory pathway, which we attribute to a fine-tuned regulation of defined gene families to support the diversity of secreted proteins and their modifications....
DEFF Research Database (Denmark)
Yu, Xiao-Jing; Zheng, Hong-Kun; Wang, Jun
2006-01-01
related species as outgroup, it is difficult to identify human-lineage-specific changes, which is critical in delineating the biological uniqueness of humans. In this study, we conducted phylogeny-based analyses of 2633 human brain-expressed genes using rhesus macaque as the outgroup. We identified 47...... candidate genes showing strong evidence of positive selection in the human lineage. Genes with maximal expression in the brain showed a higher evolutionary rate in human than in chimpanzee. We observed that many immune-defense-related genes were under strong positive selection, and this trend was more...
Directory of Open Access Journals (Sweden)
Sarah K Meadows
2008-04-01
Full Text Available Previous work has demonstrated the potential for peripheral blood (PB gene expression profiling for the detection of disease or environmental exposures.We have sought to determine the impact of several variables on the PB gene expression profile of an environmental exposure, ionizing radiation, and to determine the specificity of the PB signature of radiation versus other genotoxic stresses. Neither genotype differences nor the time of PB sampling caused any lessening of the accuracy of PB signatures to predict radiation exposure, but sex difference did influence the accuracy of the prediction of radiation exposure at the lowest level (50 cGy. A PB signature of sepsis was also generated and both the PB signature of radiation and the PB signature of sepsis were found to be 100% specific at distinguishing irradiated from septic animals. We also identified human PB signatures of radiation exposure and chemotherapy treatment which distinguished irradiated patients and chemotherapy-treated individuals within a heterogeneous population with accuracies of 90% and 81%, respectively.We conclude that PB gene expression profiles can be identified in mice and humans that are accurate in predicting medical conditions, are specific to each condition and remain highly accurate over time.
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
Cell-Type-Specific Gene Programs of the Normal Human Nephron Define Kidney Cancer Subtypes.
Lindgren, David; Eriksson, Pontus; Krawczyk, Krzysztof; Nilsson, Helén; Hansson, Jennifer; Veerla, Srinivas; Sjölund, Jonas; Höglund, Mattias; Johansson, Martin E; Axelson, Håkan
2017-08-08
Comprehensive transcriptome studies of cancers often rely on corresponding normal tissue samples to serve as a transcriptional reference. In this study, we performed in-depth analyses of normal kidney tissue transcriptomes from the TCGA and demonstrate that the histological variability in cellularity, inherent in the kidney architecture, lead to considerable transcriptional differences between samples. This should be considered when comparing expression profiles of normal and cancerous kidney tissues. We exploited these differences to define renal-cell-specific gene signatures and used these as a framework to analyze renal cell carcinoma (RCC) ontogeny. Chromophobe RCCs express FOXI1-driven genes that define collecting duct intercalated cells, whereas HNF-regulated genes, specific for proximal tubule cells, are an integral part of clear cell and papillary RCC transcriptomes. These networks may be used as a framework for understanding the interplay between genomic changes in RCC subtypes and the lineage-defining regulatory machinery of their non-neoplastic counterparts. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Carrière, Marie; Tranchant, Isabelle; Niore, Pierre-Antoine; Byk, Gerardo; Mignet, Nathalie; Escriou, Virginie; Scherman, Daniel; Herscovici, Jean
2002-01-01
The rationale design aimed at the enhancement of cationic lipid mediated gene transfer is discussed. These improvements are based on the straight evaluation of the structure-activity relationship and on the introduction of new structures. Much attention have been given to the supramolecular structures of the lipid/DNA complexes, to the effect of serum on gene transfer and to the intracellular trafficking of the lipoplexes. Finally new avenue using reducible cationic lipids has been discussed.
The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
Directory of Open Access Journals (Sweden)
Nandina Paria
Full Text Available Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY gene catalogue was developed for the horse--an odd-toed ungulate. Using direct cDNA selection from horse testis, and sequence analysis of Y-specific BAC clones, 37 horse MSY genes/transcripts were identified. The genes were mapped to the MSY BAC contig map, characterized for copy number, analyzed for transcriptional profiles by RT-PCR, examined for the presence of ORFs, and compared to other mammalian orthologs. We demonstrate that the horse MSY harbors 20 X-degenerate genes with known orthologs in other eutherian species. The remaining 17 genes are acquired or novel and have so far been identified only in the horse or donkey Y chromosomes. Notably, 3 transcripts were found in the heterochromatic part of the Y. We show that despite substantial differences between the sequence, gene content and organization of horse and other mammalian Y chromosomes, the functions of MSY genes are predominantly related to testis and spermatogenesis. Altogether, 10 multicopy genes with testis-specific expression were identified in the horse MSY, and considered likely candidate genes for stallion fertility. The findings establish an important foundation for the study of Y-linked genetic factors governing fertility in stallions, and improve our knowledge about the evolutionary processes that have shaped Y chromosomes in different mammalian lineages.
Paria, Nandina; Raudsepp, Terje; Pearks Wilkerson, Alison J; O'Brien, Patricia C M; Ferguson-Smith, Malcom A; Love, Charles C; Arnold, Carolyn; Rakestraw, Peter; Murphy, William J; Chowdhary, Bhanu P
2011-01-01
Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY) contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY gene catalogue was developed for the horse--an odd-toed ungulate. Using direct cDNA selection from horse testis, and sequence analysis of Y-specific BAC clones, 37 horse MSY genes/transcripts were identified. The genes were mapped to the MSY BAC contig map, characterized for copy number, analyzed for transcriptional profiles by RT-PCR, examined for the presence of ORFs, and compared to other mammalian orthologs. We demonstrate that the horse MSY harbors 20 X-degenerate genes with known orthologs in other eutherian species. The remaining 17 genes are acquired or novel and have so far been identified only in the horse or donkey Y chromosomes. Notably, 3 transcripts were found in the heterochromatic part of the Y. We show that despite substantial differences between the sequence, gene content and organization of horse and other mammalian Y chromosomes, the functions of MSY genes are predominantly related to testis and spermatogenesis. Altogether, 10 multicopy genes with testis-specific expression were identified in the horse MSY, and considered likely candidate genes for stallion fertility. The findings establish an important foundation for the study of Y-linked genetic factors governing fertility in stallions, and improve our knowledge about the evolutionary processes that have shaped Y chromosomes in different mammalian lineages.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Energy Technology Data Exchange (ETDEWEB)
Khare, B.; Krishnan, V.; Rajashankar, K.R.; I-Hsiu, H.; Xin, M.; Ton-That, H.; Narayana, S.V. (Texas-HSC); (Cornell); (UAB)
2011-10-21
The assembly of pili on the cell wall of Gram-positive bacteria requires transpeptidase enzymes called sortases. In Streptococcus agalactiae, the PI-1 pilus island of strain 2603V/R encodes two pilus-specific sortases (SrtC1 and SrtC2) and three pilins (GBS80, GBS52 and GBS104). Although either pilus-specific sortase is sufficient for the polymerization of the major pilin, GBS80, incorporation of the minor pilins GBS52 and GBS104 into the pilus structure requires SrtC1 and SrtC2, respectively. The S. agalactiae housekeeping sortase, SrtA, whose gene is present at a different location and does not catalyze pilus polymerization, was shown to be involved in cell wall anchoring of pilus polymers. To understand the structural basis of sortases involved in such diverse functions, we determined the crystal structures of S. agalactiae SrtC1 and SrtA. Both enzymes are made of an eight-stranded beta-barrel core with variations in their active site architecture. SrtA exhibits a catalytic triad arrangement similar to that in Streptococcus pyogenes SrtA but different from that in Staphylococcus aureus SrtA. In contrast, the SrtC1 enzyme contains an N-terminal helical domain and a 'lid' in its putative active site, which is similar to that seen in Streptococcus pneumoniae pilus-specific sortases, although with subtle differences in positioning and composition. To understand the effect of such differences on substrate recognition, we have also determined the crystal structure of a SrtC1 mutant, in which the conserved DP(W/F/Y) motif was replaced with the sorting signal motif of GBS80, IPNTG. By comparing the structures of WT wild type SrtA and SrtC1 and the 'lid' mutant of SrtC1, we propose that structural elements within the active site and the lid may be important for defining the role of specific sortase in pili biogenesis.
Directory of Open Access Journals (Sweden)
B Khare
Full Text Available The assembly of pili on the cell wall of Gram-positive bacteria requires transpeptidase enzymes called sortases. In Streptococcus agalactiae, the PI-1 pilus island of strain 2603V/R encodes two pilus-specific sortases (SrtC1 and SrtC2 and three pilins (GBS80, GBS52 and GBS104. Although either pilus-specific sortase is sufficient for the polymerization of the major pilin, GBS80, incorporation of the minor pilins GBS52 and GBS104 into the pilus structure requires SrtC1 and SrtC2, respectively. The S. agalactiae housekeeping sortase, SrtA, whose gene is present at a different location and does not catalyze pilus polymerization, was shown to be involved in cell wall anchoring of pilus polymers. To understand the structural basis of sortases involved in such diverse functions, we determined the crystal structures of S. agalactiae SrtC1 and SrtA. Both enzymes are made of an eight-stranded beta-barrel core with variations in their active site architecture. SrtA exhibits a catalytic triad arrangement similar to that in Streptococcus pyogenes SrtA but different from that in Staphylococcus aureus SrtA. In contrast, the SrtC1 enzyme contains an N-terminal helical domain and a 'lid' in its putative active site, which is similar to that seen in Streptococcus pneumoniae pilus-specific sortases, although with subtle differences in positioning and composition. To understand the effect of such differences on substrate recognition, we have also determined the crystal structure of a SrtC1 mutant, in which the conserved DP(W/F/Y motif was replaced with the sorting signal motif of GBS80, IPNTG. By comparing the structures of WT wild type SrtA and SrtC1 and the 'lid' mutant of SrtC1, we propose that structural elements within the active site and the lid may be important for defining the role of specific sortase in pili biogenesis.
Population structure of barley landrace populations and gene-flow with modern varieties.
Directory of Open Access Journals (Sweden)
Elisa Bellucci
Full Text Available Landraces are heterogeneous plant varieties that are reproduced by farmers as populations that are subject to both artificial and natural selection. Landraces are distinguished by farmers due to their specific traits, and different farmers often grow different populations of the same landrace. We used simple sequence repeats (SSRs to analyse 12 barley landrace populations from Sardinia from two collections spanning 10 years. We analysed the population structure, and compared the population diversity of the landraces that were collected at field level (population. We used a representative pool of barley varieties for diversity comparisons and to analyse the effects of gene flow from modern varieties. We found that the Sardinian landraces are a distinct gene pool from those of both two-row and six-row barley varieties. There is also a low, but significant, mean level and population-dependent level of introgression from the modern varieties into the Sardinian landraces. Moreover, we show that the Sardinian landraces have the same level of gene diversity as the representative sample of modern commercial varieties grown in Italy in the last decades, even within population level. Thus, these populations represent crucial sources of germplasm that will be useful for crop improvement and for population genomics studies and association mapping, to identify genes, loci and genome regions responsible for adaptive variations. Our data also suggest that landraces are a source of valuable germplasm for sustainable agriculture in the context of future climate change, and that in-situ conservation strategies based on farmer use can preserve the genetic identity of landraces while allowing adaptation to local environments.
In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.
Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi
2013-10-04
Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jamie G Bates
Full Text Available To what extent might the regulation of translation contribute to differentiation programs, or to the molecular pathogenesis of cancer? Pre-B cells transformed with the viral oncogene v-Abl are suspended in an immortalized, cycling state that mimics leukemias with a BCR-ABL1 translocation, such as Chronic Myelogenous Leukemia (CML and Acute Lymphoblastic Leukemia (ALL. Inhibition of the oncogenic Abl kinase with imatinib reverses transformation, allowing progression to the next stage of B cell development. We employed a genome-wide polysome profiling assay called Gradient Encoding to investigate the extent and potential contribution of translational regulation to transformation and differentiation in v-Abl-transformed pre-B cells. Over half of the significantly translationally regulated genes did not change significantly at the level of mRNA abundance, revealing biology that might have been missed by measuring changes in transcript abundance alone. We found extensive, gene-specific changes in translation affecting genes with known roles in B cell signaling and differentiation, cancerous transformation, and cytoskeletal reorganization potentially affecting adhesion. These results highlight a major role for gene-specific translational regulation in remodeling the gene expression program in differentiation and malignant transformation.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
International Nuclear Information System (INIS)
Tucker, M.A.
1988-01-01
Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome
Neugart, Susanne; Krumbein, Angelika; Zrenner, Rita
2016-01-01
Light intensity and temperature are very important signals for the regulation of plant growth and development. Plants subjected to less favorable light or temperature conditions often respond with accumulation of secondary metabolites. Some of these metabolites have been identified as bioactive compounds, considered to exert positive effects on human health when consumed regularly. In order to test a typical range of growth parameters for the winter crop Brassica oleracea var. sabellica, plants were grown either at 400 μmol m(-2) s(-1) or 100 μmol m(-2) s(-1) at 10°C, or at 400 μmol m(-2) s(-1) with 5 or 15°C. The higher light intensity overall increased flavonol content of leaves, favoring the main quercetin glycosides, a caffeic acid monoacylated kaempferol triglycoside, and disinapoyl-gentiobiose. The higher temperature mainly increased the hydroxycinnamic acid derivative disinapoyl-gentiobiose, while at lower temperature synthesis is in favor of very complex sinapic acid acylated flavonol tetraglycosides such as kaempferol-3-O-sinapoyl-sophoroside-7-O-diglucoside. A global analysis of light and temperature dependent alterations of gene expression in B. oleracea var. sabellica leaves was performed with the most comprehensive Brassica microarray. When compared to the light experiment much less genes were differentially expressed in kale leaves grown at 5 or 15°C. A structured evaluation of differentially expressed genes revealed the expected enrichment in the functional categories of e.g. protein degradation at different light intensities or phytohormone metabolism at different temperature. Genes of the secondary metabolism namely phenylpropanoids are significantly enriched with both treatments. Thus, the genome of B. oleracea was screened for predicted genes putatively involved in the biosynthesis of flavonoids and hydroxycinnamic acid derivatives. All identified B. oleracea genes were analyzed for their most specific 60-mer oligonucleotides present on the
Directory of Open Access Journals (Sweden)
Spyros I. Papamichos
2015-01-01
Full Text Available The incidence of cancer in human is high as compared to chimpanzee. However previous analysis has documented that numerous human cancer-related genes are highly conserved in chimpanzee. Till date whether human genome includes species-specific cancer-related genes that could potentially contribute to a higher cancer susceptibility remains obscure. This study focuses on MYEOV, an oncogene encoding for two protein isoforms, reported as causally involved in promoting cancer cell proliferation and metastasis in both haematological malignancies and solid tumours. First we document, via stringent in silico analysis, that MYEOV arose de novo in Catarrhini. We show that MYEOV short-isoform start codon was evolutionarily acquired after Catarrhini/Platyrrhini divergence. Throughout the course of Catarrhini evolution MYEOV acquired a gradually elongated translatable open reading frame (ORF, a gradually shortened translation-regulatory upstream ORF, and alternatively spliced mRNA variants. A point mutation introduced in human allowed for the acquisition of MYEOV long-isoform start codon. Second, we demonstrate the precious impact of exonized transposable elements on the creation of MYEOV gene structure. Third, we highlight that the initial part of MYEOV long-isoform coding DNA sequence was under positive selection pressure during Catarrhini evolution. MYEOV represents a Primate Orphan Gene that acquired, via ORF expansion, a human-protein-specific coding potential.
Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F
2015-10-01
The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jill A. McKay
2016-10-01
Full Text Available Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or “programme”, the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.
McKay, Jill A; Xie, Long; Adriaens, Michiel; Evelo, Chris T; Ford, Dianne; Mathers, John C
2016-10-22
Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or "programme", the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated) in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated) in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.
Directory of Open Access Journals (Sweden)
Rupert W Overall
Full Text Available BACKGROUND: Adult hippocampal neurogenesis is not a single phenotype, but consists of a number of sub-processes, each of which is under complex genetic control. Interpretation of gene expression studies using existing resources often does not lead to results that address the interrelatedness of these processes. Formal structure, such as provided by ontologies, is essential in any field for comprehensive interpretation of existing knowledge but, until now, such a structure has been lacking for adult neurogenesis. METHODOLOGY/PRINCIPAL FINDINGS: We have created a resource with three components 1. A structured ontology describing the key stages in the development of adult hippocampal neural stem cells into functional granule cell neurons. 2. A comprehensive survey of the literature to annotate the results of all published reports on gene function in adult hippocampal neurogenesis (257 manuscripts covering 228 genes to the appropriate terms in our ontology. 3. An easy-to-use searchable interface to the resulting database made freely available online. The manuscript presents an overview of the database highlighting global trends such as the current bias towards research on early proliferative stages, and an example gene set enrichment analysis. A limitation of the resource is the current scope of the literature which, however, is growing by around 100 publications per year. With the ontology and database in place, new findings can be rapidly annotated and regular updates of the database will be made publicly available. CONCLUSIONS/SIGNIFICANCE: The resource we present allows relevant interpretation of gene expression screens in terms of defined stages of postnatal neuronal development. Annotation of genes by hand from the adult neurogenesis literature ensures the data are directly applicable to the system under study. We believe this approach could also serve as an example to other fields in a 'bottom-up' community effort complementing the already
Cell type-specific suppression of mechanosensitive genes by audible sound stimulation.
Kumeta, Masahiro; Takahashi, Daiji; Takeyasu, Kunio; Yoshimura, Shige H
2018-01-01
Audible sound is a ubiquitous environmental factor in nature that transmits oscillatory compressional pressure through the substances. To investigate the property of the sound as a mechanical stimulus for cells, an experimental system was set up using 94.0 dB sound which transmits approximately 10 mPa pressure to the cultured cells. Based on research on mechanotransduction and ultrasound effects on cells, gene responses to the audible sound stimulation were analyzed by varying several sound parameters: frequency, wave form, composition, and exposure time. Real-time quantitative PCR analyses revealed a distinct suppressive effect for several mechanosensitive and ultrasound-sensitive genes that were triggered by sounds. The effect was clearly observed in a wave form- and pressure level-specific manner, rather than the frequency, and persisted for several hours. At least two mechanisms are likely to be involved in this sound response: transcriptional control and RNA degradation. ST2 stromal cells and C2C12 myoblasts exhibited a robust response, whereas NIH3T3 cells were partially and NB2a neuroblastoma cells were completely insensitive, suggesting a cell type-specific response to sound. These findings reveal a cell-level systematic response to audible sound and uncover novel relationships between life and sound.
Directory of Open Access Journals (Sweden)
Tushar eDwivedi
2015-01-01
Full Text Available Bipolar disorder (BD, one of the most debilitating mental disorders, is associated with increased morbidity and mortality. Lithium is the first line of treatment option for BD and is often used for maintenance therapy. Recently, the neuroprotective action of lithium has gained tremendous attention, given that BD is associated with structural and functional abnormalities of the brain. However, the precise molecular mechanism by which lithium exerts its neuroprotective action is not clearly understood. In hippocampal neurons, the effects of lithium on neuronal viability against glutamate-induced cytotoxicity, dendritic length and number, and expression and methylation of BDNF promoter exons and expression of apoptotic regulatory genes were studied. In rat hippocampal neurons, lithium not only increased dendritic length and number, but also neuronal viability against glutamate-induced cytotoxicity. While lithium increased the expression of BDNF as well as genes associated with neuroprotection such as Bcl2 and Bcl-XL, it decreased the expression of pro-apoptotic genes Bax, Bad, and caspases 3. Interestingly, lithium activated transcription of specific exon IV to induce BDNF gene expression. This was accompanied by hypomethylation of BDNF exon IV promoter. This study delineates mechanisms by which lithium mediates its effects in protecting neurons.
Directory of Open Access Journals (Sweden)
Herington Adrian C
2007-08-01
Full Text Available Abstract Background Ghrelin is a multifunctional peptide hormone expressed in a range of normal tissues and pathologies. It has been reported that the human ghrelin gene consists of five exons which span 5 kb of genomic DNA on chromosome 3 and includes a 20 bp non-coding first exon (20 bp exon 0. The availability of bioinformatic tools enabling comparative analysis and the finalisation of the human genome prompted us to re-examine the genomic structure of the ghrelin locus. Results We have demonstrated the presence of an additional novel exon (exon -1 and 5' extensions to exon 0 and 1 using comparative in silico analysis and have demonstrated their existence experimentally using RT-PCR and 5' RACE. A revised exon-intron structure demonstrates that the human ghrelin gene spans 7.2 kb and consists of six rather than five exons. Several ghrelin gene-derived splice forms were detected in a range of human tissues and cell lines. We have demonstrated ghrelin gene-derived mRNA transcripts that do not code for ghrelin, but instead may encode the C-terminal region of full-length preproghrelin (C-ghrelin, which contains the coding region for obestatin and a transcript encoding obestatin-only. Splice variants that differed in their 5' untranslated regions were also found, suggesting a role of these regions in the post-transcriptional regulation of preproghrelin translation. Finally, several natural antisense transcripts, termed ghrelinOS (ghrelin opposite strand transcripts, were demonstrated via orientation-specific RT-PCR, 5' RACE and in silico analysis of ESTs and cloned amplicons. Conclusion The sense and antisense alternative transcripts demonstrated in this study may function as non-coding regulatory RNA, or code for novel protein isoforms. This is the first demonstration of putative obestatin and C-ghrelin specific transcripts and these findings suggest that these ghrelin gene-derived peptides may also be produced independently of preproghrelin
Directory of Open Access Journals (Sweden)
Qingzhang Du
Full Text Available In woody crop plants, the oligosaccharide components of the cell wall are essential for important traits such as bioenergy content, growth, and structural wood properties. UDP-glucuronate decarboxylase (UXS is a key enzyme in the synthesis of UDP-xylose for the formation of xylans during cell wall biosynthesis. Here, we isolated a multigene family of seven members (PtUXS1-7 encoding UXS from Populus tomentosa, the first investigation of UXSs in a tree species. Analysis of gene structure and phylogeny showed that the PtUXS family could be divided into three groups (PtUXS1/4, PtUXS2/5, and PtUXS3/6/7, consistent with the tissue-specific expression patterns of each PtUXS. We further evaluated the functional consequences of nucleotide polymorphisms in PtUXS1. In total, 243 single-nucleotide polymorphisms (SNPs were identified, with a high frequency of SNPs (1/18 bp and nucleotide diversity (πT = 0.01033, θw = 0.01280. Linkage disequilibrium (LD analysis showed that LD did not extend over the entire gene (r (2<0.1, P<0.001, within 700 bp. SNP- and haplotype-based association analysis showed that nine SNPs (Q <0.10 and 12 haplotypes (P<0.05 were significantly associated with growth and wood property traits in the association population (426 individuals, with 2.70% to 12.37% of the phenotypic variation explained. Four significant single-marker associations (Q <0.10 were validated in a linkage mapping population of 1200 individuals. Also, RNA transcript accumulation varies among genotypic classes of SNP10 was further confirmed in the association population. This is the first comprehensive study of the UXS gene family in woody plants, and lays the foundation for genetic improvements of wood properties and growth in trees using genetic engineering or marker-assisted breeding.
Zha, Xianfeng; Yin, Qingsong; Tan, Huo; Wang, Chunyan; Chen, Shaohua; Yang, Lijian; Li, Bo; Wu, Xiuli; Li, Yangqiu
2013-05-01
Antigen-specific, T-cell receptor (TCR)-modified cytotoxic T lymphocytes (CTLs) that target tumors are an attractive strategy for specific adoptive immunotherapy. Little is known about whether there are any alterations in the gene expression profile after TCR gene transduction in T cells. We constructed TCR gene-redirected CTLs with specificity for diffuse large B-cell lymphoma (DLBCL)-associated antigens to elucidate the gene expression profiles of TCR gene-redirected T-cells, and we further analyzed the gene expression profile pattern of these redirected T-cells by Affymetrix microarrays. The resulting data were analyzed using Bioconductor software, a two-fold cut-off expression change was applied together with anti-correlation of the profile ratios to render the microarray analysis set. The fold change of all genes was calculated by comparing the three TCR gene-modified T-cells and a negative control counterpart. The gene pathways were analyzed using Bioconductor and Kyoto Encyclopedia of Genes and Genomes. Identical genes whose fold change was greater than or equal to 2.0 in all three TCR gene-redirected T-cell groups in comparison with the negative control were identified as the differentially expressed genes. The differentially expressed genes were comprised of 33 up-regulated genes and 1 down-regulated gene including JUNB, FOS, TNF, INF-γ, DUSP2, IL-1B, CXCL1, CXCL2, CXCL9, CCL2, CCL4, and CCL8. These genes are mainly involved in the TCR signaling, mitogen-activated protein kinase signaling, and cytokine-cytokine receptor interaction pathways. In conclusion, we characterized the gene expression profile of DLBCL-specific TCR gene-redirected T-cells. The changes corresponded to an up-regulation in the differentiation and proliferation of the T-cells. These data may help to explain some of the characteristics of the redirected T-cells.
Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance
2009-04-21
To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease
Gene Composer: database software for protein construct design, codon engineering, and gene synthesis
Directory of Open Access Journals (Sweden)
Mixon Mark
2009-04-01
assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies.
Bednár, Branislav; Roller, Ladislav; Čižmár, Daniel; Mitrová, Diana; Žitňan, Dušan
2017-05-01
Allatotropin (AT) and related neuropeptides are widespread bioactive molecules that regulate development, food intake and muscle contractions in insects and other invertebrates. In moths, alternative splicing of the at gene generates three mRNA precursors encoding AT with different combinations of three structurally similar AT-like peptides (ATLI-III). We used in situ hybridization and immunohistochemistry to map the differential expression of these transcripts during the postembryonic development of Bombyx mori. Transcript encoding AT alone was expressed in numerous neurons of the central nervous system and frontal ganglion, whereas transcripts encoding AT with ATLs were produced by smaller specific subgroups of neurons in larval stages. Metamorphosis was associated with considerable developmental changes and sex-specific differences in the expression of all transcripts. The most notable was the appearance of AT/ATL transcripts (1) in the brain lateral neurosecretory cells producing prothoracicotropic hormone; (2) in the male-specific cluster of about 20 neurons in the posterior region of the terminal abdominal ganglion; (3) in the female-specific medial neurons in the abdominal ganglia AG2-7. Immunohistochemical staining showed that these neurons produced a mixture of various neuropeptides and innervated diverse peripheral organs. Our data suggest that AT/ATL neuropeptides are involved in multiple stage- and sex-specific functions during the development of B. mori.
Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum
Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes
2012-01-01
The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784
Multiple loci with different cancer specificities within the 8q24 gene desert
DEFF Research Database (Denmark)
Ghoussaini, M.; Song, H.; Koessler, T.
2008-01-01
this gene desert were specifically associated with risks of different cancers. One block was solely associated with risk of breast cancer, three others were associated solely with the risk of prostate cancer, and a fifth was associated with the risk of prostate, colorectal, and ovarian cancer...
Gene-specific correlation of RNA and protein levels in human cells and tissues
DEFF Research Database (Denmark)
Edfors, Fredrik; Danielsson, Frida; Hallström, Björn M.
2016-01-01
An important issue for molecular biology is to establish whether transcript levels of a given gene can be used as proxies for the corresponding protein levels. Here, we have developed a targeted proteomics approach for a set of human non-secreted proteins based on parallel reaction monitoring...... to measure, at steady-state conditions, absolute protein copy numbers across human tissues and cell lines and compared these levels with the corresponding mRNA levels using transcriptomics. The study shows that the transcript and protein levels do not correlate well unless a gene-specific RNA-to-protein (RTP...
Directory of Open Access Journals (Sweden)
Toshiki Ochi
2010-01-01
Full Text Available The last decade has seen great strides in the field of cancer immunotherapy, especially the treatment of melanoma. Beginning with the identification of cancer antigens, followed by the clinical application of anti-cancer peptide vaccination, it has now been proven that adoptive T-cell therapy (ACT using cancer antigen-specific T cells is the most effective option. Despite the apparent clinical efficacy of ACT, the timely preparation of a sufficient number of cancer antigen-specific T cells for each patient has been recognized as its biggest limitation. Currently, therefore, attention is being focused on ACT with engineered T cells produced using cancer antigen-specific T-cell receptor (TCR gene transfer. With regard to human leukemia, ACT using engineered T cells bearing the leukemia antigen-specific TCR gene still remains in its infancy. However, several reports have provided preclinical data on TCR gene transfer using Wilms' tumor gene product 1 (WT1, and also preclinical and clinical data on TCR gene transfer involving minor histocompatibility antigen, both of which have been suggested to provide additional clinical benefit. In this review, we examine the current status of anti-leukemia ACT with engineered T cells carrying the leukemia antigen-specific TCR gene, and discuss the existing barriers to progress in this area.
Directory of Open Access Journals (Sweden)
Nolwenn M Dheilly
Full Text Available BACKGROUND: The Pacific oyster Crassostrea gigas (Mollusca, Lophotrochozoa is an alternative and irregular protandrous hermaphrodite: most individuals mature first as males and then change sex several times. Little is known about genetic and phenotypic basis of sex differentiation in oysters, and little more about the molecular pathways regulating reproduction. We have recently developed and validated a microarray containing 31,918 oligomers (Dheilly et al., 2011 representing the oyster transcriptome. The application of this microarray to the study of mollusk gametogenesis should provide a better understanding of the key factors involved in sex differentiation and the regulation of oyster reproduction. METHODOLOGY/PRINCIPAL FINDINGS: Gene expression was studied in gonads of oysters cultured over a yearly reproductive cycle. Principal component analysis and hierarchical clustering showed a significant divergence in gene expression patterns of males and females coinciding with the start of gonial mitosis. ANOVA analysis of the data revealed 2,482 genes differentially expressed during the course of males and/or females gametogenesis. The expression of 434 genes could be localized in either germ cells or somatic cells of the gonad by comparing the transcriptome of female gonads to the transcriptome of stripped oocytes and somatic tissues. Analysis of the annotated genes revealed conserved molecular mechanisms between mollusks and mammals: genes involved in chromatin condensation, DNA replication and repair, mitosis and meiosis regulation, transcription, translation and apoptosis were expressed in both male and female gonads. Most interestingly, early expressed male-specific genes included bindin and a dpy-30 homolog and female-specific genes included foxL2, nanos homolog 3, a pancreatic lipase related protein, cd63 and vitellogenin. Further functional analyses are now required in order to investigate their role in sex differentiation in oysters
Relationships among msx gene structure and function in zebrafish and other vertebrates.
Ekker, M; Akimenko, M A; Allende, M L; Smith, R; Drouin, G; Langille, R M; Weinberg, E S; Westerfield, M
1997-10-01
The zebrafish genome contains at least five msx homeobox genes, msxA, msxB, msxC, msxD, and the newly isolated msxE. Although these genes share structural features common to all Msx genes, phylogenetic analyses of protein sequences indicate that the msx genes from zebrafish are not orthologous to the Msx1 and Msx2 genes of mammals, birds, and amphibians. The zebrafish msxB and msxC are more closely related to each other and to the mouse Msx3. Similarly, although the combinatorial expression of the zebrafish msx genes in the embryonic dorsal neuroectoderm, visceral arches, fins, and sensory organs suggests functional similarities with the Msx genes of other vertebrates, differences in the expression patterns preclude precise assignment of orthological relationships. Distinct duplication events may have given rise to the msx genes of modern fish and other vertebrate lineages whereas many aspects of msx gene functions during embryonic development have been preserved.
Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui
2011-05-01
Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Wang, Yaqiong; Ma, Hong
2015-09-01
Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Katja Nowick
Full Text Available The molecular changes underlying major phenotypic differences between humans and other primates are not well understood, but alterations in gene regulation are likely to play a major role. Here we performed a thorough evolutionary analysis of the largest family of primate transcription factors, the Krüppel-type zinc finger (KZNF gene family. We identified and curated gene and pseudogene models for KZNFs in three primate species, chimpanzee, orangutan and rhesus macaque, to allow for a comparison with the curated set of human KZNFs. We show that the recent evolutionary history of primate KZNFs has been complex, including many lineage-specific duplications and deletions. We found 213 species-specific KZNFs, among them 7 human-specific and 23 chimpanzee-specific genes. Two human-specific genes were validated experimentally. Ten genes have been lost in humans and 13 in chimpanzees, either through deletion or pseudogenization. We also identified 30 KZNF orthologs with human-specific and 42 with chimpanzee-specific sequence changes that are predicted to affect DNA binding properties of the proteins. Eleven of these genes show signatures of accelerated evolution, suggesting positive selection between humans and chimpanzees. During primate evolution the most extensive re-shaping of the KZNF repertoire, including most gene additions, pseudogenizations, and structural changes occurred within the subfamily homininae. Using zinc finger (ZNF binding predictions, we suggest potential impact these changes have had on human gene regulatory networks. The large species differences in this family of TFs stands in stark contrast to the overall high conservation of primate genomes and potentially represents a potent driver of primate evolution.
Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.
Directory of Open Access Journals (Sweden)
Yuki Mitaka
Full Text Available The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq, we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.
Directory of Open Access Journals (Sweden)
Arbeitman Michelle N
2011-07-01
Full Text Available Abstract Background Understanding animal development and physiology at a molecular-biological level has been advanced by the ability to determine at high resolution the repertoire of mRNA molecules by whole transcriptome resequencing. This includes the ability to detect and quantify rare abundance transcripts and isoform-specific mRNA variants produced from a gene. The sex hierarchy consists of a pre-mRNA splicing cascade that directs the production of sex-specific transcription factors that specify nearly all sexual dimorphism. We have used deep RNA sequencing to gain insight into how the Drosophila sex hierarchy generates somatic sex differences, by examining gene and transcript isoform expression differences between the sexes in adult head tissues. Results Here we find 1,381 genes that differ in overall expression levels and 1,370 isoform-specific transcripts that differ between males and females. Additionally, we find 512 genes not regulated downstream of transformer that are significantly more highly expressed in males than females. These 512 genes are enriched on the × chromosome and reside adjacent to dosage compensation complex entry sites, which taken together suggests that their residence on the × chromosome might be sufficient to confer male-biased expression. There are no transcription unit structural features, from a set of features, that are robustly significantly different in the genes with significant sex differences in the ratio of isoform-specific transcripts, as compared to random isoform-specific transcripts, suggesting that there is no single molecular mechanism that generates isoform-specific transcript differences between the sexes, even though the sex hierarchy is known to include three pre-mRNA splicing factors. Conclusions We identify thousands of genes that show sex-specific differences in overall gene expression levels, and identify hundreds of additional genes that have differences in the abundance of isoform-specific
Directory of Open Access Journals (Sweden)
Robert D Latzman
Full Text Available One of the major contributions of recent personality psychology is the finding that traits are related to each other in an organized hierarchy. To date, however, researchers have yet to investigate this hierarchy in nonhuman primates. Such investigations are critical in confirming the cross-species nature of trait personality helping to illuminate personality as neurobiologically-based and evolutionarily-derived dimensions of primate disposition. Investigations of potential genetic polymorphisms associated with hierarchical models of personality among nonhuman primates represent a critical first step. The current study examined the hierarchical structure of chimpanzee personality as well as sex-specific associations with a polymorphism in the promoter region of the vasopressin V1a receptor gene (AVPR1A, a gene associated with dispositional traits, among 174 chimpanzees. Results confirmed a hierarchical structure of personality across species and, despite differences in early rearing experiences, suggest a sexually dimorphic role of AVPR1A polymorphisms on hierarchical personality profiles at a higher-order level.
Latzman, Robert D.; Hopkins, William D.; Keebaugh, Alaine C.; Young, Larry J.
2014-01-01
One of the major contributions of recent personality psychology is the finding that traits are related to each other in an organized hierarchy. To date, however, researchers have yet to investigate this hierarchy in nonhuman primates. Such investigations are critical in confirming the cross-species nature of trait personality helping to illuminate personality as neurobiologically-based and evolutionarily-derived dimensions of primate disposition. Investigations of potential genetic polymorphisms associated with hierarchical models of personality among nonhuman primates represent a critical first step. The current study examined the hierarchical structure of chimpanzee personality as well as sex-specific associations with a polymorphism in the promoter region of the vasopressin V1a receptor gene (AVPR1A), a gene associated with dispositional traits, among 174 chimpanzees. Results confirmed a hierarchical structure of personality across species and, despite differences in early rearing experiences, suggest a sexually dimorphic role of AVPR1A polymorphisms on hierarchical personality profiles at a higher-order level. PMID:24752497
Nwaobi, Sinifunanya E; Olsen, Michelle L
2015-09-26
DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.
A dual-specificity isoform of the protein kinase inhibitor PKI produced by alternate gene splicing.
Kumar, Priyadarsini; Walsh, Donal A
2002-03-15
We have previously shown that the protein kinase inhibitor beta (PKIbeta) form of the cAMP-dependent protein kinase inhibitor exists in multiple isoforms, some of which are specific inhibitors of the cAMP-dependent protein kinase, whereas others also inhibit the cGMP-dependent enzyme [Kumar, Van Patten and Walsh (1997), J. Biol. Chem. 272, 20011-20020]. We have now demonstrated that the switch from a cAMP-dependent protein kinase (PKA)-specific inhibitor to one with dual specificity arises as a consequence of alternate gene splicing. We have confirmed using bacterially produced pure protein that a single inhibitor species has dual specificity for both PKA and cGMP-dependent protein kinase (PKG), inhibiting each with very high and closely similar inhibitory potencies. The gene splicing converted a protein with 70 amino acids into one of 109 amino acids, and did not change the inhibitory potency to PKA, but changed it from a protein that had no detectable PKG inhibitory activity to one that now inhibited PKG in the nanomolar range.
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
International Nuclear Information System (INIS)
Allen-Brady, Kristina; Camp, Nicola J
2005-01-01
Characterization of the linkage disequilibrium (LD) structure of candidate genes is the basis for an effective association study of complex diseases such as cancer. In this study, we report the LD and haplotype architecture and tagging-single nucleotide polymorphisms (tSNPs) for five DNA repair genes: ATM, MRE11A, XRCC4, NBS1 and RAD50. The genes ATM, MRE11A, and XRCC4 were characterized using a panel of 94 unrelated female subjects (47 breast cancer cases, 47 controls) obtained from high-risk breast cancer families. A similar LD structure and tSNP analysis was performed for NBS1 and RAD50, using publicly available genotyping data. We studied a total of 61 SNPs at an average marker density of 10 kb. Using a matrix decomposition algorithm, based on principal component analysis, we captured >90% of the intragenetic variation for each gene. Our results revealed that three of the five genes did not conform to a haplotype block structure (MRE11A, RAD50 and XRCC4). Instead, the data fit a more flexible LD group paradigm, where SNPs in high LD are not required to be contiguous. Traditional haplotype blocks assume recombination is the only dynamic at work. For ATM, MRE11A and XRCC4 we repeated the analysis in cases and controls separately to determine whether LD structure was consistent across breast cancer cases and controls. No substantial difference in LD structures was found. This study suggests that appropriate SNP selection for an association study involving candidate genes should allow for both mutation and recombination, which shape the population-level genomic structure. Furthermore, LD structure characterization in either breast cancer cases or controls appears to be sufficient for future cancer studies utilizing these genes
A Subset of Autism-Associated Genes Regulate the Structural Stability of Neurons
Lin, Yu-Chih; Frei, Jeannine A.; Kilander, Michaela B. C.; Shen, Wenjuan; Blatt, Gene J.
2016-01-01
Autism spectrum disorder (ASD) comprises a range of neurological conditions that affect individuals’ ability to communicate and interact with others. People with ASD often exhibit marked qualitative difficulties in social interaction, communication, and behavior. Alterations in neurite arborization and dendritic spine morphology, including size, shape, and number, are hallmarks of almost all neurological conditions, including ASD. As experimental evidence emerges in recent years, it becomes clear that although there is broad heterogeneity of identified autism risk genes, many of them converge into similar cellular pathways, including those regulating neurite outgrowth, synapse formation and spine stability, and synaptic plasticity. These mechanisms together regulate the structural stability of neurons and are vulnerable targets in ASD. In this review, we discuss the current understanding of those autism risk genes that affect the structural connectivity of neurons. We sub-categorize them into (1) cytoskeletal regulators, e.g., motors and small RhoGTPase regulators; (2) adhesion molecules, e.g., cadherins, NCAM, and neurexin superfamily; (3) cell surface receptors, e.g., glutamatergic receptors and receptor tyrosine kinases; (4) signaling molecules, e.g., protein kinases and phosphatases; and (5) synaptic proteins, e.g., vesicle and scaffolding proteins. Although the roles of some of these genes in maintaining neuronal structural stability are well studied, how mutations contribute to the autism phenotype is still largely unknown. Investigating whether and how the neuronal structure and function are affected when these genes are mutated will provide insights toward developing effective interventions aimed at improving the lives of people with autism and their families. PMID:27909399
TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.
Directory of Open Access Journals (Sweden)
Adrienne Baillet
Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.
Directory of Open Access Journals (Sweden)
Xiaoyan Zhang
2015-10-01
Full Text Available The AT motif-binding factor (ATBF1 not only interacts with protein inhibitor of activated signal transducer and activator of transcription 3 (STAT3 (PIAS3 to suppress STAT3 signaling regulating embryo early development and cell differentiation, but is required for early activation of the pituitary specific transcription factor 1 (Pit1 gene (also known as POU1F1 critically affecting mammalian growth and development. The goal of this study was to detect novel nucleotide variations and haplotypes structure of the ATBF1 gene, as well as to test their associations with growth-related traits in goats. Herein, a total of seven novel single nucleotide polymorphisms (SNPs (SNP 1-7 within this gene were found in two well-known Chinese native goat breeds. Haplotypes structure analysis demonstrated that there were four haplotypes in Hainan black goat while seventeen haplotypes in Xinong Saanen dairy goat, and both breeds only shared one haplotype (hap1. Association testing revealed that the SNP2, SNP5, SNP6, and SNP7 loci were also found to significantly associate with growth-related traits in goats, respectively. Moreover, one diplotype in Xinong Saanen dairy goats significantly linked to growth related traits. These preliminary findings not only would extend the spectrum of genetic variations of the goat ATBF1 gene, but also would contribute to implementing marker-assisted selection in genetics and breeding in goats.
Lin, F; Chen, X M
2007-05-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values
Male germ cell-specific expression of a novel Patched-domain containing gene Ptchd3
International Nuclear Information System (INIS)
Fan Jun; Akabane, Hiroto; Zheng Xuehai; Zhou Xuan; Zhang Li; Liu Qiang; Zhang Yonglian; Yang Jing; Zhu Guozhang
2007-01-01
The Hedgehog (Hh) signaling pathway plays an important role in various biological processes, including pattern formation, cell fate determination, proliferation, and differentiation. Hh function is mediated through its membrane receptor Patched. Herein, we have characterized a novel Patched-domain containing gene Ptchd3 in mouse. Messenger RNA of Ptchd3 was exclusively detected in the testis, and existed in two isoforms Ptchd3a and Ptchd3b. The expression of these two mRNA isoforms was shown to be developmentally regulated in testes, and specifically found in male germ cells. Further analysis revealed that the Ptchd3 protein was located on the midpiece of mouse, rat and human sperm. Collectively, these results indicate that Ptchd3 is a novel male germ cell-specific gene and may be involved in the Hh signaling to regulate sperm development and/or sperm function
Marsico, Annalisa
2013-01-01
Abstract The zebrafish (Danio rerio) is an established model organism for developmental and biomedical research. It is frequently used for high-throughput functional genomics experiments, such as genome-wide gene expression measurements, to systematically analyze molecular mechanisms. However, the use of whole embryos or larvae in such experiments leads to a loss of the spatial information. To address this problem, we have developed a tool called Zebrafish Expression Ontology of Gene Sets (ZEOGS) to assess the enrichment of anatomical terms in large gene sets. ZEOGS uses gene expression pattern data from several sources: first, in situ hybridization experiments from the Zebrafish Model Organism Database (ZFIN); second, it uses the Zebrafish Anatomical Ontology, a controlled vocabulary that describes connected anatomical structures; and third, the available connections between expression patterns and anatomical terms contained in ZFIN. Upon input of a gene set, ZEOGS determines which anatomical structures are overrepresented in the input gene set. ZEOGS allows one for the first time to look at groups of genes and to describe them in terms of shared anatomical structures. To establish ZEOGS, we first tested it on random gene selections and on two public microarray datasets with known tissue-specific gene expression changes. These tests showed that ZEOGS could reliably identify the tissues affected, whereas only very few enriched terms to none were found in the random gene sets. Next we applied ZEOGS to microarray datasets of 24 and 72 h postfertilization zebrafish embryos treated with beclomethasone, a potent glucocorticoid. This analysis resulted in the identification of several anatomical terms related to glucocorticoid-responsive tissues, some of which were stage-specific. Our studies highlight the ability of ZEOGS to extract spatial information from datasets derived from whole embryos, indicating that ZEOGS could be a useful tool to automatically analyze gene
Prykhozhij, Sergey V; Marsico, Annalisa; Meijsing, Sebastiaan H
2013-09-01
The zebrafish (Danio rerio) is an established model organism for developmental and biomedical research. It is frequently used for high-throughput functional genomics experiments, such as genome-wide gene expression measurements, to systematically analyze molecular mechanisms. However, the use of whole embryos or larvae in such experiments leads to a loss of the spatial information. To address this problem, we have developed a tool called Zebrafish Expression Ontology of Gene Sets (ZEOGS) to assess the enrichment of anatomical terms in large gene sets. ZEOGS uses gene expression pattern data from several sources: first, in situ hybridization experiments from the Zebrafish Model Organism Database (ZFIN); second, it uses the Zebrafish Anatomical Ontology, a controlled vocabulary that describes connected anatomical structures; and third, the available connections between expression patterns and anatomical terms contained in ZFIN. Upon input of a gene set, ZEOGS determines which anatomical structures are overrepresented in the input gene set. ZEOGS allows one for the first time to look at groups of genes and to describe them in terms of shared anatomical structures. To establish ZEOGS, we first tested it on random gene selections and on two public microarray datasets with known tissue-specific gene expression changes. These tests showed that ZEOGS could reliably identify the tissues affected, whereas only very few enriched terms to none were found in the random gene sets. Next we applied ZEOGS to microarray datasets of 24 and 72 h postfertilization zebrafish embryos treated with beclomethasone, a potent glucocorticoid. This analysis resulted in the identification of several anatomical terms related to glucocorticoid-responsive tissues, some of which were stage-specific. Our studies highlight the ability of ZEOGS to extract spatial information from datasets derived from whole embryos, indicating that ZEOGS could be a useful tool to automatically analyze gene expression
Paria, Nandina; Raudsepp, Terje; Pearks Wilkerson, Alison J.; O'Brien, Patricia C. M.; Ferguson-Smith, Malcom A.; Love, Charles C.; Arnold, Carolyn; Rakestraw, Peter; Murphy, William J.; Chowdhary, Bhanu P.
2011-01-01
Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY) contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY g...
Tokuhiro, Shinji; Uda, Kouji; Yano, Hiroko; Nagataki, Mitsuru; Jarilla, Blanca R; Suzuki, Tomohiko; Agatsuma, Takeshi
2013-04-01
Phosphagen kinases (PKs) play a major role in the regulation of energy metabolism in animals. Creatine kinase (CK) is the sole PK in vertebrates, whereas several PKs are present in invertebrates. Here, we report the enzymatic properties and gene structure of PK in the trematode Schistosoma japonicum (Sj). SjPK has a unique contiguous dimeric structure comprising domain 1 (D1) and domain 2 (D2). The three states of the recombinant SjPK (D1, D2, and D1D2) show a specific activity for the substrate taurocyamine. The comparison of the two domains of SjPK revealed that D1 had a high turnover rate (kcat=52.91) and D2 exhibited a high affinity for taurocyamine (Km(Tauro) =0.53±0.06). The full-length protein exhibited higher affinity for taurocyamine (Km(Tauro) =0.47±0.03) than the truncated domains (D1=1.30±0.10, D2=0.53±0.06). D1D2 also exhibited higher catalytic efficiency (kcat/Km(Tauro) =82.98) than D1 (40.70) and D2 (29.04). These results demonstrated that both domains of SjTKD1D2 interacted efficiently and remained functional. The three-dimensional structure of SjPKD1 was constructed by the homology modeling based on the transition state analog complex state of Limulus AK. This protein model of SjPKD1 suggests that the overall structure is almost conserve between SjPKD1 and Limulus AK except for the flexible loops, that is, particularly guanidino-specificity (GS) region, which is associated with the recognition of the corresponding guanidino substrate. The constructed NJ tree and the comparison of exon/intron organization suggest that SjTK has evolved from an arginine kinase (AK) gene. SjTK has potential as a novel antihelminthic drug target as it is absent in mammals and its strong activity may imply a significant role for this protein in the energy metabolism of the parasite. Copyright © 2013 Elsevier B.V. All rights reserved.
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...
Computer analysis of protein functional sites projection on exon structure of genes in Metazoa.
Medvedeva, Irina V; Demenkov, Pavel S; Ivanisenko, Vladimir A
2015-01-01
Study of the relationship between the structural and functional organization of proteins and their coding genes is necessary for an understanding of the evolution of molecular systems and can provide new knowledge for many applications for designing proteins with improved medical and biological properties. It is well known that the functional properties of proteins are determined by their functional sites. Functional sites are usually represented by a small number of amino acid residues that are distantly located from each other in the amino acid sequence. They are highly conserved within their functional group and vary significantly in structure between such groups. According to this facts analysis of the general properties of the structural organization of the functional sites at the protein level and, at the level of exon-intron structure of the coding gene is still an actual problem. One approach to this analysis is the projection of amino acid residue positions of the functional sites along with the exon boundaries to the gene structure. In this paper, we examined the discontinuity of the functional sites in the exon-intron structure of genes and the distribution of lengths and phases of the functional site encoding exons in vertebrate genes. We have shown that the DNA fragments coding the functional sites were in the same exons, or in close exons. The observed tendency to cluster the exons that code functional sites which could be considered as the unit of protein evolution. We studied the characteristics of the structure of the exon boundaries that code, and do not code, functional sites in 11 Metazoa species. This is accompanied by a reduced frequency of intercodon gaps (phase 0) in exons encoding the amino acid residue functional site, which may be evidence of the existence of evolutionary limitations to the exon shuffling. These results characterize the features of the coding exon-intron structure that affect the functionality of the encoded protein and
Occurrence of the structural enterocin A, P, B, L50B genes in enterococci of different origin.
Strompfová, Viola; Lauková, Andrea; Simonová, Monika; Marcináková, Miroslava
2008-12-10
Enterococci are well-known producers of antimicrobial peptides--bacteriocins (enterocins) and the number of characterized enterocins has been significantly increased. Recently, enterocins are of great interest for their potential as biopreservatives in food or feed while research on enterocins as alternative antimicrobials in humans and animals is only at the beginning. The present study provides a survey about the occurrence of enterocin structural genes A, P, B, L50B in a target of 427 strains of Enterococcus faecium (368) and Enterococcus faecalis (59) species from different sources (animal isolates, food and feed) performed by PCR method. Based on our results, 234 strains possessed one or more enterocin structural gene(s). The genes of enterocin P and enterocin A were the most frequently detected structural genes among the PCR positive strains (170 and 155 strains, respectively). Different frequency of the enterocin genes occurrence was detected in strains according to their origin; the strains from horses and silage showed the highest frequency of enterocin genes presence. All possible combinations of the tested genes occurred at least twice except the combination of the gene of enterocin B and L50B which possessed neither strain. The gene of enterocin A was exclusively detected among E. faecium strains, while the gene of enterocin P, B, L50B were detected in strains of both species E. faecium and E. faecalis. In conclusion, a high-frequency and variability of enterocin structural genes exists among enterococci of different origin what offers a big possibility to find effective bacteriocin-producing strains for their application in veterinary medicine.
Directory of Open Access Journals (Sweden)
Kushner Brian
2009-02-01
Full Text Available Abstract Background Neuroblastoma (NB tumours have the highest incidence of spontaneous remission, especially among the stage 4s NB subgroup affecting infants. Clinical distinction of stage 4s from lethal stage 4 can be difficult, but critical for therapeutic decisions. The aim of this study was to investigate chromosomal alterations and differential gene expression amongst infant disseminated NB subgroups. Methods Thirty-five NB tumours from patients diagnosed at Results All stage 4s patients underwent spontaneous remission, only 48% stage 4 patients survived despite combined modality therapy. Stage 4 tumours were 90% near-diploid/tetraploid, 44% MYCN amplified, 77% had 1p LOH (50% 1p36, 23% 11q and/or 14q LOH (27% and 47% had 17q gain. Stage 4s were 90% near-triploid, none MYCN amplified and LOH was restricted to 11q. Initial comparison analyses between stage 4s and 4 P P = 0.0054, 91% with higher expression in stage 4. Less definite expression profiles were observed between stage 4s and 4 P P = 0.005 was maintained. Distinct gene expression profiles but no significant association with specific chromosomal region localization was observed between stage 4s and stage 4 Conclusion Specific chromosomal aberrations are associated with distinct gene expression profiles which characterize spontaneously regressing or aggressive infant NB, providing the biological basis for the distinct clinical behaviour.
Site-specific selfish genes as tools for the control and genetic engineering of natural populations.
Burt, Austin
2003-05-07
Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.
Molecular cloning and sequence analysis of VP6 gene of giant ...
African Journals Online (AJOL)
Jane
2011-10-24
Oct 24, 2011 ... G), and the major structural protein of inner capsid particles (ICP), and also specific antigen of mucosa immunization that mediate specific immunological reaction. In this report, sequence analysis of VP6 gene of giant panda rotavirus was carried out. Full-length VP6 gene encoding for ICP of giant panda.
Directory of Open Access Journals (Sweden)
Roy C. Y. Choi
2011-01-01
Full Text Available Danggui Buxue Tang (DBT, a Chinese herbal decoction used to treat ailments in women, contains Radix Astragali (Huangqi; RA and Radix Angelicae Sinensis (Danggui; RAS. When DBT was applied onto cultured MG-63 cells, an increase of cell proliferation and differentiation of MG-63 cell were revealed: both of these effects were significantly higher in DBT than RA or RAS extract. To search for the biological markers that are specifically regulated by DBT, DNA microarray was used to reveal the gene expression profiling of DBT in MG-63 cells as compared to that of RA- or RAS-treated cells. Amongst 883 DBT-regulated genes, 403 of them are specifically regulated by DBT treatment, including CCL-2, CCL-7, CCL-8, and galectin-9. The signaling cascade of this DBT-regulated gene expression was also elucidated in cultured MG-63 cells. The current results reveal the potential usage of this herbal decoction in treating osteoporosis and suggest the uniqueness of Chinese herbal decoction that requires a well-defined formulation. The DBT-regulated genes in the culture could serve as biological responsive markers for quality assurance of the herbal preparation.
International Nuclear Information System (INIS)
Robinson, Claire; Kolb, Andreas F.
2009-01-01
The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene
Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.
Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W
2011-09-01
Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.
Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism
International Nuclear Information System (INIS)
Welin, Martin; Nordlund, Paer
2010-01-01
Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.
Tolmachov, Oleg E
2015-01-01
are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Mónica Serrano
2015-04-01
Full Text Available Gene expression during spore development in Bacillus subtilis is controlled by cell type-specific RNA polymerase sigma factors. σFand σE control early stages of development in the forespore and the mother cell, respectively. When, at an intermediate stage in development, the mother cell engulfs the forespore, σF is replaced by σG and σE is replaced by σK. The anti-sigma factor CsfB is produced under the control of σF and binds to and inhibits the auto-regulatory σG, but not σF. A position in region 2.1, occupied by an asparagine in σG and by a glutamate in οF, is sufficient for CsfB discrimination of the two sigmas, and allows it to delay the early to late switch in forespore gene expression. We now show that following engulfment completion, csfB is switched on in the mother cell under the control of σK and that CsfB binds to and inhibits σE but not σK, possibly to facilitate the switch from early to late gene expression. We show that a position in region 2.3 occupied by a conserved asparagine in σE and by a conserved glutamate in σK suffices for discrimination by CsfB. We also show that CsfB prevents activation of σG in the mother cell and the premature σG-dependent activation of σK. Thus, CsfB establishes negative feedback loops that curtail the activity of σE and prevent the ectopic activation of σG in the mother cell. The capacity of CsfB to directly block σE activity may also explain how CsfB plays a role as one of the several mechanisms that prevent σE activation in the forespore. Thus the capacity of CsfB to differentiate between the highly similar σF/σG and σE/σK pairs allows it to rinforce the cell-type specificity of these sigma factors and the transition from early to late development in B. subtilis, and possibly in all sporeformers that encode a CsfB orthologue.
Directory of Open Access Journals (Sweden)
Kouji Satoh
Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.
DEFF Research Database (Denmark)
Olsen, Helle G; Skovgaard, Kerstin; Nielsen, Ole L
2013-01-01
Serum amyloid A (SAA) is a prominent acute phase protein. Although its biological functions are debated, the wide species distribution of highly homologous SAA proteins and their uniform behavior in response to injury or inflammation in itself suggests a significant role for this protein. The pig...... is increasingly being used as a model for the study of inflammatory reactions, yet only little is known about how specific SAA genes are regulated in the pig during acute phase responses and other responses induced by pro-inflammatory host mediators. We designed SAA gene specific primers and quantified the gene...... expression of porcine SAA1, SAA2, SAA3, and SAA4 by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) in liver, spleen, and lung tissue from pigs experimentally infected with the Gram-negative swine specific bacterium Actinobacillus pleuropneumoniae, as well as from pigs experimentally...
Iwata, Yuji; Nishino, Tsuneyo; Iwano, Megumi; Takayama, Seiji; Koizumi, Nozomu
2012-01-01
Accumulation of unfolded proteins in the endoplasmic reticulum (ER) of eukaryotic cells triggers the transcriptional activation of ER-resident molecular chaperones and folding enzymes to maintain cellular homeostasis. This process is known as the ER stress response or the unfolded protein response. We have identified tunicamycin induced 1 (TIN1), a plant-specific ER stress-inducible Arabidopsis thaliana gene. The TIN1 protein is localized in the ER; however, its molecular function has yet to be clarified. In this study, we performed functional analysis of TIN1 in planta. RT-PCR analysis showed that TIN1 is highly expressed in pollen. Analysis using the β-glucuronidase reporter gene demonstrated that the TIN1 promoter is active throughout pollen development, peaking at the time of flowering and in an ovule of an open flower. Although a T-DNA insertion mutant of TIN1 grows normally under ambient laboratory conditions, abnormal pollen surface morphology was observed under a scanning electron microscope. Based on the current and previous observations, a possible physiological function of TIN1 during pollen development is discussed. © 2012 The Japanese Society for Plant Cell and Molecular Biology.
Chen, Meng-Yun; Liang, Dan; Zhang, Peng
2015-11-01
Incongruence between different phylogenomic analyses is the main challenge faced by phylogeneticists in the genomic era. To reduce incongruence, phylogenomic studies normally adopt some data filtering approaches, such as reducing missing data or using slowly evolving genes, to improve the signal quality of data. Here, we assembled a phylogenomic data set of 58 jawed vertebrate taxa and 4682 genes to investigate the backbone phylogeny of jawed vertebrates under both concatenation and coalescent-based frameworks. To evaluate the efficiency of extracting phylogenetic signals among different data filtering methods, we chose six highly intractable internodes within the backbone phylogeny of jawed vertebrates as our test questions. We found that our phylogenomic data set exhibits substantial conflicting signal among genes for these questions. Our analyses showed that non-specific data sets that are generated without bias toward specific questions are not sufficient to produce consistent results when there are several difficult nodes within a phylogeny. Moreover, phylogenetic accuracy based on non-specific data is considerably influenced by the size of data and the choice of tree inference methods. To address such incongruences, we selected genes that resolve a given internode but not the entire phylogeny. Notably, not only can this strategy yield correct relationships for the question, but it also reduces inconsistency associated with data sizes and inference methods. Our study highlights the importance of gene selection in phylogenomic analyses, suggesting that simply using a large amount of data cannot guarantee correct results. Constructing question-specific data sets may be more powerful for resolving problematic nodes. © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Partial characterization of nif genes from the bacterium Azospirillum amazonense
Directory of Open Access Journals (Sweden)
D.P. Potrich
2001-09-01
Full Text Available Azospirillum amazonense revealed genomic organization patterns of the nitrogen fixation genes similar to those of the distantly related species A. brasilense. Our work suggests that A. brasilense nifHDK, nifENX, fixABC operons and nifA and glnB genes may be structurally homologous to the counterpart genes of A. amazonense. This is the first analysis revealing homology between A. brasilense nif genes and the A. amazonense genome. Sequence analysis of PCR amplification products revealed similarities between the amino acid sequences of the highly conserved nifD and glnB genes of A. amazonense and related genes of A. brasilense and other bacteria. However, the A. amazonense non-coding regions (the upstream activator sequence region and the region between the nifH and nifD genes differed from related regions of A. brasilense even in nitrogenase structural genes which are highly conserved among diazotrophic bacteria. The feasibility of the 16S ribosomal RNA gene-based PCR system for specific detection of A. amazonense was shown. Our results indicate that the PCR primers for 16S rDNA defined in this article are highly specific to A. amazonense and can distinguish this species from A. brasilense.
Directory of Open Access Journals (Sweden)
Christos Gournas
2018-05-01
Full Text Available In the recent years, molecular modeling and substrate docking, coupled with biochemical and genetic analyses have identified the substrate-binding residues of several amino acid transporters of the yeast amino acid transporter (YAT family. These consist of (a residues conserved across YATs that interact with the invariable part of amino acid substrates and (b variable residues that interact with the side chain of the amino acid substrate and thus define specificity. Secondary structure sequence alignments showed that the positions of these residues are conserved across YATs and could thus be used to predict the specificity of YATs. Here, we discuss the potential of combining molecular modeling and structural alignments with intra-species phylogenetic comparisons of transporters, in order to predict the function of uncharacterized members of the family. We additionally define some orphan branches which include transporters with potentially novel, and to be characterized specificities. In addition, we discuss the particular case of the highly specific l-proline transporter, PrnB, of Aspergillus nidulans, whose gene is part of a cluster of genes required for the utilization of proline as a carbon and/or nitrogen source. This clustering correlates with transcriptional regulation of these genes, potentially leading to the efficient coordination of the uptake of externally provided l-Pro via PrnB and its enzymatic degradation in the cell.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Regulating expressin of cell and tissue-specific genes by modifying transcription
Energy Technology Data Exchange (ETDEWEB)
Beachy, Roger N. [Donald Danforth Plant Science Center, St. Louis, MO (United States); Dai, Shunhong [Donald Danforth Plant Science Center, St. Louis, MO (United States)
2009-12-15
Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Our research supported by this program has led to the identification of rice bZIP transcription factors RF2a, RF2b and RLP1 that play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV) through their interactions with the Box II essential cis element located in the promoter. RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants and to improve biofuel feedstock.
Minson, A C; Darby, G K; Wildy, P
1979-11-01
Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.
DEFF Research Database (Denmark)
Pedersen, Margit; Østergaard, Solvej; Bresciani, José
2000-01-01
Two putative structural genes, orf tmp (tape measure protein) and orf bpp (baseplate protein), of the temperate lactococcal phage TP901-1 were examined by introduction of specific mutations in the prophage strain Lactococcus lactic ssp. cremoris 901-1. The adsorption efficiencies of the mutated...... or duplication of 29% in orf tmp was shown to shorten or lengthen the phage tail by approximately 30%, respectively. The orf tmp is proposed to function as a tape measure protein, TMP, important for assembly of the TP901-1 phage tail and involved in tail length determination. Specific mutations in orf bpp...... produced phages which were unable to adsorb to the indicator strain and electron microscopy revealed particles lacking the baseplate structure. The orf bpp is proposed to encode a highly immunogenic structural baseplate protein, BPP, important for assembly of the baseplate. Finally, an assembly pathway...
Directory of Open Access Journals (Sweden)
Linda Sterrenburg
Full Text Available BACKGROUND: Although the higher prevalence of depression in women than in men is well known, the neuronal basis of this sex difference is largely elusive. METHODS: Male and female rats were exposed to chronic variable mild stress (CVMS after which immediate early gene products, corticotropin-releasing factor (CRF mRNA and peptide, various epigenetic-associated enzymes and DNA methylation of the Crf gene were determined in the hypothalamic paraventricular nucleus (PVN, oval (BSTov and fusiform (BSTfu parts of the bed nucleus of the stria terminalis, and central amygdala (CeA. RESULTS: CVMS induced site-specific changes in Crf gene methylation in all brain centers studied in female rats and in the male BST and CeA, whereas the histone acetyltransferase, CREB-binding protein was increased in the female BST and the histone-deacetylase-5 decreased in the male CeA. These changes were accompanied by an increased amount of c-Fos in the PVN, BSTfu and CeA in males, and of FosB in the PVN of both sexes and in the male BSTov and BSTfu. In the PVN, CVMS increased CRF mRNA in males and CRF peptide decreased in females. CONCLUSIONS: The data confirm our hypothesis that chronic stress affects gene expression and CRF transcriptional, translational and secretory activities in the PVN, BSTov, BSTfu and CeA, in a brain center-specific and sex-specific manner. Brain region-specific and sex-specific changes in epigenetic activity and neuronal activation may play, too, an important role in the sex specificity of the stress response and the susceptibility to depression.
Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity
Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.
2014-01-01
The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.
Gil-Ibañez, Pilar; García-García, Francisco; Dopazo, Joaquín; Bernal, Juan; Morte, Beatriz
2017-01-01
Thyroid hormones, thyroxine, and triiodothyronine (T3) are crucial for cerebral cortex development acting through regulation of gene expression. To define the transcriptional program under T3 regulation, we have performed RNA-Seq of T3-treated and untreated primary mouse cerebrocortical cells. The expression of 1145 genes or 7.7% of expressed genes was changed upon T3 addition, of which 371 responded to T3 in the presence of cycloheximide indicating direct transcriptional regulation. The results were compared with available transcriptomic datasets of defined cellular types. In this way, we could identify targets of T3 within genes enriched in astrocytes and neurons, in specific layers including the subplate, and in specific neurons such as prepronociceptin, cholecystokinin, or cortistatin neurons. The subplate and the prepronociceptin neurons appear as potentially major targets of T3 action. T3 upregulates mostly genes related to cell membrane events, such as G-protein signaling, neurotransmission, and ion transport and downregulates genes involved in nuclear events associated with the M phase of cell cycle, such as chromosome organization and segregation. Remarkably, the transcriptomic changes induced by T3 sustain the transition from fetal to adult patterns of gene expression. The results allow defining in molecular terms the elusive role of thyroid hormones on neocortical development. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Energy Technology Data Exchange (ETDEWEB)
Jones, J.C.; Stevsner, Tinna; Bohr, Vilhelm A. (National Cancer Institute, NIH, Bethesda, MD (USA). Division of Cancer Treatment, Laboratory of Molecular Pharmacology); Mattern, M.R. (Smith Kline Beecham Pharmaceuticals, King of Prussia, PA (USA). Department of Biomolecular Discovery)
1991-09-01
The effects were studied of some specific enzyme inhibitors on DNA repair and replication after UV damage in Chinese hamster ovary cells. The DNA repair was studied at the level of the average, overall genome and also in the active dihydrofolate reductase gene. Replication was measured in the overall genome. The inhibitors were tested of DNA poly-merase {alpha} and {delta} (aphidicolin), of poly(ADPr) polymerase (3-aminobenzamide), of ribonucleotide reductase (hydroxyurea), of topo-isomerase I (camptothecin), and of topoisomerase II (merbarone, VP-16). In addition, the effects were tested of the potential topoisomerase I activator, {beta}-lapachone. All of these compounds inhibited genome replication and all topoisomerase inhibitors affected the overall genome repair; {beta}-lapachone stimulated it. None of these compounds had any effect on the gene-specific repair. (author). 36 refs.; 3 figs.; 2 tabs.
Correlations in the population structure of music, genes and language
Brown, Steven; Savage, Patrick E.; Ko, Albert Min-Shan; Stoneking, Mark; Ko, Ying-Chin; Loo, Jun-Hun; Trejaut, Jean A.
2014-01-01
We present, to our knowledge, the first quantitative evidence that music and genes may have coevolved by demonstrating significant correlations between traditional group-level folk songs and mitochondrial DNA variation among nine indigenous populations of Taiwan. These correlations were of comparable magnitude to those between language and genes for the same populations, although music and language were not significantly correlated with one another. An examination of population structure for genetics showed stronger parallels to music than to language. Overall, the results suggest that music might have a sufficient time-depth to retrace ancient population movements and, additionally, that it might be capturing different aspects of population history than language. Music may therefore have the potential to serve as a novel marker of human migrations to complement genes, language and other markers. PMID:24225453
Directory of Open Access Journals (Sweden)
Konstantin Yarygin
Full Text Available The gut microbiota is essentially a multifunctional bioreactor within a human being. The exploration of its enormous metabolic potential provides insights into the mechanisms underlying microbial ecology and interactions with the host. The data obtained using "shotgun" metagenomics capture information about the whole spectrum of microbial functions. However, each new study presenting new sequencing data tends to extract only a little of the information concerning the metabolic potential and often omits specific functions. A meta-analysis of the available data with an emphasis on biomedically relevant gene groups can unveil new global trends in the gut microbiota. As a step toward the reuse of metagenomic data, we developed a method for the quantitative profiling of user-defined groups of genes in human gut metagenomes. This method is based on the quick analysis of a gene coverage matrix obtained by pre-mapping the metagenomic reads to a global gut microbial catalogue. The method was applied to profile the abundance of several gene groups related to antibiotic resistance, phages, biosynthesis clusters and carbohydrate degradation in 784 metagenomes from healthy populations worldwide and patients with inflammatory bowel diseases and obesity. We discovered country-wise functional specifics in gut resistome and virome compositions. The most distinct features of the disease microbiota were found for Crohn's disease, followed by ulcerative colitis and obesity. Profiling of the genes belonging to crAssphage showed that its abundance varied across the world populations and was not associated with clinical status. We demonstrated temporal resilience of crAssphage and the influence of the sample preparation protocol on its detected abundance. Our approach offers a convenient method to add value to accumulated "shotgun" metagenomic data by helping researchers state and assess novel biological hypotheses.
Greenblatt, Marc S.; Brody, Lawrence C.; Foulkes, William D.; Genuardi, Maurizio; Hofstra, Robert M. W.; Olivier, Magali; Plon, Sharon E.; Sijmons, Rolf H.; Sinilnikova, Olga; Spurdle, Amanda B.
2008-01-01
Locus-specific databases (LSDBs) are curated collections of sequence variants in genes associated with disease. LSDBs of cancer-related genes often serve as a critical resource to researchers, diagnostic laboratories, clinicians, and others in the cancer genetics community. LSDBs are poised to play
Curtis, Ross E; Kim, Seyoung; Woolford, John L; Xu, Wenjie; Xing, Eric P
2013-03-21
Association analysis using genome-wide expression quantitative trait locus (eQTL) data investigates the effect that genetic variation has on cellular pathways and leads to the discovery of candidate regulators. Traditional analysis of eQTL data via pairwise statistical significance tests or linear regression does not leverage the availability of the structural information of the transcriptome, such as presence of gene networks that reveal correlation and potentially regulatory relationships among the study genes. We employ a new eQTL mapping algorithm, GFlasso, which we have previously developed for sparse structured regression, to reanalyze a genome-wide yeast dataset. GFlasso fully takes into account the dependencies among expression traits to suppress false positives and to enhance the signal/noise ratio. Thus, GFlasso leverages the gene-interaction network to discover the pleiotropic effects of genetic loci that perturb the expression level of multiple (rather than individual) genes, which enables us to gain more power in detecting previously neglected signals that are marginally weak but pleiotropically significant. While eQTL hotspots in yeast have been reported previously as genomic regions controlling multiple genes, our analysis reveals additional novel eQTL hotspots and, more interestingly, uncovers groups of multiple contributing eQTL hotspots that affect the expression level of functional gene modules. To our knowledge, our study is the first to report this type of gene regulation stemming from multiple eQTL hotspots. Additionally, we report the results from in-depth bioinformatics analysis for three groups of these eQTL hotspots: ribosome biogenesis, telomere silencing, and retrotransposon biology. We suggest candidate regulators for the functional gene modules that map to each group of hotspots. Not only do we find that many of these candidate regulators contain mutations in the promoter and coding regions of the genes, in the case of the Ribi group
The Mycoplasma hominis vaa gene displays a mosaic gene structure
DEFF Research Database (Denmark)
Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.
1998-01-01
Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular...
Wang, Hao; Liu, Kan; Chen, Kuan-Ju; Lu, Yujie; Wang, Shutao; Lin, Wei-Yu; Guo, Feng; Kamei, Ken-ichiro; Chen, Yi-Chun; Ohashi, Minori; Wang, Mingwei; Garcia, Mitch André; Zhao, Xing-Zhong; Shen, Clifton K-F; Tseng, Hsian-Rong
2010-10-26
Nanoparticles are regarded as promising transfection reagents for effective and safe delivery of nucleic acids into a specific type of cells or tissues providing an alternative manipulation/therapy strategy to viral gene delivery. However, the current process of searching novel delivery materials is limited due to conventional low-throughput and time-consuming multistep synthetic approaches. Additionally, conventional approaches are frequently accompanied with unpredictability and continual optimization refinements, impeding flexible generation of material diversity creating a major obstacle to achieving high transfection performance. Here we have demonstrated a rapid developmental pathway toward highly efficient gene delivery systems by leveraging the powers of a supramolecular synthetic approach and a custom-designed digital microreactor. Using the digital microreactor, broad structural/functional diversity can be programmed into a library of DNA-encapsulated supramolecular nanoparticles (DNA⊂SNPs) by systematically altering the mixing ratios of molecular building blocks and a DNA plasmid. In vitro transfection studies with DNA⊂SNPs library identified the DNA⊂SNPs with the highest gene transfection efficiency, which can be attributed to cooperative effects of structures and surface chemistry of DNA⊂SNPs. We envision such a rapid developmental pathway can be adopted for generating nanoparticle-based vectors for delivery of a variety of loads.
Purification of specific structured lipids by distillation: Effects on acyl migration
DEFF Research Database (Denmark)
Xu, Xuebing; Skands, A.; Adler-Nissen, Jens
2001-01-01
The cause and effects of acyl migration during the purification of specific structured lipids by distillation were studied in a conventional batch deodorizer with stripping steam. The mixture of specific structured lipids produced by lipase-catalyzed acidolysis between rapeseed oil and capric acid...... influenced the rate of acyl migration, and their combinations made the effect more severe. However, diacylglycerols were found to be the main reason for acyl migration. In the distillation of the specific structured lipid product mixture, distillation temperature and time were the main factors to determine...... the degree of acyl migration and the extent of separation of free fatty acids. The results indicate that more efficient separation technology should be used to improve the quality of the purified structured lipids. in order to reduce the distillation temperature, vacuum should be made as low as possible...
Regulatory regions in the rat lactase-phlorizin hydrolase gene that control cell-specific expression
Verhave, Menno; Krasinski, Stephen D.; Christian, Sara I.; van Schaik, Sandrijn; van den Brink, Gijs R.; Doting, Edwina M. H.; Maas, Saskia M.; Wolthers, Katja C.; Grand, Richard J.; Montgomery, Robert K.
2004-01-01
OBJECTIVES: Lactase-phlorizin hydrolase (LPH) is an enterocyte-specific gene whose expression has been well-characterized, not only developmentally but also along the crypt-villus axis and along the length of the small bowel. Previous studies from the authors' laboratory have demonstrated that 2 kb
International Nuclear Information System (INIS)
Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi
2016-01-01
NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.
Porous silicon structures with high surface area/specific pore size
Northrup, M.A.; Yu, C.M.; Raley, N.F.
1999-03-16
Fabrication and use of porous silicon structures to increase surface area of heated reaction chambers, electrophoresis devices, and thermopneumatic sensor-actuators, chemical preconcentrates, and filtering or control flow devices. In particular, such high surface area or specific pore size porous silicon structures will be useful in significantly augmenting the adsorption, vaporization, desorption, condensation and flow of liquids and gases in applications that use such processes on a miniature scale. Examples that will benefit from a high surface area, porous silicon structure include sample preconcentrators that are designed to adsorb and subsequently desorb specific chemical species from a sample background; chemical reaction chambers with enhanced surface reaction rates; and sensor-actuator chamber devices with increased pressure for thermopneumatic actuation of integrated membranes. Examples that benefit from specific pore sized porous silicon are chemical/biological filters and thermally-activated flow devices with active or adjacent surfaces such as electrodes or heaters. 9 figs.
Parent-of-origin dependent gene-specific knock down in mouse embryos
International Nuclear Information System (INIS)
Iqbal, Khursheed; Kues, Wilfried A.; Niemann, Heiner
2007-01-01
In mice hemizygous for the Oct4-GFP transgene, the F1 embryos show parent-of-origin dependent expression of the marker gene. F1 embryos with a maternally derived OG2 allele (OG2 mat /-) express GFP in the oocyte and during preimplantation development until the blastocyst stage indicating a maternal and embryonic expression pattern. F1-embryos with a paternally inherited OG2 allele (OG2 pat /-) express GFP from the 4- to 8-cell stage onwards showing only embryonic expression. This allows to study allele specific knock down of GFP expression. RNA interference (RNAi) was highly efficient in embryos with the paternally inherited GFP allele, whereas embryos with the maternally inherited GFP allele showed a delayed and less stringent suppression, indicating that the initial levels of the target transcript and the half life of the protein affect RNAi efficacy. RT-PCR analysis revealed only minimum of GFP mRNA. These results have implications for studies of gene silencing in mammalian embryos
Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir
2015-01-22
Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production
de Krom, Mariken; van der Schouw, Yvonne T.; Hendriks, Judith; Ophoff, Roel A.; van Gils, Carla H.; Stolk, Ronald P.; Grobbee, Diederick E.; Adan, Roger
Obesity has a heritable component; however, the heterogeneity of obesity complicates dissection of its genetic background. In this study, we therefore focused on eating patterns as specific traits within obesity. These traits have a heritable component; genes associated with a specific eating
Directory of Open Access Journals (Sweden)
Raymond L Fields
Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.
Presence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria
Directory of Open Access Journals (Sweden)
Lindblad Peter
2003-05-01
Full Text Available Abstract Background Hydrogenases catalyze the simplest of all chemical reactions: the reduction of protons to molecular hydrogen or vice versa. Cyanobacteria can express an uptake, a bidirectional or both NiFe-hydrogenases. Maturation of those depends on accessory proteins encoded by hyp-genes. The last maturation step involves the cleavage of a ca. 30 amino acid long peptide from the large subunit by a C-terminal endopeptidase. Until know, nothing is known about the maturation of cyanobacterial NiFe-hydrogenases. The availability of three complete cyanobacterial genome sequences from strains with either only the uptake (Nostoc punctiforme ATCC 29133/PCC 73102, only the bidirectional (Synechocystis PCC 6803 or both NiFe-hydrogenases (Anabaena PCC 7120 prompted us to mine these genomes for hydrogenase maturation related genes. In this communication we focus on the presence and the expression of the NiFe-hydrogenases and the corresponding C-terminal endopeptidases, in the three strains mentioned above. Results We identified genes encoding putative cyanobacterial hydrogenase specific C-terminal endopeptidases in all analyzed cyanobacterial genomes. The genes are not part of any known hydrogenase related gene cluster. The derived amino acid sequences show only low similarity (28–41% to the well-analyzed hydrogenase specific C-terminal endopeptidase HybD from Escherichia coli, the crystal structure of which is known. However, computational secondary and tertiary structure modeling revealed the presence of conserved structural patterns around the highly conserved active site. Gene expression analysis shows that the endopeptidase encoding genes are expressed under both nitrogen-fixing and non-nitrogen-fixing conditions. Conclusion Anabaena PCC 7120 possesses two NiFe-hydrogenases and two hydrogenase specific C-terminal endopeptidases but only one set of hyp-genes. Thus, in contrast to the Hyp-proteins, the C-terminal endopeptidases are the only known
Hemarajata, P; Gao, C; Pflughoeft, K J; Thomas, C M; Saulnier, D M; Spinler, J K; Versalovic, J
2013-12-01
Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes that were highly expressed during the stationary phase of growth, when TNF suppression is most potent. One such gene was found to be a regulator of genes involved in histidine-histamine metabolism by this probiotic species. During the course of these studies, this gene was renamed the Lactobacillus reuteri-specific immunoregulatory (rsiR) gene. The rsiR gene is essential for human TNF suppression by L. reuteri and expression of the histidine decarboxylase (hdc) gene cluster on the L. reuteri chromosome. Inactivation of rsiR resulted in diminished TNF suppression in vitro and reduced anti-inflammatory effects in vivo in a trinitrobenzene sulfonic acid (TNBS)-induced mouse model of acute colitis. A L. reuteri strain lacking an intact rsiR gene was unable to suppress colitis and resulted in greater concentrations of serum amyloid A (SAA) in the bloodstream of affected animals. The PhdcAB promoter region targeted by rsiR was defined by reporter gene experiments. These studies support the presence of a regulatory gene, rsiR, which modulates the expression of a gene cluster known to mediate immunoregulation by probiotics at the transcriptional level. These findings may point the way toward new strategies for controlling gene expression in probiotics by dietary interventions or microbiome manipulation.
Yoshikawa, Mamoru; Kojima, Hiromi; Wada, Kota; Tsukidate, Toshiharu; Okada, Naoko; Saito, Hirohisa; Moriyama, Hiroshi
2006-07-01
To investigate the role of fibroblasts in the pathogenesis of cholesteatoma. Tissue specimens were obtained from our patients. Middle ear cholesteatoma-derived fibroblasts (MECFs) and postauricular skin-derived fibroblasts (SFs) as controls were then cultured for a few weeks. These fibroblasts were stimulated with interleukin (IL) 1alpha and/or IL-1beta before gene expression assays. We used the human genome U133A probe array (GeneChip) and real-time polymerase chain reaction to examine and compare the gene expression profiles of the MECFs and SFs. Six patients who had undergone tympanoplasty. The IL-1alpha-regulated genes were classified into 4 distinct clusters on the basis of profiles differentially regulated by SF and MECF using a hierarchical clustering analysis. The messenger RNA expressions of LARC (liver and activation-regulated chemokine), GMCSF (granulocyte-macrophage colony-stimulating factor), epiregulin, ICAM1 (intercellular adhesion molecule 1), and TGFA (transforming growth factor alpha) were more strongly up-regulated by IL-1alpha and/or IL-1beta in MECF than in SF, suggesting that these fibroblasts derived from different tissues retained their typical gene expression profiles. Fibroblasts may play a role in hyperkeratosis of middle ear cholesteatoma by releasing molecules involved in inflammation and epidermal growth. These fibroblasts may retain tissue-specific characteristics presumably controlled by epigenetic mechanisms.
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Energy Technology Data Exchange (ETDEWEB)
Spencer, Virginia A.; Xu, Ren; Bissell, Mina J.
2006-08-01
Almost three decades ago, we presented a model where theextracellular matrix (ECM) was postulated to influence gene expressionand tissue-specificity through the action of ECM receptors and thecytoskeleton. This hypothesis implied that ECM molecules could signal tothe nucleus and that the unit of function in higher organisms was not thecell alone, but the cell plus its microenvironment. We now know that ECMinvokes changes in tissue and organ architecture and that tissue, cell,nuclear, and chromatin structure are changed profoundly as a result ofand during malignant progression. Whereas some evidence has beengenerated for a link between ECM-induced alterations in tissuearchitecture and changes in both nuclear and chromatin organization, themanner by which these changes actively induce or repress gene expressionin normal and malignant cells is a topic in need of further attention.Here, we will discuss some key findings that may provide insights intomechanisms through which ECM could influence gene transcription and howtumor cells acquire the ability to overcome these levels ofcontrol.
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
Haplotype specific alteration of diabetes MHC risk by olfactory receptor gene polymorphism.
Jahromi, Mohamed M
2012-12-01
Evidence for genes associated with risk for Type 1 diabetes (T1D) in the extended region of the major histocompatibility complex (MHC) genes is accumulating. The aim of this study was to investigate the association pattern of the extended MHC region with T1D susceptibility to identify effects independent of well established DR/DQ genes. A total of 394 Europid families with T1D were genotyped for the single nucleotide polymorphism (SNP) in the olfactory receptor family 14, subfamily J, member 1 (OR14J1) gene, rs9257691, in the MHC telomeric region. The OR provides "an internal depiction of our external world" through the capture of odorant molecules in the main OR system by several large families of G-protein coupled receptors (GPCR). These receptors transduce and chemosignals into the central nervous system (CNS). This SNP was chosen to identify its association with T1D. Interestingly, OR14J1C allele was significantly associated with T1D that seems to go with DRB1*0401, Χ(2)=10.9, p=0.0003. However, by fixing both genes of DR*0401-DQB1*0302, high risk, the association of T1D with OR14J1C still existed, Χ(2)=7.4, p=0.005. The occurrence of association of the OR14J1C allele with T1D patients with DRB1*401/DQB1*0302 is an independent risk for T1D. As an accumulative report suggests the role of OR in the pathogenesis of diabetic microvascular and other diabetic complications, undoubtedly, this haplotype specific alteration of T1D risk is an independent risk for the disease and can address the promising MHC-linked gene other than DR/DQ. Moreover, there is nothing to hinder for that this might be a signal that identifies the role of OR gene in the pathogenesis of T1D in patients who are prone to diabetic complications. Copyright © 2012. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Simmons David K
2012-01-01
Full Text Available Abstract Background Nervous systems are thought to be important to the evolutionary success and diversification of metazoans, yet little is known about the origin of simple nervous systems at the base of the animal tree. Recent data suggest that ctenophores, a group of macroscopic pelagic marine invertebrates, are the most ancient group of animals that possess a definitive nervous system consisting of a distributed nerve net and an apical statocyst. This study reports on details of the evolution of the neural cell type specifying transcription factor family of LIM homeobox containing genes (Lhx, which have highly conserved functions in neural specification in bilaterian animals. Results Using next generation sequencing, the first draft of the genome of the ctenophore Mnemiopsis leidyi has been generated. The Lhx genes in all animals are represented by seven subfamilies (Lhx1/5, Lhx3/4, Lmx, Islet, Lhx2/9, Lhx6/8, and LMO of which four were found to be represented in the ctenophore lineage (Lhx1/5, Lhx3/4, Lmx, and Islet. Interestingly, the ctenophore Lhx gene complement is more similar to the sponge complement (sponges do not possess neurons than to either the cnidarian-bilaterian or placozoan Lhx complements. Using whole mount in situ hybridization, the Lhx gene expression patterns were examined and found to be expressed around the blastopore and in cells that give rise to the apical organ and putative neural sensory cells. Conclusion This research gives us a first look at neural cell type specification in the ctenophore M. leidyi. Within M. leidyi, Lhx genes are expressed in overlapping domains within proposed neural cellular and sensory cell territories. These data suggest that Lhx genes likely played a conserved role in the patterning of sensory cells in the ancestor of sponges and ctenophores, and may provide a link to the expression of Lhx orthologs in sponge larval photoreceptive cells. Lhx genes were later co-opted into patterning more
International Nuclear Information System (INIS)
Hering, Thomas M.; Kazmi, Najam H.; Huynh, Tru D.; Kollar, John; Xu, Laura; Hunyady, Aaron B.; Johnstone, Brian
2004-01-01
As part of a study to identify novel transcriptional regulators of chondrogenesis-related gene expression, we have cloned and characterized cDNA for zinc-finger protein 470 (ZNF470), the human ortholog of which encodes a 717 amino acid residue protein containing 17 Cys 2 His 2 zinc-finger domains, as well as KRAB-A and KRAB-B motifs. The cDNA library used to isolate the initial ZNF470 clone was prepared from human bone marrow-derived mesenchymal progenitor cells at an intermediate stage of chondrogenic differentiation. We have determined the intron-exon structure of the human ZNF470 gene, which has been mapped to a zinc-finger cluster in a known imprinted region of human chromosome 19q13.4. ZNF470 is expressed at high levels in human testis and is expressed at low or undetectible levels in other adult tissues. Human ZNF470 expressed in mammalian cells as an EGFP fusion protein localizes predominantly to the nucleus, consistent with a role in transcriptional regulation. ZNF470, analyzed by quantitative real time PCR, was transiently expressed before the maximal expression of COL2A1 during chondrogenic differentiation in vitro. We have also characterized the bovine ortholog of human ZNF470, which encodes a 508 amino acid residue protein having 10 zinc-finger domains. A bovine ZNF470 cDNA clone was used to examine expression of ZNF470 in bovine articular chondrocytes treated with retinoic acid to stimulate dedifferentiation. Bovine ZNF470 expression was undetectable in freshly isolated bovine articular chondrocytes, but was dramatically upregulated in dedifferentiated retinoic acid-treated chondrocytes. These results, in two model systems, suggest a possible role for ZNF470 in the regulation of chondrogenesis-specific gene expression
Directory of Open Access Journals (Sweden)
Je-Hyuk Lee
2009-11-01
Full Text Available Normal variation in gene expression due to regulatory polymorphisms is often masked by biological and experimental noise. In addition, some regulatory polymorphisms may become apparent only in specific tissues. We derived human induced pluripotent stem (iPS cells from adult skin primary fibroblasts and attempted to detect tissue-specific cis-regulatory variants using in vitro cell differentiation. We used padlock probes and high-throughput sequencing for digital RNA allelotyping and measured allele-specific gene expression in primary fibroblasts, lymphoblastoid cells, iPS cells, and their differentiated derivatives. We show that allele-specific expression is both cell type and genotype-dependent, but the majority of detectable allele-specific expression loci remains consistent despite large changes in the cell type or the experimental condition following iPS reprogramming, except on the X-chromosome. We show that our approach to mapping cis-regulatory variants reduces in vitro experimental noise and reveals additional tissue-specific variants using skin-derived human iPS cells.
Directory of Open Access Journals (Sweden)
Chun-Nun Chao
Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin
2016-01-01
Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Czech Academy of Sciences Publication Activity Database
Stratil, Antonín; Horák, Pavel; Filkuková, Jitka; Van Poucke, M.; Bartenschlager, H.; Peelman, L. J.; Geldermann, H.
2010-01-01
Roč. 41, - (2010), s. 558-559 ISSN 0268-9146 R&D Projects: GA ČR(CZ) GA523/06/1302; GA ČR GA523/09/0844 Institutional research plan: CEZ:AV0Z50450515 Keywords : genomic structure * muscle-specific genes * porcine Subject RIV: GI - Animal Husbandry ; Breeding Impact factor: 2.203, year: 2010
Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya
2014-05-01
Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S
2012-08-19
Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Gene expression and gene therapy imaging
International Nuclear Information System (INIS)
Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.
2007-01-01
The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)
Directory of Open Access Journals (Sweden)
Agata Jedrzejuk
2012-01-01
Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.
Giuliani, Alessandro; Tomita, Masaru
2010-01-01
Cell fate decision remarkably generates specific cell differentiation path among the multiple possibilities that can arise through the complex interplay of high-dimensional genome activities. The coordinated action of thousands of genes to switch cell fate decision has indicated the existence of stable attractors guiding the process. However, origins of the intracellular mechanisms that create “cellular attractor” still remain unknown. Here, we examined the collective behavior of genome-wide expressions for neutrophil differentiation through two different stimuli, dimethyl sulfoxide (DMSO) and all-trans-retinoic acid (atRA). To overcome the difficulties of dealing with single gene expression noises, we grouped genes into ensembles and analyzed their expression dynamics in correlation space defined by Pearson correlation and mutual information. The standard deviation of correlation distributions of gene ensembles reduces when the ensemble size is increased following the inverse square root law, for both ensembles chosen randomly from whole genome and ranked according to expression variances across time. Choosing the ensemble size of 200 genes, we show the two probability distributions of correlations of randomly selected genes for atRA and DMSO responses overlapped after 48 hours, defining the neutrophil attractor. Next, tracking the ranked ensembles' trajectories, we noticed that only certain, not all, fall into the attractor in a fractal-like manner. The removal of these genome elements from the whole genomes, for both atRA and DMSO responses, destroys the attractor providing evidence for the existence of specific genome elements (named “genome vehicle”) responsible for the neutrophil attractor. Notably, within the genome vehicles, genes with low or moderate expression changes, which are often considered noisy and insignificant, are essential components for the creation of the neutrophil attractor. Further investigations along with our findings might
Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R
1995-09-01
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II
Structural influence of gene networks on their inference: analysis of C3NET
Directory of Open Access Journals (Sweden)
Emmert-Streib Frank
2011-06-01
Full Text Available Abstract Background The availability of large-scale high-throughput data possesses considerable challenges toward their functional analysis. For this reason gene network inference methods gained considerable interest. However, our current knowledge, especially about the influence of the structure of a gene network on its inference, is limited. Results In this paper we present a comprehensive investigation of the structural influence of gene networks on the inferential characteristics of C3NET - a recently introduced gene network inference algorithm. We employ local as well as global performance metrics in combination with an ensemble approach. The results from our numerical study for various biological and synthetic network structures and simulation conditions, also comparing C3NET with other inference algorithms, lead a multitude of theoretical and practical insights into the working behavior of C3NET. In addition, in order to facilitate the practical usage of C3NET we provide an user-friendly R package, called c3net, and describe its functionality. It is available from https://r-forge.r-project.org/projects/c3net and from the CRAN package repository. Conclusions The availability of gene network inference algorithms with known inferential properties opens a new era of large-scale screening experiments that could be equally beneficial for basic biological and biomedical research with auspicious prospects. The availability of our easy to use software package c3net may contribute to the popularization of such methods. Reviewers This article was reviewed by Lev Klebanov, Joel Bader and Yuriy Gusev.
Directory of Open Access Journals (Sweden)
Power Deborah M
2010-12-01
Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which
Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence
Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.
2009-01-01
Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function
Directory of Open Access Journals (Sweden)
Jingjing Zhai
2016-12-01
Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.
Horiuchi, Youko; Harushima, Yoshiaki; Fujisawa, Hironori; Mochizuki, Takako; Fujita, Masahiro; Ohyanagi, Hajime; Kurata, Nori
2015-01-01
Abstract Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis
Engaging Students in a Bioinformatics Activity to Introduce Gene Structure and Function
Directory of Open Access Journals (Sweden)
Barbara J. May
2013-02-01
Full Text Available Bioinformatics spans many fields of biological research and plays a vital role in mining and analyzing data. Therefore, there is an ever-increasing need for students to understand not only what can be learned from this data, but also how to use basic bioinformatics tools. This activity is designed to provide secondary and undergraduate biology students to a hands-on activity meant to explore and understand gene structure with the use of basic bioinformatic tools. Students are provided an “unknown” sequence from which they are asked to use a free online gene finder program to identify the gene. Students then predict the putative function of this gene with the use of additional online databases.
Use of tiling array data and RNA secondary structure predictions to identify noncoding RNA genes
DEFF Research Database (Denmark)
Weile, Christian; Gardner, Paul P; Hedegaard, Mads M
2007-01-01
neuroblastoma cell line SK-N-AS. Using this strategy, we identify thousands of human candidate RNA genes. To further verify the expression of these genes, we focused on candidate genes that had a stable hairpin structures or a high level of covariance. Using northern blotting, we verify the expression of 2 out...
Perceptual learning is specific to the trained structure of information.
Cohen, Yamit; Daikhin, Luba; Ahissar, Merav
2013-12-01
What do we learn when we practice a simple perceptual task? Many studies have suggested that we learn to refine or better select the sensory representations of the task-relevant dimension. Here we show that learning is specific to the trained structural regularities. Specifically, when this structure is modified after training with a fixed temporal structure, performance regresses to pretraining levels, even when the trained stimuli and task are retained. This specificity raises key questions as to the importance of low-level sensory modifications in the learning process. We trained two groups of participants on a two-tone frequency discrimination task for several days. In one group, a fixed reference tone was consistently presented in the first interval (the second tone was higher or lower), and in the other group the same reference tone was consistently presented in the second interval. When following training, these temporal protocols were switched between groups, performance of both groups regressed to pretraining levels, and further training was needed to attain postlearning performance. ERP measures, taken before and after training, indicated that participants implicitly learned the temporal regularity of the protocol and formed an attentional template that matched the trained structure of information. These results are consistent with Reverse Hierarchy Theory, which posits that even the learning of simple perceptual tasks progresses in a top-down manner, hence can benefit from temporal regularities at the trial level, albeit at the potential cost that learning may be specific to these regularities.
tRNA gene diversity in the three domains of life
Directory of Open Access Journals (Sweden)
Kosuke eFujishima
2014-05-01
Full Text Available Transfer RNA (tRNA is widely known for its key role in decoding mRNA into protein. Despite their necessity and relatively short nucleotide sequences, a large diversity of gene structures and RNA secondary structures of pre-tRNAs and mature tRNAs have recently been discovered in the three domains of life. Growing evidences of disrupted tRNA genes in the genomes of Archaea reveals unique gene structures such as, intron-containing tRNA, split tRNA, and permuted tRNA. Coding sequence for these tRNAs are either separated with introns, fragmented, or permuted at the genome level. Although evolutionary scenario behind the tRNA gene disruption is still unclear, diversity of tRNA structure seems to be co-evolved with their processing enzyme, so-called RNA splicing endonuclease. Metazoan mitochondrial tRNAs (mtRNAs are known for their unique lack of either one or two arms from the typical tRNA cloverleaf structure, while still maintaining functionality. Recently identified nematode-specific V-arm containing tRNAs (nev-tRNAs possess long variable arms that are specific to eukaryotic class II tRNASer and tRNALeu but also decode class I tRNA codons. Moreover, many tRNA-like sequences have been found in the genomes of different organisms and viruses. Thus this review is aimed to cover the latest knowledge on tRNA gene diversity and further recapitulate the evolutionary and biological aspects that caused such uniqueness.
Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi
2016-01-01
Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.
Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S
2017-01-01
Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Cell-Specific Actions of a Human LHX3 Gene Enhancer During Pituitary and Spinal Cord Development
Park, Soyoung; Mullen, Rachel D.
2013-01-01
The LIM class of homeodomain protein 3 (LHX3) transcription factor is essential for pituitary gland and nervous system development in mammals. In humans, mutations in the LHX3 gene underlie complex pediatric syndromes featuring deficits in anterior pituitary hormones and defects in the nervous system. The mechanisms that control temporal and spatial expression of the LHX3 gene are poorly understood. The proximal promoters of the human LHX3 gene are insufficient to guide expression in vivo and downstream elements including a conserved enhancer region appear to play a role in tissue-specific expression in the pituitary and nervous system. Here we characterized the activity of this downstream enhancer region in regulating gene expression at the cellular level during development. Human LHX3 enhancer-driven Cre reporter transgenic mice were generated to facilitate studies of enhancer actions. The downstream LHX3 enhancer primarily guides gene transcription in α-glycoprotein subunit -expressing cells secreting the TSHβ, LHβ, or FSHβ hormones and expressing the GATA2 and steroidogenic factor 1 transcription factors. In the developing nervous system, the enhancer serves as a targeting module active in V2a interneurons. These results demonstrate that the downstream LHX3 enhancer is important in specific endocrine and neural cell types but also indicate that additional regulatory elements are likely involved in LHX3 gene expression. Furthermore, these studies revealed significant gonadotrope cell heterogeneity during pituitary development, providing insights into the cellular physiology of this key reproductive regulatory cell. The human LHX3 enhancer-driven Cre reporter transgenic mice also provide a valuable tool for further developmental studies of cell determination and differentiation in the pituitary and nervous system. PMID:24100213
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense
Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells.
Directory of Open Access Journals (Sweden)
Yan Huang
Full Text Available A recently developed strategy of sequencing alternative polyadenylation (APA sites (SAPAS with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here, we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs and differentiated mouse embryonic fibroblast cells (MEFs as controls. As a result, we obtained 99,944 poly(A sites, approximately 40% of which were newly detected in our experiments. These poly(A sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site
Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells
Lin, Zhuoheng; Feng, Xuyang; Jiang, Xue; Songyang, Zhou; Huang, Junjiu
2015-01-01
A recently developed strategy of sequencing alternative polyadenylation (APA) sites (SAPAS) with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs) maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here), we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS) and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs) and differentiated mouse embryonic fibroblast cells (MEFs) as controls. As a result, we obtained 99,944 poly(A) sites, approximately 40% of which were newly detected in our experiments. These poly(A) sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA) genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A) switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A) site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site profiles and
In vitro assembly of a prohead-like structure of the Rhodobacter capsulatus gene transfer agent
International Nuclear Information System (INIS)
Spano, Anthony J.; Chen, Frank S.; Goodman, Benjamin E.; Sabat, Agnes E.; Simon, Martha N.; Wall, Joseph S.; Correia, John J.; McIvor, Wilson; Newcomb, William W.; Brown, Jay C.; Schnur, Joel M.; Lebedev, Nikolai
2007-01-01
The gene transfer agent (GTA) is a phage-like particle capable of exchanging double-stranded DNA fragments between cells of the photosynthetic bacterium Rhodobacter capsulatus. Here we show that the major capsid protein of GTA, expressed in E. coli, can be assembled into prohead-like structures in the presence of calcium ions in vitro. Transmission electron microscopy (TEM) of uranyl acetate staining material and thin sections of glutaraldehyde-fixed material demonstrates that these associates have spherical structures with diameters in the range of 27-35 nm. The analysis of scanning TEM images revealed particles of mass ∼ 4.3 MDa, representing 101 ± 11 copies of the monomeric subunit. The establishment of this simple and rapid method to form prohead-like particles permits the GTA system to be used for genome manipulation within the photosynthetic bacterium, for specific targeted drug delivery, and for the construction of biologically based distributed autonomous sensors for environmental monitoring
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Directory of Open Access Journals (Sweden)
Suyan Tian
Full Text Available The existence of fundamental differences between lung adenocarcinoma (AC and squamous cell carcinoma (SCC in their underlying mechanisms motivated us to postulate that specific genes might exist relevant to prognosis of each histology subtype. To test on this research hypothesis, we previously proposed a simple Cox-regression model based feature selection algorithm and identified successfully some subtype-specific prognostic genes when applying this method to real-world data. In this article, we continue our effort on identification of subtype-specific prognostic genes for AC and SCC, and propose a novel embedded feature selection method by extending Threshold Gradient Descent Regularization (TGDR algorithm and minimizing on a corresponding negative partial likelihood function. Using real-world datasets and simulated ones, we show these two proposed methods have comparable performance whereas the new proposal is superior in terms of model parsimony. Our analysis provides some evidence on the existence of such subtype-specific prognostic genes, more investigation is warranted.
Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V
2012-11-01
Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling
2012-10-01
To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.
DEFF Research Database (Denmark)
Andersen, Jannik N; Jansen, Peter G; Echwald, Søren M
2004-01-01
sequence databases, we discovered one novel human PTP gene and defined chromosomal loci and exon structure of the additional 37 genes encoding known PTP transcripts. Direct orthologs were present in the mouse genome for all 38 human PTP genes. In addition, we identified 12 PTP pseudogenes unique to humans...... that have probably contaminated previous bioinformatics analysis of this gene family. PCR amplification and transcript sequencing indicate that some PTP pseudogenes are expressed, but their function (if any) is unknown. Furthermore, we analyzed the enhanced diversity generated by alternative splicing...
Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression
Energy Technology Data Exchange (ETDEWEB)
Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..
2000-02-01
Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.
Moreno, Renata; Fonseca, Pilar; Rojo, Fernando
2010-08-06
In Pseudomonas putida, the expression of the pWW0 plasmid genes for the toluene/xylene assimilation pathway (the TOL pathway) is subject to complex regulation in response to environmental and physiological signals. This includes strong inhibition via catabolite repression, elicited by the carbon sources that the cells prefer to hydrocarbons. The Crc protein, a global regulator that controls carbon flow in pseudomonads, has an important role in this inhibition. Crc is a translational repressor that regulates the TOL genes, but how it does this has remained unknown. This study reports that Crc binds to sites located at the translation initiation regions of the mRNAs coding for XylR and XylS, two specific transcription activators of the TOL genes. Unexpectedly, eight additional Crc binding sites were found overlapping the translation initiation sites of genes coding for several enzymes of the pathway, all encoded within two polycistronic mRNAs. Evidence is provided supporting the idea that these sites are functional. This implies that Crc can differentially modulate the expression of particular genes within polycistronic mRNAs. It is proposed that Crc controls TOL genes in two ways. First, Crc inhibits the translation of the XylR and XylS regulators, thereby reducing the transcription of all TOL pathway genes. Second, Crc inhibits the translation of specific structural genes of the pathway, acting mainly on proteins involved in the first steps of toluene assimilation. This ensures a rapid inhibitory response that reduces the expression of the toluene/xylene degradation proteins when preferred carbon sources become available.
Smith-Keune, C; Dove, S
2008-01-01
Recent incidences of mass coral bleaching indicate that major reef building corals are increasingly suffering thermal stress associated with climate-related temperature increases. The development of pulse amplitude modulated (PAM) fluorometry has enabled rapid detection of the onset of thermal stress within coral algal symbionts, but sensitive biomarkers of thermal stress specific to the host coral have been slower to emerge. Differential display reverse transcription polymerase chain reaction (DDRT-PCR) was used to produce fingerprints of gene expression for the reef-building coral Acropora millepora exposed to 33 degrees C. Changes in the expression of 23 out of 399 putative genes occurred within 144 h. Down-regulation of one host-specific gene (AmA1a) occurred within just 6 h. Full-length sequencing revealed the product of this gene to be an all-protein chromatophore (green fluorescent protein [GFP]-homolog). RT-PCR revealed consistent down-regulation of this GFP-homolog for three replicate colonies within 6 h at both 32 degrees C and 33 degrees C but not at lower temperatures. Down-regulation of this host gene preceded significant decreases in the photosynthetic activity of photosystem II (dark-adapted F (v)/F (m)) of algal symbionts as measured by PAM fluorometry. Gene expression of host-specific genes such as GFP-homologs may therefore prove to be highly sensitive indicators for the onset of thermal stress within host coral cells.
Rumnieks, Janis; Tars, Kaspars
2014-03-06
The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein-RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-specific contacts with the protein. Unlike in other RNA phages, the Qβ coat protein does not utilize an adenine-recognition pocket for binding a bulged adenine base in the hairpin stem but instead uses a stacking interaction with a tyrosine side chain to accommodate the base. The extended loop between β strands E and F of Qβ coat protein makes contacts with the lower part of the RNA stem, explaining the greater length dependence of the RNA helix for optimal binding to the protein. Consequently, the complex structure allows the proposal of a mechanism by which the Qβ coat protein recognizes and discriminates in favor of its cognate RNA. © 2013.
International Nuclear Information System (INIS)
Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.
2010-01-01
Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.
Directory of Open Access Journals (Sweden)
Mo-bin Cheng
2014-12-01
Full Text Available Histone lysine (K residues, which are modified by methyl- and acetyl-transferases, diversely regulate RNA synthesis. Unlike the ubiquitously activating effect of histone K acetylation, the effects of histone K methylation vary with the number of methyl groups added and with the position of these groups in the histone tails. Histone K demethylases (KDMs counteract the activity of methyl-transferases and remove methyl group(s from specific K residues in histones. KDM3A (also known as JHDM2A or JMJD1A is an H3K9me2/1 demethylase. KDM3A performs diverse functions via the regulation of its associated genes, which are involved in spermatogenesis, metabolism, and cell differentiation. However, the mechanism by which the activity of KDM3A is regulated is largely unknown. Here, we demonstrated that mitogen- and stress-activated protein kinase 1 (MSK1 specifically phosphorylates KDM3A at Ser264 (p-KDM3A, which is enriched in the regulatory regions of gene loci in the human genome. p-KDM3A directly interacts with and is recruited by the transcription factor Stat1 to activate p-KDM3A target genes under heat shock conditions. The demethylation of H3K9me2 at the Stat1 binding site specifically depends on the co-expression of p-KDM3A in the heat-shocked cells. In contrast to heat shock, IFN-γ treatment does not phosphorylate KDM3A via MSK1, thereby abrogating its downstream effects. To our knowledge, this is the first evidence that a KDM can be modified via phosphorylation to determine its specific binding to target genes in response to thermal stress.
Directory of Open Access Journals (Sweden)
Ribal María
2008-06-01
Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.
Directory of Open Access Journals (Sweden)
Amy L Bauer
2010-11-01
Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.
Templated Synthesis of Single-Walled Carbon Nanotubes with Specific Structure.
Yang, Feng; Wang, Xiao; Li, Meihui; Liu, Xiyan; Zhao, Xiulan; Zhang, Daqi; Zhang, Yan; Yang, Juan; Li, Yan
2016-04-19
Single-walled carbon nanotubes (SWNTs) have shown great potential in various applications attributed to their unique structure-dependent properties. Therefore, the controlled preparation of chemically and structurally pristine SWNTs is a crucial issue for their advanced applications (e.g., nanoelectronics) and has been a great challenge for two decades. Epitaxial growth from well-defined seeds has been shown to be a promising strategy to control the structure of SWNTs. Segments of carbon nanotubes, including short pipes from cutting of preformed nanotubes and caps from opening of fullerenes or cyclodehydrogenation of polycyclic hydrocarbon precursors, have been used as the seeds to grow SWNTs. Single-chirality SWNTs were obtained with both presorted chirality-pure SWNT segments and end caps obtained from polycyclic hydrocarbon molecules with designed structure. The main challenges of nanocarbon-segment-seeded processes are the stability of the seeds, yield, and efficiency. Catalyst-mediated SWNT growth is believed to be more efficient. The composition and morphology of the catalyst nanoparticles have been widely reported to affect the chirality distribution of SWNTs. However, chirality-specific SWNT growth is hard to achieve by alternating catalysts. The specificity of enzyme-catalyzed reactions brings us an awareness of the essentiality of a unique catalyst structure for the chirality-selective growth of SWNTs. Only catalysts with the desired atomic arrangements in their crystal planes can act as structural templates for chirality-specific growth of SWNTs. We have developed a new family of catalysts, tungsten-based intermetallic compounds, which have high melting points and very special crystal structures, to facilitate the growth of SWNTs with designed chirality. By the use of W6Co7 catalysts, (12,6) SWNTs were directly grown with purity higher than 92%. Both high-resolution transmission electron microscopy measurements and density functional theory simulations
Wu, Shwu-Yuan; Lee, A-Young; Lai, Hsien-Tsung; Zhang, Hong; Chiang, Cheng-Ming
2013-03-07
Bromodomain-containing protein 4 (Brd4) is an epigenetic reader and transcriptional regulator recently identified as a cancer therapeutic target for acute myeloid leukemia, multiple myeloma, and Burkitt's lymphoma. Although chromatin targeting is a crucial function of Brd4, there is little understanding of how bromodomains that bind acetylated histones are regulated, nor how the gene-specific activity of Brd4 is determined. Via interaction screen and domain mapping, we identified p53 as a functional partner of Brd4. Interestingly, Brd4 association with p53 is modulated by casein kinase II (CK2)-mediated phosphorylation of a conserved acidic region in Brd4 that selectively contacts either a juxtaposed bromodomain or an adjacent basic region to dictate the ability of Brd4 binding to chromatin and also the recruitment of p53 to regulated promoters. The unmasking of bromodomains and activator recruitment, concurrently triggered by the CK2 phospho switch, provide an intriguing mechanism for gene-specific targeting by a universal epigenetic reader. Copyright © 2013 Elsevier Inc. All rights reserved.
Development of Non-Viral, Trophoblast-Specific Gene Delivery for Placental Therapy.
Directory of Open Access Journals (Sweden)
Noura Abd Ellah
Full Text Available Low birth weight is associated with both short term problems and the fetal programming of adult onset diseases, including an increased risk of obesity, diabetes and cardiovascular disease. Placental insufficiency leading to intrauterine growth restriction (IUGR contributes to the prevalence of diseases with developmental origins. Currently there are no therapies for IUGR or placental insufficiency. To address this and move towards development of an in utero therapy, we employ a nanostructure delivery system complexed with the IGF-1 gene to treat the placenta. IGF-1 is a growth factor critical to achieving appropriate placental and fetal growth. Delivery of genes to a model of human trophoblast and mouse placenta was achieved using a diblock copolymer (pHPMA-b-pDMAEMA complexed to hIGF-1 plasmid DNA under the control of trophoblast-specific promoters (Cyp19a or PLAC1. Transfection efficiency of pEGFP-C1-containing nanocarriers in BeWo cells and non-trophoblast cells was visually assessed via fluorescence microscopy. In vivo transfection and functionality was assessed by direct placental-injection into a mouse model of IUGR. Complexes formed using pHPMA-b-pDMAEMA and CYP19a-923 or PLAC1-modified plasmids induce trophoblast-selective transgene expression in vitro, and placental injection of PLAC1-hIGF-1 produces measurable RNA expression and alleviates IUGR in our mouse model, consequently representing innovative building blocks towards human placental gene therapies.
Energy Technology Data Exchange (ETDEWEB)
Noel, K. Dale [Marquette Univ., Milwaukee,WI (United States)
2008-12-07
the roles of other important bacterial factors at multiple stages of nodule development. The project also investigated the biosynthesis of this bacterial factor. It has a complex structure and the first accomplishment was the determination of the sequences of genetic regions known to be important. Next the discovered genes were mutated to identify the 26 that are required for its synthesis. In addition, six others were discovered that are believed to change its structure under various environmental conditions. By studying mutants affected in specific genes, genes were associated with each of the predicted steps in the biosynthesis. Current work is testing the predicted biosynthetic model with studies conducted in vitro with bacterial extracts. Overall, the work funded by this grant establishes this system as a model for host-bacterial interactions based on specific polysaccharide structure. All areas that are needed for a comprehensive model have been significantly advanced: the biological function, the structural features that are crucial, the complete set of bacterial genes involved, and a model for the biosynthesis.
Olival, Kevin J; Dick, Carl W; Simmons, Nancy B; Morales, Juan Carlos; Melnick, Don J; Dittmar, Katharina; Perkins, Susan L; Daszak, Peter; Desalle, Rob
2013-08-08
Population-level studies of parasites have the potential to elucidate patterns of host movement and cross-species interactions that are not evident from host genealogy alone. Bat flies are obligate and generally host-specific blood-feeding parasites of bats. Old-World flies in the family Nycteribiidae are entirely wingless and depend on their hosts for long-distance dispersal; their population genetics has been unstudied to date. We collected a total of 125 bat flies from three Pteropus species (Pteropus vampyrus, P. hypomelanus, and P. lylei) from eight localities in Malaysia, Cambodia, and Vietnam. We identified specimens morphologically and then sequenced three mitochondrial DNA gene fragments (CoI, CoII, cytB; 1744 basepairs total) from a subset of 45 bat flies. We measured genetic diversity, molecular variance, and population genetic subdivision (FST), and used phylogenetic and haplotype network analyses to quantify parasite genetic structure across host species and localities. All flies were identified as Cyclopodia horsfieldi with the exception of two individuals of Eucampsipoda sundaica. Low levels of population genetic structure were detected between populations of Cyclopodia horsfieldi from across a wide geographic range (~1000 km), and tests for isolation by distance were rejected. AMOVA results support a lack of geographic and host-specific population structure, with molecular variance primarily partitioned within populations. Pairwise FST values from flies collected from island populations of Pteropus hypomelanus in East and West Peninsular Malaysia supported predictions based on previous studies of host genetic structure. The lack of population genetic structure and morphological variation observed in Cyclopodia horsfieldi is most likely due to frequent contact between flying fox species and subsequent high levels of parasite gene flow. Specifically, we suggest that Pteropus vampyrus may facilitate movement of bat flies between the three Pteropus
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
Kassir, Yona; Stuart, David T
2017-01-01
The budding yeast Saccharomyces cerevisiae has a long history as a model organism for studies of meiosis and the cell cycle. The popularity of this yeast as a model is in large part due to the variety of genetic and cytological approaches that can be effectively performed with the cells. Cultures of the cells can be induced to synchronously progress through meiosis and sporulation allowing large-scale gene expression and biochemical studies to be performed. Additionally, the spore tetrads resulting from meiosis make it possible to characterize the haploid products of meiosis allowing investigation of meiotic recombination and chromosome segregation. Here we describe genetic methods for analysis progression of S. cerevisiae through meiosis and sporulation with an emphasis on strategies for the genetic analysis of regulators of meiosis-specific genes.
Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei
2017-11-01
Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.
Directory of Open Access Journals (Sweden)
Yushi Yao
2017-11-01
Full Text Available Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM, which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.
Structure and Chromosomal Organization of Yeast Genes Regulated by Topoisomerase II.
Joshi, Ricky S; Nikolaou, Christoforos; Roca, Joaquim
2018-01-03
Cellular DNA topoisomerases (topo I and topo II) are highly conserved enzymes that regulate the topology of DNA during normal genome transactions, such as DNA transcription and replication. In budding yeast, topo I is dispensable whereas topo II is essential, suggesting fundamental and exclusive roles for topo II, which might include the functions of the topo IIa and topo IIb isoforms found in mammalian cells. In this review, we discuss major findings of the structure and chromosomal organization of genes regulated by topo II in budding yeast. Experimental data was derived from short (10 min) and long term (120 min) responses to topo II inactivation in top-2 ts mutants. First, we discuss how short term responses reveal a subset of yeast genes that are regulated by topo II depending on their promoter architecture. These short term responses also uncovered topo II regulation of transcription across multi-gene clusters, plausibly by common DNA topology management. Finally, we examine the effects of deactivated topo II on the elongation of RNA transcripts. Each study provides an insight into the particular chromatin structure that interacts with the activity of topo II. These findings are of notable clinical interest as numerous anti-cancer therapies interfere with topo II activity.
Pittman, Jon K; Hirschi, Kendal D
2016-12-01
The Ca(2+)/Cation Antiporter (CaCA) superfamily is an ancient and widespread family of ion-coupled cation transporters found in nearly all kingdoms of life. In animals, K(+)-dependent and K(+)-indendent Na(+)/Ca(2+) exchangers (NCKX and NCX) are important CaCA members. Recently it was proposed that all rice and Arabidopsis CaCA proteins should be classified as NCX proteins. Here we performed phylogenetic analysis of CaCA genes and protein structure homology modelling to further characterise members of this transporter superfamily. Phylogenetic analysis of rice and Arabidopsis CaCAs in comparison with selected CaCA members from non-plant species demonstrated that these genes form clearly distinct families, with the H(+)/Cation exchanger (CAX) and cation/Ca(2+) exchanger (CCX) families dominant in higher plants but the NCKX and NCX families absent. NCX-related Mg(2+)/H(+) exchanger (MHX) and CAX-related Na(+)/Ca(2+) exchanger-like (NCL) proteins are instead present. Analysis of genomes of ten closely-related rice species and four Arabidopsis-related species found that CaCA gene family structures are highly conserved within related plants, apart from minor variation. Protein structures were modelled for OsCAX1a and OsMHX1. Despite exhibiting broad structural conservation, there are clear structural differences observed between the different CaCA types. Members of the CaCA superfamily form clearly distinct families with different phylogenetic, structural and functional characteristics, and therefore should not be simply classified as NCX proteins, which should remain as a separate gene family.
DEFF Research Database (Denmark)
Winther, Thilde Nordmann; Jacobsen, Kari Stougaard; Mirza, Aashiq Hussain
2014-01-01
Background and Aim. Hepatitis B e antigen positive (HBeAg-positive) children are at high risk of severe complications such as hepatocellular carcinoma and cirrhosis. Liver damage is caused by the host immune response to infected hepatocytes, and we hypothesise that specific microRNAs play a role...... in this complex interaction between virus and host. The study aimed to identify microRNAs with aberrant plasma expressions in HBeAg-positive children and with liver-specific target genes. Methods. By revisiting our previous screen of microRNA plasma levels in HBeAg-positive and HBeAg-negative children...... with chronic hepatitis B (CHB) and in healthy controls, candidate microRNAs with aberrant plasma expressions in HBeAg-positive children were identified. MicroRNAs targeting liver-specific genes were selected based on bioinformatics analysis and validated by qRT-PCR using plasma samples from 34 HBe...
Rebscher, Nicole; Deichmann, Christina; Sudhop, Stefanie; Fritzenwanker, Jens Holger; Green, Stephen; Hassel, Monika
2009-10-01
We have analyzed the evolution of fibroblast growth factor receptor (FGFR) tyrosine kinase genes throughout a wide range of animal phyla. No evidence for an FGFR gene was found in Porifera, but we tentatively identified an FGFR gene in the placozoan Trichoplax adhaerens. The gene encodes a protein with three immunoglobulin-like domains, a single-pass transmembrane, and a split tyrosine kinase domain. By superimposing intron positions of 20 FGFR genes from Placozoa, Cnidaria, Protostomia, and Deuterostomia over the respective protein domain structure, we identified ten ancestral introns and three conserved intron groups. Our analysis shows (1) that the position of ancestral introns correlates to the modular structure of FGFRs, (2) that the acidic domain very likely evolved in the last common ancestor of triploblasts, (3) that splicing of IgIII was enabled by a triploblast-specific insertion, and (4) that IgI is subject to substantial loss or duplication particularly in quickly evolving genomes. Moreover, intron positions in the catalytic domain of FGFRs map to the borders of protein subdomains highly conserved in other serine/threonine kinases. Nevertheless, these introns were introduced in metazoan receptor tyrosine kinases exclusively. Our data support the view that protein evolution dating back to the Cambrian explosion took place in such a short time window that only subtle changes in the domain structure are detectable in extant representatives of animal phyla. We propose that the first multidomain FGFR originated in the last common ancestor of Placozoa, Cnidaria, and Bilateria. Additional domains were introduced mainly in the ancestor of triploblasts and in the Ecdysozoa.
Salton, S R; Fischberg, D J; Dong, K W
1991-05-01
Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.
Analysis of ribosomal protein gene structures: implications for intron evolution.
Directory of Open Access Journals (Sweden)
2006-03-01
Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.
Directory of Open Access Journals (Sweden)
Yan V Sun
Full Text Available A more thorough understanding of the differences in DNA methylation (DNAm profiles in populations may hold promise for identifying molecular mechanisms through which genetic and environmental factors jointly contribute to human diseases. Inflammation is a key molecular mechanism underlying several chronic diseases including cardiovascular disease, and it affects DNAm profile on both global and locus-specific levels. To understand the impact of inflammation on the DNAm of the human genome, we investigated DNAm profiles of peripheral blood leukocytes from 966 African American participants in the Genetic Epidemiology Network of Arteriopathy (GENOA study. By testing the association of DNAm sites on CpG islands of over 14,000 genes with C-reactive protein (CRP, an inflammatory biomarker of cardiovascular disease, we identified 257 DNAm sites in 240 genes significantly associated with serum levels of CRP adjusted for age, sex, body mass index and smoking status, and corrected for multiple testing. Of the significantly associated DNAm sites, 80.5% were hypomethylated with higher CRP levels. The most significant Gene Ontology terms enriched in the genes associated with the CRP levels were immune system process, immune response, defense response, response to stimulus, and response to stress, which are all linked to the functions of leukocytes. While the CRP-associated DNAm may be cell-type specific, understanding the DNAm association with CRP in peripheral blood leukocytes of multi-ethnic populations can assist in unveiling the molecular mechanism of how the process of inflammation affects the risks of developing common disease through epigenetic modifications.
Energy Technology Data Exchange (ETDEWEB)
Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F. (Hagedorn Research Laboratory, Gentofte (Denmark))
1988-09-01
The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression.
International Nuclear Information System (INIS)
Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F.
1988-01-01
The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression