WorldWideScience

Sample records for specific dust event

  1. Dust storm events over Delhi: verification of dust AOD forecasts with satellite and surface observations

    Science.gov (United States)

    Singh, Aditi; Iyengar, Gopal R.; George, John P.

    2016-05-01

    Thar desert located in northwest part of India is considered as one of the major dust source. Dust storms originate in Thar desert during pre-monsoon season, affects large part of Indo-Gangetic plains. High dust loading causes the deterioration of the ambient air quality and degradation in visibility. Present study focuses on the identification of dust events and verification of the forecast of dust events over Delhi and western part of IG Plains, during the pre-monsoon season of 2015. Three dust events have been identified over Delhi during the study period. For all the selected days, Terra-MODIS AOD at 550 nm are found close to 1.0, while AURA-OMI AI shows high values. Dust AOD forecasts from NCMRWF Unified Model (NCUM) for the three selected dust events are verified against satellite (MODIS) and ground based observations (AERONET). Comparison of observed AODs at 550 nm from MODIS with NCUM predicted AODs reveals that NCUM is able to predict the spatial and temporal distribution of dust AOD, in these cases. Good correlation (~0.67) is obtained between the NCUM predicted dust AODs and location specific observations available from AERONET. Model under-predicted the AODs as compared to the AERONET observations. This may be mainly because the model account for only dust and no anthropogenic activities are considered. The results of the present study emphasize the requirement of more realistic representation of local dust emission in the model both of natural and anthropogenic origin, to improve the forecast of dust from NCUM during the dust events.

  2. Asian dust events of April 1998

    Science.gov (United States)

    Husar, R.B.; Tratt, D.M.; Schichtel, B.A.; Falke, S.R.; Li, F.; Jaffe, D.; Gasso, S.; Gill, T.; Laulainen, N.S.; Lu, F.; Reheis, M.C.; Chun, Y.; Westphal, D.; Holben, B.N.; Gueymard, C.; McKendry, I.; Kuring, N.; Feldman, G.C.; McClain, C.; Frouin, R.J.; Merrill, J.; DuBois, D.; Vignola, F.; Murayama, T.; Nickovic, S.; Wilson, W.E.; Sassen, K.; Sugimoto, N.; Malm, W.C.

    2001-01-01

    On April 15 and 19, 1998, two intense dust storms were generated over the Gobi desert by springtime low-pressure systems descending from the northwest. The windblown dust was detected and its evolution followed by its yellow color on SeaWiFS satellite images, routine surface-based monitoring, and through serendipitous observations. The April 15 dust cloud was recirculating, and it was removed by a precipitating weather system over east Asia. The April 19 dust cloud crossed the Pacific Ocean in 5 days, subsided to the surface along the mountain ranges between British Columbia and California, and impacted severely the optical and the concentration environments of the region. In east Asia the dust clouds increased the albedo over the cloudless ocean and land by up to 10-20%, but it reduced the near-UV cloud reflectance, causing a yellow coloration of all surfaces. The yellow colored backscattering by the dust eludes a plausible explanation using simple Mie theory with constant refractive index. Over the West Coast the dust layer has increased the spectrally uniform optical depth to about 0.4, reduced the direct solar radiation by 30-40%, doubled the diffuse radiation, and caused a whitish discoloration of the blue sky. On April 29 the average excess surface-level dust aerosol concentration over the valleys of the West Coast was about 20-50 ??g/m3 with local peaks >100 ??g/m3. The dust mass mean diameter was 2-3 ??m, and the dust chemical fingerprints were evident throughout the West Coast and extended to Minnesota. The April 1998 dust event has impacted the surface aerosol concentration 2-4 times more than any other dust event since 1988. The dust events were observed and interpreted by an ad hoc international web-based virtual community. It would be useful to set up a community-supported web-based infrastructure to monitor the global aerosol pattern for such extreme aerosol events, to alert and to inform the interested communities, and to facilitate collaborative

  3. Effects of Asian dust storm events on daily mortality in Taipei, Taiwan

    International Nuclear Information System (INIS)

    Chen, Y.-S.; Sheen, P.-C.; Chen, E.-R.; Liu, Y.-K.; Wu, T.-N.; Yang, C.-Y.

    2004-01-01

    In spring, windblown dust storms originating in the deserts of Mongolia and China make their way to Taipei City. These occurrences are known as Asian dust storm events. The objective of this study was to assess the possible effects of Asian dust storms on the mortality of residents in Taipei, Taiwan, during the period from 1995 to 2000. We identified 39 dust storm episodes, which were classified as index days. Daily deaths on the index days were compared with deaths on the comparison days. We selected two comparison days for each index day, 7 days before the index day and 7 days after the index day. The strongest estimated effects of dust storms were increases of 7.66% in risk for respiratory disease 1 day after the event, 4.92% for total deaths 2 days following the dust storms and 2.59% for circulatory diseases 2 days following the dust storms. However, none of these effects were statistically significant. This study found greater specificity for associations with respiratory deaths, and this increases the likelihood that the association between dust events and daily mortality represents a causal relationship

  4. Pancam and Microscopic Imager observations of dust on the Spirit Rover: Cleaning events, spectral properties, and aggregates

    Science.gov (United States)

    Vaughan, Alicia F.; Johnson, Jeffrey R.; Herkenhoff, Kenneth E.; Sullivan, Robert; Landis, Geoffrey A.; Goetz, Walter; Madsen, Morten B.

    2010-01-01

    This work describes dust deposits on the Spirit Rover over 2000 sols through examination of Pancam and Microscopic Imager observations of specific locations on the rover body, including portions of the solar array, Pancam and Mini-TES calibration targets, and the magnets. This data set reveals the three "cleaning events" experienced by Spirit to date, the spectral properties of dust, and the tendency of dust particles to form aggregates 100 um and larger.

  5. Long-term variability of dust events in Iceland (1949-2011)

    Science.gov (United States)

    Dagsson-Waldhauserova, P.; Arnalds, O.; Olafsson, H.

    2014-12-01

    The long-term frequency of atmospheric dust observations was investigated for the southern part of Iceland and interpreted together with earlier results obtained from northeastern (NE) Iceland (Dagsson-Waldhauserova et al., 2013). In total, over 34 dust days per year on average occurred in Iceland based on conventionally used synoptic codes for dust observations. However, frequent volcanic eruptions, with the re-suspension of volcanic materials and dust haze, increased the number of dust events fourfold (135 dust days annually). The position of the Icelandic Low determined whether dust events occurred in the NE (16.4 dust days annually) or in the southern (S) part of Iceland (about 18 dust days annually). The decade with the most frequent dust days in S Iceland was the 1960s, but the 2000s in NE Iceland. A total of 32 severe dust storms (visibility typically warm, occurring during summer/autumn (May-September) and during mild southwesterly winds, while the subarctic dust events (S Iceland) were mainly cold, occurring during winter/spring (March-May) and during strong northeasterly winds. About half of the dust events in S Iceland occurred in winter or at sub-zero temperatures. A good correlation was found between particulate matter (PM10) concentrations and visibility during dust observations at the stations Vík and Stórhöfði. This study shows that Iceland is among the dustiest areas of the world and that dust is emitted year-round.

  6. Urban particle size distributions during two contrasting dust events originating from Taklimakan and Gobi Deserts

    International Nuclear Information System (INIS)

    Zhao, Suping; Yu, Ye; Xia, Dunsheng; Yin, Daiying; He, Jianjun; Liu, Na; Li, Fang

    2015-01-01

    The dust origins of the two events were identified using HYSPLIT trajectory model and MODIS and CALIPSO satellite data to understand the particle size distribution during two contrasting dust events originated from Taklimakan and Gobi deserts. The supermicron particles significantly increased during the dust events. The dust event from Gobi desert affected significantly on the particles larger than 2.5 μm, while that from Taklimakan desert impacted obviously on the particles in 1.0–2.5 μm. It is found that the particle size distributions and their modal parameters such as VMD (volume median diameter) have significant difference for varying dust origins. The dust from Taklimakan desert was finer than that from Gobi desert also probably due to other influencing factors such as mixing between dust and urban emissions. Our findings illustrated the capacity of combining in situ, satellite data and trajectory model to characterize large-scale dust plumes with a variety of aerosol parameters. - Highlights: • Dust particle size distributions had large differences for varying origins. • Dust originating from Taklimakan Desert was finer than that from Gobi Desert. • Effect of dust on the supermicron particles was obvious. • PM_1_0 concentrations increased by a factor of 3.4–25.6 during the dust event. - Dust particle size distributions had large differences for varying origins, which may be also related to other factors such as mixing between dust and urban emissions.

  7. Atmospheric dust events in central Asia: Relationship to wind, soil type, and land use

    Science.gov (United States)

    Pi, Huawei; Sharratt, Brenton; Lei, Jiaqiang

    2017-06-01

    Xinjiang Province in northwest China is one of the most important source regions of atmospheric dust in the world. Spatial-temporal characteristics of dust events in the province were investigated by time series analysis of annual dust event frequency and meteorological data collected at 101 meteorological stations from 1960 to 2007. Blowing dust frequency (BDF) and dust storm frequency (DSF) decreased with time in North, South, and East Xinjiang whereas floating dust frequency (FDF) decreased with time only in South and East Xinjiang. Dust concentrations were lower in North than in South Xinjiang and decreased with time in East Xinjiang. Wind significantly influenced the temporal trend in FDF, BDF, and DSF in South Xinjiang and DSF in North Xinjiang. Frequency of dust events was smaller by an order of magnitude in North (10.9 d yr-1) than in South Xinjiang (111.3 d yr-1), possibly due in part to higher annual precipitation in North Xinjiang. Floating dust was most frequently observed in East and South Xinjiang, while blowing dust was most frequently observed in North Xinjiang. The high frequency of floating dust in East and South Xinjiang is likely due to the enclosed terrain that characterizes these regions. Land use and soil type also influenced dust events. Although climate influences frequency of dust events, the occurrence of these events may be reduced most effectively by imposing better land management practices in deciduous forests or orchards characterized by saline soils in respectively North and East Xinjiang and meadows characterized by Guanyu soils in South Xinjiang.

  8. Characterization of major pollution events (dust, haze, and two festival events) at Agra, India.

    Science.gov (United States)

    Pachauri, Tripti; Singla, Vyoma; Satsangi, Aparna; Lakhani, Anita; Kumari, K Maharaj

    2013-08-01

    Total suspended particulate (TSP) samples were collected during dust, haze, and two festival events (Holi and Diwali) from February 2009 to June 2010. Pollutant gases (NO2, SO2, and O3) along with the meteorological parameters were also measured during the four pollution events at Agra. The concentration of pollutant gases decreases during dust events (DEs), but the levels of the gases increase during other pollution events indicating the impact of anthropogenic emissions. The mass concentrations were about two times higher during pollution events than normal days (NDs). High TSP concentrations during Holi and Diwali events may be attributed to anthropogenic activities while increased combustion sources in addition to stagnant meteorological conditions contributed to high TSP mass during haze events. On the other hand, long-range transport of atmospheric particles plays a major role during DEs. In the dust samples, Ca(2+), Cl(-), NO3 (-), and SO4 (2-) were the most abundant ions and Ca(2+) alone accounted for 22 % of the total ionic mass, while during haze event, the concentrations of secondary aerosols species, viz., NO3 (-), SO4 (2-), and NH4 (+), were 3.6, 3.3, and 5.1 times higher than the normal days. During Diwali, SO4 (2-) concentration (17.8 μg m(-3)) was highest followed by NO3 (-), K(+), and Cl(-) while the Holi samples were strongly enriched with Cl(-) and K(+) which together made up 32.7 % of the total water-soluble ions. The ion balances indicate that the haze samples were acidic. On the other hand, Holi, Diwali, and DE samples were enriched with cations. The carbonaceous aerosol shows strong variation with the highest concentration during Holi followed by haze, Diwali, DEs, and NDs. However, the secondary organic carbon concentration follows the order haze > DEs > Diwali > Holi > NDs. The scanning electron microscope/EDX results indicate that KCl and carbon-rich particles were more dominant during Holi and haze events while DE samples were enriched

  9. Simulation of dust production in ITER transient events

    International Nuclear Information System (INIS)

    Pestchanyi, S.E.; Landman, I.S.

    2008-01-01

    Dust production from the divertor armour during edge-localised modes (ELMs) has been investigated. Analysis of available experimental data on the dust particle production and the particles distribution on size for the MPG-8 graphite and for NB31 carbon fibre composite (CFC) under the disruption-like surface heat load allowed revealing the unknown mechanical parameters of the NB31 CFC. Using these data the code PEGASUS-3D has been fitted and verified for simulation of the dust production by ELMs. First simulation of the dust production for the ELM of 1 MJ/m 2 heat load and 0.5 ms time duration has been calculated

  10. Simulation of dust production in ITER transient events

    Energy Technology Data Exchange (ETDEWEB)

    Pestchanyi, S.E. [Forschungszentrum Karlsruhe, Institute for Pulsed Power and Microwave Technology, P.B. 3640, D-76021 Karlsruhe (Germany)], E-mail: sergey.pestchanyi@ihm.fzk.de; Landman, I.S. [Forschungszentrum Karlsruhe, Institute for Pulsed Power and Microwave Technology, P.B. 3640, D-76021 Karlsruhe (Germany)

    2008-12-15

    Dust production from the divertor armour during edge-localised modes (ELMs) has been investigated. Analysis of available experimental data on the dust particle production and the particles distribution on size for the MPG-8 graphite and for NB31 carbon fibre composite (CFC) under the disruption-like surface heat load allowed revealing the unknown mechanical parameters of the NB31 CFC. Using these data the code PEGASUS-3D has been fitted and verified for simulation of the dust production by ELMs. First simulation of the dust production for the ELM of 1 MJ/m{sup 2} heat load and 0.5 ms time duration has been calculated.

  11. Revealing the meteorological drivers of the September 2015 severe dust event in the Eastern Mediterranean

    Directory of Open Access Journals (Sweden)

    P. Gasch

    2017-11-01

    Full Text Available In September 2015 one of the severest and most unusual dust events on record occurred in the Eastern Mediterranean. Surprisingly, operational dust transport models were unable to forecast the event. This study details the reasons for this failure and presents simulations of the event at convection-permitting resolution using the modelling system ICON-ART. The results allow for an in-depth analysis of the influence of the synoptic situation, the complex interaction of multiple driving atmospheric systems and the mineral dust radiative effect on the dust event. A comparison of the results with observations reveals the quality of the simulation results with respect to structure and timing of the dust transport. The forecast of the dust event is improved decisively. The event is triggered by the unusually early occurrence of an active Red Sea trough situation with an easterly axis over Mesopotamia. The connected sustained organized mesoscale convection produces multiple cold-pool outflows responsible for intense dust emissions. Complexity is added by the interaction with an intense heat low, the inland-penetrating Eastern Mediterranean sea breeze and the widespread occurrence of supercritical flow conditions and subsequent hydraulic jumps in the vicinity of the Dead Sea Rift Valley. The newly implemented mineral dust radiation interaction leads to systematically more intense and faster propagating cold-pool outflows.

  12. Aerosol optical, microphysical and radiative forcing properties during variable intensity African dust events in the Iberian Peninsula

    Science.gov (United States)

    Fernández, A. J.; Molero, F.; Salvador, P.; Revuelta, A.; Becerril-Valle, M.; Gómez-Moreno, F. J.; Artíñano, B.; Pujadas, M.

    2017-11-01

    Aerosol measurements at two AERONET (AErosol RObotic NETwork) sites of the Iberian Peninsula: Madrid (40°.45N, 3.72W) and La Coruña (43°.36N, 8°.42W) have been analyzed for the period 2012-2015 to assess aerosol optical properties (intensive and extensive) throughout the atmospheric column and their radiative forcing (RF) and radiative forcing efficiency (RFeff) estimates at the Bottom and Top Of Atmosphere (BOA and TOA respectively). Specific conditions as dust-free and African dust have been considered for the study. Unprecedented, this work uses the quantification of the African dust aerosol at ground level which allows us to study such AERONET products at different intensity levels of African events: Low (L), High (H) and very high (VH). The statistical difference between dust-free and African dust conditions on the aforementioned parameters, quantified by means of the non-parametric Kolmogorov-Smirnov test, is quite clear in Madrid, however it is not in La Coruña. Scattering Angstrom Exponent (SAE) and Absorption Angstrom Exponent (AAE) were found to be 1.64 ± 0.29 and 1.14 ± 0.23 respectively in Madrid for dust-free conditions because typical aerosol sources are traffic emissions and residential heating, and black carbon is an important compound in this aerosol kind. On the other hand, SAE and AAE were 0.96 ± 0.60 and 1.44 ± 0.51 for African dust conditions in this location. RF (at shortwave radiation) seems to decrease as the African dust contribution at ground level is larger which indicates the cooling effect of African dust aerosol in Madrid. We have also proved the potential of a 2D-cluster analysis based on AAE and SAE to differentiate both situations in Madrid. Conversely, it is suggested that aerosols observed in La Coruña under dust-free conditions might come from different sources. Then, SAE and AAE are not good enough indicators to distinguish between dust-free and African dust conditions. Besides, as La Coruña is at a further distance

  13. Simulation of dust production in ITER transient events

    Energy Technology Data Exchange (ETDEWEB)

    Pestchanyi, S. [Forschungszentrum Karlsruhe (Germany)

    2007-07-01

    The tritium retention problem is a critical issue for the tokamak ITER performance. Tritium is trapped in redeposited T-C layers and at the surface of carbon dust, where it is retained in form of various hydrocarbons. The area of dust surface and hence, the amount of tritium deposited on the surface depends on the dust amount and of the dust sizes. The carbon dust appears as a result of brittle destruction at the surface of the carbon fibre composite (CFC) which is now the reference armour material for the most loaded part of tokamak divertor. Stationary heat flux on the ITER divertor armour does not cause its brittle destruction and does not produce dust. However, according to the modern understanding of tokamak fusion devices performance, the most attractive regime of ITER operation is the ELMy H mode. This regime is associated with a repetitive short time increase of heat flux at the CFC divertor armour of 2-3 orders of magnitude over its stationary value during edge localized modes (ELMs). Under influence of these severe heat shocks CFC armour can crack due to the thermostress, producing a dust of carbon. Besides, a carbon dust produced during disruptions due to brittle destruction of the armour under influence of thermoshock. Most of the modern tokamaks do not produce the ELMs powerful enough to cause CFC brittle destruction at the divertor surface, except of very special regimes in JET. This is why the CFC erosion and dust production could be investigated now only theoretically and experimentally in plasma guns and electron beam facilities. Simulation of the CFC brittle destruction has been done using the code PEGASUS already developed and tested in FZK for simulation of erosion for ITER candidate materials under the heat shocks. After upgrades the code was used for simulation of the amount of carbon dust particles and of the distribution of their sizes. The code has been tested against available experimental data from the plasma gun MK-200UG and from the

  14. Simulation of dust production in ITER transient events

    International Nuclear Information System (INIS)

    Pestchanyi, S.

    2007-01-01

    The tritium retention problem is a critical issue for the tokamak ITER performance. Tritium is trapped in redeposited T-C layers and at the surface of carbon dust, where it is retained in form of various hydrocarbons. The area of dust surface and hence, the amount of tritium deposited on the surface depends on the dust amount and of the dust sizes. The carbon dust appears as a result of brittle destruction at the surface of the carbon fibre composite (CFC) which is now the reference armour material for the most loaded part of tokamak divertor. Stationary heat flux on the ITER divertor armour does not cause its brittle destruction and does not produce dust. However, according to the modern understanding of tokamak fusion devices performance, the most attractive regime of ITER operation is the ELMy H mode. This regime is associated with a repetitive short time increase of heat flux at the CFC divertor armour of 2-3 orders of magnitude over its stationary value during edge localized modes (ELMs). Under influence of these severe heat shocks CFC armour can crack due to the thermostress, producing a dust of carbon. Besides, a carbon dust produced during disruptions due to brittle destruction of the armour under influence of thermoshock. Most of the modern tokamaks do not produce the ELMs powerful enough to cause CFC brittle destruction at the divertor surface, except of very special regimes in JET. This is why the CFC erosion and dust production could be investigated now only theoretically and experimentally in plasma guns and electron beam facilities. Simulation of the CFC brittle destruction has been done using the code PEGASUS already developed and tested in FZK for simulation of erosion for ITER candidate materials under the heat shocks. After upgrades the code was used for simulation of the amount of carbon dust particles and of the distribution of their sizes. The code has been tested against available experimental data from the plasma gun MK-200UG and from the

  15. Saharan Dust Event Impacts on Cloud Formation and Radiation over Western Europe

    Science.gov (United States)

    Bangert, M.; Nenes, A.; Vogel, B.; Vogel, H.; Barahona, D.; Karydis, V. A.; Kumar, P.; Kottmeier, C.; Blahak, U.

    2013-01-01

    We investigated the impact of mineral dust particles on clouds, radiation and atmospheric state during a strong Saharan dust event over Europe in May 2008, applying a comprehensive online-coupled regional model framework that explicitly treats particle-microphysics and chemical composition. Sophisticated parameterizations for aerosol activation and ice nucleation, together with two-moment cloud microphysics are used to calculate the interaction of the different particles with clouds depending on their physical and chemical properties. The impact of dust on cloud droplet number concentration was found to be low, with just a slight increase in cloud droplet number concentration for both uncoated and coated dust. For temperatures lower than the level of homogeneous freezing, no significant impact of dust on the number and mass concentration of ice crystals was found, though the concentration of frozen dust particles reached up to 100 l-1 during the ice nucleation events. Mineral dust particles were found to have the largest impact on clouds in a temperature range between freezing level and the level of homogeneous freezing, where they determined the number concentration of ice crystals due to efficient heterogeneous freezing of the dust particles and modified the glaciation of mixed phase clouds. Our simulations show that during the dust events, ice crystals concentrations were increased twofold in this temperature range (compared to if dust interactions are neglected). This had a significant impact on the cloud optical properties, causing a reduction in the incoming short-wave radiation at the surface up to -75Wm-2. Including the direct interaction of dust with radiation caused an additional reduction in the incoming short-wave radiation by 40 to 80Wm-2, and the incoming long-wave radiation at the surface was increased significantly in the order of +10Wm-2. The strong radiative forcings associated with dust caused a reduction in surface temperature in the order of -0

  16. Saharan dust event impacts on cloud formation and radiation over Western Europe

    Directory of Open Access Journals (Sweden)

    M. Bangert

    2012-05-01

    Full Text Available We investigated the impact of mineral dust particles on clouds, radiation and atmospheric state during a strong Saharan dust event over Europe in May 2008, applying a comprehensive online-coupled regional model framework that explicitly treats particle microphysics and chemical composition. Sophisticated parameterizations for aerosol activation and ice nucleation, together with two-moment cloud microphysics are used to calculate the interaction of the different particles with clouds depending on their physical and chemical properties.

    The impact of dust on cloud droplet number concentration was found to be low, with just a slight increase in cloud droplet number concentration for both uncoated and coated dust. For temperatures lower than the level of homogeneous freezing, no significant impact of dust on the number and mass concentration of ice crystals was found, though the concentration of frozen dust particles reached up to 100 l−1 during the ice nucleation events. Mineral dust particles were found to have the largest impact on clouds in a temperature range between freezing level and the level of homogeneous freezing, where they determined the number concentration of ice crystals due to efficient heterogeneous freezing of the dust particles and modified the glaciation of mixed phase clouds.

    Our simulations show that during the dust events, ice crystals concentrations were increased twofold in this temperature range (compared to if dust interactions are neglected. This had a significant impact on the cloud optical properties, causing a reduction in the incoming short-wave radiation at the surface up to −75 W m−2. Including the direct interaction of dust with radiation caused an additional reduction in the incoming short-wave radiation by 40 to 80 W m−2, and the incoming long-wave radiation at the surface was increased significantly in the order of +10 W m−2.

    The

  17. [Process study on hysteresis of vegetation cover influencing sand-dust events].

    Science.gov (United States)

    Xu, Xing-Kui; Wang, Xiao-Tao; Zhang, Feng

    2009-02-15

    Data analysis from satellite and weather stations during 1982-2000 shows nonlinear relationship between vegetation cover and sand-dust events is present in most part of China. Vegetation cover ratio in summer can impact significantly on the frequency of sand-dust storms from winter to spring in the source regions of sand-dust events. It is not quite clear about the hysteresis that vegetation cover in summer influence sand-dust events during winter and spring. A quasi-geostrophic barotropic model is used under the condition of 3 magnitude of frictional coefficient to investigate the cause of the hysteresis. Wind velocity shows a greatest decline at 90% during 72 h as initial wind velocity is 10 m/s for magnitude of frictional coefficient between atmosphere and water surface, greatest decline at 100% during 18 h for magnitude of frictional coefficient between atmosphere and bare soil and a 100% reduction of wind speed during 1 h for magnitude of frictional coefficient between atmosphere and vegetation cover. Observation and simulation prove that residual root and stem from summervegetation are one of factors to influence sand-dust events happened during winter and spring. Air inhibition from residual root and stem is a most important reason for hysteresis that vegetation cover influence sand-dust events.

  18. Modeling a typical winter-time dust event over the Arabian Peninsula and the Red Sea

    Directory of Open Access Journals (Sweden)

    S. Kalenderski

    2013-02-01

    Full Text Available We used WRF-Chem, a regional meteorological model coupled with an aerosol-chemistry component, to simulate various aspects of the dust phenomena over the Arabian Peninsula and Red Sea during a typical winter-time dust event that occurred in January 2009. The model predicted that the total amount of emitted dust was 18.3 Tg for the entire dust outburst period and that the two maximum daily rates were ~2.4 Tg day−1 and ~1.5 Tg day−1, corresponding to two periods with the highest aerosol optical depth that were well captured by ground- and satellite-based observations. The model predicted that the dust plume was thick, extensive, and mixed in a deep boundary layer at an altitude of 3–4 km. Its spatial distribution was modeled to be consistent with typical spatial patterns of dust emissions. We utilized MODIS-Aqua and Solar Village AERONET measurements of the aerosol optical depth (AOD to evaluate the radiative impact of aerosols. Our results clearly indicated that the presence of dust particles in the atmosphere caused a significant reduction in the amount of solar radiation reaching the surface during the dust event. We also found that dust aerosols have significant impact on the energy and nutrient balances of the Red Sea. Our results showed that the simulated cooling under the dust plume reached 100 W m−2, which could have profound effects on both the sea surface temperature and circulation. Further analysis of dust generation and its spatial and temporal variability is extremely important for future projections and for better understanding of the climate and ecological history of the Red Sea.

  19. Modeling a typical winter-time dust event over the Arabian Peninsula and the Red Sea

    KAUST Repository

    Kalenderski, Stoitchko

    2013-02-20

    We used WRF-Chem, a regional meteorological model coupled with an aerosol-chemistry component, to simulate various aspects of the dust phenomena over the Arabian Peninsula and Red Sea during a typical winter-time dust event that occurred in January 2009. The model predicted that the total amount of emitted dust was 18.3 Tg for the entire dust outburst period and that the two maximum daily rates were ?2.4 Tg day-1 and ?1.5 Tg day-1, corresponding to two periods with the highest aerosol optical depth that were well captured by ground-and satellite-based observations. The model predicted that the dust plume was thick, extensive, and mixed in a deep boundary layer at an altitude of 3-4 km. Its spatial distribution was modeled to be consistent with typical spatial patterns of dust emissions. We utilized MODIS-Aqua and Solar Village AERONET measurements of the aerosol optical depth (AOD) to evaluate the radiative impact of aerosols. Our results clearly indicated that the presence of dust particles in the atmosphere caused a significant reduction in the amount of solar radiation reaching the surface during the dust event. We also found that dust aerosols have significant impact on the energy and nutrient balances of the Red Sea. Our results showed that the simulated cooling under the dust plume reached 100 W m-2, which could have profound effects on both the sea surface temperature and circulation. Further analysis of dust generation and its spatial and temporal variability is extremely important for future projections and for better understanding of the climate and ecological history of the Red Sea.

  20. A long Saharan dust event over the western Mediterranean: Lidar, Sun photometer observations, and regional dust modeling

    Science.gov (United States)

    PéRez, C.; Nickovic, S.; Baldasano, J. M.; Sicard, M.; Rocadenbosch, F.; Cachorro, V. E.

    2006-08-01

    A long Saharan dust event affected the western Mediterranean in the period 12-28 June 2002. Dust was present mainly between 1- and 5-km height affecting most parts of the Iberian Peninsula and reaching western/central Europe. Intensive backscatter lidar observations over Barcelona (Spain) and Sun photometer data from two stations (El Arenosillo, Spain, and Avignon, France) are used to evaluate different configurations the Dust Regional Atmospheric Modeling (DREAM) system. DREAM currently operates dust forecasts over the Mediterranean region (http://www.bsc.es/projects/earthscience/DREAM/) considering four particle size bins while only the first two are relevant for long-range transport analysis since their life time is larger than 12 hours. A more detailed bin method is implemented, and two different dust distributions at sources are compared to the operational version. Evaluations are performed at two wavelengths (532 and 1064 nm). The dust horizontal and vertical structure simulated by DREAM shows very good qualitative agreement when compared to SeaWIFS satellite images and lidar height-time displays over Barcelona. When evaluating the modeled aerosol optical depth (AOD) against Sun photometer data, significant improvements are achieved with the use of the new detailed bin method. In general, the model underpredicts the AOD for increasing Ångström exponents because of the influence of anthropogenic pollution in the boundary layer. In fact, the modeled AOD is highly anticorrelated with the observed Ångström exponents. Avignon shows higher influence of small anthropogenic aerosols which explains the better results of the model at the wavelength of 1064 nm over this location. The uncertainties of backscatter lidar inversions (20-30%) are in the same order of magnitude as the differences between the model experiments. Better model results are obtained when comparing to lidar because most of the anthropogenic effect is removed.

  1. Metagenomic Analysis of Airborne Bacterial Community and Diversity in Seoul, Korea, during December 2014, Asian Dust Event.

    Science.gov (United States)

    Cha, Seho; Srinivasan, Sathiyaraj; Jang, Jun Hyeong; Lee, Dongwook; Lim, Sora; Kim, Kyung Sang; Jheong, Weonhwa; Lee, Dong-Won; Park, Eung-Roh; Chung, Hyun-Mi; Choe, Joonho; Kim, Myung Kyum; Seo, Taegun

    2017-01-01

    Asian dust or yellow sand events in East Asia are a major issue of environmental contamination and human health, causing increasing concern. A high amount of dust particles, especially called as particulate matter 10 (PM10), is transported by the wind from the arid and semi-arid tracks to the Korean peninsula, bringing a bacterial population that alters the terrestrial and atmospheric microbial communities. In this study, we aimed to explore the bacterial populations of Asian dust samples collected during November-December 2014. The dust samples were collected using the impinger method, and the hypervariable regions of the 16S rRNA gene were amplified using PCR followed by pyrosequencing. Analysis of the sequencing data were performed using Mothur software. The data showed that the number of operational taxonomic units and diversity index during Asian dust events were higher than those during non-Asian dust events. At the phylum level, the proportions of Proteobacteria, Actinobacteria, and Firmicutes were different between Asian dust and non-Asian dust samples. At the genus level, the proportions of the genus Bacillus (6.9%), Arthrobacter (3.6%), Blastocatella (2%), Planomicrobium (1.4%) were increased during Asian dust compared to those in non-Asian dust samples. This study showed that the significant relationship between bacterial populations of Asian dust samples and non-Asian dust samples in Korea, which could significantly affect the microbial population in the environment.

  2. Detection and monitoring of two dust storm events by multispectral modis images.

    Digital Repository Service at National Institute of Oceanography (India)

    Mehta P.S.; Kunte, P.D.

    of Oman, over Arabian Sea to the coast of Pakistan. The dust storm lasted over the Arabian Sea till 30th March. MODIS sensors on both Terra and Aqua Satellites captured images of both events. From the difference in emissive/transmissive nature...

  3. Atmospheric deposition of radioactive cesium (137Cs) associated with dust events in East Asia

    International Nuclear Information System (INIS)

    Fujiwara, H.

    2010-01-01

    Since the cessation of atmospheric nuclear testing in 1980, there has been no known serious atmospheric contamination by radioactive cesium (sup(137)Cs) apart from the Chernobyl nuclear reactor accident in 1986. There now remain only small amounts of anthropogenic radionuclides in the atmosphere that can be directly related to past testing. However, sup(137)Cs is still regularly found in atmospheric deposition samples in Japan. In this study, we analyzed sup(137)Cs monitoring data, meteorological data, and field survey results to investigate the recent transport and deposition of sup(137)Cs associated with dust phenomena. Monthly records of nationwide sup(137)Cs deposition in Japan during the 1990s show a consistent seasonal variation, with higher levels of deposition occurring in spring. In March 2002, an unexpectedly high amount of sup(137)Cs was deposited in the northwestern coastal area of Japan at the same time as an Asian dust event was observed. Analysis of land-based weather data showed that sandstorms and other dust-raising phenomena also occurred in March 2002 over areas of Mongolia and northeastern China where grassland and shrubs predominated. Furthermore, radioactivity measurements showed sup(137)Cs enrichment in the surface layer of grassland soils in the areas affected by these sandstorms. These results suggest that grasslands are potential sources of sup(137)Cs-bearing dust. Continued desertification of the East Asian continent in response to recent climate change can be expected to result in an increase in sup(137)Cs-bearing soil particles in the atmosphere, and their subsequent re-deposition in Japan. However, soil dust is also raised around Japanese monitoring sites by the strong winds that are common in Japan in spring, and this local dust might also contribute to sup(137)Cs deposition in Japan. To estimate the relative contributions of local and distant dust events to the total sup(137)Cs deposition, we monitored deposition of mineral particles

  4. Quantification of the lithogenic carbon pump following a simulated dust-deposition event in large mesocosms

    Science.gov (United States)

    Bressac, M.; Guieu, C.; Doxaran, D.; Bourrin, F.; Desboeufs, K.; Leblond, N.; Ridame, C.

    2014-02-01

    Lithogenic particles, such as desert dust, have been postulated to influence particulate organic carbon (POC) export to the deep ocean by acting as mineral ballasts. However, an accurate understanding and quantification of the POC-dust association that occurs within the upper ocean is required in order to refine the "ballast hypothesis". In the framework of the DUNE (a DUst experiment in a low-Nutrient, low-chlorophyll Ecosystem) project, two artificial seedings were performed seven days apart within large mesocosms. A suite of optical and biogeochemical measurements were used to quantify surface POC export following simulated dust events within a low-nutrient, low-chlorophyll ecosystem. The two successive seedings led to a 2.3-6.7-fold higher POC flux than the POC flux observed in controlled mesocosms. A simple linear regression analysis revealed that the lithogenic fluxes explained more than 85% of the variance in POC fluxes. On the scale of a dust-deposition event, we estimated that 42-50% of POC fluxes were strictly associated with lithogenic particles (through aggregation and most probably sorption processes). Lithogenic ballasting also likely impacted the remaining POC fraction which resulted from the fertilization effect. The observations support the "ballast hypothesis" and provide a quantitative estimation of the surface POC export abiotically triggered by dust deposition. In this work, we demonstrate that the strength of such a "lithogenic carbon pump" depends on the biogeochemical conditions of the water column at the time of deposition. Based on these observations, we suggest that this lithogenic carbon pump could represent a major component of the biological pump in oceanic areas subjected to intense atmospheric forcing.

  5. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Quantification of the lithogenic carbon pump following a dust deposition event

    Science.gov (United States)

    Bressac, M.; Guieu, C.; Doxaran, D.; Bourrin, F.; Desboeufs, K.; Leblond, N.; Ridame, C.

    2013-08-01

    Lithogenic particles, such as desert dust, have been postulated to influence particulate organic carbon (POC) export to the deep ocean by acting as mineral ballasts. However, an accurate understanding and quantification of the POC-dust association that occurs within the upper ocean is required in order to affine the "ballast hypothesis". In the framework of the DUNE project, two artificial seedings were performed seven days apart within large mesocosms. A suite of optical and biogeochemical measurements were used to quantify surface POC export following simulated dust events within a low-nutrient low-chlorophyll ecosystem. The two successive seedings led to a 2.3-6.7 fold higher POC flux as compared to the POC flux observed in controlled mesocosms. A simple linear regression analysis revealed that the lithogenic fluxes explained more than 85% of the variance in POC fluxes. At the scale of a dust deposition event, we estimated that 42-50% of POC fluxes were strictly associated with lithogenic particles through an aggregation process. Lithogenic ballasting also likely impacted the remaining POC fraction which resulted from the fertilization effect. The observations support the "ballast hypothesis" and provide a quantitative estimation of the surface POC export abiotically triggered by dust deposition. In this work, we demonstrate that the strength of such a "lithogenic carbon pump" depends on the biogeochemical conditions of the water column at the time of deposition. Based on these observations, we suggest that this "lithogenic carbon pump" could represent a major component of the biological pump in oceanic areas subjected to intense atmospheric forcing.

  7. Presence of specific IgG antibody to grain dust does not go with respiratory symptoms.

    Science.gov (United States)

    Park, H S; Suh, C H; Nahm, D H; Kim, H Y

    1999-02-01

    A high prevalence of work-related symptoms in relation to grain dust exposure has been reported in grain dust workers, but the role of the specific IgG antibody is unknown. To study the possible role of specific IgG (sIgG) and specific IgG4 (sIgG4) in the development of work-related symptoms, sIgG and sIgG4 subclass antibodies against grain dust antigens were determined by ELISA in sera from 43 workers and 27 non-exposed controls. They were compared with results of specific IgE antibodies, exposure intensity and the presence of respiratory symptoms. SIgG and sIgG4 antibodies were detectable in almost all sera of exposed workers, and the prevalence were significantly higher than those of controls (pgrain dust exposure and may unlikely play a role in the etiology of respiratory symptoms.

  8. DASCH ON KU Cyg: A ∼ 5 YEAR DUST ACCRETION EVENT IN ∼ 1900

    International Nuclear Information System (INIS)

    Tang Sumin; Grindlay, Jonathan; Los, Edward; Servillat, Mathieu

    2011-01-01

    KU Cyg is an eclipsing binary consisting of an F-type star accreting through a large accretion disk from a K5III red giant. Here we present the discovery of a 5 year dip around 1900 found from its 100 year DASCH light curve. It showed a ∼0.5 mag slow fading from 1899 to 1903 and brightened back around 1904 on a relatively shorter timescale. The light curve shape of the 1899-1904 fading-brightening event differs from the dust production and dispersion process observed in R Coronae Borealis stars, which usually has a faster fading and slower recovery, and for KU Cyg is probably related to the accretion disk surrounding the F star. The slow fading in KU Cyg is probably caused by increases in dust extinction in the disk, and the subsequent quick brightening may be due to the evaporation of dust transported inward through the disk. The extinction excess which caused the fading may arise from increased mass transfer rate in the system or from dust clump ejections from the K giant.

  9. Insights into a dust event transported through Beijing in spring 2012: Morphology, chemical composition and impact on surface aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Wei [State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Faculty of Environmental and Symbiotic Sciences, Prefectural University of Kumamoto, Kumamoto 862-8502 (Japan); Niu, Hongya [State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Key Laboratory of Resource Exploration Research of Hebei Province, Hebei University of Engineering, Handan, Hebei 056038 (China); Zhang, Daizhou [Faculty of Environmental and Symbiotic Sciences, Prefectural University of Kumamoto, Kumamoto 862-8502 (Japan); Wu, Zhijun [State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Chen, Chen [State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Beijing Municipal Environmental Monitoring Center, Beijing 100044 (China); Wu, Yusheng; Shang, Dongjie [State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China); Hu, Min, E-mail: minhu@pku.edu.cn [State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871 (China)

    2016-09-15

    Multiple approaches were used to investigate the evolution of surface aerosols in Beijing during the passage of a dust event at high altitude, which was from the Gobi areas of southern Mongolia and covered a wide range of North China. Single particle analysis with electron microscope showed that the majority of coarse particles were mineral ones, and most of them were in the size range of 1–7 μm with a peak of number concentration at about 3.5 μm. Based on elemental composition and morphology, the mineral particles could be classified into several groups, including Si-rich (71%), Ca-rich (15%), Fe-rich (6%), and halite-rich (2%), etc., and they were the main contributors to the aerosol optical depth as the dust occurred. The size distributions of surface aerosols were significantly affected by the dust intrusion. The average number concentration of accumulation mode particles during the event was about 400 cm{sup −3}, which was much lower than that in heavily polluted days (6300 cm{sup −3}). At the stage of floating dust, the number concentration of accumulation mode particles decreased, and coarse particles contributed to total volume concentration of particulate matter as much as 90%. The accumulation mode particles collected in this stage were mostly in the size range of 0.2–0.5 μm, and were rectangular or spherical. They were considered to be particles consisting of ammonium sulfate. New particle formation (NPF) was observed around noon in the three days during the dust event, indicating that the passage of the dust was probably favorable for NPF. - Highlights: • A dust event transported at high altitude through Beijing was investigated. • The dust event caused high variation in surface aerosol number concentrations. • Fine particles in the floating dust period probably consisted of ammonium sulfate. • Passage of the dust induced a favorable condition for new particle formation.

  10. Insights into a dust event transported through Beijing in spring 2012: Morphology, chemical composition and impact on surface aerosols

    International Nuclear Information System (INIS)

    Hu, Wei; Niu, Hongya; Zhang, Daizhou; Wu, Zhijun; Chen, Chen; Wu, Yusheng; Shang, Dongjie; Hu, Min

    2016-01-01

    Multiple approaches were used to investigate the evolution of surface aerosols in Beijing during the passage of a dust event at high altitude, which was from the Gobi areas of southern Mongolia and covered a wide range of North China. Single particle analysis with electron microscope showed that the majority of coarse particles were mineral ones, and most of them were in the size range of 1–7 μm with a peak of number concentration at about 3.5 μm. Based on elemental composition and morphology, the mineral particles could be classified into several groups, including Si-rich (71%), Ca-rich (15%), Fe-rich (6%), and halite-rich (2%), etc., and they were the main contributors to the aerosol optical depth as the dust occurred. The size distributions of surface aerosols were significantly affected by the dust intrusion. The average number concentration of accumulation mode particles during the event was about 400 cm"−"3, which was much lower than that in heavily polluted days (6300 cm"−"3). At the stage of floating dust, the number concentration of accumulation mode particles decreased, and coarse particles contributed to total volume concentration of particulate matter as much as 90%. The accumulation mode particles collected in this stage were mostly in the size range of 0.2–0.5 μm, and were rectangular or spherical. They were considered to be particles consisting of ammonium sulfate. New particle formation (NPF) was observed around noon in the three days during the dust event, indicating that the passage of the dust was probably favorable for NPF. - Highlights: • A dust event transported at high altitude through Beijing was investigated. • The dust event caused high variation in surface aerosol number concentrations. • Fine particles in the floating dust period probably consisted of ammonium sulfate. • Passage of the dust induced a favorable condition for new particle formation.

  11. Dust events in Beijing, China (2004–2006: comparison of ground-based measurements with columnar integrated observations

    Directory of Open Access Journals (Sweden)

    Z. J. Wu

    2009-09-01

    Full Text Available Ambient particle number size distributions spanning three years were used to characterize the frequency and intensity of atmospheric dust events in the urban areas of Beijing, China in combination with AERONET sun/sky radiometer data. Dust events were classified into two types based on the differences in particle number and volume size distributions and local weather conditions. This categorization was confirmed by aerosol index images, columnar aerosol optical properties, and vertical potential temperature profiles. During the type-1 events, dust particles dominated the total particle volume concentration (<10 μm, with a relative share over 70%. Anthropogenic particles in the Aitken and accumulation mode played a subordinate role here because of high wind speeds (>4 m s−1. The type-2 events occurred in rather stagnant air masses and were characterized by a lower volume fraction of coarse mode particles (on average, 55%. Columnar optical properties showed that the superposition of dust and anthropogenic aerosols in type-2 events resulted in a much higher AOD (average: 1.51 than for the rather pure dust aerosols in type-1 events (average AOD: 0.36. A discrepancy was found between the ground-based and column integrated particle volume size distributions, especially for the coarse mode particles. This discrepancy likely originates from both the limited comparability of particle volume size distributions derived from Sun photometer and in situ number size distributions, and the inhomogeneous vertical distribution of particles during dust events.

  12. PM{sub 10} composition during an intense Saharan dust transport event over Athens (Greece)

    Energy Technology Data Exchange (ETDEWEB)

    Remoundaki, E., E-mail: remound@metal.ntua.gr [National Technical University of Athens (NTUA), School of Mining and Metallurgical Engineering, Laboratory of Environmental Science and Engineering, Heroon Polytechniou 9, 15780 Zografou (Greece); Bourliva, A. [Aristotle University of Thessaloniki (AUTH), Department of Geology, 54124 Thessaloniki (Greece); Hellenic Open University, School of Science and Technology, 26335 Patras (Greece); Kokkalis, P.; Mamouri, R.E.; Papayannis, A. [National Technical University of Athens (NTUA), Laser Remote Sensing Laboratory, Heroon Polytechniou 9, 15780 Zografou (Greece); Grigoratos, T.; Samara, C. [Aristotle University of Thessaloniki (AUTH), Department of Chemistry, Environmental Pollution Control Laboratory, 54124 Thessaloniki (Greece); Tsezos, M. [National Technical University of Athens (NTUA), School of Mining and Metallurgical Engineering, Laboratory of Environmental Science and Engineering, Heroon Polytechniou 9, 15780 Zografou (Greece)

    2011-09-15

    The influence of Saharan dust on the air quality of Southern European big cities became a priority during the last decade. The present study reports results on PM{sub 10} monitored at an urban site at 14 m above ground level during an intense Saharan dust transport event. The elemental composition was determined by Energy Dispersive X-ray Fluorescence Spectrometry (EDXRF) for 12 elements: Si, Al, Fe, K, Ca, Mg, Ti, S, Ni, Cu, Zn and Mn. PM{sub 10} concentrations exceeded the EU limit (50 {mu}g/m{sup 3}) several times during the sampling period. Simultaneous maxima have been observed for the elements of crustal origin. The concentrations of all the elements presented a common maximum, corresponding to the date where the atmosphere was heavily charged with particulate matter permanently for an interval of about 10 h. Sulfur and heavy metal concentrations were also associated to local emissions. Mineral dust represented the largest fraction of PM{sub 10} reaching 79%. Seven days back trajectories have shown that the air masses arriving over Athens, originated from Western Sahara. Scanning Electron Microscopy coupled with Energy Dispersive X-ray analysis (SEM-EDX) revealed that particle agglomerates were abundant, most of them having sizes < 2 {mu}m. Aluminosilicates were predominant in dust particles also rich in calcium which was distributed between calcite, dolomite, gypsum and Ca-Si particles. These results were consistent with the origin of the dust particles and the elemental composition results. Sulfur and heavy metals were associated to very fine particles < 1 {mu}m. - Highlights: {yields} The paper focuses on the contribution of Saharan dust in PM10 levels at an urban site. {yields} High Ca and Fe, calcite, illite and smectites and poor quartz contents are related to source-regions. {yields} The data sets presented are in very good agreement and are also strongly confirmed by literature. {yields} Dust contribution in PM10 can be of comparable importance for

  13. PM10 composition during an intense Saharan dust transport event over Athens (Greece)

    International Nuclear Information System (INIS)

    Remoundaki, E.; Bourliva, A.; Kokkalis, P.; Mamouri, R.E.; Papayannis, A.; Grigoratos, T.; Samara, C.; Tsezos, M.

    2011-01-01

    The influence of Saharan dust on the air quality of Southern European big cities became a priority during the last decade. The present study reports results on PM 10 monitored at an urban site at 14 m above ground level during an intense Saharan dust transport event. The elemental composition was determined by Energy Dispersive X-ray Fluorescence Spectrometry (EDXRF) for 12 elements: Si, Al, Fe, K, Ca, Mg, Ti, S, Ni, Cu, Zn and Mn. PM 10 concentrations exceeded the EU limit (50 μg/m 3 ) several times during the sampling period. Simultaneous maxima have been observed for the elements of crustal origin. The concentrations of all the elements presented a common maximum, corresponding to the date where the atmosphere was heavily charged with particulate matter permanently for an interval of about 10 h. Sulfur and heavy metal concentrations were also associated to local emissions. Mineral dust represented the largest fraction of PM 10 reaching 79%. Seven days back trajectories have shown that the air masses arriving over Athens, originated from Western Sahara. Scanning Electron Microscopy coupled with Energy Dispersive X-ray analysis (SEM-EDX) revealed that particle agglomerates were abundant, most of them having sizes < 2 μm. Aluminosilicates were predominant in dust particles also rich in calcium which was distributed between calcite, dolomite, gypsum and Ca-Si particles. These results were consistent with the origin of the dust particles and the elemental composition results. Sulfur and heavy metals were associated to very fine particles < 1 μm. - Highlights: → The paper focuses on the contribution of Saharan dust in PM10 levels at an urban site. → High Ca and Fe, calcite, illite and smectites and poor quartz contents are related to source-regions. → The data sets presented are in very good agreement and are also strongly confirmed by literature. → Dust contribution in PM10 can be of comparable importance for both an urban and a remote location.

  14. Effects of dust storm events on weekly clinic visits related to pulmonary tuberculosis disease in Minqin, China

    Science.gov (United States)

    Wang, Yun; Wang, Ruoyu; Ming, Jing; Liu, Guangxiu; Chen, Tuo; Liu, Xinfeng; Liu, Haixia; Zhen, Yunhe; Cheng, Guodong

    2016-02-01

    Pulmonary tuberculosis (PTB) is a major public health problem in China. Minqin, a Northwest county of China, has a very high number of annual PTB clinic visits and it is also known for its severe dust storms. The epidemic usually begins in February and ends in July, while the dust storms mainly occur throughout spring and early summer, thereby suggesting that there might be a close link between the causative agent of PTB and dust storms. We investigated the general impact of dust storms on PTB over time by analyzing the variation in weekly clinic visits in Minqin during 2005-2012. We used the Mann-Whitney-Pettitt test and a regression model to determine the seasonal periodicity of PTB and dust storms in a time series, as well as assessing the relationships between meteorological variables and weekly PTB clinic visits. After comparing the number of weekly PTB cases in Gansu province with dust storm events, we detected a clear link between the population dynamics of PTB and climate events, i.e., the onset of epidemics and dust storms (defined by an atmospheric index) occurred in almost the same mean week. Thus, particulate matter might be the cause of PTB outbreaks on dust storm days. It is highly likely that the significant decline in annual clinic visits was closely associated with improvements in the local environment, which prevented desertification and decreased the frequency of dust storm events. To the best of our knowledge, this is the first population-based study to provide clear evidence that a PTB epidemic was affected by dust storms in China, which may give insights into the association between this environmental problem and the evolution of epidemic disease.

  15. Variations in airborne bacterial communities at high altitudes over the Noto Peninsula (Japan) in response to Asian dust events

    Science.gov (United States)

    Maki, Teruya; Hara, Kazutaka; Iwata, Ayumu; Lee, Kevin C.; Kawai, Kei; Kai, Kenji; Kobayashi, Fumihisa; Pointing, Stephen B.; Archer, Stephen; Hasegawa, Hiroshi; Iwasaka, Yasunobu

    2017-10-01

    Aerosol particles, including airborne microorganisms, are transported through the free troposphere from the Asian continental area to the downwind area in East Asia and can influence climate changes, ecosystem dynamics, and human health. However, the variations present in airborne bacterial communities in the free troposphere over downwind areas are poorly understood, and there are few studies that provide an in-depth examination of the effects of long-range transport of aerosols (natural and anthropogenic particles) on bacterial variations. In this study, the vertical distributions of airborne bacterial communities at high altitudes were investigated and the bacterial variations were compared between dust events and non-dust events.Aerosols were collected at three altitudes from ground level to the free troposphere (upper level: 3000 or 2500 m; middle level: 1200 or 500 m; and low level: 10 m) during Asian dust events and non-dust events over the Noto Peninsula, Japan, where westerly winds carry aerosols from the Asian continental areas. During Asian dust events, air masses at high altitudes were transported from the Asian continental area by westerly winds, and laser imaging detection and ranging (lidar) data indicated high concentrations of non-spherical particles, suggesting that dust-sand particles were transported from the central desert regions of Asia. The air samples collected during the dust events contained 10-100 times higher concentrations of microscopic fluorescent particles and optical particle counter (OPC) measured particles than in non-dust events. The air masses of non-dust events contained lower amounts of dust-sand particles. Additionally, some air samples showed relatively high levels of black carbon, which were likely transported from the Asian continental coasts. Moreover, during the dust events, microbial particles at altitudes of > 1200 m increased to the concentrations ranging from 1. 2 × 106 to 6. 6 × 106 particles m-3. In contrast

  16. Enhancement and identification of dust events in the south-west ...

    Indian Academy of Sciences (India)

    in dust source regions, which have a negative impact on human health ... Keywords. MODIS; dust storm; visible; infrared; remote sensing; brightness temperature. 1 ... clouds can often be misinterpreted as dust. In order to ... dust aerosol outbreaks over land using satellite ... models were also used to track air parcels arriving.

  17. [Geochemical characteristics and sources of atmospheric particulates in Shanghai during dust storm event].

    Science.gov (United States)

    Qian, Peng; Zheng, Xiang-min; Zhou, Li-min

    2013-05-01

    Atmospheric particulates were sampled from three sampling sites of Putuo, Minhang and Qingpu Districts in Shanghai between Oct. , 2009 and Oct. , 2010. In addition, particulate samples were also collected from Nantong, Zhengzhou, Xi'an, and Beijing city where dust storm dust transported along during spring. Element compositions of atmospheric particulates were determined by XRF and ICP-MS. The concentrations of major and trace elements in atmospheric particulates from Putuo, Minhang and Qingpu Districts were similar, indicating their common source. The UCC standardization distribution map showed that the major element composition of dust storm samples was similar to that of loess in northwestern China, indicating that the dust storm dust was mainly derived from Western desert and partly from local area. The REE partition patterns of dust storm dusts among different cities along dust transport route were similar to each other, as well as to those of northern loess, which indicates that the dust storm samples may have the same material source as loess, which mainly comes from crust material. However, the REE partition patterns of non-dust storm particulates were different among the studied cities, and different from those of loess, which suggests that the non-dust storm samples may be mixed with non-crust source material, which is different from dust storm dust and loess. The major element composition and REE partition pattern are effective indicators for source tracing of dust storm dust.

  18. Spatial and Temporal Variation of the Extreme Saharan Dust Event over Turkey in March 2016

    Directory of Open Access Journals (Sweden)

    Hakki Baltaci

    2017-02-01

    Full Text Available In this study, the influence of an extraordinary Saharan dust episode over Turkey on 23–24 March 2016 and the atmospheric conditions that triggered this event were evaluated in detail. PM10 (particulate matter less than 10 μm observations from 97 air quality stations, METAR (Meteorological Terminal Aviation Routine Weather Report observations at 64 airports, atmospheric soundings, and satellite products were used for the analysis. To determine the surface and upper levels of atmospheric circulation, National Centers of Environmental Prediction (NCEP/National Center for Atmospheric Research (NCAR Reanalysis data were applied to the extreme dust episodes. On 23 March 2016, high southwesterly winds due to the interaction between surface low- and high-pressure centers over Italy and Levant basin brought thick dust particles from Libya to Turkey. The daily PM10 data from 43 stations exceeded their long-term spring means over Turkey (especially at the northern and western stations. As a consequence of the longitudinal movement of the surface low from Italy to the Balkan Peninsula, and the quasi-stationary conditions of the surface high-pressure center allowed for the penetration of strong south and southwesterly winds to inner parts of the country on the following day. As a consequence, 100%, 90%, 88%, and 87% of the monitoring stations in Marmara (NW Turkey, central Anatolia, western (Aegean and northern (Black Sea regions of Turkey, respectively, exhibited above-normal daily PM10 values. In addition, while strong subsidence at the low levels of the atmosphere plays a significant role in having excessive daily PM10 values in Black Sea, dry atmospheric conditions and thick inversion level near the ground surface of Marmara ensured this region to have peak PM10 values ~00 Local Time (LT.

  19. A Model of Dust-like Spherically Symmetric Gravitational Collapse without Event Horizon Formation

    Directory of Open Access Journals (Sweden)

    Piñol M.

    2015-10-01

    Full Text Available Some dynamical aspects of gravitational collapse are explored in this paper. A time- dependent spherically symmetric metric is proposed and the corresponding Einstein field equations are derived. An ultrarelativistic dust-like stress-momentum tensor is considered to obtain analytical solutions of these equations, with the perfect fluid con- sisting of two purely radial fluxes — the inwards flux of collapsing matter and the outwards flux of thermally emitted radiation. Thermal emission is calculated by means of a simplistic but illustrative model of uninteracting collapsing shells. Our results show an asymptotic approach to a maximal space-time deformation without the formation of event horizons. The size of the body is slightly larger than the Schwarzschild radius during most of its lifetime, so that there is no contradiction with either observations or previous theorems on black holes. The relation of the latter with our results is scruti- nized in detail.

  20. Injection of mineral dust into the free troposphere during fire events observed with polarization lidar at Limassol, Cyprus

    Directory of Open Access Journals (Sweden)

    A. Nisantzi

    2014-11-01

    Full Text Available Four-year observations (2010–2014 with EARLINET polarization lidar and AERONET sun/sky photometer at Limassol (34.7° N, 33° E, Cyprus, were used to study the soil dust content in lofted fire smoke plumes advected from Turkey. This first systematic attempt to characterize less than 3-day-old smoke plumes in terms of particle linear depolarization ratio (PDR, measured with lidar, contributes to the more general effort to properly describe the life cycle of free-tropospheric smoke–dust mixtures from the emission event to phases of long-range transport (> 4 days after emission. We found significant PDR differences with values from 9 to 18% in lofted aerosol layers when Turkish fires contributed to the aerosol burden and of 3–13 % when Turkish fires were absent. High Ångström exponents of 1.4–2.2 during all these events with lofted smoke layers, occurring between 1 and 3 km height, suggest the absence of a pronounced particle coarse mode. When plotted vs. travel time (spatial distance between Limassol and last fire area, PDR decreased strongly from initial values around 16–18% (1 day travel to 4–8% after 4 days of travel caused by deposition processes. This behavior was found to be in close agreement with findings described in the literature. Computation of particle extinction coefficient and mass concentrations, derived from the lidar observations, separately for fine-mode dust, coarse-mode dust, and non-dust aerosol components show extinction-related dust fractions on the order of 10% (for PDR =4%, travel times > 4 days and 50% (PDR =15%, 1 day travel time and respective mass-related dust fractions of 25% (PDR =4% to 80% (PDR =15%. Biomass burning should therefore be considered as another source of free tropospheric soil dust.

  1. Modeled Downward Transport of a Passive Tracer over Western North America during an Asian Dust Event in April 1998.

    Science.gov (United States)

    Hacker, Joshua P.; McKendry, Ian G.; Stull, Roland B.

    2001-09-01

    An intense Gobi Desert dust storm in April 1998 loaded the midtroposphere with dust that was transported across the Pacific to western North America. The Mesoscale Compressible Community (MC2) model was used to investigate mechanisms causing downward transport of the midtropospheric dust and to explain the high concentrations of particulate matter of less than 10-m diameter measured in the coastal urban areas of Washington and southern British Columbia. The MC2 was initialized with a thin, horizontally homogeneous layer of passive tracer centered at 650 hPa for a simulation from 0000 UTC 26 April to 0000 UTC 30 April 1998. Model results were in qualitative agreement with observed spatial and temporal patterns of particulate matter, indicating that it captured the important meteorological processes responsible for the horizontal and vertical transport over the last few days of the dust event. A second simulation was performed without topography to isolate the effects of topography on downward transport.Results show that the dust was advected well east of the North American coast in southwesterly midtropospheric flow, with negligible dust concentration reaching the surface initially. Vertically propagating mountain waves formed during this stage, and differences between downward and upward velocities in these waves could account for a rapid descent of dust to terrain height, where the dust was entrained into the turbulent planetary boundary layer. A deepening outflow (easterly) layer near the surface transported the tracer westward and created a zonal-shear layer that further controlled the tracer advection. Later, the shear layer lifted, leading to a downward hydraulic acceleration along the western slopes, as waves generated in the easterly flow amplified below the shear layer that was just above mountain-crest height. Examination of 10 yr of National Centers for Environmental Prediction-National Center for Atmospheric Research reanalyses suggests that such events

  2. Long-term variability of dust events in Iceland (1949-2011)

    OpenAIRE

    Dagsson-Waldhauserova, Pavla; Arnalds, Olafur; Ólafsson, Haraldur

    2014-01-01

    The long-term frequency of atmospheric dust observations was investigated for the southern part of Iceland and interpreted together with earlier results obtained from northeastern (NE) Iceland (Dagsson-Waldhauserova et al., 2013). In total, over 34 dust days per year on average occurred in Iceland based on conventionally used synoptic codes for dust observations. However, frequent volcanic eruptions, with the re-suspension of volcanic materials and dust haze, increased the n...

  3. Saharan dust particles in snow samples of Alps and Apennines during an exceptional event of transboundary air pollution.

    Science.gov (United States)

    Telloli, Chiara; Chicca, Milvia; Pepi, Salvatore; Vaccaro, Carmela

    2017-12-21

    Southern European countries are often affected in summer by transboundary air pollution from Saharan dust. However, very few studies deal with Saharan dust pollution at high altitudes in winter. In Italy, the exceptional event occurred on February 19, 2014, colored in red the entire mountain range (Alps and Apennines) and allowed to characterize the particulate matter deposited on snow from a morphological and chemical point of view. Snow samples were collected after this event in four areas in the Alps and one in the Apennines. The particulate matter of the melted snow samples was analyzed by scanning electron microscopy with energy dispersive X-ray spectrometry (SEM-EDS) and by inductively coupled plasma mass spectrometry (ICP-MS). These analyses confirmed the presence of Saharan dust particle components in all areas with similar percentages, supported also by the positive correlations between Mg-Ca, Al-Ca, Al-Mg, and Al-K in all samples.

  4. Aerosol radiative forcing during African desert dust events (2005–2010 over Southeastern Spain

    Directory of Open Access Journals (Sweden)

    A. Valenzuela

    2012-11-01

    Full Text Available The daily (24 h averages of the aerosol radiative forcing (ARF at the surface and the top of the atmosphere (TOA were calculated during desert dust events over Granada (southeastern Spain from 2005 to 2010. A radiative transfer model (SBDART was utilized to simulate the solar irradiance values (0.31–2.8 μm at the surface and TOA, using as input aerosol properties retrieved from CIMEL sun photometer measurements via an inversion methodology that uses the sky radiance measurements in principal plane configuration and a spheroid particle shape approximation. This inversion methodology was checked by means of simulated data from aerosol models, and the derived aerosol properties were satisfactorily compared against well-known AERONET products. Good agreement was found over a common spectral interval (0.2–4.0 μm between the simulated SBDART global irradiances at surface and those provided by AERONET. In addition, simulated SBDART solar global irradiances at the surface have been successfully validated against CM-11 pyranometer measurements. The comparison indicates that the radiative transfer model slightly overestimates (mean bias of 3% the experimental solar global irradiance. These results show that the aerosol optical properties used to estimate ARF represent appropriately the aerosol properties observed during desert dust outbreak over the study area. The ARF mean monthly values computed during desert dust events ranged from −13 ± 8 W m−2 to −34 ± 15 W m−2 at surface, from −4 ± 3 W m−2 to −13 ± 7 W m−2 at TOA and from +6 ± 4 to +21 ± 12 W m−2 in the atmosphere. We have checked if the differences found in aerosol optical properties among desert dust sectors translate to differences in ARF. The mean ARF at surface (TOA were −20 ± 12 (−5 ± 5 W m−2, −21 ± 9 (−7 ± 5 W m−2 and −18 ± 9 (−6 ± 5 W m−2 for sector A

  5. House dust-mite allergen exposure is associated with serum specific IgE but not with respiratory outcomes.

    Science.gov (United States)

    Bakolis, I; Heinrich, J; Zock, J P; Norbäck, D; Svanes, C; Chen, C M; Accordini, S; Verlato, G; Olivieri, M; Jarvis, D

    2015-06-01

    Exposure to house dust has been associated with asthma in adults, and this is commonly interpreted as a direct immunologic response to dust-mite allergens in those who are IgE sensitized to house dust-mite. Mattress house dust-mite concentrations were measured in a population-based sample of 2890 adults aged between 27 and 56 years living in 22 centers in 10 countries. Generalized linear mixed models were employed to explore the association of respiratory symptoms with house dust-mite concentrations, adjusting for individual and household confounders. There was no overall association of respiratory outcomes with measured house dust-mite concentrations, even in those who reported they had symptoms on exposure to dust and those who had physician-diagnosed asthma. However, there was a positive association of high serum specific IgE levels to HDM (>3.5 kUA /l) with mattress house dust-mite concentrations and a negative association of sensitization to cat with increasing house dust-mite concentrations. In conclusion, there was no evidence that respiratory symptoms in adults were associated with exposure to house dust-mite allergen in the mattress, but an association of house mite with strong sensitization was observed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. A Climatology of Dust-Emission Events over North Africa Based on 27 Years of Surface Observations

    Science.gov (United States)

    Cowie, S.; Knippertz, P.; Schepanski, K.

    2012-04-01

    The huge quantity of mineral dust emitted annually from North Africa makes this area crucial to the global dust cycle. Once in the atmosphere, dust aerosols have a significant impact on the global radiation budget, clouds, the carbon cycle and can even act as a fertilizer to rain forests in South America. Current model estimates of dust production from North Africa are uncertain. At the heart of this problem is insufficient understanding of key dust emitting processes such as haboobs (cold pools generated through evaporation of convective precipitation), low-level jets (LLJs), and dry convection (dust devils and dust plumes). Scarce observations in this region, in particular in the Sahara, make model evaluation difficult. This work uses long-term surface observations from the MIDAS data set (~120 stations in the arid part of North Africa) to explore the diurnal, seasonal, decadal and geographical variations in dust emission events and their associated wind thresholds. The threshold values are determined from probability density functions of observed 10-minute anemomenter wind speeds. Emission events are defined using the present weather codes (WW) of SYNOP reports. These codes represent events of smaller intensity such as "Dust or sand raised by wind" to severe dust storms. During the 27-year study period (1984-2011) stations are required to have a minimum of 1000 dust observations to be included in the analysis. Dust emission frequency (DEF) is calculated for different time intervals (e.g. monthly, 3-hourly) taking into account the different number of measurements available at each station. North of 25°N a maximum during March-May is evident and relatively consistent over the whole North African region. Wind-speed thresholds for dust emission north of 25°N are higher than south of 25°N in the Sahel, where station-to-station variability is larger, and enhanced DEF activity during February-March is observed. The variability in this region is closely linked to the

  7. Major dust events in Europe during marine isotope stage 5 (130–74 ka: a climatic interpretation of the "markers"

    Directory of Open Access Journals (Sweden)

    D.-D. Rousseau

    2013-09-01

    Full Text Available At present, major dust storms are occurring at mid-latitudes in the Middle East and Asia, as well as at low latitudes in Northern Africa and in Australia. Western Europe, though, does not experience such dramatic climate events, except for some African dust reaching it from the Sahara. This modern situation is of particular interest, in the context of future climate projections, since the present interglacial is usually interpreted, in this context, as an analog of the warm Eemian interval. European terrestrial records show, however, major dust events during the penultimate interglacial and early glacial. These events are easily observed in loess records by their whitish-color deposits, which lie above and below dark chernozem paleosols in Central European records of Marine Isotope Stage (MIS 5 age. We describe here the base of the Dolni Vestonice (DV loess sequence, Czech Republic, as the reference of such records. The dust is deposited during intervals that are characterized by poor vegetation – manifested by high δ13C values and low magnetic susceptibility – while the fine sand and clay in the deposits shows grain sizes that are clearly different from the overlying pleniglacial loess deposits. Some of these dust events have been previously described as "Markers" or Marker Silts (MS by one of us (G. Kukla, and are dated at about 111–109 ka and 93–92 ka, with a third and last one slightly visible at about 75–73 ka. Other events correspond to the loess material of Kukla's cycles, and are described as eolian silts (ES; they are observed in the same DV sequence and are dated at about 106–105 ka, 88–86 ka, and 78.5–77 ka. These dates are determined by considering the OSL ages with their errors measured on the studied sequence, and the comparison with Greenland ice-core and European speleothem chronologies. The fine eolian deposits mentioned above, MS as well as ES, correspond to short events that lasted about 2 ka; they are

  8. Influences of natural emission sources (wildfires and Saharan dust) on the urban organic aerosol in Barcelona (Western Mediterranean Basis) during a PM event.

    Science.gov (United States)

    van Drooge, Barend L; Lopez, Jordi F; Grimalt, Joan O

    2012-11-01

    The urban air quality in Barcelona in the Western Mediterranean Basin is characterized by overall high particulate matter (PM) concentrations, due to intensive local anthropogenic emissions and specific meteorological conditions. Moreover, on several days, especially in summer, natural PM sources, such as long-range transported Saharan dust from Northern Africa or wildfires on the Iberian Peninsula and around the Mediterranean Basin, may influence the levels and composition of the organic aerosol. In the second half of July 2009, daily collected PM(10) filter samples in an urban background site in Barcelona were analyzed on organic tracer compounds representing several emission sources. During this period, an important PM peak event was observed. Individual organic compound concentrations increased two to five times during this event. Although highest increase was observed for the organic tracer of biomass burning, the contribution to the organic aerosol was estimated to be around 6 %. Organic tracers that could be related to Saharan dust showed no correlation with the PM and OC levels, while this was the case for those related to fossil fuel combustion from traffic emissions. Moreover, a change in the meteorological conditions gave way to an overall increase of the urban background contamination. Long-range atmospheric transport of organic compounds from primary emissions sources (i.e., wildfires and Saharan dust) has a relatively moderate impact on the organic aerosol in an urban area where the local emissions are dominating.

  9. Modeling a typical winter-time dust event over the Arabian Peninsula and the Red Sea

    KAUST Repository

    Kalenderski, Stoitchko; Stenchikov, Georgiy L.; Zhao, C.

    2013-01-01

    2009. The model predicted that the total amount of emitted dust was 18.3 Tg for the entire dust outburst period and that the two maximum daily rates were ?2.4 Tg day-1 and ?1.5 Tg day-1, corresponding to two periods with the highest aerosol optical

  10. DEVS representation of dynamical systems - Event-based intelligent control. [Discrete Event System Specification

    Science.gov (United States)

    Zeigler, Bernard P.

    1989-01-01

    It is shown how systems can be advantageously represented as discrete-event models by using DEVS (discrete-event system specification), a set-theoretic formalism. Such DEVS models provide a basis for the design of event-based logic control. In this control paradigm, the controller expects to receive confirming sensor responses to its control commands within definite time windows determined by its DEVS model of the system under control. The event-based contral paradigm is applied in advanced robotic and intelligent automation, showing how classical process control can be readily interfaced with rule-based symbolic reasoning systems.

  11. Dust Deposition Events on Mt. Elbrus, Caucasus Mountains in the 21st Century Reconstructed from the Shallow Firn and Ice Cores (Invited)

    Science.gov (United States)

    Shahgedanova, M.; Kutuzov, S.; Mikhalenko, V.; Ginot, P.; Lavrentiev, I.

    2013-12-01

    This paper presents and discusses a record of dust deposition events reconstructed from the shallow firn and ice cores extracted on the Western Plateau, Mt. Elbrus, Caucasus Mountains, Russia. A combination of SEVIRI imagery, HYSPLIT trajectory model, meteorological and atmospheric optical depth data were used to establish timing of deposition events and source regions of dust with very high temporal (hours) and spatial (c. 50-100 km) resolution. The source regions of the desert dust transported to Mt. Elbrus were primarily located in the Middle East, in particular in eastern Syria and in the Syrian Desert at the border between Saudi Arabia, Iraq and Jordan. Northern Sahara, the foothills of the Djebel Akhdar Mountains in eastern Libya and the border region between Libya and Algeria were other important sources of desert dust. Dust sources in the Sahara were natural (e.g. palaeolakes and alluvial deposits in the foothills) while in the Middle East, dust entrainment occurred from both natural (e.g. dry river beds) and anthropogenic (e.g. agricultural fields) sources. The overall majority of dust deposition events occurred between March and June and, less frequently, dust deposition events occurred in February and October. In all cases, dust deposition was associated with depressions causing strong surface wind and dust uplift in the source areas, transportation of dust to the Caucasus with a strong south-westerly flow from the Sahara or southerly flow from the Middle East, merging of the dust clouds with precipitation-bearing weather fronts and precipitation over the Caucasus region. The Saharan depressions were vigorous and associated with stronger daily wind speeds of 20-30 m/s at the 700 hPa level; depressions forming over the Middle East and the associated wind speeds were weaker at 12-15 m/s. The Saharan depressions were less frequent than those carrying dust from the Middle East but higher dust loads were associated with the Saharan depressions. A higher

  12. Spatial variability of excess mortality during prolonged dust events in a high-density city: a time-stratified spatial regression approach.

    Science.gov (United States)

    Wong, Man Sing; Ho, Hung Chak; Yang, Lin; Shi, Wenzhong; Yang, Jinxin; Chan, Ta-Chien

    2017-07-24

    Dust events have long been recognized to be associated with a higher mortality risk. However, no study has investigated how prolonged dust events affect the spatial variability of mortality across districts in a downwind city. In this study, we applied a spatial regression approach to estimate the district-level mortality during two extreme dust events in Hong Kong. We compared spatial and non-spatial models to evaluate the ability of each regression to estimate mortality. We also compared prolonged dust events with non-dust events to determine the influences of community factors on mortality across the city. The density of a built environment (estimated by the sky view factor) had positive association with excess mortality in each district, while socioeconomic deprivation contributed by lower income and lower education induced higher mortality impact in each territory planning unit during a prolonged dust event. Based on the model comparison, spatial error modelling with the 1st order of queen contiguity consistently outperformed other models. The high-risk areas with higher increase in mortality were located in an urban high-density environment with higher socioeconomic deprivation. Our model design shows the ability to predict spatial variability of mortality risk during an extreme weather event that is not able to be estimated based on traditional time-series analysis or ecological studies. Our spatial protocol can be used for public health surveillance, sustainable planning and disaster preparation when relevant data are available.

  13. Cause-specific mortality in British coal workers and exposure to respirable dust and quartz

    Energy Technology Data Exchange (ETDEWEB)

    Miller, B.G.; MacCalman, L. [Institute of Occupational Medicine, Edinburgh (United Kingdom)

    2010-04-15

    In the 1950s the Pneumoconiosis Field Research (PFR) programme was set up to study the health of British coal workers. Studies included regular health surveys, an intensive characterisation of workers' individual exposures, and entry to a cohort followed up to the present for cause-specific mortality. This study reports on analyses of cause-specific mortality in a cohort of almost 18 000 men from 10 British collieries. External analyses used standardised mortality ratios (SMRs), comparing observed mortality with reference rates from the regions in which the collieries were situated. Causes investigated include lung and stomach cancers, chronic obstructive pulmonary disease and cardiovascular endpoints. Internal analyses used Cox regression models with time-dependent exposures adjusting for the confounding effects of age, smoking, cohort entry date and regional differences in population mortality rates. Several causes showed evidence of a healthy worker effect early in the follow-up, with a deficit in the SMR diminishing over time. For most of the causes there was a significant excess in the latter part of follow-up. Internal analyses found evidence of an association between increased risks of lung cancer and increased quartz exposure, particularly at a lag of 15 years. Risks of mortality from non-malignant respiratory disease showed increases with increased exposure to respirable dust. This paper adds to the evidence on the long-term effects of exposure to coalmine dust on mortality from respiratory diseases.

  14. Cause-specific mortality in British coal workers and exposure to respirable dust and quartz

    Energy Technology Data Exchange (ETDEWEB)

    Brian G Miller; Laura MacCalman [Institute of Occupational Medicine, Edinburgh (United Kingdom)

    2010-04-15

    In the 1950s the Pneumoconiosis Field Research (PFR) programme was set up to study the health of British coal workers. Studies included regular health surveys, an intensive characterisation of workers' individual exposures, and entry to a cohort followed up to the present for cause-specific mortality. This study reports on analyses of cause-specific mortality in a cohort of almost 18?000 men from 10 British collieries. External analyses used standardised mortality ratios (SMRs), comparing observed mortality with reference rates from the regions in which the collieries were situated. Causes investigated include lung and stomach cancers, chronic obstructive pulmonary disease and cardiovascular endpoints. Internal analyses used Cox regression models with time-dependent exposures adjusting for the confounding effects of age, smoking, cohort entry date and regional differences in population mortality rates. Several causes showed evidence of a healthy worker effect early in the follow-up, with a deficit in the SMR diminishing over time. For most of the causes there was a significant excess in the latter part of follow-up. Internal analyses found evidence of an association between increased risks of lung cancer and increased quartz exposure, particularly at a lag of 15 years. Risks of mortality from non-malignant respiratory disease showed increases with increased exposure to respirable dust. This paper adds to the evidence on the long-term effects of exposure to coalmine dust on mortality from respiratory diseases.

  15. Effects of Asian dust event particles on inflammation markers in peripheral blood and bronchoalveolar lavage in pulmonary hypertensive rats

    International Nuclear Information System (INIS)

    Lei, Y.-C.; Chan, C.-C.; Wang, P.-Y.; Lee, C.-T.; Cheng, T.-J.

    2004-01-01

    The health impact of dust events from China has become a concern within China and in its neighboring countries. Previous epidemiological studies have demonstrated an association between particulate matter exposure and cardiopulmonary mortality. Here, we use pulmonary hypertensive rat models to examine inflammation markers in the lung and in peripheral blood after exposure to Asian dust storm particles. Using a nose-only inhalation system, eight pulmonary hypertensive rats were exposed to concentrated ambient particles (CAPs) from an actual Asian dust storm that took place between March 18 and 19, 2002; four control rats were also exposed to room air. Four rats exposed to CAPs of 315.6 μg/m 3 for 6 h were classified as the low-exposure group, and another four rats exposed to CAPs of 684.5 μg/m 3 for 4.5 h were classified as the high-exposure group. The animals were sacrificed 36 h after exposure. Inflammation markers in the peripheral blood and in the bronchoalveolar lavage (BAL) were analyzed, and IL-6 in BAL was also determined using ELISA. White blood cell counts in peripheral blood increased with increased CAP exposure levels (P<0.001, test for trend). In BAL analysis, total cell numbers and the proportion of neutrophil also increased with increased CAP levels (P<0.001, test for trend for both markers). Positive dose-response relationships between CAP exposure and total protein (P<0.05) and between CAPs and LDH activity (P<0.05) were also observed. Moreover, IL-6 protein in BAL increasing with CAP levels (P<0.05, test for trend) was demonstrated. Our results revealed that exposure to particulate matters during an Asian dust storm could increase lung inflammation and injury in pulmonary hypertensive rats. Further studies are needed to determine the components of dust storm particles that may contribute to the particle toxicity

  16. Anticipating and addressing event-specific alcohol consumption among adolescents

    Directory of Open Access Journals (Sweden)

    Simone Pettigrew

    2016-07-01

    Full Text Available Abstract Background Various specific events and celebrations are associated with excessive alcohol consumption and related harms. End-of-school celebrations such as Schoolies in Australia are of particular concern given high levels of documented harm among underage and young drinkers. The present study investigated high school students’ expectations of their Schoolies celebrations to inform future interventions to reduce adverse outcomes among members of this vulnerable group and other young people involved in similar rites of passage. Methods A link to an online survey was distributed via high schools and Schoolies-related websites. The survey included qualitative questions that invited respondents to discuss (i aspects of Schoolies they were looking forward to most and least and (ii their perceptions of the likely consequences if they refrained from consuming alcohol during the event. In total, 435 students provided responses. Results Respondents discussed the role of Schoolies in marking their transition to adulthood. Their comments revealed a cross-temporal focus indicating that Schoolies is simultaneously symbolic of the past, present, and future. Through its ability to enhance social interaction, alcohol was perceived to have a vital role in realising the potential of this event to signify and facilitate this temporal progression. Conclusions Results suggest interventions that treat Schoolies as an isolated event that occurs in specific locations may fail to appreciate the extent to which these events transcend time for those involved. Instead, harm reduction is likely to involve a reconceptualisation of the event among both participants and authority figures to facilitate the provision of alternative pastimes to drinking during Schoolies that yield similar social benefits.

  17. Anticipating and addressing event-specific alcohol consumption among adolescents.

    Science.gov (United States)

    Pettigrew, Simone; Biagioni, Nicole; Jongenelis, Michelle I

    2016-07-29

    Various specific events and celebrations are associated with excessive alcohol consumption and related harms. End-of-school celebrations such as Schoolies in Australia are of particular concern given high levels of documented harm among underage and young drinkers. The present study investigated high school students' expectations of their Schoolies celebrations to inform future interventions to reduce adverse outcomes among members of this vulnerable group and other young people involved in similar rites of passage. A link to an online survey was distributed via high schools and Schoolies-related websites. The survey included qualitative questions that invited respondents to discuss (i) aspects of Schoolies they were looking forward to most and least and (ii) their perceptions of the likely consequences if they refrained from consuming alcohol during the event. In total, 435 students provided responses. Respondents discussed the role of Schoolies in marking their transition to adulthood. Their comments revealed a cross-temporal focus indicating that Schoolies is simultaneously symbolic of the past, present, and future. Through its ability to enhance social interaction, alcohol was perceived to have a vital role in realising the potential of this event to signify and facilitate this temporal progression. Results suggest interventions that treat Schoolies as an isolated event that occurs in specific locations may fail to appreciate the extent to which these events transcend time for those involved. Instead, harm reduction is likely to involve a reconceptualisation of the event among both participants and authority figures to facilitate the provision of alternative pastimes to drinking during Schoolies that yield similar social benefits.

  18. The concentration, source and deposition flux of ammonium and nitrate in atmospheric particles during dust events at a coastal site in northern China

    Science.gov (United States)

    Qi, Jianhua; Liu, Xiaohuan; Yao, Xiaohong; Zhang, Ruifeng; Chen, Xiaojing; Lin, Xuehui; Gao, Huiwang; Liu, Ruhai

    2018-01-01

    Asian dust has been reported to carry anthropogenic reactive nitrogen during transport from source areas to the oceans. In this study, we attempted to characterize NH4+ and NO3- in atmospheric particles collected at a coastal site in northern China during spring dust events from 2008 to 2011. Based on the mass concentrations of NH4+ and NO3- in each total suspended particle (TSP) sample, the samples can be classified into increasing or decreasing types. In Category 1, the concentrations of NH4+ and NO3- were 20-440 % higher in dust day samples relative to samples collected immediately before or after a dust event. These concentrations decreased by 10-75 % in the dust day samples in Categories 2 and 3. Back trajectory analysis suggested that multiple factors, such as the transport distance prior to the reception site, the mixing layer depth on the transport route and the residence time across highly polluted regions, might affect the concentrations of NH4+ and NO3-. NH4+ in the dust day samples was likely either in the form of ammonium salts existing separately to dust aerosols or as the residual of incomplete reactions between ammonium salts and carbonate salts. NO3- in the dust day samples was attributed to various formation processes during the long-range transport. The positive matrix factorization (PMF) receptor model results showed that the contribution of soil dust increased from 23 to 36 % on dust days, with decreasing contributions from local anthropogenic inputs and associated secondary aerosols. The estimated deposition flux of NNH4++NO3- varied greatly from event to event; e.g., the dry deposition flux of NNH4++NO3- increased by 9-285 % in Category 1 but decreased by 46-73 % in Category 2. In Category 3, the average dry deposition fluxes of particulate nitrate and ammonium decreased by 46 % and increased by 10 %, respectively, leading to 11-48 % decrease in the fluxes of NNH4++NO3-.

  19. Factors influencing on the bioaccessibility of polybrominated diphenyl ethers in size-specific dust from air conditioner filters.

    Science.gov (United States)

    Yu, Yingxin; Yang, Dan; Wang, Xinxin; Huang, Ningbao; Zhang, Xinyu; Zhang, Dongping; Fu, Jiamo

    2013-11-01

    Size-specific concentrations and bioaccessibility of polybrominated diphenyl ethers (PBDEs) in dust from air conditioner filters were measured, and the factors influencing the PBDE bioaccessibility were determined. Generally, the PBDE concentrations increased with decreasing dust particle size, and BDE209 (deca-BDE) was generally the predominant congener. The bioaccessibility ranged from 20.3% to 50.8% for tri- to hepta-BDEs, and from 5.1% to 13.9% for BDE209 in dust fractions of varied particle size. The bioaccessibility of most PBDE congeners decreased with increasing dust particle size. The way of being of PBDE (adsorbed to dust surface or incorporated into polymers) in dust significantly influenced the bioaccessibility. There was a significant negative correlation between the tri- to hepta-BDE bioaccessibility and organic matter (OM) contents in dust. Furthermore, tri- to hepta-BDE bioaccessibility increased with increasing polarity of OMs, while with decreasing aromaticity of OMs. The tri- to hepta-BDE bioaccessibility significantly positively correlated with the surface areas and pore volumes of dust. Using multiple linear regression analysis, it was found that the OM contents and pore volumes of dust were the most important factors to influence the tri- to hepta-BDE bioaccessibility and they could be used to estimate the bioaccessibility of tri- to hepta-BDEs according to the following equation: bioaccessibility (%)=45.05-0.49 × OM%+1.79 × pore volume. However, BDE209 bioaccessibility did not correlate to any of these factors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Synergy of Two Highly Specific Biomolecular Recognition Events

    DEFF Research Database (Denmark)

    Ejlersen, Maria; Christensen, Niels Johan; Sørensen, Kasper K

    2018-01-01

    Two highly specific biomolecular recognition events, nucleic acid duplex hybridization and DNA-peptide recognition in the minor groove, were coalesced in a miniature ensemble for the first time by covalently attaching a natural AT-hook peptide motif to nucleic acid duplexes via a 2'-amino......-LNA scaffold. A combination of molecular dynamics simulations and ultraviolet thermal denaturation studies revealed high sequence-specific affinity of the peptide-oligonucleotide conjugates (POCs) when binding to complementary DNA strands, leveraging the bioinformation encrypted in the minor groove of DNA...

  1. Communication plan for windblown dust.

    Science.gov (United States)

    2015-05-01

    Windblown dust events occur in Arizona, and blowing dust has been considered a contributing factor to serious crashes on the : segment of Interstate 10 (I10) between Phoenix and Tucson, as well as on other Arizona roadways. Arizonas dust events...

  2. Iron oxide minerals in dust of the Red Dawn event in eastern Australia, September 2009

    Science.gov (United States)

    Reynolds, Richard L.; Cattle, Stephen R.; Moskowitz, Bruce M.; Goldstein, Harland L.; Yauk, Kimberly; Flagg, Cody B.; Berquó, Thelma S.; Kokaly, Raymond F.; Morman, Suzette A.; Breit, George N.

    2014-01-01

    Iron oxide minerals typically compose only a few weight percent of bulk atmospheric dust but are important for potential roles in forcing climate, affecting cloud properties, influencing rates of snow and ice melt, and fertilizing marine phytoplankton. Dust samples collected from locations across eastern Australia (Lake Cowal, Orange, Hornsby, and Sydney) following the spectacular “Red Dawn” dust storm on 23 September 2009 enabled study of the dust iron oxide assemblage using a combination of magnetic measurements, Mössbauer spectroscopy, reflectance spectroscopy, and scanning electron microscopy. Red Dawn was the worst dust storm to have hit the city of Sydney in more than 60 years, and it also deposited dust into the Tasman Sea and onto snow cover in New Zealand. Magnetization measurements from 20 to 400 K reveal that hematite, goethite, and trace amounts of magnetite are present in all samples. Magnetite concentrations (as much as 0.29 wt%) were much higher in eastern, urban sites than in western, agricultural sites in central New South Wales (0.01 wt%), strongly suggesting addition of magnetite from local urban sources. Variable temperature Mössbauer spectroscopy (300 and 4.2 K) indicates that goethite and hematite compose approximately 25–45% of the Fe-bearing phases in samples from the inland sites of Orange and Lake Cowal. Hematite was observed at both temperatures but goethite only at 4.2 K, thereby revealing the presence of nanogoethite (less than about 20 nm). Similarly, hematite particulate matter is very small (some of it d < 100 nm) on the basis of magnetic results and Mössbauer spectra. The degree to which ferric oxide in these samples might absorb solar radiation is estimated by comparing reflectance values with a magnetic parameter (hard isothermal remanent magnetization, HIRM) for ferric oxide abundance. Average visible reflectance and HIRM are correlated as a group (r2 = 0.24), indicating that Red Dawn ferric oxides have

  3. Unsupervised behaviour-specific dictionary learning for abnormal event detection

    DEFF Research Database (Denmark)

    Ren, Huamin; Liu, Weifeng; Olsen, Søren Ingvor

    2015-01-01

    the training data is only a small proportion of the surveillance data. Therefore, we propose behavior-specific dictionaries (BSD) through unsupervised learning, pursuing atoms from the same type of behavior to represent one behavior dictionary. To further improve the dictionary by introducing information from...... potential infrequent normal patterns, we refine the dictionary by searching ‘missed atoms’ that have compact coefficients. Experimental results show that our BSD algorithm outperforms state-of-the-art dictionaries in abnormal event detection on the public UCSD dataset. Moreover, BSD has less false alarms...

  4. Short-term changes in the northwest African Upwelling System induced by Saharan dust deposition events

    Energy Technology Data Exchange (ETDEWEB)

    Ramos, A G; Coca, J; Redondo, A [SeaSnet Canarias. Dpto. de Biologia (University of Las Palmas de Gran Canaria), Canary Islands (Spain); Cuevas, E; Alonso-Perez, S; Bustos, J J [Izana Atmospheric Research Center, Agencia Estatal de Meteorologia, Tenerife (Spain); Perez, C; Baldasano, J M [Earth Sciences Department. Barcelona Supercomputing Center, Barcelona (Spain); Nickovic, S [Atmospheric Research and Environment Branch, World Meteorological Organization, Geneva (Switzerland)], E-mail: aramos@pesca.gi.ulpgc.es

    2009-03-01

    During the last 7-year period (2000-2006) atmosphere circulation changes show strong influences on the dust storm deposition dynamics and, as a result, on the primary production dynamics of the northwest African Upwelling System. From 2000 to 2006, the annual mean sea level pressure became higher ranging from 1014 to 1015 mb. Mean annual zonal wind intensity became higher (from 1.1 to 1.8 m s{sup -1}), while the mean annual meridional was reduced from 6.2 to 5.3 m s{sup -1} at the north of the Canary Islands. Mean annual satellite-derived AVHRR/NOAA SST recorded in the northwest African Upwelling became warmer in both locations, from 18.3 deg. C to 18.8 deg. C in Cape Ghir and from 19.5 deg. C to 20.3 deg. C north Canary Islands waters. CHL records from the SeaWiFS/OV-2 showed a different pattern trend. Mean annual CHL levels increased at Cape Ghir from 0.65 mg m-3 to 0.9 mg m-3 and significantly reduced from 0.59 mg m{sup -3} to 0.31 mg m{sup -3} at the north of the Canary Islands. Changes observed in the role of CHL during the last 7-years period could be associated to intensive dust deposition and exceptional weather warming observed in this area since 2000. However, this study focused on a 7-year period and conclusions on possible links between dust deposition and marine biochemistry activity cannot be generalized.

  5. Short-term changes in the northwest African Upwelling System induced by Saharan dust deposition events

    International Nuclear Information System (INIS)

    Ramos, A G; Coca, J; Redondo, A; Cuevas, E; Alonso-Perez, S; Bustos, J J; Perez, C; Baldasano, J M; Nickovic, S

    2009-01-01

    During the last 7-year period (2000-2006) atmosphere circulation changes show strong influences on the dust storm deposition dynamics and, as a result, on the primary production dynamics of the northwest African Upwelling System. From 2000 to 2006, the annual mean sea level pressure became higher ranging from 1014 to 1015 mb. Mean annual zonal wind intensity became higher (from 1.1 to 1.8 m s -1 ), while the mean annual meridional was reduced from 6.2 to 5.3 m s -1 at the north of the Canary Islands. Mean annual satellite-derived AVHRR/NOAA SST recorded in the northwest African Upwelling became warmer in both locations, from 18.3 deg. C to 18.8 deg. C in Cape Ghir and from 19.5 deg. C to 20.3 deg. C north Canary Islands waters. CHL records from the SeaWiFS/OV-2 showed a different pattern trend. Mean annual CHL levels increased at Cape Ghir from 0.65 mg m-3 to 0.9 mg m-3 and significantly reduced from 0.59 mg m -3 to 0.31 mg m -3 at the north of the Canary Islands. Changes observed in the role of CHL during the last 7-years period could be associated to intensive dust deposition and exceptional weather warming observed in this area since 2000. However, this study focused on a 7-year period and conclusions on possible links between dust deposition and marine biochemistry activity cannot be generalized.

  6. Bacterial diversity and composition during rain events with and without Saharan dust influence reaching a high mountain lake in the Alps.

    Science.gov (United States)

    Peter, Hannes; Hörtnagl, Paul; Reche, Isabel; Sommaruga, Ruben

    2014-12-01

    The diversity of airborne microorganisms that potentially reach aquatic ecosystems during rain events is poorly explored. Here, we used a culture-independent approach to characterize bacterial assemblages during rain events with and without Saharan dust influence arriving to a high mountain lake in the Austrian Alps. Bacterial assemblage composition differed significantly between samples with and without Saharan dust influence. Although alpha diversity indices were within the same range in both sample categories, rain events with Atlantic or continental origins were dominated by Betaproteobacteria, whereas those with Saharan dust intrusions were dominated by Gammaproteobacteria. The high diversity and evenness observed in all samples suggests that different sources of bacteria contributed to the airborne assemblage collected at the lake shore. During experiments with bacterial assemblages collected during rain events with Saharan dust influence, cell numbers rapidly increased in sterile lake water from initially ∼3 × 103 cell ml-1 to 3.6-11.1 x105 cells ml-1 within 4-5 days, and initially, rare taxa dominated at the end of the experiment. Our study documents the dispersal of viable bacteria associated to Saharan dust intrusions travelling northwards as far as 47° latitude.

  7. Significant impacts of heterogeneous reactions on the chemical composition and mixing state of dust particles: A case study during dust events over northern China

    Science.gov (United States)

    Wang, Zhe; Pan, Xiaole; Uno, Itsushi; Li, Jie; Wang, Zifa; Chen, Xueshun; Fu, Pingqing; Yang, Ting; Kobayashi, Hiroshi; Shimizu, Atsushi; Sugimoto, Nobuo; Yamamoto, Shigekazu

    2017-06-01

    The impact of heterogeneous reactions on the chemical components and mixing state of dust particles are investigated by observations and an air quality model over northern China between March 27, 2015 and April 2, 2015. Synergetic observations were conducted using a polarization optical particle counter (POPC), a depolarized two-wavelength Lidar and filter samples in Beijing. During this period, dust plume passed through Beijing on March 28, and flew back on March 29 because of synoptic weather changes. Mineral dust mixed with anthropogenic pollutants was simulated using the Nested Air Quality Prediction Modeling System (NAQPMS) to examine the role of heterogeneous processes on the dust. A comparison of observations shows that the NAQPMS successfully reproduces the time series of the vertical profile, particulate matter concentration, and chemical components of fine mode (diameter ≤ 2.5 μm) and coarse mode (2.5 μm mixed with dust particles. The significant alterations of the chemical composition and mixing state of particles due to heterogeneous reactions are important for the direct and indirect climate effects of dust and anthropogenic aerosols.

  8. Simulation of the mineral dust content over Western Africa from the event to the annual scale with the CHIMERE-DUST model

    Directory of Open Access Journals (Sweden)

    C. Schmechtig

    2011-07-01

    Full Text Available The chemistry and transport model CHIMERE-DUST have been used to simulate the mineral dust cycle over the Sahara in 2006. Surface measurements deployed during the AMMA field campaign allow to test the capability of the model to correctly reproduce the atmospheric dust load and surface concentrations from the daily to the seasonal time-scale. The simulated monthly mean Aerosol Optical Depths (AOD and surface concentrations are significantly correlated with the measured ones. The simulated daily concentrations and hourly AOD are in the same range of magnitude than the observed ones despite relatively high simulated dust emissions. The level of agreement between the simulations and the observations has been quantified at different time scales using statistical parameters classically used to evaluate air quality models. The capability of the model to reproduce the altitude of the dust transport was tested for two contrasted cases of low and high altitude transport. These results highlight the sensitivity of the simulations to the surface winds used as external forcing and the necessity to further constrain the dust mass budget at the regional scale.

  9. Radioecological impact of Saharan dusts fallout. Case study of a major event on the 21. of february 2004 in south part of France

    International Nuclear Information System (INIS)

    Masson, O.; Pourcelot, L.; Gurriaran, R.; Paulat, P.

    2005-01-01

    levels in the atmospheric area close to ground level are routinely attributed to resuspension of formerly deposited aerosols. In the particular case of the Saharan dust deposits, apart from the resuspension mechanisms that caused the Saharan soil particles to be taken up, other mechanisms may have intervened during transports up until deposit on French soil. Such mechanisms, which have already been identified for other atmospheric compounds or pollutants, give a lead in attempting to understand the enhanced relative or absolute radioactivity of the mineral particles. Two hypotheses have been put forward to explain this enhanced radioactivity: either a process rather like a 'horizontal leaching' of compounds or pollutants present in the atmosphere during transport, or the early fall of the heavier and thus less radioactive mineral particles, giving rise to a relative increase in specific activity. One cannot overlook the contribution these sporadic phenomena make to atmospheric deposits on an annual basis. Further studies are needed to evaluate the weight of these phenomena on a multi-annual scale in the reduction of activity levels in the atmospheric compartment by dry or wet process and at short time scale the deposition of radioactivity with dust from remote regions. Taking into account current metrological performance devices at the IRSN (Institute for Radiological Protection and Nuclear Safety), regular monitoring of these events allow opportunity to follow the changes of plutonium isotopes in the atmosphere. (authors)

  10. SIZE AND SURFACE AREA OF ICY DUST AGGREGATES AFTER A HEATING EVENT AT A PROTOPLANETARY NEBULA

    Energy Technology Data Exchange (ETDEWEB)

    Sirono, Sin-iti [Earth and Environmental Sciences, Graduate School of Environmental Studies, Nagoya University, Nagoya 464-8601 (Japan)

    2013-03-01

    The activity of a young star rises abruptly during an FU Orionis outburst. This event causes a temporary temperature increase in the protoplanetary nebula. H{sub 2}O icy grains are sublimated by this event, and silicate cores embedded inside the ice are ejected. During the high-temperature phase, the silicate grains coagulate to form silicate core aggregates. After the heating event, the temperature drops, and the ice recondenses onto the aggregates. I determined numerically the size distribution of the ice-covered aggregates. The size of the aggregates exceeds 10 {mu}m around the snow line. Because of the migration of the ice to large aggregates, only a small fraction of the silicate core aggregate is covered with H{sub 2}O ice. After the heating event, the surface of an ice-covered aggregate is totally covered by silicate core aggregates. This might reduce the fragmentation velocity of aggregates when they collide. It is possible that the covering silicate cores shield the UV radiation field which induces photodissociation of H{sub 2}O ice. This effect may cause the shortage of cold H{sub 2}O vapor observed by Herschel.

  11. Time-course monitoring of urban bioaerosol bacterial communities and its use in microbial hazard identification during Asian Dust events in Seoul, Korea

    Science.gov (United States)

    Park, J.

    2015-12-01

    The microbial communities transported by Asian dust events have attracted much attention as bioaerosols because the transported airborne microbes may strongly influence the downwind ecosystems and potentially human health in East Asia. Bioaerosol study has received relatively little attention and their characterization and risk assessments remain poorly developed. We used high throughput 16S rRNA gene targeted pyrosequencing and real-time quantitative PCR (qPCR) to monitor airborne bacterial communities and assess their potential risk. We monitored microbial communities in bioaerosol in Seoul between 2011 and 2013 using high volume air samplers. Six samples were collected during Asian dust (AD) events and the other 34 samples were urban air collected during non-Asian dust (non-AD) events. According to the qPCR result, the gene copy numbers of 16S rRNA genes were significantly higher during the AD events (P culture methods. 16S rRNA gene sequences of several pathogens were detected and their relative abundances appeared to have increased with increased concentrations of PM10. About 1% of Bacillus isolates were identified as known pathogenic B. cereus, confirming their presence in Asian dust samples. The qPCR detection of bceT gene, which codes for an enterotoxin in B. cereus group, was significantly increased in the AD dust samples over the non-AD samples. The following MLST assessment and virulence test of cultivated Bacillus isolates showed that B. cereus, B. licheniformis and B. mycoides were identified as pathogenic bacteria, and these pathogenic bacteria were usually more abundant during AD events. To assess the possible associations of identified pathogens on the hospital stroke admissions of residents in Seoul, we identified sixteen bioaerosol episodes using Poisson regression and calculated relative risk. The findings are useful in building a database for bacterial pathogens in AD events.

  12. Stress: Specific Life Events in the Teaching Profession.

    Science.gov (United States)

    Martray, Carl R.; Adams, Ronald D.

    This study examined the greatest stressors in teaching situations that affect teachers, and how these events vary for groups of elementary, middle, and secondary school teachers. The list of possibly stressful situations was taken from the Teaching Events Stress Inventory (TESI), developed by Cichon and Koff in 1978. Data were collected from…

  13. Advancing Littoral Zone Aerosol Prediction via Holistic Studies in Regime-Dependent Flows: August 3-9, 2016 Middle East Dust Event

    Science.gov (United States)

    Solbrig, J. E.; Miller, S. D.; van den Heever, S. C.; Kreidenweis, S. M.; Oo, M. M.; Zupanski, M.; Zhang, J.; Wang, J.; Holz, R.; Albers, S. C.; Grasso, L. D.; Kliewer, A.; Bukowski, J.; Park, J.; Saleeby, S. M.; Wu, T. C.

    2017-12-01

    Coastal regions represent a complex environment for meteorological processes, their effect on aerosol distributions, and the resulting impacts of those aerosols. These regions are rife with discontinuities that make dynamical processes difficult to predict and confound optical retrieval algorithms with highly variable and poorly characterized backgrounds. Local dynamics can be complicated by interactions between maritime and continental airmasses and the presence of coastal terrain. Additionally, coastal shallow water and high-turbidity produce backgrounds with high water leaving radiance which biases results from remote sensing retrievals. Here we present the highlights of the first two years of work from a Multi-disciplinary University Research Initiative entitled Holistic Analysis of Aerosol in Littoral Environments (HAALE-MURI) with specific focus on a dust event that occurred during the period of August 3-9 2016. During this period, two large dust plumes were observed advecting across the Arabian Peninsula. The first, embedded in a dry airmass, moved across the peninsula from north-west to south-east. This plume eventually stalls as it encounters a moist airmass, likely driven by the sea breeze. Embedded in the moist airmass is a second dust plume lofted from Oman, which then advects northwards over the Persian Gulf. This case presents significant challenges for forecasting, remote sensing, and data assimilation due to a complex meteorological environment and variable coastal bright-water backgrounds. The project team, who endeavor to advance our fundamental understanding of the factors that govern aerosol distribution, optical properties, and microphysical properties in the coastal regions, have focused on this case as our first in-depth case study. We demonstrate new retrieval techniques during both day and night including retrievals over bright coastal waters, a novel approach to in-line data assimilation of aerosol properties including AOT, and the results

  14. Temporal and spatial variations in sand and dust storm events in East Asia from 2007 to 2016: Relationships with surface conditions and climate change.

    Science.gov (United States)

    An, Linchang; Che, Huizheng; Xue, Min; Zhang, Tianhang; Wang, Hong; Wang, Yaqiang; Zhou, Chunhong; Zhao, Hujia; Gui, Ke; Zheng, Yu; Sun, Tianze; Liang, Yuanxin; Sun, Enwei; Zhang, Hengde; Zhang, Xiaoye

    2018-08-15

    We analyzed the frequency and intensity of sand and dust storms (SDSs) in East Asia from 2007 to 2016 using observational data from ground stations, numerical modeling, and vegetation indices obtained from both satellite and reanalysis data. The relationships of SDSs with surface conditions and the synoptic circulation pattern were also analyzed. The statistical analyses demonstrated that the number and intensity of SDS events recorded in spring during 2007 to 2016 showed a decreasing trend. The total number of spring SDSs decreased from at least ten events per year before 2011 to less than ten events per year after 2011. The overall average annual variation of the surface dust concentration in the main dust source regions decreased 33.24μg/m 3 (-1.75%) annually. The variation in the temperatures near and below the ground surface and the amount of precipitation and soil moisture all favored an improvement in vegetation coverage, which reduced the intensity and frequency of SDSs. The strong winds accompanying the influx of cold air from high latitudes showed a decreasing trend, leading to a decrease in the number of SDSs and playing a key role in the decadal decrease of SDSs. The decrease in the intensity of the polar vortex during study period was closely related to the decrease in the intensity and frequency of SDSs. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. A SHORT-DURATION EVENT AS THE CAUSE OF DUST EJECTION FROM MAIN-BELT COMET P/2012 F5 (GIBBS)

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, F. [Instituto de Astrofisica de Andalucia, CSIC, Glorieta de la Astronomia s/n, E-18008 Granada (Spain); Licandro, J.; Cabrera-Lavers, A., E-mail: fernando@iaa.es [Instituto de Astrofisica de Canarias, c/Via Lactea s/n, E-38200 La Laguna, Tenerife (Spain)

    2012-12-10

    We present observations and an interpretative model of the dust environment of the Main-Belt Comet P/2010 F5 (Gibbs). The narrow dust trails observed can be interpreted unequivocally as an impulsive event that took place around 2011 July 1 with an uncertainty of {+-}10 days, and a duration of less than a day, possibly of the order of a few hours. The best Monte Carlo dust model fits to the observed trail brightness imply ejection velocities in the range 8-10 cm s{sup -1} for particle sizes between 30 cm and 130 {mu}m. This weak dependence of velocity on size contrasts with that expected from ice sublimation and agrees with that found recently for (596) Scheila, a likely impacted asteroid. The particles seen in the trail are found to follow a power-law size distribution of index Almost-Equal-To -3.7. Assuming that the slowest particles were ejected at the escape velocity of the nucleus, its size is constrained to about 200-300 m in diameter. The total ejected dust mass is {approx}> 5 Multiplication-Sign 10{sup 8} kg, which represents approximately 4%-20% of the nucleus mass.

  16. Contribution of Asian dust to atmospheric deposition of radioactive cesium (137Cs)

    International Nuclear Information System (INIS)

    Fukuyama, Taijiro; Fujiwara, Hideshi

    2008-01-01

    Both Asian dust (kosa) transported from the East Asian continent and locally suspended dust near monitoring sites contribute to the observed atmospheric deposition of 137 Cs in Japan. To estimate the relative contribution of these dust phenomena to the total 137 Cs deposition, we monitored weekly deposition of mineral particles and 137 Cs in spring. Deposition of 137 Cs from a single Asian dust event was 62.3 mBq m -2 and accounted for 67% of the total 137 Cs deposition during the entire monitoring period. Furthermore, we found high 137 Cs specific activity in the Asian dust deposition sample. Although local dust events contributed to 137 Cs deposition, their contribution was considerably smaller than that of Asian dust. We conclude that the primary source of atmospheric 137 Cs in Japan is dust transported from the East Asian continent

  17. 40 CFR 761.375 - Specific requirements for surfaces coated or covered with dust, dirt, grime, grease, or another...

    Science.gov (United States)

    2010-07-01

    ... coated or covered with dust, dirt, grime, grease, or another absorbent material. 761.375 Section 761.375... coated or covered with dust, dirt, grime, grease, or another absorbent material. (a) First wash. Cover..., absorbent pad until the surface appears dry. This cleaning should remove any residual dirt, dust, grime, or...

  18. A comparison of the physical properties of desert dust retrieved from the sunphotometer observation of major events in the Sahara, Sahel, and Arabian Peninsula

    KAUST Repository

    Masmoudi, Mohamed

    2015-05-01

    © 2015 Elsevier B.V. The objective of this work is to assess the variability of the size-distribution, real (n) and imaginary (k) parts of the refractive index, asymmetry parameter (g), and single scattering albedo (SSA) of desert dust events observed in the Sahara, Sahel, and Arabian Peninsula areas. For this we use the level-2 inversions of 14 AERONET sunphotometers representative of the area of study. In the dataset, the dust-dominated events are discriminated on the basis of their large optical depth and low (<. 0.3) Ångström exponent (α) calculated between 440. nm and 870. nm. In all the volume size-distributions a coarse mode (CM) of particles is observed but a fine mode (FM) of particles with radii. <. 0.2. μm is also present. The volume fraction represented by the FM is lower (3%) during the most intense dust storms than during moderate ones (12%). The inter-site variability of the characteristics of the CM-dominated situations is found to be non-significant and at 440, 675, 870, and 1020. nm a common set of values can be adopted for n (1.54 ± 0.03, 1.53 ± 0.02, 1.50 ± 0.02, 1.48 ± 0.02), k (0.0037 ± 0.0007, 0.0012 ± 0.0002, 0.0011 ± 0.0002, 0.0012 ± 0.0002), g (0.77 ± 0.01, 0.74 ± 0.01, 0.73 ± 0.01, 0.74 ± 0.01), and the SSA (0.90 ± 0.02, 0.97 ± 0.01, 0.98 ± 0.01, 0.98 ± 0.01). However; during the less intense dust-events the growing influence of the FM leads to regional differentiation of the dust properties and 2 main areas can be distinguished: 1) the relatively clean central Sahara/Sahel, and 2) the more polluted continuum constituted by the Mediterranean coast and the Arabian Peninsula.

  19. A comparison of the physical properties of desert dust retrieved from the sunphotometer observation of major events in the Sahara, Sahel, and Arabian Peninsula

    KAUST Repository

    Masmoudi, Mohamed; Alfaro, Sté phane C.; El Metwally, Mossad

    2015-01-01

    © 2015 Elsevier B.V. The objective of this work is to assess the variability of the size-distribution, real (n) and imaginary (k) parts of the refractive index, asymmetry parameter (g), and single scattering albedo (SSA) of desert dust events observed in the Sahara, Sahel, and Arabian Peninsula areas. For this we use the level-2 inversions of 14 AERONET sunphotometers representative of the area of study. In the dataset, the dust-dominated events are discriminated on the basis of their large optical depth and low (<. 0.3) Ångström exponent (α) calculated between 440. nm and 870. nm. In all the volume size-distributions a coarse mode (CM) of particles is observed but a fine mode (FM) of particles with radii. <. 0.2. μm is also present. The volume fraction represented by the FM is lower (3%) during the most intense dust storms than during moderate ones (12%). The inter-site variability of the characteristics of the CM-dominated situations is found to be non-significant and at 440, 675, 870, and 1020. nm a common set of values can be adopted for n (1.54 ± 0.03, 1.53 ± 0.02, 1.50 ± 0.02, 1.48 ± 0.02), k (0.0037 ± 0.0007, 0.0012 ± 0.0002, 0.0011 ± 0.0002, 0.0012 ± 0.0002), g (0.77 ± 0.01, 0.74 ± 0.01, 0.73 ± 0.01, 0.74 ± 0.01), and the SSA (0.90 ± 0.02, 0.97 ± 0.01, 0.98 ± 0.01, 0.98 ± 0.01). However; during the less intense dust-events the growing influence of the FM leads to regional differentiation of the dust properties and 2 main areas can be distinguished: 1) the relatively clean central Sahara/Sahel, and 2) the more polluted continuum constituted by the Mediterranean coast and the Arabian Peninsula.

  20. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  1. Temporal Evolution of Water and Dust in Comet 9P/Tempel 1 after the Deep Impact Event, as Observed from Spitzer

    Science.gov (United States)

    Gicquel, Adeline; Bockelée-Morvan, D.; Kelley, M. S.; Woodward, C. E.; Wooden, D. H.

    2010-10-01

    The Deep Impact (DI) spacecraft encountered comet 9P/Tempel 1 on July 4th, 2005. The spacecraft released an impactor that collided with the comet nucleus and excavated (possibly unprocessed) cometary material in a prominent ejecta plume. Spectral maps covering 20'' x 67'' (1.85''/pixel) were acquired with the IRS instrument on the Spitzer Space Telescope at different times around the DI event: twice before impact (TI-41.3hrs and TI-22.9hrs) and twelve times after impact (between TI+0.67hrs and TI+1027hrs). These IRS observations are stored in the Spitzer data archive and presented by Lisse et al. (2006, Science 313, 635). We present the interpretation of 5.2-7.6 micrometer spectra obtained in the second order of the short-wavelength module (SL2). To reduce the contribution of artifacts in the spectra, 5x5 pixel extraction apertures (9.25''x9.25'') were used. The underlying continuum in the spectra provides information on the grain size distribution and color temperature of the dust ejecta. In order to determine the grain size distribution, we assumed that ejecta consist of a composition of both amorphous carbon and silicates. The grains are assumed to be spherical with sizes in range from 0.1 to 100 micrometers. We used the Mie theory to calculate the optical properties of each material and the temperature of the grain. We constrained the grain size distribution and velocities from the spectra and the temporal evolution of the dust flux. The dust mass and dust/gas ratio in the ejecta cloud are also derived and compared with other values published in the literature.

  2. Preparing for what might happen: An episodic specificity induction impacts the generation of alternative future events.

    Science.gov (United States)

    Jing, Helen G; Madore, Kevin P; Schacter, Daniel L

    2017-12-01

    A critical adaptive feature of future thinking involves the ability to generate alternative versions of possible future events. However, little is known about the nature of the processes that support this ability. Here we examined whether an episodic specificity induction - brief training in recollecting details of a recent experience that selectively impacts tasks that draw on episodic retrieval - (1) boosts alternative event generation and (2) changes one's initial perceptions of negative future events. In Experiment 1, an episodic specificity induction significantly increased the number of alternative positive outcomes that participants generated to a series of standardized negative events, compared with a control induction not focused on episodic specificity. We also observed larger decreases in the perceived plausibility and negativity of the original events in the specificity condition, where participants generated more alternative outcomes, relative to the control condition. In Experiment 2, we replicated and extended these findings using a series of personalized negative events. Our findings support the idea that episodic memory processes are involved in generating alternative outcomes to anticipated future events, and that boosting the number of alternative outcomes is related to subsequent changes in the perceived plausibility and valence of the original events, which may have implications for psychological well-being. Published by Elsevier B.V.

  3. Vertical profiles of aerosol mass concentration derived by unmanned airborne in situ and remote sensing instruments during dust events

    Science.gov (United States)

    Mamali, Dimitra; Marinou, Eleni; Sciare, Jean; Pikridas, Michael; Kokkalis, Panagiotis; Kottas, Michael; Binietoglou, Ioannis; Tsekeri, Alexandra; Keleshis, Christos; Engelmann, Ronny; Baars, Holger; Ansmann, Albert; Amiridis, Vassilis; Russchenberg, Herman; Biskos, George

    2018-05-01

    In situ measurements using unmanned aerial vehicles (UAVs) and remote sensing observations can independently provide dense vertically resolved measurements of atmospheric aerosols, information which is strongly required in climate models. In both cases, inverting the recorded signals to useful information requires assumptions and constraints, and this can make the comparison of the results difficult. Here we compare, for the first time, vertical profiles of the aerosol mass concentration derived from light detection and ranging (lidar) observations and in situ measurements using an optical particle counter on board a UAV during moderate and weak Saharan dust episodes. Agreement between the two measurement methods was within experimental uncertainty for the coarse mode (i.e. particles having radii > 0.5 µm), where the properties of dust particles can be assumed with good accuracy. This result proves that the two techniques can be used interchangeably for determining the vertical profiles of aerosol concentrations, bringing them a step closer towards their systematic exploitation in climate models.

  4. High Latitude Dust in the Earth System

    Science.gov (United States)

    Bullard, Joanna E.; Baddock, Matthew; Bradwell, Tom; Crusius, John; Darlington, Eleanor; Gaiero, Diego; Gasso, Santiago; Gisladottir, Gudrun; Hodgkins, Richard; McCulloch, Robert; hide

    2016-01-01

    Natural dust is often associated with hot, subtropical deserts, but significant dust events have been reported from cold, high latitudes. This review synthesizes current understanding of high-latitude (> or = 50degN and > or = 40degS) dust source geography and dynamics and provides a prospectus for future research on the topic. Although the fundamental processes controlling aeolian dust emissions in high latitudes are essentially the same as in temperate regions, there are additional processes specific to or enhanced in cold regions. These include low temperatures, humidity, strong winds, permafrost and niveo-aeolian processes all of which can affect the efficiency of dust emission and distribution of sediments. Dust deposition at high latitudes can provide nutrients to the marine system, specifically by contributing iron to high-nutrient, low-chlorophyll oceans; it also affects ice albedo and melt rates. There have been no attempts to quantify systematically the expanse, characteristics, or dynamics of high-latitude dust sources. To address this, we identify and compare the main sources and drivers of dust emissions in the Northern (Alaska, Canada, Greenland, and Iceland) and Southern (Antarctica, New Zealand, and Patagonia) Hemispheres. The scarcity of year-round observations and limitations of satellite remote sensing data at high latitudes are discussed. It is estimated that under contemporary conditions high-latitude sources cover >500,000 sq km and contribute at least 80-100 Tg/yr1 of dust to the Earth system (approx. 5% of the global dust budget); both are projected to increase under future climate change scenarios.

  5. On constructing optimistic simulation algorithms for the discrete event system specification

    International Nuclear Information System (INIS)

    Nutaro, James J.

    2008-01-01

    This article describes a Time Warp simulation algorithm for discrete event models that are described in terms of the Discrete Event System Specification (DEVS). The article shows how the total state transition and total output function of a DEVS atomic model can be transformed into an event processing procedure for a logical process. A specific Time Warp algorithm is constructed around this logical process, and it is shown that the algorithm correctly simulates a DEVS coupled model that consists entirely of interacting atomic models. The simulation algorithm is presented abstractly; it is intended to provide a basis for implementing efficient and scalable parallel algorithms that correctly simulate DEVS models

  6. Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

    Science.gov (United States)

    Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

    2017-07-01

    One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Life review based on remembering specific positive events in active aging.

    Science.gov (United States)

    Latorre, José M; Serrano, Juan P; Ricarte, Jorge; Bonete, Beatriz; Ros, Laura; Sitges, Esther

    2015-02-01

    The aim of this study is to evaluate the effectiveness of life review (LR) based on specific positive events in non-depressed older adults taking part in an active aging program. Fifty-five older adults were randomly assigned to an experimental group or an active control (AC) group. A six-session individual training of LR based on specific positive events was carried out with the experimental group. The AC group undertook a "media workshop" of six sessions focused on learning journalistic techniques. Pre-test and post-test measures included life satisfaction, depressive symptoms, experiencing the environment as rewarding, and autobiographical memory (AM) scales. LR intervention decreased depressive symptomatology, improved life satisfaction, and increased specific memories. The findings suggest that practice in AM for specific events is an effective component of LR that could be a useful tool in enhancing emotional well-being in active aging programs, thus reducing depressive symptoms. © The Author(s) 2014.

  8. The shared and specific relationships between exposure to potentially traumatic events and transdiagnostic dimensions of psychopathology.

    Science.gov (United States)

    Sunderland, Matthew; Carragher, Natacha; Chapman, Cath; Mills, Katherine; Teesson, Maree; Lockwood, Emma; Forbes, David; Slade, Tim

    2016-03-01

    The experience of traumatic events has been linked to the development of psychopathology. Changing perspectives on psychopathology have resulted in the hypothesis that broad dimensional constructs account for the majority of variance across putatively distinct disorders. As such, traumatic events may be associated with several disorders due to their relationship with these broad dimensions rather than any direct disorder-specific relationship. The current study used data from 8871 Australians to test this hypothesis. Two broad dimensions accounted for the majority of relationships between traumatic events and mental and substance use disorders. Direct relationships remained between post-traumatic stress disorder and six categories of traumatic events in the total population and between drug dependence and accidents/disasters for males only. These results have strong implications for how psychopathology is conceptualized and offer some evidence that traumatic events are associated with an increased likelihood of experiencing psychopathology in general. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Chemical Composition Based Aerosol Optical Properties According to Size Distribution and Mixture Types during Smog and Asian Dust Events in Seoul, Korea

    Science.gov (United States)

    Jung, Chang Hoon; Lee, Ji Yi; Um, Junshik; Lee, Seung Soo; Kim, Yong Pyo

    2018-02-01

    This study investigated the optical properties of aerosols involved in different meteorological events, including smog and Asian dust days. Carbonaceous components and inorganic species were measured in Seoul, Korea between 25 and 31 March 2012. Based on the measurements, the optical properties of aerosols were calculated by considering composition, size distribution, and mixing state of aerosols. To represent polydisperse size distributions of aerosols, a lognormal size distribution with a wide range of geometric mean diameters and geometric standard deviations was used. For the optical property calculations, the Mie theory was used to compute single-scattering properties of aerosol particles with varying size and composition. Analysis of the sampled data showed that the water-soluble components of organic matter increased on smog days, whereas crustal elements increased on dust days. The water content significantly influenced the optical properties of aerosols during the smog days as a result of high relative humidity and an increase in the water-soluble component. The absorption coefficients depended on the aerosol mixture type and the aerosol size distributions. Therefore, to improve our knowledge on radiative impacts of aerosols, especially the regional impacts of aerosols in East Asia, accurate measurements of aerosols, such as size distribution, composition, and mixture type, under different meteorological conditions are required.

  10. Pancam and microscopic imager observations of dust on the Spirit Rovers

    DEFF Research Database (Denmark)

    Vaughan....[], Alicia F.; Johnson, Jeffrey R.; Walter, Goetz

    2010-01-01

    This work describes dust deposits on the Spirit Rover over 2000 sols through examination of Pancam and Microscopic Imager observations of specific locations on the rover body, including portions of the solar array, Pancam and Mini-TES calibration targets, and the magnets. This data set reveals...... the three "cleaning events" experienced by Spirit to date, the spectral properties of dust, and the tendency of dust particles to form aggregates 100 um and larger...

  11. Associations among Life Events, Empathic Concern, and Adolescents' Prosocial and Aggressive Behaviors Toward Specific Targets.

    Science.gov (United States)

    Davis, Alexandra N; Luce, Haley; Davalos, Natasha

    2018-05-25

    The goal of the present study was to examine the links between life events and adolescents' social behaviors (prosocial and aggressive behaviors) toward specific targets and to examine how empathic concern may play a role in these associations. The study examined two hypotheses: both the mediating role of empathic concern and the moderating role of empathic concern. The sample included 311 high school students from the Midwest (M age = 16.10 years; age range = 14-19 years; 58.7% girls; 82.7% White, 13.6% Latino). The results demonstrated support for the moderation model as well as complex links between life events and prosocial and aggressive behaviors toward specific targets. The discussion focuses on the role of empathic concern in understanding how life events are ultimately associated with adolescents' social development.

  12. Particulate matter from re-suspended mineral dust and emergency cause-specific respiratory hospitalizations in Hong Kong

    Science.gov (United States)

    Pun, Vivian C.; Tian, Linwei; Ho, Kin-fai

    2017-09-01

    While contribution from non-exhaust particulate matter (PM) emissions towards traffic-related emissions is increasing, few epidemiologic evidence of their health impact is available. We examined the association of short-term exposure to PM10 apportioned to re-suspended mineral dust with emergency hospitalizations for three major respiratory causes in Hong Kong between 2001 and 2008. Time-series regression model was constructed to examine association of PM10 from re-suspended mineral dust with emergency hospitalizations for upper respiratory infection (URI), chronic obstructive pulmonary disease (COPD) and asthma at exposure lag 0-5 days, adjusting for time trends, seasonality, temperature and relative humidity. An interquartile range (6.8 μg/m3) increment in re-suspended mineral dust on previous day was associated with 0.66% (95% CI: 0.12, 0.98) increase in total respiratory hospitalizations, and 1.01% (95% CI: 0.14, 1.88) increase in URI hospitalizations. A significant 0.66%-0.80% increases in risk of COPD hospitalizations were found after exposure to re-suspended mineral dust at lag 3 or later. Exposure to mineral dust at lag 4 was linked to 1.71% increase (95% CI: 0.14, 2.22) in asthma hospitalizations. Associations from single-pollutant models remained significant in multi-pollutant models, which additionally adjusted for PM10 contributing from vehicle exhaust, regional combustion, residual oil, fresh sea salt, aged sea salt, secondary nitrate and secondary sulfate, or gaseous pollutants (i.e., nitrogen dioxide, sulfur dioxide, or ozone), respectively. Our findings provide insight into the biological mechanism by which non-exhaust pollution may be associated with risk of adverse respiratory outcomes, and also stress the needs for strategies to reduce emission and re-suspension of mineral dust. More research is warranted to assess the health effects of different non-exhaust PM emissions under various roadway conditions and vehicle fleets.

  13. House dust mite-specific immunotherapy alters the basal expression of T regulatory and FcεRI pathway genes.

    Science.gov (United States)

    Pevec, Branko; Radulovic Pevec, Mira; Stipic Markovic, Asja; Batista, Irena; Rijavec, Matija; Silar, Mira; Kosnik, Mitja; Korosec, Peter

    2012-01-01

    Regulatory T (Treg) cells and IgE-mediated signaling pathways could play important roles in the induction of allergen tolerance during house dust mite-specific subcutaneous immunotherapy (HDM-SCIT). Our aim was to compare the basal expression levels of Treg, T helper 1 (Th1) and Th2 transcription factors and components involved in IgE-mediated signaling in healthy subjects with those in HDM-allergic patients both untreated and successfully treated with HDM-SCIT. Thirty-nine HDM-allergic patients who completed a 3- to 5-year course of mite extract SCIT, 20 mite-allergic controls and 25 healthy controls participated in this study. The efficacy of SCIT was monitored using skin-prick tests (SPTs), total immunoglobulin E (tIgE), specific IgE (sIgE), sIgG(4), nasal challenge and visual analog scale (VAS) scores at several time points. The mRNA levels of forkhead box protein 3 (FOXP3), T-BET, GATA-3, FcεRI, spleen tyrosine kinase (Syk), phosphatidylinositol 3 kinase (PI3K) and SH2 domain-containing inositol phosphatase (SHIP) were quantified by real-time RT-PCR using nonstimulated whole blood samples. Decreased wheal sizes and VAS scores, negative challenges and increased sIgG(4) levels indicated that SCIT was effective in the treated patients. Basal expression levels of FOXP3 and GATA-3 decreased and T-BET levels increased in both treated patients and in healthy controls compared to untreated patients. The IgE-mediated pathway kinases Syk and PI3K exhibited reduced expression, whereas SHIP phosphatase levels were elevated in both treated patients and healthy controls relative to untreated patients. The expression levels of FcεRI were not significantly altered. Immunotherapy using HDM extracts results in a modification of the basal expression levels of several IgE-related signaling factors and induces a highly significant upregulation of Th1-response and downregulation of Th2-response transcription factors. Interestingly, this therapy also appears to reduce the basal

  14. An Entry Point for Formal Methods: Specification and Analysis of Event Logs

    Directory of Open Access Journals (Sweden)

    Howard Barringer

    2010-03-01

    Full Text Available Formal specification languages have long languished, due to the grave scalability problems faced by complete verification methods. Runtime verification promises to use formal specifications to automate part of the more scalable art of testing, but has not been widely applied to real systems, and often falters due to the cost and complexity of instrumentation for online monitoring. In this paper we discuss work in progress to apply an event-based specification system to the logging mechanism of the Mars Science Laboratory mission at JPL. By focusing on log analysis, we exploit the "instrumentation" already implemented and required for communicating with the spacecraft. We argue that this work both shows a practical method for using formal specifications in testing and opens interesting research avenues, including a challenging specification learning problem.

  15. Laboratory Measurements of Mass Specific Absorption Spectra for Suites of Black Carbon-like, Biomass Burning and Mineral Dust Aerosols

    Science.gov (United States)

    Radney, J.; Zangmeister, C.

    2017-12-01

    Light-absorbing atmospheric aerosols can be grouped into three categories: black carbon (BC), brown carbon (BrC) or mineral dust (MD). In many cases, the absorption of these species is best quantified using a mass-specific absorption cross section (MAC) since the particles are in the Rayleigh regime (BC) or optically thin (BrC and MD); notably, MAC values are both traceable to the SI and transferrable between photoacoustic spectroscopy and filter-based absorption measurements. Here, we present laboratory measurements of MAC for all three light-absorbing aerosol classes. Particles were size- and mass-selected using a differential mobility analyzer and aerosol particle mass analyzer, respectively, with absorption coefficients (αabs) and number concentrations (N) being measured by a broadband photoacoustic spectrometer and condensation particle counter, respectively. This suite of instrumentation allows for direct quantification of MAC from the measured parameters (MAC = αabs/Nmp). Further, the measurements contained > 8 data points spanning λ = 405 nm to 840 nm allowing for spectral curvatures (i.e. the Absorption Angstrom Exponent or AAE) to be fit from many data points versus the more common 2-point interpolations. For the carbonaceous, BC-like aerosols - five samples generated from flames, spark discharge soot (i.e. fullerene soot), graphene, reduced graphene oxide (rGO), and fullerene (C60) - we found: 1) measured MAC ranged between 2.4 m2 g-1 and 8.6 m2 g-1 at λ = 550 nm, 2) most AAEs ranged between 0.5 and 1.3; C60 AAE was 7.5 ± 0.9 and 3) MAC spectra were dependent on fuel type and formation conditions. For BrC particles generated from smoldering combustion of 3 hardwood (Oak, Hickory and Mesquite) and 3 softwood species (Western redcedar, Blue spruce and Baldcypress), we found: 1) median MAC values ranged from 1.4 x 10-2 m2 g-1 to 7.9 x 10-2 m2 g-1 at λ = 550 nm, 2) AAE values ranged between 3.5 and 6.2, and 3) Oak, Western redcedar and Blue spruce

  16. [Effect of 1-year specific immunotherapy with standardized house dust mite vaccine on mild to moderate allergic asthmatic patients].

    Science.gov (United States)

    Wang, Hong-yu; Lin, Xiao-ping; Hao, Chuang-li; Zhang, Chun-qing; Sun, Bao-qing; Zheng, Jin-ping; Chen, Ping; Sheng, Jin-yun; Wu, Adrian; Zhong, Nan-shan

    2006-10-01

    To evaluate the clinical efficacy and safety of specific immunotherapy (SIT) with standardized house dust mite (HDM) vaccine on allergic asthmatic patients. The investigation was a multicentre, randomized, double-blind, placebo-controlled clinical study. 132 patients with mild to moderate asthma who were allergic to HDM, recruited from three hospitals of China (The First Affiliated Hospital of Guangzhou Medical College, Shenyang General Military Hospital, Suzhou Children's Hospital), were randomly allocated to the active group (n = 66) or the control group (n = 66) respectively. The active group received SIT with a standardized depot Dermatophagoides pteronyssinus (Der p) extract absorbed to aluminium hydroxide (Alutard SQ, ALK-Abelló, Denmark), while the control group received a placebo containing histamine dihydrochloride by subcutaneous injections for 1 year. Treatment of each group was started from the initial concentration. Updosing was performed with weekly injections from four 10-fold dose-increase vials (active group: 100, 1,000, 10,000, 100,000 SQ-U/ml, control group: 0.01, 0.1, 1.0, 10 microg/ml. 100,000 SQ-U/ml of Der p extract contains 9.8 microg/ml of the majoy allergen Der p1). The single-dose was injected weekly with 0.2, 0.4, 0.8 ml of each concentration in turn from the preceding 3 vials, totally for 9 weeks. Subsequently, the dose with 0.1, 0.2, 0.4, 0.6, 0.8 ml of the highest concentration was injected weekly from the 10th-14th week and a maintenance dose with 1 ml was reached at the 15th week. The dosing interval was then gradually increased to 2, 4, 6 weeks until the end of the first 26-weeks updosing phase (phase I, H(1)). Thereafter, the dosing continued at 6-week intervals for maintenance phase (phase II, H(2)) till the end of the complete treatment. The patient was observed for at least 30 minutes in the clinic after each injection. A total of 132 subjects were randomized and 129 subjects (64 in the active group, 65 in the control group

  17. Dust plume formation in the free troposphere and aerosol size distribution during the Saharan Mineral Dust Experiment in North Africa

    KAUST Repository

    Khan, Basit Ali; Stenchikov, Georgiy L.; Weinzierl, Bernadett; Kalenderski, Stoitchko; Osipov, Sergey

    2015-01-01

    , this study combines model simulations and dust observations collected during the first stage of the Saharan Mineral Dust Experiment (SAMUM-I), which sampled dust events that extended from Morocco to Portugal, and investigated the spatial distribution

  18. Wood Dust

    Science.gov (United States)

    Learn about wood dust, which can raise the risk of cancers of the paranasal sinuses and nasal cavity. High amounts of wood dust are produced in sawmills, and in the furniture-making, cabinet-making, and carpentry industries.

  19. Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

    Science.gov (United States)

    Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L

    2015-08-10

    The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

  20. High Proportions of Sub-micron Particulate Matter in Icelandic Dust Storms in 2015

    Science.gov (United States)

    Dagsson Waldhauserova, Pavla; Arnalds, Olafur; Olafsson, Haraldur; Magnusdottir, Agnes

    2017-04-01

    in situ measurements at the dust source in 2013 revealed extremely high number concentrations of submicron particles, specifically in the size range 0.3-0.337 μm. The PM2.5/PM10 ratios of mass concentrations seem to be lower at the dust sources that in some distance from the sources as measured in 2015. Common dust storms in Iceland are of several hundred thousand tons of magnitude from relatively well defined main dust sources. Numerical simulations were used calculate the total dust flux from the sources as 180,000 - 280,000 tons in this study. The mean PM1 (PM10) concentrations inside of the dust plumes varied from 97 to 241 µg m-3 (PM10 = 158 to 583 µg m-3). The extent of moderate dust events was calculated as 2.450 km2 to 4.220 km2 of the land area suggesting the regional scale of the events. Dust plumes reported here passed the most densely inhabited areas of Iceland, health risk warnings for the general public were, however, not issued. The data provided stresses the need for such warning system and is an important step towards its development.

  1. The effect of social networks and social support on common mental disorders following specific life events.

    Science.gov (United States)

    Maulik, P K; Eaton, W W; Bradshaw, C P

    2010-08-01

    This study examined the association between life events and common mental disorders while accounting for social networks and social supports. Participants included 1920 adults in the Baltimore Epidemiologic Catchment Area Cohort who were interviewed in 1993-1996, of whom 1071 were re-interviewed in 2004-2005. Generalized estimating equations were used to analyze the data. Social support from friends, spouse or relatives was associated with significantly reduced odds of panic disorder and psychological distress, after experiencing specific life events. Social networks or social support had no significant stress-buffering effect. Social networks and social support had almost no direct or buffering effect on major depressive disorder, and no effect on generalized anxiety disorder and alcohol abuse or dependence disorder. The significant association between social support and psychological distress, rather than diagnosable mental disorders, highlights the importance of social support, especially when the severity of a mental health related problem is low.

  2. Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

    Science.gov (United States)

    Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

  3. Human active X-specific DNA methylation events showing stability across time and tissues

    Science.gov (United States)

    Joo, Jihoon Eric; Novakovic, Boris; Cruickshank, Mark; Doyle, Lex W; Craig, Jeffrey M; Saffery, Richard

    2014-01-01

    The phenomenon of X chromosome inactivation in female mammals is well characterised and remains the archetypal example of dosage compensation via monoallelic expression. The temporal series of events that culminates in inactive X-specific gene silencing by DNA methylation has revealed a ‘patchwork' of gene inactivation along the chromosome, with approximately 15% of genes escaping. Such genes are therefore potentially subject to sex-specific imbalance between males and females. Aside from XIST, the non-coding RNA on the X chromosome destined to be inactivated, very little is known about the extent of loci that may be selectively silenced on the active X chromosome (Xa). Using longitudinal array-based DNA methylation profiling of two human tissues, we have identified specific and widespread active X-specific DNA methylation showing stability over time and across tissues of disparate origin. Our panel of X-chromosome loci subject to methylation on Xa reflects a potentially novel mechanism for controlling female-specific X inactivation and sex-specific dimorphisms in humans. Further work is needed to investigate these phenomena. PMID:24713664

  4. Long-term (2002–2012 investigation of Saharan dust transport events at Mt. Cimone GAW global station, Italy (2165 m a.s.l.

    Directory of Open Access Journals (Sweden)

    Rocco Duchi

    2016-02-01

    Full Text Available Abstract Mineral dust transport from North Africa towards the Mediterranean basin and Europe was monitored over an 11-y period (2002–2012 using the continuous observations made at Mt. Cimone WMO/GAW global station (CMN. CMN is in a strategic position for investigating the impact of mineral dust transported from northern Africa on the atmospheric composition of the Mediterranean basin and southern Europe. The identification of “dusty days” is based on coupling the measured in situ coarse aerosol particle number concentration with an analysis of modeled back trajectories tracing the origin of air masses from North Africa. More than 400 episodes of mineral dust transport were identified, accounting for 15.7% of the investigated period. Our analysis points to a clear seasonal cycle, with the highest frequency from spring to autumn, and a dust-induced variation of the coarse particle number concentration larger than 123% on a seasonal basis. In addition, FLEXTRA 10-d back trajectories showed that northwestern and central Africa are the major mineral dust source regions. Significant inter-annual variability of dust outbreak frequency and related mineral dust loading were detected and during spring the NAO index was positively correlated (R2 = 0.32 with dust outbreak frequency. Lastly, the impact of transported mineral dust on the surface O3 mixing ratio was quantified over the 11-y investigation period. Evidence of a non-linear and negative correlation between mineral dust and ozone concentrations was found, resulting in an average spring and summer decrease of the O3 mixing ratio down to 7%.

  5. High-latitude dust in the Earth system

    Science.gov (United States)

    Bullard, Joanna E; Baddock, Matthew; Bradwell, Tom; Crusius, John; Darlington, Eleanor; Gaiero, Diego; Gasso, Santiago; Gisladottir, Gudrun; Hodgkins, Richard; McCulloch, Robert; NcKenna Neuman, Cheryl; Mockford, Tom; Stewart, Helena; Thorsteinsson, Throstur

    2016-01-01

    Natural dust is often associated with hot, subtropical deserts, but significant dust events have been reported from cold, high latitudes. This review synthesizes current understanding of high-latitude (≥50°N and ≥40°S) dust source geography and dynamics and provides a prospectus for future research on the topic. Although the fundamental processes controlling aeolian dust emissions in high latitudes are essentially the same as in temperate regions, there are additional processes specific to or enhanced in cold regions. These include low temperatures, humidity, strong winds, permafrost and niveo-aeolian processes all of which can affect the efficiency of dust emission and distribution of sediments. Dust deposition at high latitudes can provide nutrients to the marine system, specifically by contributing iron to high-nutrient, low-chlorophyll oceans; it also affects ice albedo and melt rates. There have been no attempts to quantify systematically the expanse, characteristics, or dynamics of high-latitude dust sources. To address this, we identify and compare the main sources and drivers of dust emissions in the Northern (Alaska, Canada, Greenland, and Iceland) and Southern (Antarctica, New Zealand, and Patagonia) Hemispheres. The scarcity of year-round observations and limitations of satellite remote sensing data at high latitudes are discussed. It is estimated that under contemporary conditions high-latitude sources cover >500,000 km2 and contribute at least 80–100 Tg yr−1 of dust to the Earth system (~5% of the global dust budget); both are projected to increase under future climate change scenarios.

  6. Events

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2016-02-01

    Full Text Available The 9th ARRCN Symposium 2015 was held during 21st–25th October 2015 at the Novotel Hotel, Chumphon, Thailand, one of the most favored travel destinations in Asia. The 10th ARRCN Symposium 2017 will be held during October 2017 in the Davao, Philippines. International Symposium on the Montagu's Harrier (Circus pygargus «The Montagu's Harrier in Europe. Status. Threats. Protection», organized by the environmental organization «Landesbund für Vogelschutz in Bayern e.V.» (LBV was held on November 20-22, 2015 in Germany. The location of this event was the city of Wurzburg in Bavaria.

  7. [Development and validation of event-specific quantitative PCR method for genetically modified maize LY038].

    Science.gov (United States)

    Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi

    2013-01-01

    In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.

  8. Correlation between Asian Dust and Specific Radioactivities of Fission Products Included in Airborne Samples in Tokushima, Shikoku Island, Japan, Due to the Fukushima Nuclear Accident

    Energy Technology Data Exchange (ETDEWEB)

    Sakama, M., E-mail: minorusakama@tokushima-u.ac.jp [Department of Radiological Science, Division of Biomedical Information Sciences, Institute of Health Biosciences, The University of Tokushima, Tokushima 770-8509 (Japan); Nagano, Y. [Department of Radiological Science, Division of Biomedical Information Sciences, Institute of Health Biosciences, The University of Tokushima, Tokushima 770-8509 (Japan); Kitade, T. [Department of Laboratory, M and S Instruments Inc., Osaka 532-0005 (Japan); Shikino, O. [Department of Inorganic Analysis, PerkinElmer Japan Co. Ltd., Yokohama 240-0005 (Japan); Nakayama, S. [Department of Nuclear Science, Institute of Socio-Arts and Sciences, The University of Tokushima, Tokushima 770-8502 (Japan)

    2014-06-15

    Radioactive fission product {sup 131}I released from the Fukushima Daiichi Nuclear Power Plants (FD-NPP) was first detected on March 23, 2011 in an airborne aerosol sample collected at Tokushima, Shikoku Island, located in western Japan. Two other radioactive fission products, {sup 134}Cs and {sup 137}Cs were also observed in a sample collected from April 2 to 4, 2011. The maximum specific radioactivities observed in this work were about 2.5 to 3.5 mBq×m{sup -3} in a airborne aerosol sample collected on April 6. During the course of the continuous monitoring, we also made our first observation of seasonal Asian Dust and those fission products associated with the FDNPP accident concurrently from May 2 to 5, 2011. We found that the specific radioactivities of {sup 134}Cs and {sup 137}Cs decreased drastically only during the period of Asian Dust. And also, it was found that this trend was very similar to the atmospheric elemental concentration (ng×m{sup -3}) variation of stable cesium ({sup 133}Cs) quantified by elemental analyses using our developed ICP-DRC-MS instrument.

  9. Correlation between Asian Dust and Specific Radioactivities of Fission Products Included in Airborne Samples in Tokushima, Shikoku Island, Japan, Due to the Fukushima Nuclear Accident

    International Nuclear Information System (INIS)

    Sakama, M.; Nagano, Y.; Kitade, T.; Shikino, O.; Nakayama, S.

    2014-01-01

    Radioactive fission product 131 I released from the Fukushima Daiichi Nuclear Power Plants (FD-NPP) was first detected on March 23, 2011 in an airborne aerosol sample collected at Tokushima, Shikoku Island, located in western Japan. Two other radioactive fission products, 134 Cs and 137 Cs were also observed in a sample collected from April 2 to 4, 2011. The maximum specific radioactivities observed in this work were about 2.5 to 3.5 mBq×m -3 in a airborne aerosol sample collected on April 6. During the course of the continuous monitoring, we also made our first observation of seasonal Asian Dust and those fission products associated with the FDNPP accident concurrently from May 2 to 5, 2011. We found that the specific radioactivities of 134 Cs and 137 Cs decreased drastically only during the period of Asian Dust. And also, it was found that this trend was very similar to the atmospheric elemental concentration (ng×m -3 ) variation of stable cesium ( 133 Cs) quantified by elemental analyses using our developed ICP-DRC-MS instrument

  10. An investigation of Martian and terrestrial dust devils

    Science.gov (United States)

    Ringrose, Timothy John

    2004-10-01

    It is the purpose of this work to provide an insight into the theoretical and practical dynamics of dust devils and how they are detected remotely from orbit or in situ on planetary surfaces. There is particular interest in the detection of convective vortices on Mars; this has been driven by involvement in the development of the Beagle 2 Environmental Sensor Suite. This suite of sensors is essentially a martian weather station and will be the first planetary lander experiment specifically looking for the presence of dust devils on Mars. Dust devils are characterised by their visible dusty core and intense rotation. The physics of particle motion, including dust lofting and the rotational dynamics within convective vortices are explained and modelled. This modelling has helped in identifying dust devils in meteorological data from both terrestrial and martian investigations. An automated technique for dust devil detection using meteorological data has been developed. This technique searches data looking for the specific vortex signature as well as detecting other transient events. This method has been tested on both terrestrial and martian data with surprising results. 38 possible convective vortices were detected in the first 60 sols of the Viking Lander 2 meteorological data. Tests were also carried out on data from a terrestrial dust devil campaign, which provided conclusive evidence from visual observations of the reliability of this technique. A considerable amount of this work does focus on terrestrial vortices. This is to aid in the understanding of dust devils, specifically how, why and when they form. Both laboratory and terrestrial fieldwork is investigated, providing useful data on the general structure of dust devils.

  11. Identify alternative splicing events based on position-specific evolutionary conservation.

    Directory of Open Access Journals (Sweden)

    Liang Chen

    Full Text Available The evolution of eukaryotes is accompanied by the increased complexity of alternative splicing which greatly expands genome information. One of the greatest challenges in the post-genome era is a complete revelation of human transcriptome with consideration of alternative splicing. Here, we introduce a comparative genomics approach to systemically identify alternative splicing events based on the differential evolutionary conservation between exons and introns and the high-quality annotation of the ENCODE regions. Specifically, we focus on exons that are included in some transcripts but are completely spliced out for others and we call them conditional exons. First, we characterize distinguishing features among conditional exons, constitutive exons and introns. One of the most important features is the position-specific conservation score. There are dramatic differences in conservation scores between conditional exons and constitutive exons. More importantly, the differences are position-specific. For flanking intronic regions, the differences between conditional exons and constitutive exons are also position-specific. Using the Random Forests algorithm, we can classify conditional exons with high specificities (97% for the identification of conditional exons from intron regions and 95% for the classification of known exons and fair sensitivities (64% and 32% respectively. We applied the method to the human genome and identified 39,640 introns that actually contain conditional exons and classified 8,813 conditional exons from the current RefSeq exon list. Among those, 31,673 introns containing conditional exons and 5,294 conditional exons classified from known exons cannot be inferred from RefSeq, UCSC or Ensembl annotations. Some of these de novo predictions were experimentally verified.

  12. Short-term memory for event duration: modality specificity and goal dependency.

    Science.gov (United States)

    Takahashi, Kohske; Watanabe, Katsumi

    2012-11-01

    Time perception is involved in various cognitive functions. This study investigated the characteristics of short-term memory for event duration by examining how the length of the retention period affects inter- and intramodal duration judgment. On each trial, a sample stimulus was followed by a comparison stimulus, after a variable delay period (0.5-5 s). The sample and comparison stimuli were presented in the visual or auditory modality. The participants determined whether the comparison stimulus was longer or shorter than the sample stimulus. The distortion pattern of subjective duration during the delay period depended on the sensory modality of the comparison stimulus but was not affected by that of the sample stimulus. When the comparison stimulus was visually presented, the retained duration of the sample stimulus was shortened as the delay period increased. Contrarily, when the comparison stimulus was presented in the auditory modality, the delay period had little to no effect on the retained duration. Furthermore, whenever the participants did not know the sensory modality of the comparison stimulus beforehand, the effect of the delay period disappeared. These results suggest that the memory process for event duration is specific to sensory modality and that its performance is determined depending on the sensory modality in which the retained duration will be used subsequently.

  13. Fatigue during treatment with antiepileptic drugs: A levetiracetam-specific adverse event?

    Science.gov (United States)

    Mula, Marco; von Oertzen, Tim J; Cock, Hannah R; Yogarajah, Mahinda; Lozsadi, Dora A; Agrawal, Niruj

    2017-07-01

    To examine the prevalence and clinical correlates of fatigue as an adverse event (AE) of antiepileptic drug (AED) treatment in patients with epilepsy. Data from 443 adult outpatients with epilepsy assessed with the Adverse Event Profile (AEP) and the Neurological Disorder Depression Inventory for Epilepsy (NDDIE) were analysed. Fatigue is reported by 36.6% of patients as always a problem during AED treatment. Fatigue is more likely to be reported by females (64.8% vs. 35.2%; Chi-Square=16.762; df=3; p=0.001) and during treatment with levetiracetam (42.3% vs. 33.2%; Chi-Square=11.462; df=3; p=0.009). The associations with the female gender and levetiracetam treatment were not mediated by depression, as identified with the NDDIE, and could not be simply explained by the large number of subjects on levetiracetam treatment, as analogous figures resulted from the analysis of a monotherapy subsample (41.7% vs. 30.3%; Chi-Square=11.547; df=3; p=0.009). One third of patients with epilepsy reports fatigue as a significant problem during AED treatment. Fatigue is more likely to be reported by females and seems to be specifically associated with LEV treatment. However, fatigue is not mediated by a negative effect of LEV on mood. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Martian crustal dichotomy: product of accretion and not a specific event?

    International Nuclear Information System (INIS)

    Frey, H.; Schultz, R.A.; Maxwell, T.A.

    1987-01-01

    Attempts to explain the fundamental crustal dichotomy on Mars range from purely endogenic to extreme exogenic processes, but to date no satisfactory theory has evolved. What is accepted is: (1) the dichotomy is an ancient feature of the Martian crust, and (2) the boundary between the cratered highlands and northern plains which marks the dichotomy in parts of Mars has undergone significant and variable modification during the observable parts of Martian history. Some ascribe it to a single mega-impact event, essentially an instantaneous rearrangement of the crustal structures (topography and lithospheric thickness). Others prefer an internal mechanism: a period of vigorous convection subcrustally erodes the northern one third of Mars, causing foundering and isostatic lowering of that part of Mars. The evidence for each theory is reviewed, with the conclusion that there is little to recommend either. An alternative is suggested: the formation of the crustal dichotomy on Mars was not a specific tectonic event but a byproduct of the accretionary process and therefore a primordial characteristic of the Martian crust, predating the oldest recognizable landforms

  15. Radioisotope dust pollution monitor

    International Nuclear Information System (INIS)

    Szepke, R.; Harasimczuk, J.; Dobrowiecki, J.

    1990-01-01

    Measuring principles and specification of two dust monitors: station-type AMIZ and portable-type PIK-10 for ambient air pollution are presented. The first one, a fully automatic instrument is destined for permanent monitoring of air pollution in preset sampling time from .25 to 24 hours. The second one was developed as a portable working model. Both instruments display their results in digital form in dust concentration units. (author)

  16. Cometary Dust

    Science.gov (United States)

    Levasseur-Regourd, Anny-Chantal; Agarwal, Jessica; Cottin, Hervé; Engrand, Cécile; Flynn, George; Fulle, Marco; Gombosi, Tamas; Langevin, Yves; Lasue, Jérémie; Mannel, Thurid; Merouane, Sihane; Poch, Olivier; Thomas, Nicolas; Westphal, Andrew

    2018-04-01

    This review presents our understanding of cometary dust at the end of 2017. For decades, insight about the dust ejected by nuclei of comets had stemmed from remote observations from Earth or Earth's orbit, and from flybys, including the samples of dust returned to Earth for laboratory studies by the Stardust return capsule. The long-duration Rosetta mission has recently provided a huge and unique amount of data, obtained using numerous instruments, including innovative dust instruments, over a wide range of distances from the Sun and from the nucleus. The diverse approaches available to study dust in comets, together with the related theoretical and experimental studies, provide evidence of the composition and physical properties of dust particles, e.g., the presence of a large fraction of carbon in macromolecules, and of aggregates on a wide range of scales. The results have opened vivid discussions on the variety of dust-release processes and on the diversity of dust properties in comets, as well as on the formation of cometary dust, and on its presence in the near-Earth interplanetary medium. These discussions stress the significance of future explorations as a way to decipher the formation and evolution of our Solar System.

  17. Dust, Climate, and Human Health

    Science.gov (United States)

    Maynard, Nancy G.

    2003-01-01

    Air pollution from both natural and anthropogenic causes is considered to be one of the most serious world-wide environment-related health problems, and is expected to become worse with changes in the global climate. Dust storms from the atmospheric transport of desert soil dust that has been lifted and carried by the winds - often over significant distances - have become an increasingly important emerging air quality issue for many populations. Recent studies have shown that the dust storms can cause significant health impacts from the dust itself as well as the accompanying pollutants, pesticides, metals, salt, plant debris, and other inorganic and organic materials, including viable microorganisms (bacteria, viruses and fungi). For example, thousands of tons of Asian desert sediments, some containing pesticides and herbicides from farming regions, are commonly transported into the Arctic during dust storm events. These chemicals have been identified in animal and human tissues among Arctic indigenous populations. Millions of tons of airborne desert dust are being tracked by satellite imagery, which clearly shows the magnitude as well as the temporal and spatial variability of dust storms across the "dust belt" regions of North Africa, the Middle East, and China. This paper summarizes the most recent findings on the effects of airborne desert dust on human health as well as potential climate influences on dust and health.

  18. Specific neural basis of Chinese idioms processing: an event-related functional MRI study

    International Nuclear Information System (INIS)

    Chen Shaoqi; Zhang Yanzhen; Xiao Zhuangwei; Zhang Xuexin

    2007-01-01

    Objective: To address the neural basis of Chinese idioms processing with different kinds of stimuli using an event-related fMRI design. Methods: Sixteen native Chinese speakers were asked to perform a semantic decision task during fMRI scanning. Three kinds of stimuli were used: Real idioms (Real-idiom condition); Literally plausible phrases (Pseudo-idiom condition, the last character of a real idiom was replaced by a character with similar meaning); Literally implausible strings (Non-idiom condition, the last character of a real idiom was replaced by a character with unrelated meaning). Reaction time and correct rate were recorded at the same time. Results: The error rate was 2.6%, 5.2% and 0.9% (F=3.51, P 0.05) for real idioms, pseudo-idioms and wrong idioms, respectively. Similar neural network was activated in all of the three conditions. However, the right hippocampus was only activated in the real idiom condition, and significant activations were found in anterior portion of left inferior frontal gyms (BA47) in real-and pseudo-idiom conditions, but not in non-idiom condition. Conclusion: The right hippocampus plays a specific role in the particular wording of the Chinese idioms. And the left anterior inferior frontal gyms (BA47) may be engaged in the semantic processing of Chinese idioms. The results support the notion that there were specific neural bases for Chinese idioms processing. (authors)

  19. Ultrafast hydrogen exchange reveals specific structural events during the initial stages of folding of cytochrome c.

    Science.gov (United States)

    Fazelinia, Hossein; Xu, Ming; Cheng, Hong; Roder, Heinrich

    2014-01-15

    Many proteins undergo a sharp decrease in chain dimensions during early stages of folding, prior to the rate-limiting step in folding. However, it remains unclear whether compact states are the result of specific folding events or a general hydrophobic collapse of the poly peptide chain driven by the change in solvent conditions. To address this fundamental question, we extended the temporal resolution of NMR-detected H/D exchange labeling experiments into the microsecond regime by adopting a microfluidics approach. By observing the competition between H/D exchange and folding as a function of labeling pH, coupled with direct measurement of exchange rates in the unfolded state, we were able to monitor hydrogen-bond formation for over 50 individual backbone NH groups within the initial 140 microseconds of folding of horse cytochrome c. Clusters of solvent-shielded amide protons were observed in two α-helical segments in the C-terminal half of the protein, while the N-terminal helix remained largely unstructured, suggesting that proximity in the primary structure is a major factor in promoting helix formation and association at early stages of folding, while the entropically more costly long-range contacts between the N- and C-terminal helices are established only during later stages. Our findings clearly indicate that the initial chain condensation in cytochrome c is driven by specific interactions among a subset of α-helical segments rather than a general hydrophobic collapse.

  20. A linkage between Asian dust, dissolved iron and marine export production in the deep ocean

    Science.gov (United States)

    Han, Yongxiang; Zhao, Tianliang; Song, Lianchun; Fang, Xiaomin; Yin, Yan; Deng, Zuqin; Wang, Suping; Fan, Shuxian

    2011-08-01

    Iron-addition experiments have revealed that iron supply exerts controls on biogeochemical cycles in the ocean and ultimately influences the Earth's climate system. The iron hypothesis in its broad outlines has been proved to be correct. However, the hypothesis needs to be verified with an observable biological response to specific dust deposition events. Plankton growth following the Asian dust storm over Ocean Station PAPA (50°N, 145°W) in the North Pacific Ocean in April 2001 was the first supportive evidence of natural aeolian iron inputs to ocean; The data were obtained through the SeaWiFS satellite and robot carbon explorers by Bishop et al. Using the NARCM modeling results in this study, the calculated total dust deposition flux was 35 mg m -2 per day in PAPA region from the dust storm of 11-13 April, 2001 into 0.0615 mg m -2 d -1 (about 1100 nM) soluble iron in the surface layer at Station PAPA. It was enough for about 1100 nM to enhance the efficiency of the marine biological pump and trigger the rapid increase of POC and chlorophyll. The iron fertilization hypothesis therefore is plausible. However, even if this specific dust event can support the iron fertilization hypothesis, long-term observation data are lacking in marine export production and continental dust. In this paper, we also conducted a simple correlation analysis between the diatoms and foraminifera at about 3000 m and 4000 m at two subarctic Pacific stations and the dust aerosol production from China's mainland. The correlation coefficient between marine export production and dust storm frequency in the core area of the dust storms was significantly high, suggesting that aerosols generated by Asian dust storm are the source of iron for organic matter fixation in the North Pacific Ocean. These results suggest that there could be an interlocking chain for the change of atmospheric dust aerosol-soluble iron-marine export production.

  1. Long-range-transported bioaerosols captured in snow cover on Mount Tateyama, Japan: impacts of Asian-dust events on airborne bacterial dynamics relating to ice-nucleation activities

    Directory of Open Access Journals (Sweden)

    T. Maki

    2018-06-01

    Full Text Available The westerly wind travelling at high altitudes over eastern Asia transports aerosols from the Asian deserts and urban areas to downwind areas such as Japan. These long-range-transported aerosols include not only mineral particles but also microbial particles (bioaerosols, that impact the ice-cloud formation processes as ice nuclei. However, the detailed relations of airborne bacterial dynamics to ice nucleation in high-elevation aerosols have not been investigated. Here, we used the aerosol particles captured in the snow cover at altitudes of 2450 m on Mt Tateyama to investigate sequential changes in the ice-nucleation activities and bacterial communities in aerosols and elucidate the relationships between the two processes. After stratification of the snow layers formed on the walls of a snow pit on Mt Tateyama, snow samples, including aerosol particles, were collected from 70 layers at the lower (winter accumulation and upper (spring accumulation parts of the snow wall. The aerosols recorded in the lower parts mainly came from Siberia (Russia, northern Asia and the Sea of Japan, whereas those in the upper parts showed an increase in Asian dust particles originating from the desert regions and industrial coasts of Asia. The snow samples exhibited high levels of ice nucleation corresponding to the increase in Asian dust particles. Amplicon sequencing analysis using 16S rRNA genes revealed that the bacterial communities in the snow samples predominately included plant associated and marine bacteria (phyla Proteobacteria during winter, whereas during spring, when dust events arrived frequently, the majority were terrestrial bacteria of phyla Actinobacteria and Firmicutes. The relative abundances of Firmicutes (Bacilli showed a significant positive relationship with the ice nucleation in snow samples. Presumably, Asian dust events change the airborne bacterial communities over Mt Tateyama and carry terrestrial bacterial populations, which

  2. Long-range-transported bioaerosols captured in snow cover on Mount Tateyama, Japan: impacts of Asian-dust events on airborne bacterial dynamics relating to ice-nucleation activities

    Science.gov (United States)

    Maki, Teruya; Furumoto, Shogo; Asahi, Yuya; Lee, Kevin C.; Watanabe, Koichi; Aoki, Kazuma; Murakami, Masataka; Tajiri, Takuya; Hasegawa, Hiroshi; Mashio, Asami; Iwasaka, Yasunobu

    2018-06-01

    The westerly wind travelling at high altitudes over eastern Asia transports aerosols from the Asian deserts and urban areas to downwind areas such as Japan. These long-range-transported aerosols include not only mineral particles but also microbial particles (bioaerosols), that impact the ice-cloud formation processes as ice nuclei. However, the detailed relations of airborne bacterial dynamics to ice nucleation in high-elevation aerosols have not been investigated. Here, we used the aerosol particles captured in the snow cover at altitudes of 2450 m on Mt Tateyama to investigate sequential changes in the ice-nucleation activities and bacterial communities in aerosols and elucidate the relationships between the two processes. After stratification of the snow layers formed on the walls of a snow pit on Mt Tateyama, snow samples, including aerosol particles, were collected from 70 layers at the lower (winter accumulation) and upper (spring accumulation) parts of the snow wall. The aerosols recorded in the lower parts mainly came from Siberia (Russia), northern Asia and the Sea of Japan, whereas those in the upper parts showed an increase in Asian dust particles originating from the desert regions and industrial coasts of Asia. The snow samples exhibited high levels of ice nucleation corresponding to the increase in Asian dust particles. Amplicon sequencing analysis using 16S rRNA genes revealed that the bacterial communities in the snow samples predominately included plant associated and marine bacteria (phyla Proteobacteria) during winter, whereas during spring, when dust events arrived frequently, the majority were terrestrial bacteria of phyla Actinobacteria and Firmicutes. The relative abundances of Firmicutes (Bacilli) showed a significant positive relationship with the ice nucleation in snow samples. Presumably, Asian dust events change the airborne bacterial communities over Mt Tateyama and carry terrestrial bacterial populations, which possibly induce ice

  3. Allergies, asthma, and dust

    Science.gov (United States)

    Reactive airway disease - dust; Bronchial asthma - dust; Triggers - dust ... Things that make allergies or asthma worse are called triggers. Dust is a common trigger. When your asthma or allergies become worse due to dust, you are ...

  4. Continuous measurements of natural radionuclides on air-borne dust using β-α correlated events. Towards on-line detection of artificial radionuclides in nuclear-fuel reprocessing and its related facilities

    International Nuclear Information System (INIS)

    Hashimoto, Tetsuo; Ishiyama, Hisanobu; Itou, Shigeki

    2008-01-01

    On the highly sensitive and on-line detection for the contamination of artificial nuclides, much attention has been paid to the elimination of significant problem due to 222 Rn-progenies. A phosfich-type α- and β-ray radiation counter, which was fixed just above the dust-collecting filter paper within a space in a few mm, provides both α- and β-ray pulses during continuous collection of air-borne dust. Both pulse input times were registered into the memory buffer in a pulse time interval analyzing (TIA) system, followed rapidly by the data processing using MTA (multiple TIA) method. Resultant β-α TIA-spectrum (or decay-curve of β-α correlated events) and changes of α- and β-counting rates were displayed instantly on a PC-display with 1 μs time resolution using installed softwares. Thus, three practical values, including β-α correlated event rates (n αβ ), α-(n α ), and β-ray counting rates (n β ) were available from the present TIA-measurement system. A uranium deposited source (as mixture of α- and β-ray emitters), uranium mineral powder sample, and 226 Ra-source (as β-source) showed negligible contribution to β-α correlated events in TIA-spectrum, giving constant α/β counting ratios. In the case of air-borne dust samples, the β-α correlated events in TIA-spectrum showed certainly a presence of 164 μs decay-curve due to 214 Po, based on successive decay process such as 241 Bi(β) → 214 Po(α:T 1/2 =164 μs)→. By using three measuring values, new parameters, R α and R β [equal to (n α or n β ) * (n α + n β )/n αβ ], have been introduced for the highly sensitive and real-time indicators of contamination owing to artificial nuclides, even under the inevitable existence of 222 Rn progenies in the air-borne dust sample. The present radiation measurement system, combined with β-α correlated events, has been proved to be useful for the detection of extremely small contamination with artificial α-nuclides as well as

  5. Of sports and politics: Predicting category-specific retention of news events from demographic variables

    NARCIS (Netherlands)

    Meeter, M.; Ochtman, D.J.C.; Janssen, S.M.J.; Murre, J.M.J.

    2010-01-01

    Many tests of retrograde amnesia consist of questions on news events. It is therefore important to know how such questions are answered by normal adults. We analysed the retention of news events in a sample of 12,913 participants, who provided basic demographic information and subsequently answered

  6. Of sports and politics: Predicting category-specific retention of news events from demographic variables.

    NARCIS (Netherlands)

    Meeter, M.; Ochtman, D.J.C.; Janssen, S.M.J.; Murre, J.M.J.

    2010-01-01

    Many tests of retrograde amnesia consist of questions on news events. It is therefore important to know how such questions are answered by normal adults. We analysed the retention of news events in a sample of 12,913 participants, who provided basic demographic information and subsequently answered

  7. Specific plasma oxylipins increase the odds of cardiovascular and cerebrovascular events in patients with peripheral artery disease.

    Science.gov (United States)

    Caligiuri, Stephanie P B; Aukema, Harold M; Ravandi, Amir; Lavallée, Renée; Guzman, Randy; Pierce, Grant N

    2017-08-01

    Oxylipins and fatty acids may be novel therapeutic targets for cardiovascular disease. The objective was to determine if plasma oxylipins or fatty acids can influence the odds of cardiovascular/cerebrovascular events. In 98 patients (25 female, 73 male) with peripheral artery disease, the prevalence of transient ischemic attacks, cerebrovascular accidents, stable angina, and acute coronary syndrome was n = 16, 10, 16, and 24, respectively. Risk factors such as being male, diagnosed hypertension, diabetes mellitus, and hyperlipidemia were not associated with events. Plasma fatty acids and oxylipins were analyzed with gas chromatography and HPLC-MS/MS, respectively. None of 24 fatty acids quantified were associated with events. In contrast, 39 plasma oxylipins were quantified, and 8 were significantly associated with events. These 8 oxylipins are known regulators of vascular tone. For example, every 1 unit increase in Thromboxane B 2 /Prostaglandin F 1 α and every 1 nmol/L increase in plasma 16-hydroxyeicosatetraenoic acid, thromboxane B2, or 11,12-dihydroxyeicosatrienoic acid (DiHETrE) increased the odds of having had ≥2 events versus no event (p < 0.05). The greatest predictor was plasma 8,9-DiHETrE, which increased the odds of acute coronary syndrome by 92-fold. In conclusion, specific oxylipins were highly associated with clinical events and may represent specific biomarkers and (or) therapeutic targets of cardiovascular disease.

  8. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

    Science.gov (United States)

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

    2011-12-28

    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

  9. The Effect of Specific Immunotherapy on Natural Killer T cells in Peripheral Blood of House Dust Mite-Sensitized Children with Asthma

    Directory of Open Access Journals (Sweden)

    Lu Yan-ming

    2012-01-01

    Full Text Available To investigate the effects of specific immunotherapy on the NKT cells in peripheral blood and the ability of NKT cells to proliferate in response to alpha-galactosylceramide (alpha-GalCer in house-dust-mite- (HDM- sensitized asthma children, peripheral blood mononuclear cells were isolated from 42 asthmatic children, of whom 24 were on specific immunotherapy (SIT for more than a year and 20 were healthy. Compared with control group, the ratio of peripheral blood NKT and CD4+NKT cells was significantly decreased (P<0.01 and was elevated in SIT asthma group (P<0.05, respectively, but it was still less than the normal control group (P<0.01. The level of IL-4 in serum secreted by NKT cells in asthma group was significantly higher than that of control group (P<0.01, particularly apparent after 72 hours. The level of IL-4 in SIT group decreased significantly (P<0.01. The level of IL-10 in serum secreted by NKT cells in asthma group was decreased significantly than that of the control group (P<0.01 especially in 48 hours, while that of SIT group was increased significantly (P<0.01. These results suggest that the pathogenesis of asthma may be related to the ratio and dysfunction of NKT and CD4+NKT cells.

  10. Relationship between presence of cows with milk positive for Mycobacterium avium subsp. paratuberculosis-specific antibody by enzyme-linked immunosorbent assay and viable M. avium subsp. paratuberculosis in dust in cattle barns.

    Science.gov (United States)

    Eisenberg, Susanne W F; Chuchaisangrat, Ruj; Nielen, Mirjam; Koets, Ad P

    2013-09-01

    Paratuberculosis, or Johne's disease, in cattle is caused by Mycobacterium avium subsp. paratuberculosis, which has recently been suspected to be transmitted through dust. This longitudinal study on eight commercial M. avium subsp. paratuberculosis-positive dairy farms studied the relationship between the number of cows with M. avium subsp. paratuberculosis antibody-positive milk and the presence of viable M. avium subsp. paratuberculosis in settled-dust samples, including their temporal relationship. Milk and dust samples were collected in parallel monthly for 2 years. M. avium subsp. paratuberculosis antibodies in milk were measured by enzyme-linked immunosorbent assay (ELISA) and used as a proxy for M. avium subsp. paratuberculosis shedding. Settled-dust samples were collected by using electrostatic dust collectors (EDCs) at six locations in housing for dairy cattle and young stock. The presence of viable M. avium subsp. paratuberculosis was identified by liquid culture and PCR. The results showed a positive relationship (odds ratio [OR], 1.2) between the number of cows with ELISA-positive milk and the odds of having positive EDCs in the same airspace as the adult dairy cattle. Moreover, the total number of lactating cows also showed an OR slightly above 1. This relationship remained the same for settled-dust samples collected up to 2 months before or after the time of milk sampling. The results suggest that removal of adult cows with milk positive for M. avium subsp. paratuberculosis-specific antibody by ELISA might result in a decrease in the presence of viable M. avium subsp. paratuberculosis in dust and therefore in the environment. However, this decrease is likely delayed by several weeks at least. In addition, the data support the notion that M. avium subsp. paratuberculosis exposure of young stock is reduced by separate housing.

  11. Development of requirements and functional specifications for crash event data recorders : final report

    Science.gov (United States)

    2004-12-01

    The U.S. DOT has conducted research on the requirements for a Crash Event Data Recorder to facilitate the reconstruction of commercial motor vehicle crashes. This report documents the work performed on the Development of Requirements and Functiona...

  12. Electrodynamic Dust Shield Demonstrator

    Science.gov (United States)

    Stankie, Charles G.

    2013-01-01

    The objective of the project was to design and manufacture a device to demonstrate a new technology developed by NASA's Electrostatics and Surface Physics Laboratory. The technology itself is a system which uses magnetic principles to remove regolith dust from its surface. This project was to create an enclosure that will be used to demonstrate the effectiveness of the invention to The Office of the Chief Technologist. ONE of the most important challenges of space exploration is actually caused by something very small and seemingly insignificant. Dust in space, most notably on the moon and Mars, has caused many unforeseen issues. Dirt and dust on Earth, while a nuisance, can be easily cleaned and kept at bay. However, there is considerably less weathering and erosion in space. As a result, the microscopic particles are extremely rough and abrasive. They are also electrostatically charged, so they cling to everything they make contact with. This was first noted to be a major problem during the Apollo missions. Dust would stick to the spacesuits, and could not be wiped off as predicted. Dust was brought back into the spacecraft, and was even inhaled by astronauts. This is a major health hazard. Atmospheric storms and other events can also cause dust to coat surfaces of spacecraft. This can cause abrasive damage to the craft. The coating can also reduce the effectiveness of thermal insulation and solar panels.' A group of engineers at Kennedy Space Center's Electrostatics and Surface Physics Laboratory have developed a new technology, called the Electrodynamic Dust Shield, to help alleviate these problems. It is based off of the electric curtain concept developed at NASA in 1967. "The EDS is an active dust mitigation technology that uses traveling electric fields to transport electrostatically charged dust particles along surfaces. To generate the traveling electric fields, the EDS consists of a multilayer dielectric coating with an embedded thin electrode grid

  13. Non-goal-directed recall of specific events in apes after long delays.

    Science.gov (United States)

    Lewis, Amy; Call, Josep; Berntsen, Dorthe

    2017-07-12

    We examined if apes spontaneously remember one-time, distinctive events across long delays when probed by discriminant cues. Apes witnessed an experimenter hide a cache of food, which they could then retrieve. They retrieved one of two food types; one more distinctive than the other. Two, 10 or 50 weeks later, the apes returned to the same enclosure and found a piece of the previously hidden food on the ground. An experimenter who had not hidden the food was also present. Apes immediately searched the location where the food was previously hidden (no food was here), showing recall of the event. One week later, apes returned to the same enclosure, with the same food on the ground, but now the experimenter that had hidden the food was present. Again, apes immediately searched the hiding location. Apes that had not witnessed the hiding event did not search. There was no significant effect of food type, and retention declined from exposure to the two-week delay, then levelled, consistent with the forgetting curve in humans (Ebbinghaus, H. 1964 Memory: a contribution to experimental psychology (transl. H.A. Ruger & C.E. Bussenvis). New York, NY: Dover. (Original work published 1885.)). This is the first study to show apes can recall a one-time, non-goal-directed event longer than two weeks ago and that apes' recall declines in accordance with a standard retention function. © 2017 The Author(s).

  14. Changes in the Silicate Dust Features of the Symbiotic Star R Aquarii Prior to the Upcoming 2022 Eclipse and Periastron Events

    Science.gov (United States)

    Omelian, Eric; Sankrit, Ravi; Helton, Andrew; Gorti, Uma; Wagner, R. Mark

    2018-01-01

    The symbiotic star, R Aquarii (R Aqr) consists of a dusty, pulsating Mira (period 387 days) and a hot white dwarf (WD) that orbit each other with a period of about 44 years. Based on the light curve from ca. 1890 CE onwards, and associated nebular and jet activity, it has been established (with a high degree of confidence) that the WD eclipses the Mira around the time of the periastron passage. One of the phenomena associated with this phase in the orbit is enhanced accretion onto the WD, which in turn energizes the jet outflow. The next eclipse is imminent, and it is estimated that periastron will occur in 2022. Infrared observations of R Aqr have established that the emission consists of a thermal spectrum with an effective temperature of about 2500 K with superposed silicate dust features. These silicate features are known to vary with time, and UKIRT spectra taken within a single Mira phase have shown that some of the variation is correlated with the pulsation of the dust envelope of the AGB star.We have used the FORCAST instrument on SOFIA to observe R Aqr during Cycles 4 and 5 as part of an ongoing monitoring of the system as it goes through eclipse and periastron. Photometry between 6 and 37 μm, and spectra covering the 10 and 18 μm silicate features have shown significant changes in the spectrum compared with earlier data in the same wavelength range obtained by ISO at an epoch closer to apastron. We present our data along with archival data from other IR observatories and use them to characterize the changes in the silicate emission. These data are presented along with model calculations using DUSTY and RADMC-3D that we have used to explore the changes in dust properties that are necessary to explain the differences in the emission profiles. We also present our plans for continued monitoring of R Aqr through the upcoming eclipse, which is required in order to separate the effects of pulsation from the longer-term orbital effects on the dust profiles.

  15. Geomorphic and land cover identification of dust sources in the eastern Great Basin of Utah, U.S.A.

    Science.gov (United States)

    Hahnenberger, Maura; Nicoll, Kathleen

    2014-01-01

    This study identifies anthropogenically disturbed areas and barren playa surfaces as the two primary dust source types that repeatedly contribute to dust storm events in the eastern Great Basin of western Utah, U.S.A. This semi-arid desert region is an important contributor to dust production in North America, with this study being the first to specifically identify and characterize regional dust sources. From 2004 to 2010, a total of 51 dust event days (DEDs) affected the air quality in Salt Lake City, UT. MODIS satellite imagery during 16 of these DEDs was analyzed to identify dust plumes, and assess the characteristics of dust source areas. A total of 168 plumes were identified, and showed mobilization of dust from Quaternary deposits located within the Bonneville Basin. This analysis identifies 4 major and 5 secondary source areas for dust in this region, which produce dust primarily during the spring and fall months and during moderate or greater drought conditions, with a Palmer Drought Index (PDI) of - 2 or less. The largest number of observed dust plumes (~ 60% of all plumes) originated from playas (ephemeral lakes) and are classified as barren land cover with a silty clay soil sediment surface. Playa surfaces in this region undergo numerous recurrent anthropogenic disturbances, including military operations and anthropogenic water withdrawal. Anthropogenic disturbance is necessary to produce dust from the vegetated landscape in the eastern Great Basin, as evidenced by the new dust source active from 2008 to 2010 in the area burned by the 2007 Milford Flat Fire; this fire was the largest in Utah's history due to extensive cover of invasive cheatgrass (Bromus tectorum) along with drought conditions. However, dust mobilization from the Milford Flat Burned Area was limited to regions that had been significantly disturbed by post-fire land management techniques that consisted of seeding, followed by chaining or tilling of the soil. Dust storms in the eastern

  16. Investigation of tissue-specific human orthologous alternative splice events in pig

    DEFF Research Database (Denmark)

    Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Salicio, Susanna Cirera

    2010-01-01

    Alternative splicing of pre-mRNA can contribute to differences between tissues or cells either by regulating gene expression or creating proteins with various functions encoded by one gene. The number of investigated alternative splice events in pig has so far been limited. In this study we have ...... in preservation of open reading frame are indicative of a functional significance of the splice variants of the gene....

  17. Extracting lunar dust parameters from image charge signals produced by the Lunar Dust Experiment

    Science.gov (United States)

    Stanley, J.; Kempf, S.; Horanyi, M.; Szalay, J.

    2015-12-01

    The Lunar Dust Experiment (LDEX) onboard the Lunar Atmosphere and Dust Environment Explorer (LADEE) is an impact ionization dust detector used to characterize the lunar dust exosphere generated by the impacts of large interplanetary particles and meteor streams (Horanyi et al., 2015). In addition to the mass and speed of these lofted particles, LDEX is sensitive to their charge. The resulting signatures of impact events therefore provide valuable information about not only the ambient plasma environment, but also the speed vectors of these dust grains. Here, impact events produced from LDEX's calibration at the Dust Accelerator Laboratory are analyzed using an image charge model derived from the electrostatic simulation program, Coulomb. We show that parameters such as dust grain speed, size, charge, and position of entry into LDEX can be recovered and applied to data collected during LADEE's seven-month mission.

  18. Stochastic histories of refractory interstellar dust

    International Nuclear Information System (INIS)

    Liffman, K.; Chayton, D.D.

    1988-01-01

    The authors calculate histories for refractory dust particles in the interstellar medium. The double purposes are to learn something of the properties of interstellar dust as a system and to evaluate with specific assumptions the cosmic chemical memory interpretation of a specific class of isotopic anomalies. They assemble the profile of a particle population from a large number of stochastic, or Monte Carlo, histories of single particles, which are necessarily taken to be independent with this approach. They specify probabilities for each of the events that may befall a given particle and unfold its history by a sequence of random numbers. They assume that refractory particles are created only by thermal condensation within stellar material during its ejection from stars, and that these refractory particles can be destroyed only by being sputtered to a size too small for stability or by being incorporated into the formation of new stars. In order to record chemical detail, the authors take each new refractory particle to consist of a superrefractory core plus a more massive refractory mantle. They demonstrate that these superrefractory cores have effective lifetimes much longer than the turnover time of dust mass against sputtering. As examples of cosmic chemical memory they evaluate the 16 O-richness of interstellar aluminum and mechanisms for the 48 Ca/ 50 Ti correlation. Several related consequences of this approach are discussed

  19. Coupling Mars' Dust and Water Cycles: Effects on Dust Lifting Vigor, Spatial Extent and Seasonality

    Science.gov (United States)

    Kahre, M. A.; Hollingsworth, J. L.; Haberle, R. M.; Montmessin, F.

    2012-01-01

    The dust cycle is an important component of Mars' current climate system. Airborne dust affects the radiative balance of the atmosphere, thus greatly influencing the thermal and dynamical state of the atmosphere. Dust raising events on Mars occur at spatial scales ranging from meters to planet-wide. Although the occurrence and season of large regional and global dust storms are highly variable from one year to the next, there are many features of the dust cycle that occur year after year. Generally, a low-level dust haze is maintained during northern spring and summer, while elevated levels of atmospheric dust occur during northern autumn and winter. During years without global-scale dust storms, two peaks in total dust loading were observed by MGS/TES: one peak occurred before northern winter solstice at Ls 200-240, and one peak occurred after northern winter solstice at L(sub s) 305-340. These maxima in dust loading are thought to be associated with transient eddy activity in the northern hemisphere, which has been observed to maximize pre- and post-solstice. Interactive dust cycle studies with Mars General Circulation Models (MGCMs) have included the lifting, transport, and sedimentation of radiatively active dust. Although the predicted global dust loadings from these simulations capture some aspects of the observed dust cycle, there are marked differences between the simulated and observed dust cycles. Most notably, the maximum dust loading is robustly predicted by models to occur near northern winter solstice and is due to dust lifting associated with down slope flows on the flanks of the Hellas basin. Thus far, models have had difficulty simulating the observed pre- and post- solstice peaks in dust loading. Interactive dust cycle studies typically have not included the formation of water ice clouds or their radiative effects. Water ice clouds can influence the dust cycle by scavenging dust from atmosphere and by interacting with solar and infrared radiation

  20. The impact of different emotional states on the memory for what, where and when features of specific events.

    Science.gov (United States)

    Zlomuzica, Armin; Preusser, Friederike; Totzeck, Christina; Dere, Ekrem; Margraf, Jürgen

    2016-02-01

    Emotions can modulate the encoding and recollection of personal events. In the present study, we investigated the effects of different emotional states (pleasant, neutral or anxious) on episodic memory formation in a virtual reality (VR) setting. Emotional states were induced by pleasant, neutral or anxiety-inducing movie clips prior to the presentation of specific events in a VR scenario. Episodic memory performance of healthy participants in whom an anxious emotional state had been induced was inferior to those of the neutral and pleasant conditions. In the anxious condition, participants were particularly impaired regarding their memory for the location of events. A correlational analysis indicated that high levels of negative arousal were associated with poor memory for the temporal and spatial context of events. In contrast, high levels of happiness were associated with better memory for the spatial context of events. Our data provide evidence that emotional arousal can modulate memory for what happened, where and when. Copyright © 2015. Published by Elsevier B.V.

  1. Concurrently examining unrealistic absolute and comparative optimism: Temporal shifts, individual-difference and event-specific correlates, and behavioural outcomes.

    Science.gov (United States)

    Ruthig, Joelle C; Gamblin, Bradlee W; Jones, Kelly; Vanderzanden, Karen; Kehn, Andre

    2017-02-01

    Researchers have spent considerable effort examining unrealistic absolute optimism and unrealistic comparative optimism, yet there is a lack of research exploring them concurrently. This longitudinal study repeatedly assessed unrealistic absolute and comparative optimism within a performance context over several months to identify the degree to which they shift as a function of proximity to performance and performance feedback, their associations with global individual difference and event-specific factors, and their link to subsequent behavioural outcomes. Results showed similar shifts in unrealistic absolute and comparative optimism based on proximity to performance and performance feedback. Moreover, increases in both types of unrealistic optimism were associated with better subsequent performance beyond the effect of prior performance. However, several differences were found between the two forms of unrealistic optimism in their associations with global individual difference factors and event-specific factors, highlighting the distinctiveness of the two constructs. © 2016 The British Psychological Society.

  2. Associations between social media displays and event-specific alcohol consumption by college students.

    Science.gov (United States)

    Moreno, Megan A; Kacvinsky, Lauren; Pumper, Megan; Wachowski, Leah; Whitehill, Jennifer M

    2013-12-01

    The Mifflin Street Block Party is a yearly Wisconsin event known for high levels of alcohol consumption and previous negative outcomes. This study investigated displayed Mifflin references on Facebook and their association with alcohol consumption at the block party. Participants included first-year college students who were enrolled in a longitudinal study involving Facebook profile assessments and interviews. We identified a subset of participants who were interviewed within 28 days following the Mifflin St Block Party. Participants were categorized as "Mifflin Displayers" or "Non-displayers" based on Facebook profile content. Interviews included the timeline follow-back method to assess alcohol use in the past 28 days. Analysis included logistic and linear regression. Among the 66 participants included in this study, 45 (68.2%) were female and 38 (50%) were Mifflin Displayers on Facebook. Among the Mifflin Displayer participants, 18 (27.2%) displayed prior to Mifflin, 11 displayed the day of Mifflin (16.7%) and 19 (28.8%) displayed after. Some participants displayed in more than 1 time frame. A total of 40 (60.6%) reported alcohol use on the day of the Mifflin Street Block Party. The mean number of drinks reported on the day of Mifflin was 8.8 (SD = 6.1), with a range of 1 to 35. Displayed references to Mifflin on Facebook were positively associated with reporting alcohol use at Mifflin (OR = 20.9, 95% CI 5.6-78.8). Displaying Facebook references to Mifflin was associated with alcohol consumption on the day of the event. Future prevention efforts could consider creating Facebook advertisements with safety messages triggered by Mifflin displays.

  3. ELEMENTS OF KINEMATICS SPECIFIC TO THE JUMP OF THE MALE TRIPLE JUMP EVENT

    Directory of Open Access Journals (Sweden)

    MIHAI ILIE

    2010-12-01

    Full Text Available The quality of results obtained in competitions is based on the use of the most efficient technologies and conducting systems in the sportive training process, all embedded in operational strategies to enable the efficient filtering of the information exchange between coaches and athletes in order to ensure all the resources needed for an optimal monitoring and conveyance training process. The purpose of this study was to examine the kinematic point of view the main technical aspects of specific proof of triple last step - the long jump. Research was conducted on athletes who specialize in thissample, and components of the National Olympic Lot Romanian Athletics Federation. Using kinematic analysis software movement - Dartfish © I obtained a series of kinematic parameters (time, position, angles discussed specific issues in research, processing and interpretation leading to the general conclusion according to which: kinematic analysis of the key features approach specific technical triple last step of the sample by use of IT leads to useful information specific to this test in monitoring technique

  4. Respirable quartz hazard associated with coal mine roof bolter dust

    International Nuclear Information System (INIS)

    Joy, G.J.; Beck, T.W.; Listak, J.M.

    2010-01-01

    Pneumoconiosis has been reported to be increasing among underground coal miners in the Southern Appalachian Region. The National Institute for Occupational Safety and Health conducted a study to examine the particle size distribution and quartz content of dust generated by the installation of roof bolts in mines. Forty-six bulk samples of roof bolting machine pre-cleaner cyclone dump dust and collector box dust were collected from 26 underground coal mines. Real-time and integrated airborne respirable dust concentrations were measured on 3 mining sections in 2 mines. The real-time airborne dust concentrations profiles were examined to identify any concentration changes that might be associated with pre-cleaner cyclone dust discharge events. The study showed that bolter dust is a potential inhalation hazard due to the fraction of dust less than 10 μm in size, and the quartz content of the dust. The pre-cleaner cyclone dust was significantly larger than the collector box dust, indicating that the pre-cleaner functioned properly in removing the larger dust size fraction from the airstream. However, the pre-cleaner dust still contained a substantial amount of respirable dust. It was concluded that in order to maintain the effectiveness of a roof bolter dust collector, periodic removal of dust is required. Appropriate work procedures and equipment are necessary to minimize exposure during this cleaning task. 13 refs., 3 tabs., 2 figs.

  5. Correlation of skin test results and specific immunoglobulin E blood levels with nasal provocation testing for house-dust mite allergies.

    Science.gov (United States)

    Haxel, Boris R; Huppertz, Tilman; Boessert, Patrick; Bast, Florian; Fruth, Kai

    2016-01-01

    Allergen-specific immunotherapy for house-dust mite (HDM) allergies is associated with lower success rates when compared with similar treatments for other inhalant allergens, such as grass or birch. One reason might be the greater difficulty in diagnosing patients with assumed HDM allergies because symptoms occur perennially and may differ from those of a conventional allergic rhinitis. The aim of the study was to compare the different methods of diagnosis in patients with assumed HDM allergy. We performed a retrospective analysis of nasal provocation tests (NPT) from patients (n = 161) evaluated for Dermatophagoides pteronyssinus (n = 127) and Dermatophagoides farinae (n = 104) allergies, and compared the results with other allergen testing methods (skin-prick test [SPT], intracutaneous test, and allergen specific immunoglobulin E levels [sIgE] to detect sensitization). Receiver operating characteristic curves were used for the analyses and the areas under the curve were calculated. For D. pteronyssinus and D. farinae, 86 and 70 complete data files, respectively, were available. For both tested HDMs, the results of the receiver operating characteristic curves showed a significant correlation for SPT and sIgE, with the results of the NPT (area under the curve, 0.742 to 0.763) but not for the intracutaneous test. In patients with a positive SPT (≥3 mm), an allergy was confirmed by the NPT in 69% of cases for D. pteronyssinus and 71% for D. farinae. A positive sIgE result (ImmunoCAP class of ≥2) was verified by the NPT in 69% of cases (D. pteronyssinus) and 70% (D. farinae). The predictability value for a positive NPT result is best for SPT and sIgE. Nevertheless, even if the results of both test systems are combined, the positive predictive value that was achieved was only 0.77 for D. pteronyssinus and 0.69 for D. farinae. Therefore, in patients eligible for immunotherapy for HDM, an NPT should be performed before the start of the therapy to verify a clinically

  6. Eating and weight/shape criticism as a specific life-event related to bulimia nervosa: a case control study.

    Science.gov (United States)

    Gonçalves, Sonia Ferreira; Machado, Bárbara César; Martins, Carla

    2014-01-01

    The present study aims to evaluate the occurrence of life events preceding the onset of eating problems in bulimia nervosa patients. A case-control design was used involving the comparison of 60 female subjects who meet DSM-IV criteria for bulimia nervosa with 60 healthy control subjects and 60 subjects with other psychiatric disorders. The RFI (Fairburn et al., 1998) subset of factors that represent exposure to life events in the 12 months immediately before the development of eating problems was used. Women with bulimia nervosa reported higher rates of major stress, criticism about eating, weight and shape and also a great number of antecedent life events during the year preceding the development of eating problems than the healthy control group. However, when compared with the general psychiatric control group only the exposure to critical comments about weight, shape, or eating emerged as a specific trigger for bulimia nervosa. Our findings support the fact that eating and shape/weight criticism in the year preceding the development of eating disturbance seems to be specifically related to bulimia nervosa.

  7. Radioecological impact of Saharan dusts fallout. Case study of a major event on the 21. of february 2004 in south part of France; Impact radioecologique des retombees de poussieres sahariennes. Episode majeur du 21/02/2004 dans le sud de la France

    Energy Technology Data Exchange (ETDEWEB)

    Masson, O.; Pourcelot, L.; Gurriaran, R.; Paulat, P

    2005-07-01

    deposited by flood events, for example. Changes in artificial radionuclide activity levels in the atmospheric area close to ground level are routinely attributed to resuspension of formerly deposited aerosols. In the particular case of the Saharan dust deposits, apart from the resuspension mechanisms that caused the Saharan soil particles to be taken up, other mechanisms may have intervened during transports up until deposit on French soil. Such mechanisms, which have already been identified for other atmospheric compounds or pollutants, give a lead in attempting to understand the enhanced relative or absolute radioactivity of the mineral particles. Two hypotheses have been put forward to explain this enhanced radioactivity: either a process rather like a 'horizontal leaching' of compounds or pollutants present in the atmosphere during transport, or the early fall of the heavier and thus less radioactive mineral particles, giving rise to a relative increase in specific activity. One cannot overlook the contribution these sporadic phenomena make to atmospheric deposits on an annual basis. Further studies are needed to evaluate the weight of these phenomena on a multi-annual scale in the reduction of activity levels in the atmospheric compartment by dry or wet process and at short time scale the deposition of radioactivity with dust from remote regions. Taking into account current metrological performance devices at the IRSN (Institute for Radiological Protection and Nuclear Safety), regular monitoring of these events allow opportunity to follow the changes of plutonium isotopes in the atmosphere. (authors)

  8. Simulating southwestern U.S. desert dust influences on supercell thunderstorms

    Science.gov (United States)

    Lerach, David G.; Cotton, William R.

    2018-05-01

    Three-dimensional numerical simulations were performed to evaluate potential southwestern U.S. dust indirect microphysical and direct radiative impacts on a real severe storms outbreak. Increased solar absorption within the dust plume led to modest increases in pre-storm atmospheric stability at low levels, resulting in weaker convective updrafts and less widespread precipitation. Dust microphysical impacts on convection were minor in comparison, due in part to the lofted dust concentrations being relatively few in number when compared to the background (non-dust) aerosol population. While dust preferentially serving as cloud condensation nuclei (CCN) versus giant CCN had opposing effects on warm rain production, both scenarios resulted in ample supercooled water and subsequent glaciation aloft, yielding larger graupel and hail. Associated latent heating from condensation and freezing contributed little to overall updraft invigoration. With reduced rain production overall, the simulations that included dust effects experienced slightly reduced grid-cumulative precipitation and notably warmer and spatially smaller cold pools. Dust serving as ice nucleating particles did not appear to play a significant role. The presence of dust ultimately reduced the number of supercells produced but allowed for supercell evolution characterized by consistently higher values of relative vertical vorticity within simulated mesocyclones. Dust radiative and microphysical effects were relatively small in magnitude when compared to those from altering the background convective available potential energy and vertical wind shear. It is difficult to generalize such findings from a single event, however, due to a number of case-specific environmental factors. These include the nature of the low-level moisture advection and characteristics of the background aerosol distribution.

  9. The physics of wind-blown sand and dust.

    Science.gov (United States)

    Kok, Jasper F; Parteli, Eric J R; Michaels, Timothy I; Karam, Diana Bou

    2012-10-01

    The transport of sand and dust by wind is a potent erosional force, creates sand dunes and ripples, and loads the atmosphere with suspended dust aerosols. This paper presents an extensive review of the physics of wind-blown sand and dust on Earth and Mars. Specifically, we review the physics of aeolian saltation, the formation and development of sand dunes and ripples, the physics of dust aerosol emission, the weather phenomena that trigger dust storms, and the lifting of dust by dust devils and other small-scale vortices. We also discuss the physics of wind-blown sand and dune formation on Venus and Titan.

  10. Task-specific noise exposure during manual concrete surface grinding in enclosed areas-influence of operation variables and dust control methods.

    Science.gov (United States)

    Akbar-Khanzadeh, Farhang; Ames, April L; Milz, Sheryl A; Akbar-Khanzadeh, Mahboubeh

    2013-01-01

    Noise exposure is a distinct hazard during hand-held concrete grinding activities, and its assessment is challenging because of the many variables involved. Noise dosimeters were used to examine the extent of personal noise exposure while concrete grinding was performed with a variety of grinder sizes, types, accessories, and available dust control methods. Noise monitoring was conducted in an enclosed area covering 52 task-specific grinding sessions lasting from 6 to 72 minutes. Noise levels, either in minute average noise level (Lavg, dBA) or in minute peak (dBC), during concrete grinding were significantly (P grinding cup wheel (blade) sizes of 4-inch (100 mm), 5-inch (125 mm) and 6-inch (150 mm), and surface orientation (horizontal, inclined). Overall, minute Lavg during grinding was 97.0 ± 3.3 (mean ± SD), ranging from 87.9 to 113. The levels of minute Lavg during uncontrolled grinding (98.9 ± 5.2) or wet-grinding (98.5 ± 2.7) were significantly higher than those during local exhaust ventilation (LEV) grinding (96.2 ± 2.8). A 6-inch grinding cup wheel generated significantly higher noise levels (98.7 ± 2.8) than 5-inch (96.3 ± 3.2) or 4-inch (95.3 ± 3.5) cup wheels. The minute peak noise levels (dBC) during grinding was 113 ± 5.2 ranging from 104 to 153. The minute peak noise levels during uncontrolled grinding (119 ± 10.2) were significantly higher than those during wet-grinding (115 ± 4.5) and LEV-grinding (112 ± 3.4). A 6-inch grinding cup wheel generated significantly higher minute peak noise levels (115 ± 5.3) than 5-inch (112 ± 4.5) or 4-inch (111 ± 5.4) cup wheels. Assuming an 8-hour work shift, the results indicated that noise exposure levels during concrete grinding in enclosed areas exceeded the recommended permissible exposure limits and workers should be protected by engineering control methods, safe work practices, and/or personal protective devices.

  11. Original sounding and drifting balloon-borne measurements in the western Mediterranean with the aerosol counter/sizer LOAC during summer ChArMEx campaigns, with a focus on desert dust events

    Science.gov (United States)

    Renard, Jean-Baptiste; Dulac, François; Vignelles, Damien; Jeannot, Matthieu; Verdier, Nicolas; Chazette, Patrick; Crenn, Vincent; Sciare, Jean; Totems, Julien; Durand, Pierre; Barret, Brice; Jambert, Corinne; Mallet, Marc; Menut, Laurent; Mailler, Sylvain; Basart, Sara; Baldasano, José Maria

    2015-04-01

    LOAC (Light Optical Aerosol Counter) is a new small optical particle counter/sizer of ~250 grams designed to fly under all kinds of balloons. The measurements are conducted at two scattering angles (12° and 60°), allowing the determination of the aerosol particle concentrations in 19 size classes within a diameter range of ~0.2-100 µm and some identification of the nature of particles dominating different size classes. Following laboratory calibration, the sensor particularly discriminates wet or liquid particles, mineral dust, soot carbon particles and salts. Comparisons with other in situ sensors at the surface and with remote sensing measurements on the vertical were performed to give confidence in measurements. The instrument has been operated at the surface, under all kinds of balloons up to more than 35 km in altitude, including tethered, sounding, open stratospheric and new boundary-layer pressurized drifting balloons (BLPB) from CNES, and was tested on board a small UAV. Operations encompass a variety of environments including the Arctic (Reykjavik, Island, and Kiruna, Sweden), Brazil (Sao Paolo), the western Mediterranean Basin, southwestern France, peri-urban (Ile de France) and urban areas (Paris and Vienna). Presented results are focused on the LOAC balloon-borne measurements performed in the western Mediterranean basin during MISTRALS/ChArMEx campaigns (Mediterranean Integrated Studies aT Regional And Local Scales/the Chemistry-Aerosol Mediterranean Experiment; http://www.mistrals-hjome.org; http://charmex.lsce.ipsl.fr), with a focus on African dust events. Two test flights with a first version of LOAC under sounding balloons were first successfully performed in late June 2012 near Marseille during an intense dust event. In 2013, 19 LOAC flights have been performed under meteorological balloons and 12 under low altitude drifting balloons, most of them from Minorca Island (Spain) in June and early July and others from Levant Island (south of France

  12. Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

    Science.gov (United States)

    Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

  13. An electrostatic detector for dust measurement on HT-7 tokamak

    International Nuclear Information System (INIS)

    Ling, B.L.; Zhang, X.D.; Ti, A.; Gao, X.

    2007-01-01

    An electrostatic dust detector has been successfully developed to measure dust event in situ and in real time on the HT-7 tokamak. For measuring dust near the edge plasmas and preventing interference of electrons and ions, the shielding plates were designed and installed around the dust detector. The electric signal of dust has been successfully measured during LHCD discharges on HT-7 tokamak. The measured dust signal was in good agreement with bursts appeared on multi-channel H α radiation and on multi-channel ECE diagnostics. Diagnostics of the spectrum and the measurement of impurity emission during dust bursts were studied in detail. It is interesting that there is a delay between dust bursts and CIII line emission. It is observed that the delay time between dust signal and measured CIII line emission is about 0.3 ms in the HT-7 tokamak

  14. Assessing cost-effectiveness of specific LID practice designs in response to large storm events

    Science.gov (United States)

    Chui, Ting Fong May; Liu, Xin; Zhan, Wenting

    2016-02-01

    Low impact development (LID) practices have become more important in urban stormwater management worldwide. However, most research on design optimization focuses on relatively large scale, and there is very limited information or guideline regarding individual LID practice designs (i.e., optimal depth, width and length). The objective of this study is to identify the optimal design by assessing the hydrological performance and the cost-effectiveness of different designs of LID practices at a household or business scale, and to analyze the sensitivity of the hydrological performance and the cost of the optimal design to different model and design parameters. First, EPA SWMM, automatically controlled by MATLAB, is used to obtain the peak runoff of different designs of three specific LID practices (i.e., green roof, bioretention and porous pavement) under different design storms (i.e., 2 yr and 50 yr design storms of Hong Kong, China and Seattle, U.S.). Then, life cycle cost is estimated for the different designs, and the optimal design, defined as the design with the lowest cost and at least 20% peak runoff reduction, is identified. Finally, sensitivity of the optimal design to the different design parameters is examined. The optimal design of green roof tends to be larger in area but thinner, while the optimal designs of bioretention and porous pavement tend to be smaller in area. To handle larger storms, however, it is more effective to increase the green roof depth, and to increase the area of the bioretention and porous pavement. Porous pavement is the most cost-effective for peak flow reduction, followed by bioretention and then green roof. The cost-effectiveness, measured as the peak runoff reduction/thousand Dollars of LID practices in Hong Kong (e.g., 0.02 L/103 US s, 0.15 L/103 US s and 0.93 L/103 US s for green roof, bioretention and porous pavement for 2 yr storm) is lower than that in Seattle (e.g., 0.03 L/103 US s, 0.29 L/103 US s and 1.58 L/103 US s for

  15. A Simple Ensemble Simulation Technique for Assessment of Future Variations in Specific High-Impact Weather Events

    Science.gov (United States)

    Taniguchi, Kenji

    2018-04-01

    To investigate future variations in high-impact weather events, numerous samples are required. For the detailed assessment in a specific region, a high spatial resolution is also required. A simple ensemble simulation technique is proposed in this paper. In the proposed technique, new ensemble members were generated from one basic state vector and two perturbation vectors, which were obtained by lagged average forecasting simulations. Sensitivity experiments with different numbers of ensemble members, different simulation lengths, and different perturbation magnitudes were performed. Experimental application to a global warming study was also implemented for a typhoon event. Ensemble-mean results and ensemble spreads of total precipitation, atmospheric conditions showed similar characteristics across the sensitivity experiments. The frequencies of the maximum total and hourly precipitation also showed similar distributions. These results indicate the robustness of the proposed technique. On the other hand, considerable ensemble spread was found in each ensemble experiment. In addition, the results of the application to a global warming study showed possible variations in the future. These results indicate that the proposed technique is useful for investigating various meteorological phenomena and the impacts of global warming. The results of the ensemble simulations also enable the stochastic evaluation of differences in high-impact weather events. In addition, the impacts of a spectral nudging technique were also examined. The tracks of a typhoon were quite different between cases with and without spectral nudging; however, the ranges of the tracks among ensemble members were comparable. It indicates that spectral nudging does not necessarily suppress ensemble spread.

  16. Long-Term Exposure to Silica Dust and Risk of Total and Cause-Specific Mortality in Chinese Workers: A Cohort Study

    OpenAIRE

    Chen, Weihong; Liu, Yuewei; Wang, Haijiao; Hnizdo, Eva; Sun, Yi; Su, Liangping; Zhang, Xiaokang; Weng, Shaofan; Bochmann, Frank; Hearl, Frank J.; Chen, Jingqiong; Wu, Tangchun

    2012-01-01

    Editors' Summary Background Walk along most sandy beaches and you will be walking on millions of grains of crystalline silica, one of the commonest minerals on earth and a major ingredient in glass and in ceramic glazes. Silica is also used in the manufacture of building materials, in foundry castings, and for sandblasting, and respirable (breathable) crystalline silica particles are produced during quarrying and mining. Unfortunately, silica dust is not innocuous. Several serious diseases ar...

  17. Attachment avoidance, alexithymia, and gender: Examining their associations with distress disclosure tendencies and event-specific disclosure.

    Science.gov (United States)

    O'Loughlin, Julia I; Cox, Daniel W; Kahn, Jeffrey H; Wu, Amery D

    2018-01-01

    Distress disclosure has been linked with reduced psychological distress, increased wellbeing, and successful psychotherapeutic outcome. Because of the importance of distress disclosure, researchers have worked to develop and improve theoretical models of disclosure to facilitate counseling practices that reduce impediments to disclosure. Presently, we conducted a 2-part study to investigate distress disclosure's associations with attachment avoidance, gender, and alexithymia-3 constructs frequently linked with disclosure. In Part 1, we examined the extent to which attachment avoidance, alexithymia, and gender predicted general disclosure tendencies. In Part 2, we examined the extent to which attachment avoidance, alexithymia, and gender predicted event-specific disclosure. Participants were recruited from a crowdsourcing website (N = 178 in Part 1; N = 108 in Part 2). In Part 1, alexithymia partially mediated the association between attachment avoidance and disclosure tendencies, and the link between attachment avoidance and alexithymia was stronger for men than women. In Part 2, the association between distress intensity and event-specific disclosure was weaker for people with high levels of alexithymia. Implications for counseling theory and practice are discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  18. Feature-Specific Event-Related Potential Effects to Action- and Sound-Related Verbs during Visual Word Recognition.

    Science.gov (United States)

    Popp, Margot; Trumpp, Natalie M; Kiefer, Markus

    2016-01-01

    Grounded cognition theories suggest that conceptual representations essentially depend on modality-specific sensory and motor systems. Feature-specific brain activation across different feature types such as action or audition has been intensively investigated in nouns, while feature-specific conceptual category differences in verbs mainly focused on body part specific effects. The present work aimed at assessing whether feature-specific event-related potential (ERP) differences between action and sound concepts, as previously observed in nouns, can also be found within the word class of verbs. In Experiment 1, participants were visually presented with carefully matched sound and action verbs within a lexical decision task, which provides implicit access to word meaning and minimizes strategic access to semantic word features. Experiment 2 tested whether pre-activating the verb concept in a context phase, in which the verb is presented with a related context noun, modulates subsequent feature-specific action vs. sound verb processing within the lexical decision task. In Experiment 1, ERP analyses revealed a differential ERP polarity pattern for action and sound verbs at parietal and central electrodes similar to previous results in nouns. Pre-activation of the meaning of verbs in the preceding context phase in Experiment 2 resulted in a polarity-reversal of feature-specific ERP effects in the lexical decision task compared with Experiment 1. This parallels analogous earlier findings for primed action and sound related nouns. In line with grounded cognitions theories, our ERP study provides evidence for a differential processing of action and sound verbs similar to earlier observation for concrete nouns. Although the localizational value of ERPs must be viewed with caution, our results indicate that the meaning of verbs is linked to different neural circuits depending on conceptual feature relevance.

  19. Dust collector

    Energy Technology Data Exchange (ETDEWEB)

    Sahourin, H.

    1988-03-22

    This invention relates to a dust collector or filter which may be used for large volume cleaning air for gases or for separating out industrial byproducts such as wood chips, sawdust, and shavings. It relies on filtration or separation using only a uniquely configured medium. A primary, but not exclusive, purpose of the invention is to enable very large throughput, capable of separating or filtering of gases containing up to three or more tons of byproduct with a minimum pressure-drop across the device. No preliminary cycloning, to remove major particulates is necessary. The collector generally comprises a continuous and integral filter medium which is suspended from a plurality of downwardly extending frames forming a series of separate elements having a triangular cross-section, each element being relatively wide at the top and narrow at the bottom to define, between adjacent elements, a divergent collecting space which is wide at the bottom. 11 figs.

  20. Trace metals in urban road dust

    International Nuclear Information System (INIS)

    Randazzo, Loredana Antonella; Dongarra, Gaetano; Manno, Emanuela; Varrica, Daniela

    2006-01-01

    Heavy metals associated with urban road dust is a matter for concern as they may have serious effects on biological systems. The bioavailability and potential toxicity of metals bound to urban dust is related to the specific chemical form of the element. In the present article are reported the determinations and chemical speciation of As, Ba, Cr, Cu, Mo, Ni, Pb and Zn in six samples of road dust collected within the urban centre and the outskirts of Palermo [it

  1. Dust Measurements in Tokamaks

    International Nuclear Information System (INIS)

    Rudakov, D; Yu, J; Boedo, J; Hollmann, E; Krasheninnikov, S; Moyer, R; Muller, S; Yu, A; Rosenberg, M; Smirnov, R; West, W; Boivin, R; Bray, B; Brooks, N; Hyatt, A; Wong, C; Fenstermacher, M; Groth, M; Lasnier, C; McLean, A; Stangeby, P; Ratynskaia, S; Roquemore, A; Skinner, C; Solomon, W M

    2008-01-01

    Dust production and accumulation impose safety and operational concerns for ITER. Diagnostics to monitor dust levels in the plasma as well as in-vessel dust inventory are currently being tested in a few tokamaks. Dust accumulation in ITER is likely to occur in hidden areas, e.g. between tiles and under divertor baffles. A novel electrostatic dust detector for monitoring dust in these regions has been developed and tested at PPPL. In DIII-D tokamak dust diagnostics include Mie scattering from Nd:YAG lasers, visible imaging, and spectroscopy. Laser scattering resolves size of particles between 0.16-1.6 (micro)m in diameter; the total dust content in the edge plasmas and trends in the dust production rates within this size range have been established. Individual dust particles are observed by visible imaging using fast-framing cameras, detecting dust particles of a few microns in diameter and larger. Dust velocities and trajectories can be determined in 2D with a single camera or 3D using multiple cameras, but determination of particle size is problematic. In order to calibrate diagnostics and benchmark dust dynamics modeling, pre-characterized carbon dust has been injected into the lower divertor of DIII-D. Injected dust is seen by cameras, and spectroscopic diagnostics observe an increase of carbon atomic, C2 dimer, and thermal continuum emissions from the injected dust. The latter observation can be used in the design of novel dust survey diagnostics

  2. Solar-Panel Dust Accumulation and Cleanings

    Science.gov (United States)

    2005-01-01

    Air-fall dust accumulates on the solar panels of NASA's Mars Exploration Rovers, reducing the amount of sunlight reaching the solar arrays. Pre-launch models predicted steady dust accumulation. However, the rovers have been blessed with occasional wind events that clear significant amounts of dust from the solar panels. This graph shows the effects of those panel-cleaning events on the amount of electricity generated by Spirit's solar panels. The horizontal scale is the number of Martian days (sols) after Spirit's Jan. 4, 2005, (Universal Time) landing on Mars. The vertical scale indicates output from the rover's solar panels as a fraction of the amount produced when the clean panels first opened. Note that the gradual declines are interrupted by occasional sharp increases, such as a dust-cleaning event on sol 420.

  3. Control of dust production in ITER

    International Nuclear Information System (INIS)

    Rodriguez-Rodrigo, L.; Ciattaglia, S.; Elbez-Uzan, J.

    2006-01-01

    In the last years dust has been observed in a number of fusion devices and is being studied more in detail for understanding in particular the physical phenomena related to its formation, its composition, physical and chemical characteristics, and the amount of produced dust. The extrapolation of dust formation to ITER predicts (with large error bars), a large mass of dust production with a scattered size distribution. To evaluate the impact of dust on safety, assumptions have also been made on radionuclide inventory, and mobility in off-normal events, as well as any postulated contributions the dust may make to effluents or accidental releases. Solid activation products in structures are generally not readily mobilisable in incidental and accidental situations, so that activated dust, tritium and activated corrosions products are the important in-vessel source terms in postulated scenarios that assume a mobilisation and release of some fraction of this inventory. Such a release would require the simultaneous leak or bypass of several robust confinement barriers. Further concerns for dust may be the potential for chemical reactions between dust and coolant in the event of an in-vessel leak, and the theoretical possibility of a dust explosion, either of which could in principle cause a pressure rise that challenges one or more of the confinement barriers. Although these hazards can - and will - be controlled by other measures in the ITER design, application of the principle of Defence in Depth dictates that the dust inventory should also be minimised and controlled to prevent the potential hazard. A well-coordinated R-and-D programme is required to support this dust production control. This document provides from the safety point of view, an overview of existing data given in '' Dossier d'Options de Surete '', the first safety report presented in 2001 to the French Safety Authorities, and ITER documents; it also gathers information on status of studies on activated

  4. Correlation between Yellow Dust and Radioactivity

    Energy Technology Data Exchange (ETDEWEB)

    AIZaabia, Mouza A [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Kim, Byoung-Jik [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2015-10-15

    In East Asia, yellow dust or Asian Dust (AD) outbreaks are among the largest contributors of wind-blown dust that carry natural and anthropogenic radionuclides and subsequently alter their concentration and distribution throughout the environment. Although the Korean Peninsula has been experiencing AD events since ancient times, the research has tended to focus on the transport routes and characteristics of AD, rather than on its impact on radionuclide activity levels. This paper examines the relationship between radionuclide concentration in the air and the frequency of dusty days in South Korea during AD intrusion events. It also investigates whether increased radionuclide concentration is a function of either more mass or more dust contamination. In this study, significant linear correlations of gamma-emitting radionuclides were found with mass of dust and occurrence frequency of AD. Regardless of the source origin of the dust, {sup 137}Cs and {sup 7}Be concentration primarily depended on dust mass in the filter. Nonetheless, the correlations were greatly distorted in 2011 and in the spring season, particularly the correlations with AD days that were far below that of the correlations obtained for the whole study period. A possible explanation of these conflicting results is that a change in the dust source could appreciably alter the concentration, deposition, and distribution of airborne radionuclides.

  5. Correlation between Yellow Dust and Radioactivity

    International Nuclear Information System (INIS)

    AIZaabia, Mouza A; Kim, Byoung-Jik

    2015-01-01

    In East Asia, yellow dust or Asian Dust (AD) outbreaks are among the largest contributors of wind-blown dust that carry natural and anthropogenic radionuclides and subsequently alter their concentration and distribution throughout the environment. Although the Korean Peninsula has been experiencing AD events since ancient times, the research has tended to focus on the transport routes and characteristics of AD, rather than on its impact on radionuclide activity levels. This paper examines the relationship between radionuclide concentration in the air and the frequency of dusty days in South Korea during AD intrusion events. It also investigates whether increased radionuclide concentration is a function of either more mass or more dust contamination. In this study, significant linear correlations of gamma-emitting radionuclides were found with mass of dust and occurrence frequency of AD. Regardless of the source origin of the dust, 137 Cs and 7 Be concentration primarily depended on dust mass in the filter. Nonetheless, the correlations were greatly distorted in 2011 and in the spring season, particularly the correlations with AD days that were far below that of the correlations obtained for the whole study period. A possible explanation of these conflicting results is that a change in the dust source could appreciably alter the concentration, deposition, and distribution of airborne radionuclides

  6. Dust Dynamics Near Planetary Surfaces

    Science.gov (United States)

    Colwell, Joshua; Hughes, Anna; Grund, Chris

    streams observed by Apollo astronauts and potentially also by the Clementine spacecraft. In addition to the Surveyor images of lunar horizon glow and the high altitude streamer measurements, the Apollo 17 Lunar Ejecta and Meteorite surface package detected signals consistent with the impact of relatively slow-moving dust particles that may have been charged dust electrostatically levitated from the surface. There is renewed interest in this near-surface dust environment with plans to return robotic landers and astronauts to the lunar surface. No Apollo-era instruments were specifically designed to detect or measure dust levitated off the lunar surface. One new experiment under study is the Autonomous Lunar Dust Observer (ALDO). ALDO is a high-sensitivity scanning lidar (laser radar) that autonomously maps and records its 3-D dust environment. Flexibility of programmable scan pattern enables ALDO to characterize the dust context in and around experiment sites. Repeated shallow angle scans in a vertical plane enable high vertical resolution studies of dust levitation near the ground. Single elevation angle sector or full azimuth scans enable large-area statistical surveys of the frequency and size of ejecta plumes from micrometeoroid impacts, and vertical or fixed-angle stares enable very high sensitivity dust profiles to extended ranges. It is estimated that backscatter from dust concentrations as low as 1/cm3 can be measured. The concept is equally applicable to surface and atmospheric studies of other airless bodies.

  7. PERSPECTIVE: Dust, fertilization and sources

    Science.gov (United States)

    Remer, Lorraine A.

    2006-11-01

    fraction that arrives at another continent [2]. At the deposition end of the chain, it is still unclear how the limited minerals in the dust such as iron are released for uptake by organisms either on land or in the ocean. Not all dust deposited into oceans results in a phytoplankton bloom. The process requires a chemical pathway that mobilizes a fraction of the iron into soluble form. Meskhidze et al [3] show that phytoplankton blooms following dust transport from the Gobi desert in Asia into the Pacific ocean result in a phytoplankton bloom only if the dust is accompanied by high initial SO2-to-dust ratios, suggesting that sulfuric acid coatings on the dust particle mobilize the embedded iron in the dust for phytoplankton uptake. Quantifying transport, deposition and nutrient availability are the latter ends of a puzzle that must begin by identifying and quantifying dust emission at the sources. The emission process is complex at the microscale requiring the right conditions for saltation and bombardment, which makes identification and inclusion of sources in global transport models very difficult. The result is that estimates of annual global dust emissions range from 1000 to 3000 Tg per year [4]. Even as global estimates of dust emissions are uncertain, localizing the sources brings even greater uncertainty. It has been recognized for several years that dust sources are not uniformly distributed over the arid regions of the Earth, but are regulated to topographic lows associated with dried lake deposits [5]. Using aerosol information from satellites, a comprehensive map of the world's source regions shows sources localized to specific areas of the Earth's arid regions [6]. Still these maps suggest broad emission sources covering several degrees of latitude and longitude. In the paper by Koren and co-authors [7] appearing in this issue, one particular dust source, the Bodélé depression in Chad, is analyzed in detail. They find that the specific topography of the

  8. Translation and psychometric evaluation of Persian versions of Burn Specific Pain Anxiety Scale and Impact of Event Scale.

    Science.gov (United States)

    Ghezeljeh, Tahereh Najafi; Ardebili, Fatimah Mohades; Rafii, Forough; Hagani, Hamid

    2013-09-01

    Burn as a traumatic life incident manifests severe pain and psychological problems. Specific instruments are needed to evaluate burn patients' psychological issues related to the injury. The aim of this study was to translate and evaluate the reliability and validity of the Persian versions of Impact of Burn Specific Pain Anxiety scale (BSPAS) and Impact of Event Scale (IES). In this cross-sectional study, convenience sampling method was utilized to select 55 Iranian hospitalized burn patients. Combined translation was utilized for translating scales. Alpha cronbach, item-total correlation, convergent and discriminative validity were evaluated. The Cronbach's α for both BSPAS- and IES-Persian version was 0.96. Item-total correlation coefficients ranged from 0.70 to 0.90. Convergent construct validity was confirmed by indicating high correlation between the scales designed to measure the same concepts. The mean score of BSPAS- and IES-Persian version was lower for individuals with a lower TBSA burn percentage which assessed discriminative construct validity of scales. BSPAS- and IES-Persian version showed high internal consistency and good validity for the assessment of burn psychological outcome in hospitalized burn patients. Future studies are needed to determine repeatability, factor structure, sensitivity and specificity of the scales. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  9. Development and validation of an event-specific quantitative PCR method for genetically modified maize MIR162.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2014-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.

  10. Age-specific vibrissae growth rates: a tool for determining the timing of ecologically important events in Steller sea lions

    Science.gov (United States)

    Rea, L.D.; Christ, A.M.; Hayden, A.B.; Stegall, V.K.; Farley, S.D.; Stricker, Craig A.; Mellish, J.E.; Maniscalco, John M.; Waite, J.N.; Burkanov, V.N.; Pitcher, K.W.

    2015-01-01

    Steller sea lions (SSL; Eumetopias jubatus) grow their vibrissae continually, providing a multiyear record suitable for ecological and physiological studies based on stable isotopes. An accurate age-specific vibrissae growth rate is essential for registering a chronology along the length of the record, and for interpreting the timing of ecologically important events. We utilized four methods to estimate the growth rate of vibrissae in fetal, rookery pup, young-of-the-year (YOY), yearling, subadult, and adult SSL. The majority of vibrissae were collected from SSL live-captured in Alaska and Russia between 2000 and 2013 (n = 1,115), however, vibrissae were also collected from six adult SSL found dead on haul-outs and rookeries during field excursions to increase the sample size of this underrepresented age group. Growth rates of vibrissae were generally slower in adult (0.44 ± 0.15 cm/mo) and subadult (0.61 ± 0.10 cm/mo) SSL than in YOY (0.87 ± 0.28 cm/mo) and fetal (0.73 ± 0.05 cm/mo) animals, but there was high individual variability in these growth rates within each age group. Some variability in vibrissae growth rates was attributed to the somatic growth rate of YOY sea lions between capture events (P = 0.014, r2 = 0.206, n = 29).

  11. Do pre-drinkers consume more alcohol than non-pre-drinkers on an event-specific night out?

    DEFF Research Database (Denmark)

    Østergaard, Jeanette; Skov, Peter Rohde

    2014-01-01

    Introduction and Aims Young people drinking heavily before going out to bars and clubs is associated with alcohol-related harm and therefore of great public concern. This study examines whether pre-drinkers consume more alcohol than non-pre-drinkers on an event-specific night out in England...... demographics, socioeconomic status, frequency of intoxication and alcohol unit intake before and during the young people's night out. Results A mixed linear model performed on the panel mobile survey shows that pre-drinkers in England and Denmark consume 9.185 (P ..., respectively, more than the non-pre-drinkers. However, in both countries pre-drinkers consume 3.430 (P alcohol on-premises than the non-pre-drinkers. Discussion and Conclusion Pre-drinking is a widespread phenomenon in England and Denmark, with more than half of young...

  12. Background Predictors and Event-Specific Characteristics of Sexual Aggression Incidents: The Roles of Alcohol and Other Factors.

    Science.gov (United States)

    Davis, Kelly Cue; Danube, Cinnamon L; Stappenbeck, Cynthia A; Norris, Jeanette; George, William H

    2015-08-01

    Sexual assault in the United States is an important public health concern. Using prospective longitudinal methods and responses from 217 community men, we examined whether background characteristics predicted subsequent sexual aggression (SA) perpetration during a 3-month follow-up period. We also examined event-specific characteristics of reported SA occurrences. Consistent with predictions, SA perpetration history, aggressive and impulsive personality traits, rape myth attitudes, and alcohol expectancies predicted SA (both non- and alcohol-involved) at follow-up. In addition, alcohol-involved assaults occurred more often with casual (vs. steady) partners but were more likely to involve condom use with casual (vs. steady) partners. Results suggest important avenues for future research and SA prevention efforts. © The Author(s) 2015.

  13. Spring Dust Storm Smothers Beijing

    Science.gov (United States)

    2002-01-01

    A few days earlier than usual, a large, dense plume of dust blew southward and eastward from the desert plains of Mongolia-quite smothering to the residents of Beijing. Citizens of northeastern China call this annual event the 'shachenbao,' or 'dust cloud tempest.' However, the tempest normally occurs during the spring time. The dust storm hit Beijing on Friday night, March 15, and began coating everything with a fine, pale brown layer of grit. The region is quite dry; a problem some believe has been exacerbated by decades of deforestation. According to Chinese government estimates, roughly 1 million tons of desert dust and sand blow into Beijing each year. This true-color image was made using two adjacent swaths (click to see the full image) of data from the Sea-viewing Wide Field-of-view Sensor (SeaWiFS), flying aboard the OrbView-2 satellite, on March 17, 2002. The massive dust storm (brownish pixels) can easily be distinguished from clouds (bright white pixels) as it blows across northern Japan and eastward toward the open Pacific Ocean. The black regions are gaps between SeaWiFS' viewing swaths and represent areas where no data were collected. Image courtesy the SeaWiFS Project, NASA/Goddard Space Flight Center, and ORBIMAGE

  14. Inhibition of Rho kinase regulates specification of early differentiation events in P19 embryonal carcinoma stem cells.

    Directory of Open Access Journals (Sweden)

    Roman J Krawetz

    Full Text Available The Rho kinase pathway plays a key role in many early cell/tissue determination events that take place in embryogenesis. Rho and its downstream effector Rho kinase (ROCK play pivotal roles in cell migration, apoptosis (membrane blebbing, cell proliferation/cell cycle, cell-cell adhesion and gene regulation. We and others have previously demonstrated that inhibition of ROCK blocks endoderm differentiation in embryonal carcinoma stem cells, however, the effect of ROCK inhibition on mesoderm and ectoderm specification has not been fully examined. In this study, the role of ROCK within the specification and differentiation of all three germ layers was examined.P19 cells were treated with the specific ROCK inhibitor Y-27623, and increase in differentiation efficiency into neuro-ectodermal and mesodermal lineages was observed. However, as expected a dramatic decrease in early endodermal markers was observed when ROCK was inhibited. Interestingly, within these ROCK-inhibited RA treated cultures, increased levels of mesodermal or ectodermal markers were not observed, instead it was found that the pluripotent markers SSEA-1 and Oct-4 remained up-regulated similar to that seen in undifferentiated cultures. Using standard and widely accepted methods for reproducible P19 differentiation into all three germ layers, an enhancement of mesoderm and ectoderm differentiation with a concurrent loss of endoderm lineage specification was observed with Y-27632 treatment. Evidence would suggest that this effect is in part mediated through TGF-β and SMAD signaling as ROCK-inhibited cells displayed aberrant SMAD activation and did not return to a 'ground' state after the inhibition had been removed.Given this data and the fact that only a partial rescue of normal differentiation capacity occurred when ROCK inhibition was alleviated, the effect of ROCK inhibition on the differentiation capacity of pluripotent cell populations should be further examined to elucidate the

  15. House dust in seven Danish offices

    Science.gov (United States)

    Mølhave, L.; Schneider, T.; Kjærgaard, S. K.; Larsen, L.; Norn, S.; Jørgensen, O.

    Floor dust from Danish offices was collected and analyzed. The dust was to be used in an exposure experiment. The dust was analyzed to show the composition of the dust which can be a source of airborne dust indoors. About 11 kg of dust from vacuum cleaner bags from seven Danish office buildings with about 1047 occupants (12 751 m 2) was processed according to a standardized procedure yielding 5.5 kg of processed bulk dust. The bulk dust contained 130.000-160.000 CFU g -1 microorganisms and 71.000-90.000 CFU g -1 microfungi. The content of culturable microfungi was 65-123 CFU 30 g -1 dust. The content of endotoxins ranged from 5.06-7.24 EU g -1 (1.45 ng g -1 to 1.01 ng g -1). Allergens (ng g -1) were from 147-159 (Mite), 395-746 (dog) and 103-330 (cat). The macro molecular organic compounds (the MOD-content) varied from 7.8-9.8 mg g -1. The threshold of release of histamine from basophil leukocytes provoked by the bulk dust was between 0.3 and 1.0 mg ml -1. The water content was 2% (WGT) and the organic fraction 33%. 6.5-5.9% (dry) was water soluble. The fiber content was less than 0.2-1.5% (WGT) and the desorbable VOCs was 176-319 μg g -1. Most of the VOC were aldehydes. However, softeners for plastic (DBP and DEHP) were present. The chemical composition includes human and animal skin fragments, paper fibers, glass wool, wood and textilefibers and inorganic and metal particles. The sizes ranged from 0.001-1 mm and the average specific density was 1.0 g m -3. The bulk dust was resuspended and injected into an exposure chamber. The airborne dust was sampled and analyzed to illustrate the exposures that can result from sedimented dirt and dust. The airborne dust resulting from the bulk dust reached concentrations ranging from 0.26-0.75 mg m -3 in average contained 300-170 CFU m -3. The organic fraction was from 55-70% and the water content about 2.5% (WGT). The content of the dust was compared to the similar results reported in the literature and its toxic potency is

  16. Palaeo-dust records: A window to understanding past environments

    Science.gov (United States)

    Marx, Samuel K.; Kamber, Balz S.; McGowan, Hamish A.; Petherick, Lynda M.; McTainsh, Grant H.; Stromsoe, Nicola; Hooper, James N.; May, Jan-Hendrik

    2018-06-01

    Dust entrainment, transport over vast distances and subsequent deposition is a fundamental part of the Earth system. Yet the role and importance of dust has been underappreciated, due largely to challenges associated with recognising dust in the landscape and interpreting its depositional history. Despite these challenges, interest in dust is growing. Technical advances in remote sensing and modelling have improved understanding of dust sources and production, while advances in sedimentology, mineralogy and geochemistry (in particular) have allowed dust to be more easily distinguished within sedimentary deposits. This has facilitated the reconstruction of records of dust emissions through time. A key advance in our understanding of dust has occurred following the development of methods to geochemically provenance (fingerprint) dust to its source region. This ability has provided new information on dust transport pathways, as well as the reach and impact of dust. It has also expanded our understanding of the processes driving dust emissions over decadal to millennial timescales through linking dust deposits directly to source area conditions. Dust provenance studies have shown that dust emission, transport and deposition are highly sensitive to variability in climate. They also imply that dust emissions are not simply a function of the degree of aridity in source areas, but respond to a more complex array of conditions, including sediment availability. As well as recording natural variability, dust records are also shown to sensitively track the impact of human activity. This is reflected by both changing dust emission rates and changing dust chemistry. Specific examples of how dust responds to, and records change, are provided with our work on dust emissions from Australia, the most arid inhabited continent and the largest dust source in the Southern Hemisphere. These case studies show that Australian dust emissions reflect hydro-climate variability, with

  17. The Spatial Variation of Dust Particulate Matter Concentrations during Two Icelandic Dust Storms in 2015

    Directory of Open Access Journals (Sweden)

    Pavla Dagsson-Waldhauserova

    2016-06-01

    Full Text Available Particulate matter mass concentrations and size fractions of PM1, PM2.5, PM4, PM10, and PM15 measured in transversal horizontal profile of two dust storms in southwestern Iceland are presented. Images from a camera network were used to estimate the visibility and spatial extent of measured dust events. Numerical simulations were used to calculate the total dust flux from the sources as 180,000 and 280,000 tons for each storm. The mean PM15 concentrations inside of the dust plumes varied from 10 to 1600 µg·m−3 (PM10 = 7 to 583 µg·m−3. The mean PM1 concentrations were 97–241 µg·m−3 with a maximum of 261 µg·m−3 for the first storm. The PM1/PM2.5 ratios of >0.9 and PM1/PM10 ratios of 0.34–0.63 show that suspension of volcanic materials in Iceland causes air pollution with extremely high PM1 concentrations, similar to polluted urban areas in Europe or Asia. Icelandic volcanic dust consists of a higher proportion of submicron particles compared to crustal dust. Both dust storms occurred in relatively densely inhabited areas of Iceland. First results on size partitioning of Icelandic dust presented here should challenge health authorities to enhance research in relation to dust and shows the need for public dust warning systems.

  18. The Memory Is in the Details: Relations between Memory for the Specific Features of Events and Long-Term Recall during Infancy

    Science.gov (United States)

    Bauer, Patricia J.; Lukowski, Angela F.

    2010-01-01

    The second year of life is marked by pronounced changes in the length of time over which events are remembered. We tested whether the age-related differences are related to differences in memory for the specific features of events. In our study, 16- and 20-month-olds were tested for immediate and long-term recall of individual actions and temporal…

  19. Adverse Life Events and Psychopathology and Prosocial Behavior in Late Adolescence: Testing the Timing, Specificity, Accumulation, Gradient, and Moderation of Contextual Risk

    Science.gov (United States)

    Flouri, Eirini; Kallis, Constantinos

    2007-01-01

    A study examines the role of contextual risk in psychopathology and prosocial behavior in adolescents. The results show that risk accumulation matters instead of specificity and that the number of adverse life events is nonmultiplicative with psychopathology.

  20. Species-specific control of external superoxide levels by the coral holobiont during a natural bleaching event

    Science.gov (United States)

    Diaz, Julia M.; Hansel, Colleen M.; Apprill, Amy; Brighi, Caterina; Zhang, Tong; Weber, Laura; McNally, Sean; Xun, Liping

    2016-12-01

    The reactive oxygen species superoxide (O2.-) is both beneficial and detrimental to life. Within corals, superoxide may contribute to pathogen resistance but also bleaching, the loss of essential algal symbionts. Yet, the role of superoxide in coral health and physiology is not completely understood owing to a lack of direct in situ observations. By conducting field measurements of superoxide produced by corals during a bleaching event, we show substantial species-specific variation in external superoxide levels, which reflect the balance of production and degradation processes. Extracellular superoxide concentrations are independent of light, algal symbiont abundance and bleaching status, but depend on coral species and bacterial community composition. Furthermore, coral-derived superoxide concentrations ranged from levels below bulk seawater up to ~120 nM, some of the highest superoxide concentrations observed in marine systems. Overall, these results unveil the ability of corals and/or their microbiomes to regulate superoxide in their immediate surroundings, which suggests species-specific roles of superoxide in coral health and physiology.

  1. Long-term variability of dust-storms in Iceland

    Science.gov (United States)

    Dagsson-Waldhauserová, Pavla; Ólafsson, Haraldur; Arnalds, Ólafur

    2013-04-01

    Iceland is a volcanic island in the North Atlantic Ocean with maritime climate. In spite of moist climate, large areas are with limited vegetation cover where >40% of Iceland is classified with considerable to very severe erosion and 21% of Iceland are volcanic sandy deserts. Natural emissions from these sources influenced by strong winds affect not only regional air quality in Iceland ("Reykjavik haze") but dust particles are transported over the Atlantic ocean and Arctic Ocean > 1000 km at times. The study places Icelandic dust production area into international perspective, present long term frequency of dust storm events in NE Iceland, and estimate dust aerosol concentrations during reported dust events. Meteorological observations with dust presence codes and related visibility were used to identify the frequency and the long-term changes in dust production in NE Iceland. There were annually 16.4 days on average with reported dust observations on weather stations within the NE erosion area, indicating extreme dust plume activity and erosion within the NE deserts, even though the area is covered with snow during the major part of winter. During the 2000s the highest occurrence of dust events in six decades was reported. We have measured saltation and aeolian transport during dust/volcanic ash storms in Iceland which give some of the most intense wind erosion events ever measured. Icelandic dust affects the ecosystems over much of Iceland and causes regional haze. It is likely to affect the ecosystems of the oceans around Iceland, and it brings dust that lowers the albedo of the Icelandic glaciers, increasing melt-off due to global warming. The study indicates that Icelandic dust is not only a substantial source for regional air pollution, but may be considered to contribute to the Arctic haze phenomena and Arctic air pollution.

  2. Desert Dust Outbreaks over Mediterranean Basin: A Modeling, Observational, and Synoptic Analysis Approach

    Directory of Open Access Journals (Sweden)

    F. Calastrini

    2012-01-01

    Full Text Available Dust intrusions from African desert regions have an impact on the Mediterranean Basin (MB, as they cause an anomalous increase of aerosol concentrations in the tropospheric column and often an increase of particulate matter at the ground level. To estimate the Saharan dust contribution to PM10, a significant dust intrusion event that occurred in June 2006 is investigated, joining numerical simulations and specific measurements. As a first step, a synoptic analysis of this episode is performed. Such analysis, based only on meteorological and aerosol optical thickness observations, does not allow the assessment of exhaustive informations. In fact, it is not possible to distinguish dust outbreaks transported above the boundary layer without any impact at the ground level from those causing deposition. The approach proposed in this work applies an ad hoc model chain to describe emission, transport and deposition dynamics. Furthermore, physical and chemical analyses (PIXE analysis and ion chromatography were used to measure the concentration of all soil-related elements to quantify the contribution of dust particles to PM10. The comparison between simulation results and in-situ measurements show a satisfying agreement, and supports the effectiveness of the model chain to estimate the Saharan dust contribution at ground level.

  3. Characteristics of mineral dust impacting the Persian Gulf

    Science.gov (United States)

    Ahmady-Birgani, Hesam; McQueen, Kenneth G.; Mirnejad, Hassan

    2018-02-01

    It is generally assumed that severe dust events in western Iran could be responsible for elevated levels of toxic and radioactive elements in the region. Over a period of 5 months, from January 2012 to May 2012, dust particles in the size range PM10 (i.e. chemical compositions of dust and aerosol samples collected during the non-dusty periods and during two severe dust events. Results of ICP-MS analysis of components indicate that during dust events the concentrations of major elements such as Ca, Mg, Al and K increase relative to ambient conditions when Fe and trace elements such as Cu, Cr, Ni, Pb and Zn are in higher proportions. Toxic trace elements that are generally ascribed to human activities, including industrial and urban pollution, are thus proportionately more abundant in the dust under calm conditions than during dust events, when their concentration is diluted by more abundant mineral particles of quartz, calcite and clay. The variability of chemical species during two dust events, noted by tracking the dust plumes in satellite images, was also assessed and the results relate to two different source areas, namely northern Iraq and northwestern Syria.

  4. The Specific Role of Relationship Life Events in the Onset of Depression during Pregnancy and the Postpartum.

    Directory of Open Access Journals (Sweden)

    Nicola Wright

    Full Text Available The precipitating role of life events in the onset of depression is well-established. The present study sought to examine whether life events hypothesised to be personally salient would be more strongly associated with depression than other life events. In a sample of women making the first transition to parenthood, we hypothesised that negative events related to the partner relationship would be particularly salient and thus more strongly predictive of depression than other events.A community-based sample of 316 first-time mothers stratified by psychosocial risk completed interviews at 32 weeks gestation and 29 weeks postpartum to assess dated occurrence of life events and depression onsets from conception to 29 weeks postpartum. Complete data was available from 273 (86.4%. Cox proportional hazards regression was used to examine risk for onset of depression in the 6 months following a relationship event versus other events, after accounting for past history of depression and other potential confounders.52 women (19.0% experienced an onset of depression between conception and 6 months postpartum. Both relationship events (Hazard Ratio = 2.1, p = .001 and other life events (Hazard Ratio = 1.3, p = .020 were associated with increased risk for depression onset; however, relationship events showed a significantly greater risk for depression than did other life events (p = .044.The results are consistent with the hypothesis that personally salient events are more predictive of depression onset than other events. Further, they indicate the clinical significance of events related to the partner relationship during pregnancy and the postpartum.

  5. Characterization of atmospheric bioaerosols along the transport pathway of Asian dust during the Dust-Bioaerosol 2016 Campaign

    Science.gov (United States)

    Tang, Kai; Huang, Zhongwei; Huang, Jianping; Maki, Teruya; Zhang, Shuang; Shimizu, Atsushi; Ma, Xiaojun; Shi, Jinsen; Bi, Jianrong; Zhou, Tian; Wang, Guoyin; Zhang, Lei

    2018-05-01

    Previous studies have shown that bioaerosols are injected into the atmosphere during dust events. These bioaerosols may affect leeward ecosystems, human health, and agricultural productivity and may even induce climate change. However, bioaerosol dynamics have rarely been investigated along the transport pathway of Asian dust, especially in China where dust events affect huge areas and massive numbers of people. Given this situation, the Dust-Bioaerosol (DuBi) Campaign was carried out over northern China, and the effects of dust events on the amount and diversity of bioaerosols were investigated. The results indicate that the number of bacteria showed remarkable increases during the dust events, and the diversity of the bacterial communities also increased significantly, as determined by means of microscopic observations with 4,6-diamidino-2-phenylindole (DAPI) staining and MiSeq sequencing analysis. These results indicate that dust clouds can carry many bacteria of various types into downwind regions and may have potentially important impacts on ecological environments and climate change. The abundances of DAPI-stained bacteria in the dust samples were 1 to 2 orders of magnitude greater than those in the non-dust samples and reached 105-106 particles m-3. Moreover, the concentration ratios of DAPI-stained bacteria to yellow fluorescent particles increased from 5.1 % ± 6.3 % (non-dust samples) to 9.8 % ± 6.3 % (dust samples). A beta diversity analysis of the bacterial communities demonstrated the distinct clustering of separate prokaryotic communities in the dust and non-dust samples. Actinobacteria, Bacteroidetes, and Proteobacteria remained the dominant phyla in all samples. As for Erenhot, the relative abundances of Acidobacteria and Chloroflexi had a remarkable rise in dust events. In contrast, the relative abundances of Acidobacteria and Chloroflexi in non-dust samples of R-DzToUb were greater than those in dust samples. Alphaproteobacteria made the major

  6. The risk of a safety-critical event associated with mobile device use in specific driving contexts.

    Science.gov (United States)

    Fitch, Gregory M; Hanowski, Richard J; Guo, Feng

    2015-01-01

    We explored drivers' mobile device use and its associated risk of a safety-critical event (SCE) in specific driving contexts. Our premise was that the SCE risk associated with mobile device use increases when the driving task becomes demanding. Data from naturalistic driving studies involving commercial motor vehicle drivers and light vehicle drivers were partitioned into subsets representative of specific driving contexts. The subsets were generated using data set attributes that included level of service and relation to junction. These attributes were selected based on exogenous factors known to alter driving task demands. The subsets were analyzed using a case-cohort approach, which was selected to complement previous investigations of mobile device SCE risk using naturalistic driving data. Both commercial motor vehicle and light vehicle drivers varied as to how much they conversed on a mobile device but did not vary their engagement in visual-manual subtasks. Furthermore, commercial motor vehicle drivers conversed less frequently as the driving task demands increased, whereas light vehicle drivers did not. The risk of an SCE associated with mobile device use was dependent on the subtask performed and the driving context. Only visual-manual subtasks were associated with an increased SCE risk, whereas conversing was associated with a decreased risk in some driving contexts. Drivers' engagement in mobile device subtasks varies by driving context. The SCE risk associated with mobile device use is dependent on the types of subtasks performed and the driving context. The findings of this exploratory study can be applied to the design of driver-vehicle interfaces that mitigate distraction by preventing visual-manual subtasks while driving.

  7. A Compound-Specific Hydrogen Isotope Record at the Onset of Ocean Anoxic Event 2, Kaiparowits Plateau, Southern Utah

    Science.gov (United States)

    Todes, J.; Jones, M. M.; Sageman, B. B.; Osburn, M. R.

    2017-12-01

    Rhythmic lithologic variations (limestone-shale couplets) interpreted to reflect Milankovitch cycles occur at the onset of Ocean Anoxic Event 2 (OAE2) in deposits of the Western Interior Seaway. These couplets have been interpreted to reflect climate cycles: however, the physical mechanism(s) through which climate cycles were translated to the sedimentary record during peak greenhouse conditions remain unsettled. Although glacioeustasy has been considered, variance in surface ocean temperature, ocean circulation, or local hydrology may be more plausible options. Compound-specific hydrogen isotope ratios (δ2H) of n-alkanes and other biomarkers may provide a means to evaluate such mechanisms. Since sedimentary alkanes are direct products of plants and membrane lipid diagenesis and are resistant to secondary hydrogen exchange during thermal maturation at low (chain length distributions suggest low thermal maturity and the possible preservation of primary δ2H values. Short and long chain ­n-alkanes are potentially sourced from planktonic biomass and terrestrial plants, respectively, enabling a comparison of climatic processes between marine and terrestrial settings. Biomarkers, including both steranes and hopanes, are also preserved and reflect putative source organisms and local paleoenvironmental conditions. Facies-specific δ2H analysis will allow for evaluation of changes in the dominant source of atmospheric moisture in the Western Interior during orbitally-forced climate cycles. Organic matter deposited during periods of northerly Boreal influence would have a depleted 2H-isotope composition relative to those deposited during periods of more southerly Tethys influence. In this model, these variations are reflected by lithology - limestone deposition would occur during warm, evaporative Tethys-dominated times, while cooler, wetter Boreal periods would promote shale deposition.

  8. Intense dust episodes in the Mediterranean and possible effects on atmospheric lapse rates

    Science.gov (United States)

    Hatzianastassiou, Nikos; Gkikas, Antonis; Papadimas, Christos D.; Gavrouzou, Maria

    2016-04-01

    Dust aerosols are major contributor to the atmospheric particulate matter, having significant effects on climate and weather patterns as well as on human health, not to mention others like agriculture or ocean chlorophyll. Moreover, these effects are maximized under conditions of massive dust concentration in the atmosphere, namely dust episodes or events. Such events are caused by uplifting and transport of dust from arid and semi-arid areas under favorable synoptic conditions. The Mediterranean basin, nearby to the greatest world deserts of North Africa and Middle East, frequently undergoes dust episodes. During such Mediterranean episodes, the number and mass concentration of dust is high, due to the proximity of its source areas. The dust episodes, through the direct interaction of dust primarily withthe shortwave but also with longwave radiation can lead to strong local warming in the atmosphere, possibly causing temperature inversion during daytime. The existence of such temperature inversions, associated with intense dust episodes in the Mediterranean, is the focus in this study. The methodology followed to achieve the scientific goal of the study consists in the use of a synergy of different data. This synergy enables: (i) the determination of intense dust episodes over the Mediterranean, (ii) the investigation and specification of temperature lapse rates and inversions during the days of dust episodes and (iii) the identification of vertical distribution of aerosols in the atmosphere over specific locations during the days of the episodes. These objectives are achieved through the use of data from: (i) the AERosol Robotic NETwork (AERONET) network, (ii) the Upper Air Observations (radiosondes) database of the University of Wyoming (UoW) and (iii) the European Aerosol Research Lidar Network (EARLINET) database. The study period spans the years from 2000 to 2013, constrained by the data availability of the databases. A key element of the methodology is the

  9. Proton Pump Inhibitors and the Risk for Fracture at Specific Sites: Data Mining of the FDA Adverse Event Reporting System.

    Science.gov (United States)

    Wang, Liwei; Li, Mei; Cao, Yuying; Han, Zhengqi; Wang, Xueju; Atkinson, Elizabeth J; Liu, Hongfang; Amin, Shreyasee

    2017-07-17

    Proton pump inhibitors (PPIs) are widely used to treat gastric acid-related disorders. Concerns have been raised about potential fracture risk, especially at the hip, spine and wrist. However, fracture risk at other bone sites has not been as well studied. We investigated the association between PPIs and specific fracture sites using an aggregated knowledge-enhanced database, the Food and Drug Administration Adverse Event Reporting System Data Mining Set (AERS-DM). Proportional reporting ratio (PRR) was used to detect statistically significant associations (signals) between PPIs and fractures. We analyzed both high level terms (HLT) and preferred terms (PT) for fracture sites, defined by MedDRA (Medical Dictionary for Regulatory Activities). Of PPI users reporting fractures, the mean age was 65.3 years and the female to male ratio was 3.4:1. Results revealed signals at multiple HLT and PT fracture sites, consistent for both sexes. These included fracture sites with predominant trabecular bone, not previously reported as being associated with PPIs, such as 'rib fractures', where signals were detected for overall PPIs as well as for each of 5 generic ingredients (insufficient data for dexlansoprazole). Based on data mining from AERS-DM, PPI use appears to be associated with an increased risk for fractures at multiple sites.

  10. Assessments for the impact of mineral dust on the meningitis incidence in West Africa

    Science.gov (United States)

    Martiny, Nadège; Chiapello, Isabelle

    2013-05-01

    Recently, mineral dust has been suspected to be one of the important environmental risk factor for meningitis epidemics in West Africa. The current study is one of the first which relies on long-term robust aerosol measurements in the Sahel region to investigate the possible impact of mineral dust on meningitis cases (incidence). Sunphotometer measurements, which allow to derive aerosol and humidity parameters, i.e., aerosol optical thickness, Angström coefficient, and precipitable water, are combined with quantitative epidemiological data in Niger and Mali over the 2004-2009 AMMA (African Monsoon Multidisciplinary Analysis) program period. We analyse how the extremely high aerosol loads in this region may influence both the calendar (onset, peaks, end) and the intensity of meningitis. We highlight three distinct periods: (i) from November to December, beginning of the dry season, humidity is weak, there is no dust and no meningitis cases; (ii) from January to April, humidity is still weak, but high dust loads occur in the atmosphere and this is the meningitis season; (iii) from May to October, humidity is high and there is no meningitis anymore, in presence of dust or not, which flow anyway in higher altitudes. More specifically, the onset of the meningitis season is tightly related to mineral dust flowing close to the surface at the very beginning of the year. During the dry, and the most dusty season period, from February to April, each meningitis peak is preceded by a dust peak, with a 0-2 week lead-time. The importance (duration, intensity) of these meningitis peaks seems to be related to that of dust, suggesting that a cumulative effect in dust events may be important for the meningitis incidence. This is not the case for humidity, confirming the special contribution of dust at this period of the year. The end of the meningitis season, in May, coincides with a change in humidity conditions related to the West African Monsoon. These results, which are

  11. LADEE LUNAR DUST EXPERIMENT

    Data.gov (United States)

    National Aeronautics and Space Administration — This archive bundle includes data taken by the Lunar Dust Experiment (LDEX) instrument aboard the Lunar Atmosphere and Dust Environment Explorer (LADEE) spacecraft....

  12. Construction dust amelioration techniques.

    Science.gov (United States)

    2012-04-01

    Dust produced on seasonal road construction sites in Alaska is both a traffic safety and environmental concern. Dust emanating from : unpaved road surfaces during construction severely reduces visibility and impacts stopping sight distance, and contr...

  13. On Dust Charging Equation

    OpenAIRE

    Tsintsadze, Nodar L.; Tsintsadze, Levan N.

    2008-01-01

    A general derivation of the charging equation of a dust grain is presented, and indicated where and when it can be used. A problem of linear fluctuations of charges on the surface of the dust grain is discussed.

  14. Dust control at Yucca Mountain project

    International Nuclear Information System (INIS)

    Kissell, F.; Jurani, R.; Dresel, R.; Reaux, C.

    1999-01-01

    This report describes actions taken to control silica dust at the Yucca Mountain Exploratory Studies Facility, a tunnel located in Southern Nevada that is part of a scientific program to determine site suitability for a potential nuclear waste repository. The rock is a volcanic tuff containing significant percentages of both quartz and cristobalite. Water use for dust control was limited because of scientific test requirements, and this limitation made dust control a difficult task. Results are reported for two drifts, called the Main Loop Drift and the Cross Drift. In the Main Loop Drift, dust surveys and tracer gas tests indicated that air leakage from the TBM head, the primary ventilation duct, and movement of the conveyor belt were all significant sources of dust. Conventional dust control approaches yielded no significant reductions in dust levels. A novel alternative was to install an air cleaning station on a rear deck of the TBM trailing gear. It filtered dust from the contaminated intake air and discharged clean air towards the front of the TBM. The practical effect was to produce dust levels below the exposure limit for all TBM locations except close to the head. In the Cross Drift, better ventilation and an extra set of dust seals on the TBM served to cut down the leakage of dust from the TBM cutter head. However, the conveyor belt was much dustier than the belt in the main loop drift. The problem originated with dirt on the bottom of the belt return side and much spillage from the belt top side. Achieving lower dust levels in hard rock tunneling operations will require new approaches as well as a more meticulous application of existing technology. Planning for dust control will require specific means to deal with dust that leaks from the TBM head, dust that originates with leaky ventilation systems, and dust that comes from conveyor belts. Also, the application of water could be more efficient if automatic controls were used to adjust the water flow

  15. Physics of interstellar dust

    CERN Document Server

    Krugel, Endrik

    2002-01-01

    The dielectric permeability; How to evaluate grain cross sections; Very small and very big particles; Case studies of Mie calculus; Particle statistics; The radiative transition probability; Structure and composition of dust; Dust radiation; Dust and its environment; Polarization; Grain alignment; PAHs and spectral features of dust; Radiative transport; Diffuse matter in the Milky Way; Stars and their formation; Emission from young stars. Appendices Mathematical formulae; List of symbols.

  16. Dust as a surfactant

    International Nuclear Information System (INIS)

    Ignatov, A M; Schram, P P J M; Trigger, S A

    2003-01-01

    We argue that dust immersed in a plasma sheath acts as a surfactant. By considering the momentum balance in a plasma sheath, we evaluate the dependence of the plasma surface pressure on the dust density. It is shown that the dust may reduce the surface pressure, giving rise to a sufficiently strong tangential force. The latter is capable of confining the dust layer inside the sheath in the direction perpendicular to the ion flow

  17. Dust in Snow in the Colorado River Basin: Spatial Variability in Dust Concentrations, Radiative Forcing, and Snowmelt Rates

    Science.gov (United States)

    Skiles, M.; Painter, T.; Deems, J. S.; Landry, C.; Bryant, A.

    2012-12-01

    Since the disturbance of the western US that began with the Anglo settlement in the mid 19th century, the mountain snow cover of the Colorado River Basin (CRB) has been subject to five-fold greater dust loading. This dust deposition accelerates snowmelt through its direct reduction of albedo and its further reduction of albedo by accelerating the growth of snow effective grain size. We have previously quantified the impacts of dust in snow using a 6-year record of dust concentration and energy balance fluxes at the alpine and subalpine towers in the Senator Beck Basin Study Area (SBBSA), San Juan Mountains in southwestern Colorado, USA. Dust loading exhibited interannual variability, and end of year dust concentrations were not necessarily related to the number of dust deposition events. Radiative forcing enhanced springtime melt by 21 to 51 days with the magnitude of advanced loss being linearly related to total dust concentration at the end of snow cover. To expand our understanding of dust on snow deposition patterns we utilize collections of dust concentration at the Colorado Dust on Snow (CODOS) study sites, established in 2009 along the western side of the CRB, to assess spatial variability in dust loading. In situ sampling of dust stratigraphy and concentration occurs twice each season, once over peak snow water equivalent (15 April), and again during melt (15 May). Dust loading occurs at all sites; dust concentrations are always higher in May, vary between sites, and the highest and lowest dust years were 2009 and 2012, respectively. In the absence of regular sampling and energy balance instrumentation these sites do not allow us to quantify the advanced melt due to dust. To facilitate this a new energy balance site, Grand Mesa Study plot (GMSP), was established for water year 2010 in west central Colorado, 150 km north of SBBSA. Back trajectories indicate similar Colorado Plateau dust sources at both SBBSA and GMSP, yet GMSP exhibits slightly lower dust

  18. House Dust Mite Respiratory Allergy

    DEFF Research Database (Denmark)

    Calderón, Moisés A; Kleine-Tebbe, Jörg; Linneberg, Allan

    2015-01-01

    Although house dust mite (HDM) allergy is a major cause of respiratory allergic disease, specific diagnosis and effective treatment both present unresolved challenges. Guidelines for the treatment of allergic rhinitis and asthma are well supported in the literature, but specific evidence on the e......Although house dust mite (HDM) allergy is a major cause of respiratory allergic disease, specific diagnosis and effective treatment both present unresolved challenges. Guidelines for the treatment of allergic rhinitis and asthma are well supported in the literature, but specific evidence...... not extend beyond the end of treatment. Finally, allergen immunotherapy has a poor but improving evidence base (notably on sublingual tablets) and its benefits last after treatment ends. This review identifies needs for deeper physician knowledge on the extent and impact of HDM allergy in respiratory disease...... and therapy of HDM respiratory allergy in practice....

  19. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  20. The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method

    NARCIS (Netherlands)

    Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia

    2011-01-01

    Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the

  1. Cognitive Personality Characteristics Impact the Course of Depression: A Prospective Test of Sociotropy, Autonomy and Domain-Specific Life Events.

    Science.gov (United States)

    Iacoviello, Brian M; Grant, David A; Alloy, Lauren B; Abramson, Lyn Y

    2009-01-01

    Prospective tests of the impact of sociotropy and autonomy on the course of depression are lacking. In a sample of 97 cognitive high-risk and 62 cognitive low-risk undergraduates who experienced at least one prospective depressive episode, the interactions of sociotropy and interpersonal life events and autonomy and achievement-related life events were examined as predictors of four indicators of the course of depression. Initial analyses failed to support the hypothesis that global scores for sociotropy and autonomy interact with domain-congruent life events to predict the course indicators. The autonomy-achievement events interaction predicted less severe episodes, contrary to hypothesis. Then, factors hypothesized to underlie Sociotropy (Fear of Criticism and Rejection; Preference for Affiliation) and Autonomy were also analyzed. The puzzling autonomy-achievement life event interaction was explained by the underlying Independent Goal Attainment factor. Interactions between Fear of Criticism and Rejection and achievement events, and between Sensitivity to Others' Control and interpersonal events, significantly predicted chronicity, number and severity of episodes. The findings are discussed in terms of the event-congruency hypothesis.

  2. Near Real-Time Dust Aerosol Detection with Support Vector Machines for Regression

    Science.gov (United States)

    Rivas-Perea, P.; Rivas-Perea, P. E.; Cota-Ruiz, J.; Aragon Franco, R. A.

    2015-12-01

    Remote sensing instruments operating in the near-infrared spectrum usually provide the necessary information for further dust aerosol spectral analysis using statistical or machine learning algorithms. Such algorithms have proven to be effective in analyzing very specific case studies or dust events. However, very few make the analysis open to the public on a regular basis, fewer are designed specifically to operate in near real-time to higher resolutions, and almost none give a global daily coverage. In this research we investigated a large-scale approach to a machine learning algorithm called "support vector regression". The algorithm uses four near-infrared spectral bands from NASA MODIS instrument: B20 (3.66-3.84μm), B29 (8.40-8.70μm), B31 (10.78-11.28μm), and B32 (11.77-12.27μm). The algorithm is presented with ground truth from more than 30 distinct reported dust events, from different geographical regions, at different seasons, both over land and sea cover, in the presence of clouds and clear sky, and in the presence of fires. The purpose of our algorithm is to learn to distinguish the dust aerosols spectral signature from other spectral signatures, providing as output an estimate of the probability of a data point being consistent with dust aerosol signatures. During modeling with ground truth, our algorithm achieved more than 90% of accuracy, and the current live performance of the algorithm is remarkable. Moreover, our algorithm is currently operating in near real-time using NASA's Land, Atmosphere Near real-time Capability for EOS (LANCE) servers, providing a high resolution global overview including 64, 32, 16, 8, 4, 2, and 1km. The near real-time analysis of our algorithm is now available to the general public at http://dust.reev.us and archives of the results starting from 2012 are available upon request.

  3. Dust storms and their impact on ocean and human health: dust in Earth's atmosphere

    Science.gov (United States)

    Griffin, Dale W.; Kellog, Christina A.

    2004-01-01

    Satellite imagery has greatly influenced our understanding of dust activity on a global scale. A number of different satellites such as NASA's Earth-Probe Total Ozone Mapping Spectrometer (TOMS) and Se-viewing Field-of-view Sensor (SeaWiFS) acquire daily global-scale data used to produce imagery for monitoring dust storm formation and movement. This global-scale imagery has documented the frequent transmission of dust storm-derived soils through Earth's atmosphere and the magnitude of many of these events. While various research projects have been undertaken to understand this normal planetary process, little has been done to address its impact on ocean and human health. This review will address the ability of dust storms to influence marine microbial population densities and transport of soil-associated toxins and pathogenic microorganisms to marine environments. The implications of dust on ocean and human health in this emerging scientific field will be discussed.

  4. Accelerating Dust Storm Simulation by Balancing Task Allocation in Parallel Computing Environment

    Science.gov (United States)

    Gui, Z.; Yang, C.; XIA, J.; Huang, Q.; YU, M.

    2013-12-01

    Dust storm has serious negative impacts on environment, human health, and assets. The continuing global climate change has increased the frequency and intensity of dust storm in the past decades. To better understand and predict the distribution, intensity and structure of dust storm, a series of dust storm models have been developed, such as Dust Regional Atmospheric Model (DREAM), the NMM meteorological module (NMM-dust) and Chinese Unified Atmospheric Chemistry Environment for Dust (CUACE/Dust). The developments and applications of these models have contributed significantly to both scientific research and our daily life. However, dust storm simulation is a data and computing intensive process. Normally, a simulation for a single dust storm event may take several days or hours to run. It seriously impacts the timeliness of prediction and potential applications. To speed up the process, high performance computing is widely adopted. By partitioning a large study area into small subdomains according to their geographic location and executing them on different computing nodes in a parallel fashion, the computing performance can be significantly improved. Since spatiotemporal correlations exist in the geophysical process of dust storm simulation, each subdomain allocated to a node need to communicate with other geographically adjacent subdomains to exchange data. Inappropriate allocations may introduce imbalance task loads and unnecessary communications among computing nodes. Therefore, task allocation method is the key factor, which may impact the feasibility of the paralleling. The allocation algorithm needs to carefully leverage the computing cost and communication cost for each computing node to minimize total execution time and reduce overall communication cost for the entire system. This presentation introduces two algorithms for such allocation and compares them with evenly distributed allocation method. Specifically, 1) In order to get optimized solutions, a

  5. Identifying sources of aeolian mineral dust: Present and past

    Science.gov (United States)

    Muhs, Daniel R; Prospero, Joseph M; Baddock, Matthew C; Gill, Thomas E

    2014-01-01

    Aeolian mineral dust is an important component of the Earth’s environmental systems, playing roles in the planetary radiation balance, as a source of fertilizer for biota in both terrestrial and marine realms and as an archive for understanding atmospheric circulation and paleoclimate in the geologic past. Crucial to understanding all of these roles of dust is the identification of dust sources. Here we review the methods used to identify dust sources active at present and in the past. Contemporary dust sources, produced by both glaciogenic and non-glaciogenic processes, can be readily identified by the use of Earth-orbiting satellites. These data show that present dust sources are concentrated in a global dust belt that encompasses large topographic basins in low-latitude arid and semiarid regions. Geomorphic studies indicate that specific point sources for dust in this zone include dry or ephemeral lakes, intermittent stream courses, dune fields, and some bedrock surfaces. Back-trajectory analyses are also used to identify dust sources, through modeling of wind fields and the movement of air parcels over periods of several days. Identification of dust sources from the past requires novel approaches that are part of the geologic toolbox of provenance studies. Identification of most dust sources of the past requires the use of physical, mineralogical, geochemical, and isotopic analyses of dust deposits. Physical properties include systematic spatial changes in dust deposit thickness and particle size away from a source. Mineralogy and geochemistry can pinpoint dust sources by clay mineral ratios and Sc-Th-La abundances, respectively. The most commonly used isotopic methods utilize isotopes of Nd, Sr, and Pb and have been applied extensively in dust archives of deep-sea cores, ice cores, and loess. All these methods have shown that dust sources have changed over time, with far more abundant dust supplies existing during glacial periods. Greater dust supplies in

  6. Cognitive Personality Characteristics Impact the Course of Depression: A Prospective Test of Sociotropy, Autonomy and Domain-Specific Life Events

    OpenAIRE

    Iacoviello, Brian M.; Grant, David A.; Alloy, Lauren B.; Abramson, Lyn Y.

    2009-01-01

    Prospective tests of the impact of sociotropy and autonomy on the course of depression are lacking. In a sample of 97 cognitive high-risk and 62 cognitive low-risk undergraduates who experienced at least one prospective depressive episode, the interactions of sociotropy and interpersonal life events and autonomy and achievement-related life events were examined as predictors of four indicators of the course of depression. Initial analyses failed to support the hypothesis that global scores fo...

  7. Frequency and predictors of stroke after acute myocardial infarction: specific aspects of in-hospital and postdischarge events.

    Science.gov (United States)

    Hachet, Olivier; Guenancia, Charles; Stamboul, Karim; Daubail, Benoit; Richard, Carole; Béjot, Yannick; Yameogo, Valentin; Gudjoncik, Aurélie; Cottin, Yves; Giroud, Maurice; Lorgis, Luc

    2014-12-01

    . Finally, only 45 postdischarge strokes were recorded. Postdischarge stroke subtypes showed a more heterogeneous distribution of mechanisms. The annual rate of stroke post-AMI remained stable throughout the 10-year study period. The present study describes specific predictors of in-hospital and postdischarge stroke in patients with AMI. It showed a marked increase in the risk of death, both during hospitalization and in the year after AMI. After hospital discharge, stroke remains a rare event and is mostly associated with high cardiovascular risk. © 2014 American Heart Association, Inc.

  8. Levels of house dust mite-specific serum immunoglobulin E (IgE) in different cat populations using a monoclonal based anti-IgE enzyme-linked immunosorbent assay.

    Science.gov (United States)

    Bexley, Jennifer; Hogg, Janice E; Hammerberg, Bruce; Halliwell, Richard E W

    2009-10-01

    Levels of serum immunoglobulin E (IgE) specific for the house dust mites (HDMs) Dermatophagoides farinae (DF) and Dermatophagoides pteronyssinus (DP) in 58 cats with clinical signs suggestive of atopic dermatitis (allergic dermatitis cats), 52 cats with no history of allergic or immunological disease (nonallergic cats) and 26 specific pathogen-free (SPF) cats were measured using a monoclonal anti-IgE enzyme-linked immunosorbent assay. Reactivity to both native and reduced HDM allergens was compared. SPF cats had significantly lower levels of HDM-specific serum IgE than cats with allergic dermatitis and nonallergic cats. The difference in levels of HDM-specific IgE in the serum of cats with allergic dermatitis and nonallergic cats was significant for native DF allergen, but not for native DP allergen or reduced HDM allergens. The results suggest that DF in its native form may be a significant allergen in cats with allergic dermatitis. The clinical relevance of these reactions, however, remains to be proven.

  9. Pebble Bed Reactor Dust Production Model

    Energy Technology Data Exchange (ETDEWEB)

    Abderrafi M. Ougouag; Joshua J. Cogliati

    2008-09-01

    The operation of pebble bed reactors, including fuel circulation, can generate graphite dust, which in turn could be a concern for internal components; and to the near field in the remote event of a break in the coolant circuits. The design of the reactor system must, therefore, take the dust into account and the operation must include contingencies for dust removal and for mitigation of potential releases. Such planning requires a proper assessment of the dust inventory. This paper presents a predictive model of dust generation in an operating pebble bed with recirculating fuel. In this preliminary work the production model is based on the use of the assumption of proportionality between the dust production and the normal force and distance traveled. The model developed in this work uses the slip distances and the inter-pebble forces computed by the authors’ PEBBLES. The code, based on the discrete element method, simulates the relevant static and kinetic friction interactions between the pebbles as well as the recirculation of the pebbles through the reactor vessel. The interaction between pebbles and walls of the reactor vat is treated using the same approach. The amount of dust produced is proportional to the wear coefficient for adhesive wear (taken from literature) and to the slip volume, the product of the contact area and the slip distance. The paper will compare the predicted volume with the measured production rates. The simulation tallies the dust production based on the location of creation. Two peak production zones from intra pebble forces are predicted within the bed. The first zone is located near the pebble inlet chute due to the speed of the dropping pebbles. The second peak zone occurs lower in the reactor with increased pebble contact force due to the weight of supported pebbles. This paper presents the first use of a Discrete Element Method simulation of pebble bed dust production.

  10. Pebble Bed Reactor Dust Production Model

    International Nuclear Information System (INIS)

    Abderrafi M. Ougouag; Joshua J. Cogliati

    2008-01-01

    The operation of pebble bed reactors, including fuel circulation, can generate graphite dust, which in turn could be a concern for internal components; and to the near field in the remote event of a break in the coolant circuits. The design of the reactor system must, therefore, take the dust into account and the operation must include contingencies for dust removal and for mitigation of potential releases. Such planning requires a proper assessment of the dust inventory. This paper presents a predictive model of dust generation in an operating pebble bed with recirculating fuel. In this preliminary work the production model is based on the use of the assumption of proportionality between the dust production and the normal force and distance traveled. The model developed in this work uses the slip distances and the inter-pebble forces computed by the authors PEBBLES. The code, based on the discrete element method, simulates the relevant static and kinetic friction interactions between the pebbles as well as the recirculation of the pebbles through the reactor vessel. The interaction between pebbles and walls of the reactor vat is treated using the same approach. The amount of dust produced is proportional to the wear coefficient for adhesive wear (taken from literature) and to the slip volume, the product of the contact area and the slip distance. The paper will compare the predicted volume with the measured production rates. The simulation tallies the dust production based on the location of creation. Two peak production zones from intra pebble forces are predicted within the bed. The first zone is located near the pebble inlet chute due to the speed of the dropping pebbles. The second peak zone occurs lower in the reactor with increased pebble contact force due to the weight of supported pebbles. This paper presents the first use of a Discrete Element Method simulation of pebble bed dust production

  11. Variability of mineral dust deposition in the western Mediterranean basin and south-east of France

    Directory of Open Access Journals (Sweden)

    J. Vincent

    2016-07-01

    Full Text Available Previous studies have provided some insight into the Saharan dust deposition at a few specific locations from observations over long time periods or intensive field campaigns. However, no assessment of the dust deposition temporal variability in connection with its regional spatial distribution has been achieved so far from network observations over more than 1 year. To investigate dust deposition dynamics at the regional scale, five automatic deposition collectors named CARAGA (Collecteur Automatique de Retombées Atmosphériques insolubles à Grande Autonomie in French have been deployed in the western Mediterranean region during 1 to 3 years depending on the station. The sites include, from south to north, Lampedusa, Majorca, Corsica, Frioul and Le Casset (southern French Alps. Deposition measurements are performed on a common weekly period at the five sites. The mean dust deposition fluxes are higher close to the northern African coasts and decrease following a south–north gradient, with values from 7.4 g m−2 year−1 in Lampedusa (35°31′ N, 12°37′ E to 1 g m−2 year−1 in Le Casset (44°59′ N, 6°28′ E. The maximum deposition flux recorded is of 3.2 g m−2 wk−1 in Majorca with only two other events showing more than 1 g m−2 wk−1 in Lampedusa, and a maximum of 0.5 g m−2 wk−1 in Corsica. The maximum value of 2.1 g m−2 year−1 observed in Corsica in 2013 is much lower than existing records in the area over the 3 previous decades (11–14 g m−2 year−1. From the 537 available samples, 98 major Saharan dust deposition events have been identified in the records between 2011 and 2013. Complementary observations provided by both satellite and air mass trajectories are used to identify the dust provenance areas and the transport pathways from the Sahara to the stations for the studied period. Despite the large size of African dust plumes detected by satellites, more

  12. The Lunar Dust Environment

    Science.gov (United States)

    Szalay, Jamey Robert

    Planetary bodies throughout the solar system are continually bombarded by dust particles, largely originating from cometary activities and asteroidal collisions. Surfaces of bodies with thick atmospheres, such as Venus, Earth, Mars and Titan are mostly protected from incoming dust impacts as these particles ablate in their atmospheres as 'shooting stars'. However, the majority of bodies in the solar system have no appreciable atmosphere and their surfaces are directly exposed to the flux of high speed dust grains. Impacts onto solid surfaces in space generate charged and neutral gas clouds, as well as solid secondary ejecta dust particles. Gravitationally bound ejecta clouds forming dust exospheres were recognized by in situ dust instruments around the icy moons of Jupiter and Saturn, and had not yet been observed near bodies with refractory regolith surfaces before NASA's Lunar Dust and Environment Explorer (LADEE) mission. In this thesis, we first present the measurements taken by the Lunar Dust Explorer (LDEX), aboard LADEE, which discovered a permanently present, asymmetric dust cloud surrounding the Moon. The global characteristics of the lunar dust cloud are discussed as a function of a variety of variables such as altitude, solar longitude, local time, and lunar phase. These results are compared with models for lunar dust cloud generation. Second, we present an analysis of the groupings of impacts measured by LDEX, which represent detections of dense ejecta plumes above the lunar surface. These measurements are put in the context of understanding the response of the lunar surface to meteoroid bombardment and how to use other airless bodies in the solar system as detectors for their local meteoroid environment. Third, we present the first in-situ dust measurements taken over the lunar sunrise terminator. Having found no excess of small grains in this region, we discuss its implications for the putative population of electrostatically lofted dust.

  13. Scattering Phase Functions of Constituents of Mineral Dust Aerosols ...

    African Journals Online (AJOL)

    ... Montmorillonte, Hematite, Calcite and Quartz. The behaviour of these constituents as observed by their phase functions provide information on the optical properties and radiative effects of the mineral dust types and is therefore useful on regional and global scales in assessing radiative impacts of dust outbreak events.

  14. Anti-angiogenic-specific adverse events in patients with non-small cell lung cancer treated with nintedanib and docetaxel

    DEFF Research Database (Denmark)

    Reck, Martin; Mellemgaard, Anders; von Pawel, Joachim

    2015-01-01

    +docetaxel in the overall population and overall survival was significantly improved in the pre-specified analysis of patients with adenocarcinoma. We evaluated the frequency of characteristic adverse events (AEs) commonly seen with existing anti-angiogenic agents. MATERIALS AND METHODS: The incidence and intensity of AEs......, hypertension, bleeding, thromboembolic events, and skin disorders. RESULTS AND CONCLUSION: The incidence of patients with all-grade gastrointestinal (GI) perforations was low and balanced between arms (0.5% in both) and across histologies; the incidence of non-GI perforations was 1.2% with nintedanib......+docetaxel versus 0.2% with placebo+docetaxel. The incidence of some events was higher with nintedanib+docetaxel versus placebo+docetaxel; hypertension (3.5% vs 0.9%), rash (11.0% vs 8.1%), and cutaneous adverse reactions (13.0% vs 10.7%). Rash and cutaneous adverse reactions were predominantly Grade 1-2 with both...

  15. Drinking game play among first-year college student drinkers: an event-specific analysis of the risk for alcohol use and problems.

    Science.gov (United States)

    Ray, Anne E; Stapleton, Jerod L; Turrisi, Rob; Mun, Eun-Young

    2014-09-01

    College students who play drinking games (DGs) more frequently report higher levels of alcohol use and experience more alcohol-related harm. However, the extent to which they are at risk for increased consumption and harm as a result of DG play on a given event after accounting for their typical DG participation, and typical and event drinking, is unclear. We examined whether first-year students consumed more alcohol and were more likely to experience consequences on drinking occasions when they played DGs. Participants (n = 336) completed up to six web-based surveys following weekend drinking events in their first semester. Alcohol use, DG play, and consequences were reported for the Friday and Saturday prior to each survey. Typical DG tendencies were controlled in all models. Typical and event alcohol use were controlled in models predicting risk for consequences. Participants consumed more alcohol on DG versus non-DG events. All students were more likely to experience blackout drinking consequences when they played DGs. Women were more likely to experience social-interpersonal consequences when they played DGs. DG play is an event-specific risk factor for increased alcohol use among first-year students, regardless of individual DG play tendencies. Further, event DG play signals increased risk for blackout drinking consequences for all students, and social-interpersonal consequences for women, aside from the amount of alcohol consumed on those occasions as well as typical drinking behaviors. Prevention efforts to reduce high-risk drinking may be strengthened by highlighting both event- and person-specific risks of DG play.

  16. Monitoring of seismic events from a specific source region using a single regional array: A case study

    Science.gov (United States)

    Gibbons, S. J.; Kværna, T.; Ringdal, F.

    2005-07-01

    In the monitoring of earthquakes and nuclear explosions using a sparse worldwide network of seismic stations, it is frequently necessary to make reliable location estimates using a single seismic array. It is also desirable to screen out routine industrial explosions automatically in order that analyst resources are not wasted upon detections which can, with a high level of confidence, be associated with such a source. The Kovdor mine on the Kola Peninsula of NW Russia is the site of frequent industrial blasts which are well recorded by the ARCES regional seismic array at a distance of approximately 300 km. We describe here an automatic procedure for identifying signals which are likely to result from blasts at the Kovdor mine and, wherever possible, for obtaining single array locations for such events. Carefully calibrated processing parameters were chosen using measurements from confirmed events at the mine over a one-year period for which the operators supplied Ground Truth information. Phase arrival times are estimated using an autoregressive method and slowness and azimuth are estimated using broadband f{-} k analysis in fixed frequency bands and time-windows fixed relative to the initial P-onset time. We demonstrate the improvement to slowness estimates resulting from the use of fixed frequency bands. Events can be located using a single array if, in addition to the P-phase, at least one secondary phase is found with both an acceptable slowness estimate and valid onset-time estimate. We evaluate the on-line system over a twelve month period; every event known to have occured at the mine is detected by the process and 32 out of 53 confirmed events were located automatically. The remaining events were classified as “very likely” Kovdor events and were subsequently located by an analyst. The false alarm rate is low; only 84 very likely Kovdor events were identified during the whole of 2003 and none of these were subsequently located at a large distance from

  17. Hypervelocity dust particle impacts observed by the Giotto Magnetometer and Plasma Experiments

    OpenAIRE

    Neubauer, F. M.; Glassmeier, K. H.; Coates, A. J.; Goldstein, R.; Acuña, M. H.; Musmann, G.

    1990-01-01

    We report thirteen very short events in the magnetic field of the inner magnetic pile‐up region of comet Halley observed by the Giotto magnetometer experiment together with simultaneous plasma data obtained by the Johnstone plasma analyzer and the ion mass spectrometer experiments. The events are due to dust impacts in the milligram range on the spacecraft at the relative velocity between the cemetery dust and the spacecraft of 68 km/sec. They are generally consistent with dust impact events ...

  18. Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

    Science.gov (United States)

    Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-02-18

    In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

  19. Plant specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events

    International Nuclear Information System (INIS)

    2011-01-01

    The German Parliament requested (17 March 2011) a comprehensive inspection of German nuclear power plants. For this purpose independent expert commissions should perform a new risk analysis of all German NPPS and nuclear installations with respect to the lessons learned from the Fukushima (Japan) events and other extraordinary damage scenarios. The Reactor safety commission (RSK) was assigned by the German Bundesamt fuer Strahlenschutz to develop a catalogue of requirements for this safety inspection. The contribution summarizes the required inspection volume (status 30.03.2011) including the following events: natural events like earth quakes, floods, weather-based consequences and possible superposition. Additionally the following assumptions have to be considered: event independent postulated common failures or systematic faults, station blackout larger than 2 hours, long-term failure of the auxiliary cooling water supply; aggravating boundary conditions for the performance of emergency measures (non-availability of power supply), hydrogen generation and detonation hazard, restricted personnel availability, non-accessibility due to high radiation levels, impeded technical support from outside. (orig.)

  20. Density currents as a desert dust mobilization mechanism

    Directory of Open Access Journals (Sweden)

    S. Solomos

    2012-11-01

    Full Text Available The formation and propagation of density currents are well studied processes in fluid dynamics with many applications in other science fields. In the atmosphere, density currents are usually meso-β/γ phenomena and are often associated with storm downdrafts. These storms are responsible for the formation of severe dust episodes (haboobs over desert areas. In the present study, the formation of a convective cool pool and the associated dust mobilization are examined for a representative event over the western part of Sahara desert. The physical processes involved in the mobilization of dust are described with the use of the integrated atmospheric-air quality RAMS/ICLAMS model. Dust is effectively produced due to the development of near surface vortices and increased turbulent mixing along the frontal line. Increased dust emissions and recirculation of the elevated particles inside the head of the density current result in the formation of a moving "dust wall". Transport of the dust particles in higher layers – outside of the density current – occurs mainly in three ways: (1 Uplifting of preexisting dust over the frontal line with the aid of the strong updraft (2 Entrainment at the upper part of the density current head due to turbulent mixing (3 Vertical mixing after the dilution of the system. The role of the dust in the associated convective cloud system was found to be limited. Proper representation of convective processes and dust mobilization requires the use of high resolution (cloud resolving model configuration and online parameterization of dust production. Haboob-type dust storms are effective dust sources and should be treated accordingly in dust modeling applications.

  1. Dust Devil Tracks

    Science.gov (United States)

    2002-01-01

    (Released 8 May 2002) The Science This image, centered near 50.0 S and 17.7 W displays dust devil tracks on the surface. Most of the lighter portions of the image likely have a thin veneer of dust settled on the surface. As a dust devil passes over the surface, it acts as a vacuum and picks up the dust, leaving the darker substrate exposed. In this image there is a general trend of many of the tracks running from east to west or west to east, indicating the general wind direction. There is often no general trend present in dust devil tracks seen in other images. The track patterns are quite ephemeral and can completely change or even disappear over the course of a few months. Dust devils are one of the mechanisms that Mars uses to constantly pump dust into the ubiquitously dusty atmosphere. This atmospheric dust is one of the main driving forces of the present Martian climate. The Story Vrrrrooooooooom. Think of a tornado, the cartoon Tasmanian devil, or any number of vacuum commercials that powerfully suck up swirls of dust and dirt. That's pretty much what it's like on the surface of Mars a lot of the time. Whirlpools of wind called

  2. Comparison of the CAS-POL and IOM samplers for determining the knockdown efficiencies of water sprays on float coal dust.

    Science.gov (United States)

    Seaman, Clara E; Shahan, Michael R; Beck, Timothy W; Mischler, Steven E

    2018-03-01

    Float coal dust, generated by mining operations, is distributed throughout mine airways by ventilating air designed to purge gases and respirable dust. Float coal dust poses an explosion hazard in the event of a methane ignition. Current regulation requires the application of inert rock dust in areas subjected to float coal dust in order to mitigate the hazard. An alternate method using water sprays, which have been effective in controlling respirable dust hazards, has been proposed as a way to control float coal dust generated on longwall faces. However, the knockdown efficiency of the proposed water sprays on float coal dust needs to be verified. This study used gravimetric isokinetic Institute of Occupational Medicine (IOM) samplers alongside a real-time aerosol monitor (Cloud Aerosol Spectrometer with polarization; CAS-POL) to study the effects of spray type, operating pressure, and spray orientation on knockdown efficiencies for seven different water sprays. Because the CAS-POL has not been used to study mining dust, the CAS-POL measurements were validated with respect to the IOM samplers. This study found that the CAS-POL was able to resolve the same trends measured by the IOM samplers, while providing additional knockdown information for specific particle size ranges and locations in the test area. In addition, the CAS-POL data was not prone to the same process errors, which may occur due to the handling of the IOM filter media, and was able to provide a faster analysis of the data after testing. This study also determined that pressure was the leading design criteria influencing spray knockdown efficiency, with spray type also having some effect and orientation having little to no effect. The results of this study will be used to design future full-scale float coal dust capture tests involving multiple sprays, which will be evaluated using the CAS-POL.

  3. THE FORMATION OF THE PRIMITIVE STAR SDSS J102915+172927: EFFECT OF THE DUST MASS AND THE GRAIN-SIZE DISTRIBUTION

    International Nuclear Information System (INIS)

    Bovino, S.; Banerjee, R.; Grassi, T.; Schleicher, D. R. G.

    2016-01-01

    Understanding the formation of the extremely metal-poor star SDSS J102915+172927 is of fundamental importance to improve our knowledge on the transition between the first and second generation of stars in the universe. In this paper, we perform three-dimensional cosmological hydrodynamical simulations of dust-enriched halos during the early stages of the collapse process including a detailed treatment of the dust physics. We employ the astrochemistry package krome coupled with the hydrodynamical code enzo assuming grain-size distributions produced by the explosion of core-collapse supernovae (SNe) of 20 and 35 M ⊙ primordial stars, which are suitable to reproduce the chemical pattern of the SDSS J102915+172927 star. We find that the dust mass yield produced from Population III SNe explosions is the most important factor that drives the thermal evolution and the dynamical properties of the halos. Hence, for the specific distributions relevant in this context, the composition, the dust optical properties, and the size range have only minor effects on the results due to similar cooling functions. We also show that the critical dust mass to enable fragmentation provided by semi-analytical models should be revised, as we obtain values one order of magnitude larger. This determines the transition from disk fragmentation to a more filamentary fragmentation mode, and suggests that likely more than one single SN event or efficient dust growth should be invoked to get such high dust content.

  4. THE FORMATION OF THE PRIMITIVE STAR SDSS J102915+172927: EFFECT OF THE DUST MASS AND THE GRAIN-SIZE DISTRIBUTION

    Energy Technology Data Exchange (ETDEWEB)

    Bovino, S.; Banerjee, R. [Hamburger Sternwarte, Universität Hamburg, Gojenbergsweg 112, D-21029 Hamburg (Germany); Grassi, T. [Niels Bohr Institute and Centre for Star and Planet Formation, Øster Voldgade 5-7, DK-1350 Copenhagen (Denmark); Schleicher, D. R. G., E-mail: stefano.bovino@uni-hamburg.de [Departamento de Astronomía, Facultad Ciencias Físicas y Matemáticas, Universidad de Concepción, Av. Esteban Iturra s/n Barrio Universitario, Casilla 160, Concepción (Chile)

    2016-12-01

    Understanding the formation of the extremely metal-poor star SDSS J102915+172927 is of fundamental importance to improve our knowledge on the transition between the first and second generation of stars in the universe. In this paper, we perform three-dimensional cosmological hydrodynamical simulations of dust-enriched halos during the early stages of the collapse process including a detailed treatment of the dust physics. We employ the astrochemistry package krome coupled with the hydrodynamical code enzo assuming grain-size distributions produced by the explosion of core-collapse supernovae (SNe) of 20 and 35 M {sub ⊙} primordial stars, which are suitable to reproduce the chemical pattern of the SDSS J102915+172927 star. We find that the dust mass yield produced from Population III SNe explosions is the most important factor that drives the thermal evolution and the dynamical properties of the halos. Hence, for the specific distributions relevant in this context, the composition, the dust optical properties, and the size range have only minor effects on the results due to similar cooling functions. We also show that the critical dust mass to enable fragmentation provided by semi-analytical models should be revised, as we obtain values one order of magnitude larger. This determines the transition from disk fragmentation to a more filamentary fragmentation mode, and suggests that likely more than one single SN event or efficient dust growth should be invoked to get such high dust content.

  5. Earlier vegetation green-up has reduced spring dust storms.

    Science.gov (United States)

    Fan, Bihang; Guo, Li; Li, Ning; Chen, Jin; Lin, Henry; Zhang, Xiaoyang; Shen, Miaogen; Rao, Yuhan; Wang, Cong; Ma, Lei

    2014-10-24

    The observed decline of spring dust storms in Northeast Asia since the 1950s has been attributed to surface wind stilling. However, spring vegetation growth could also restrain dust storms through accumulating aboveground biomass and increasing surface roughness. To investigate the impacts of vegetation spring growth on dust storms, we examine the relationships between recorded spring dust storm outbreaks and satellite-derived vegetation green-up date in Inner Mongolia, Northern China from 1982 to 2008. We find a significant dampening effect of advanced vegetation growth on spring dust storms (r = 0.49, p = 0.01), with a one-day earlier green-up date corresponding to a decrease in annual spring dust storm outbreaks by 3%. Moreover, the higher correlation (r = 0.55, p storm outbreak ratio (the ratio of dust storm outbreaks to times of strong wind events) indicates that such effect is independent of changes in surface wind. Spatially, a negative correlation is detected between areas with advanced green-up dates and regional annual spring dust storms (r = -0.49, p = 0.01). This new insight is valuable for understanding dust storms dynamics under the changing climate. Our findings suggest that dust storms in Inner Mongolia will be further mitigated by the projected earlier vegetation green-up in the warming world.

  6. Whither Cometary Dust?

    Science.gov (United States)

    Lisse, Carey M.

    2010-10-01

    In this paper I will discuss recent findings that have important implications for our understanding of the formation and evolution of primitive solar system dust, including: - Nesvorny et al. (2010), following up on their dynamical analyses of the zodiacal dust bands as sourced by the breakup of the Karin (5Mya) and Veritas (8Mya) asteroid families, argue that over 90% of the interplanetary dust cloud at 1 AU comes from JFC comets with near-circularized, low inclination orbits. This implies that the noted IPD collections of anhydrous and hydrous dust particles are likely to be from Oort cloud and JFC comets, respectively, not from asteroids and comets as thought in the past. Hydrous dust particles from comets like 85P/Wild2 and 9P/Tempel 1 would be consistent with results from the STARDUST and Deep Impact experiments. - Estimates of the dust particle size distributions (PSDs) in the comae of 85P/Wild2 (Green et al. 2004, 2007) and 73P/SW-3 (Sitko et al. 2010, Vaubaillon & Reach 2010) and in the trails of comets (Reach et al. 2007) have broken power law structure, with a plateau enhancement of particles of 1 mm - 1 cm in size. This size is also the size of most chondritic inclusions, and the predicted size range of the "aggregational barrier", where collisions between dust particles become destructive. - Studies of the albedo and polarization properties of cometary dust (Kolokolova et al. 2007) suggest there are 2 major groupings, one with low scattering capability and one with high. While these families could possibly have been explained by systematics in the PSDs of the emitted dust, independent work by Lisse et al. (2008) on the mineralogy of a number of highly dusty comets has shown evidence for one family of comets with highly crystalline dust and another with highly amorphous dust.

  7. Change of the Asian dust source region deduced from the composition of anthropogenic radionuclides in surface soil in Mongolia

    Directory of Open Access Journals (Sweden)

    Y. Igarashi

    2011-07-01

    precipitation. These findings suggest that the increased specific activities and the activity ratio detected in atmospheric depositions in Japan during years with frequent Asian dust transport events in the 2000s are a sign of grassland degradation.

  8. Trapping Dust to Form Planets

    Science.gov (United States)

    Kohler, Susanna

    2017-10-01

    Growing a planet from a dust grain is hard work! A new study explores how vortices in protoplanetary disks can assist this process.When Dust Growth FailsTop: ALMA image of the protoplanetary disk of V1247 Orionis, with different emission components labeled. Bottom: Synthetic image constructed from the best-fit model. [Kraus et al. 2017]Gradual accretion onto a seed particle seems like a reasonable way to grow a planet from a grain of dust; after all, planetary embryos orbit within dusty protoplanetary disks, which provides them with plenty of fuel to accrete so they can grow. Theres a challenge to this picture, though: the radial drift problem.The radial drift problem acknowledges that, as growing dust grains orbit within the disk, the drag force on them continues to grow as well. For large enough dust grains perhaps around 1 millimeter the drag force will cause the grains orbits to decay, and the particles drift into the star before they are able to grow into planetesimals and planets.A Close-Up Look with ALMASo how do we overcome the radial drift problem in order to form planets? A commonly proposed mechanism is dust trapping, in which long-lived vortices in the disk trap the dust particles, preventing them from falling inwards. This allows the particles to persist for millions of years long enough to grow beyond the radial drift barrier.Observationally, these dust-trapping vortices should have signatures: we would expect to see, at millimeter wavelengths, specific bright, asymmetric structures where the trapping occurs in protoplanetary disks. Such disk structures have been difficult to spot with past instrumentation, but the Atacama Large Millimeter/submillimeter Array (ALMA) has made some new observations of the disk V1247 Orionis that might be just what were looking for.Schematic of the authors model for the disk of V1247 Orionis. [Kraus et al. 2017]Trapped in a Vortex?ALMAs observations of V1247 Orionis are reported by a team of scientists led by Stefan

  9. Dust in planetary nebulae

    International Nuclear Information System (INIS)

    Mathis, J.S.

    1978-01-01

    The author's review concentrates on theoretical aspects of dust in planetary nebulae (PN). He considers the questions: how much dust is there is PN; what is its composition; what effects does it have on the ionization structure, on the dynamics of the nebula. (Auth.)

  10. Toxicity of lunar dust

    NARCIS (Netherlands)

    Linnarsson, D.; Carpenter, J.; Fubini, B.; Gerde, P.; Loftus, D.; Prisk, K.; Staufer, U.; Tranfield, E.; van Westrenen, W.

    2012-01-01

    The formation, composition and physical properties of lunar dust are incompletely characterised with regard to human health. While the physical and chemical determinants of dust toxicity for materials such as asbestos, quartz, volcanic ashes and urban particulate matter have been the focus of

  11. Combustible dust tests

    Science.gov (United States)

    The sugar dust explosion in Georgia on February 7, 2008 killed 14 workers and injured many others (OSHA, 2009). As a consequence of this explosion, OSHA revised its Combustible Dust National Emphasis (NEP) program. The NEP targets 64 industries with more than 1,000 inspections and has found more tha...

  12. Short-term variability of mineral dust, metals and carbon emission from road dust resuspension

    Science.gov (United States)

    Amato, Fulvio; Schaap, Martijn; Denier van der Gon, Hugo A. C.; Pandolfi, Marco; Alastuey, Andrés; Keuken, Menno; Querol, Xavier

    2013-08-01

    Particulate matter (PM) pollution in cities has severe impact on morbidity and mortality of their population. In these cities, road dust resuspension contributes largely to PM and airborne heavy metals concentrations. However, the short-term variation of emission through resuspension is not well described in the air quality models, hampering a reliable description of air pollution and related health effects. In this study we experimentally show that the emission strength of resuspension varies widely among road dust components/sources. Our results offer the first experimental evidence of different emission rates for mineral dust, heavy metals and carbon fractions due to traffic-induced resuspension. Also, the same component (or source) recovers differently in a road in Barcelona (Spain) and a road in Utrecht (The Netherlands). This finding has important implications on atmospheric pollution modelling, mostly for mineral dust, heavy metals and carbon species. After rain events, recoveries were generally faster in Barcelona rather than in Utrecht. The largest difference was found for the mineral dust (Al, Si, Ca). Tyre wear particles (organic carbon and zinc) recovered faster than other road dust particles in both cities. The source apportionment of road dust mass provides useful information for air quality management.

  13. Non-monotonic spatial distribution of the interstellar dust in astrospheres: finite gyroradius effect

    Science.gov (United States)

    Katushkina, O. A.; Alexashov, D. B.; Izmodenov, V. V.; Gvaramadze, V. V.

    2017-02-01

    High-resolution mid-infrared observations of astrospheres show that many of them have filamentary (cirrus-like) structure. Using numerical models of dust dynamics in astrospheres, we suggest that their filamentary structure might be related to specific spatial distribution of the interstellar dust around the stars, caused by a gyrorotation of charged dust grains in the interstellar magnetic field. Our numerical model describes the dust dynamics in astrospheres under an influence of the Lorentz force and assumption of a constant dust charge. Calculations are performed for the dust grains with different sizes separately. It is shown that non-monotonic spatial dust distribution (viewed as filaments) appears for dust grains with the period of gyromotion comparable with the characteristic time-scale of the dust motion in the astrosphere. Numerical modelling demonstrates that the number of filaments depends on charge-to-mass ratio of dust.

  14. Respirable dust measured downwind during rock dust application.

    Science.gov (United States)

    Harris, M L; Organiscak, J; Klima, S; Perera, I E

    2017-05-01

    The Pittsburgh Mining Research Division of the U.S. National Institute for Occupational Safety and Health (NIOSH) conducted underground evaluations in an attempt to quantify respirable rock dust generation when using untreated rock dust and rock dust treated with an anticaking additive. Using personal dust monitors, these evaluations measured respirable rock dust levels arising from a flinger-type application of rock dust on rib and roof surfaces. Rock dust with a majority of the respirable component removed was also applied in NIOSH's Bruceton Experimental Mine using a bantam duster. The respirable dust measurements obtained downwind from both of these tests are presented and discussed. This testing did not measure miners' exposure to respirable coal mine dust under acceptable mining practices, but indicates the need for effective continuous administrative controls to be exercised when rock dusting to minimize the measured amount of rock dust in the sampling device.

  15. Lunar Dust Mitigation Screens

    Science.gov (United States)

    Knutson, Shawn; Holloway, Nancy

    With plans for the United States to return to the moon, and establish a sustainable human presence on the lunar surface many issues must be successfully overcome. Lunar dust is one of a number of issues with the potential to create a myriad of problems if not adequately addressed. Samples of dust brought back from Apollo missions show it to be soft, yet sharp and abrasive. The dust consists of a variety of morphologies including spherical, angular blocks, shards, and a number of irregular shapes. One of the main issues with lunar dust is its attraction to stick to anything it comes in contact with (i.e. astronauts, equipment, habitats, etc.). Ionized radiation from the sun strikes the moon's surface and creates an electrostatic charge on the dust. Further, the dust harbors van der Waals forces making it especially difficult to separate once it sticks to a surface. During the Apollo missions, it was discovered that trying to brush the lunar dust from spacesuits was not effective, and rubbing it caused degradation of the suit material. Further, when entering the lunar module after moonwalks, the astronauts noted that the dust was so prolific inside the cabin that they inhaled and ingested it, causing at least one of them, Harrison "Jack" Schmidt, to report irritation of the throat and lungs. It is speculated that the dust could also harm an astronaut's nervous and cardiovascular systems, especially during an extended stay. In addition to health issues, the dust can also cause problems by scouring reflective coatings off of thermal blankets, and roughening surfaces of windows and optics. Further, panels on solar cells and photovoltaics can also be compromised due to dust sticking on the surfaces. Lunar dust has the capacity to penetrate seals, interfere with connectors, as well as mechanisms on digging machines, all of which can lead to problems and failure. To address lunar dust issues, development of electrostatic screens to mitigate dust on sur-faces is currently

  16. Contribution of hydrological data to the understanding of the spatio-temporal dynamics of F-specific RNA bacteriophages in river water during rainfall-runoff events.

    Science.gov (United States)

    Fauvel, Blandine; Cauchie, Henry-Michel; Gantzer, Christophe; Ogorzaly, Leslie

    2016-05-01

    Heavy rainfall events were previously reported to bring large amounts of microorganisms in surface water, including viruses. However, little information is available on the origin and transport of viral particles in water during such rain events. In this study, an integrative approach combining microbiological and hydrological measurements was investigated to appreciate the dynamics and origins of F-specific RNA bacteriophage fluxes during two distinct rainfall-runoff events. A high frequency sampling (automatic sampler) was set up to monitor the F-specific RNA bacteriophages fluxes at a fine temporal scale during the whole course of the rainfall-runoff events. A total of 276 rainfall-runoff samples were collected and analysed using both infectivity and RT-qPCR assays. The results highlight an increase of 2.5 log10 and 1.8 log10 of infectious F-specific RNA bacteriophage fluxes in parallel of an increase of the water flow levels for both events. Faecal pollution was characterised as being mainly from anthropic origin with a significant flux of phage particles belonging to the genogroup II. At the temporal scale, two successive distinct waves of phage pollution were established and identified through the hydrological measurements. The first arrival of phages in the water column was likely to be linked to the resuspension of riverbed sediments that was responsible for a high input of genogroup II. Surface runoff contributed further to the second input of phages, and more particularly of genogroup I. In addition, an important contribution of infectious phage particles has been highlighted. These findings imply the existence of a close relationship between the risk for human health and the viral contamination of flood water. Copyright © 2016 Luxembourg institute of Science and Technology. Published by Elsevier Ltd.. All rights reserved.

  17. Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

    Science.gov (United States)

    Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2013-05-01

    In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

  18. Detection of magnetic-labeled antibody specific recognition events by combined atomic force and magnetic force microscopy

    International Nuclear Information System (INIS)

    Hong Xia; Liu Yanmei; Li Jun; Guo Wei; Bai Yubai

    2009-01-01

    Atomic force (AFM) and magnetic force microscopy (MFM) were developed to detect biomolecular specific interaction. Goat anti-mouse immunoglobulin (anti-IgG) was covalently attached onto gold substrate modified by a self-assembly monolayer of thioctic acid via 1-ethyl-3-[3-(dimethylamino) propyl] carbodiimide (EDC) activation. Magnetic-labeled IgG then specifically adsorbed onto anti-IgG surface. The morphological variation was identified by AFM. MFM was proved to be a fine assistant tool to distinguish the immunorecognized nanocomposites from the impurities by detection of the magnetic signal from magnetic-labeled IgG. It would enhance the understanding of biomolecular recognition process.

  19. Detection of magnetic-labeled antibody specific recognition events by combined atomic force and magnetic force microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Hong Xia [Center for Advanced Optoelectronic Functional Materials Research, Key Laboratory of UV Light-Emitting Materials and Technology, Ministry of Education, Northeast Normal University, Changchun 130024 (China); College of Chemistry, Jilin University, Changchun 130023 (China)], E-mail: xiahong@nenu.edu.cn; Liu Yanmei; Li Jun; Guo Wei; Bai Yubai [College of Chemistry, Jilin University, Changchun 130023 (China)

    2009-09-15

    Atomic force (AFM) and magnetic force microscopy (MFM) were developed to detect biomolecular specific interaction. Goat anti-mouse immunoglobulin (anti-IgG) was covalently attached onto gold substrate modified by a self-assembly monolayer of thioctic acid via 1-ethyl-3-[3-(dimethylamino) propyl] carbodiimide (EDC) activation. Magnetic-labeled IgG then specifically adsorbed onto anti-IgG surface. The morphological variation was identified by AFM. MFM was proved to be a fine assistant tool to distinguish the immunorecognized nanocomposites from the impurities by detection of the magnetic signal from magnetic-labeled IgG. It would enhance the understanding of biomolecular recognition process.

  20. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    Science.gov (United States)

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  1. Quality assurance ofallergen-specific immunotherapy during a national outbreak of anaphylaxis: results of a continuous sentinel event surveillance system

    DEFF Research Database (Denmark)

    Madsen, F; Frølund, L; Christensen, M

    2009-01-01

    BACKGROUND AND OBJECTIVE: Subcutaneous allergen-specific immunotherapy (SCIT) is an effective treatment for patients with allergic asthma and rhinitis. SCIT may be performed in many different ways and good safety profiles have been published. Other studies, however, have reported high frequencies...

  2. The specificity of childhood adversities and negative life events across the life span to anxiety and depressive disorders

    NARCIS (Netherlands)

    Spinhoven, Philip; Elzinga, Bernet M.; Hovens, Jacqueline G. F. M.; Roelofs, Karin; Zitman, Frans G.; van Oppen, Patricia; Penninx, Brenda W. J. H.

    2010-01-01

    Background: Although several studies have shown that life adversities play an important role in the etiology and maintenance of both depressive and anxiety disorders, little is known about the relative specificity of several types of life adversities to different forms of depressive and anxiety

  3. Quantifying Anthropogenic Dust Emissions

    Science.gov (United States)

    Webb, Nicholas P.; Pierre, Caroline

    2018-02-01

    Anthropogenic land use and land cover change, including local environmental disturbances, moderate rates of wind-driven soil erosion and dust emission. These human-dust cycle interactions impact ecosystems and agricultural production, air quality, human health, biogeochemical cycles, and climate. While the impacts of land use activities and land management on aeolian processes can be profound, the interactions are often complex and assessments of anthropogenic dust loads at all scales remain highly uncertain. Here, we critically review the drivers of anthropogenic dust emission and current evaluation approaches. We then identify and describe opportunities to: (1) develop new conceptual frameworks and interdisciplinary approaches that draw on ecological state-and-transition models to improve the accuracy and relevance of assessments of anthropogenic dust emissions; (2) improve model fidelity and capacity for change detection to quantify anthropogenic impacts on aeolian processes; and (3) enhance field research and monitoring networks to support dust model applications to evaluate the impacts of disturbance processes on local to global-scale wind erosion and dust emissions.

  4. Absence of direction-specific cross-modal visual-auditory adaptation in motion-onset event-related potentials.

    Science.gov (United States)

    Grzeschik, Ramona; Lewald, Jörg; Verhey, Jesko L; Hoffmann, Michael B; Getzmann, Stephan

    2016-01-01

    Adaptation to visual or auditory motion affects within-modality motion processing as reflected by visual or auditory free-field motion-onset evoked potentials (VEPs, AEPs). Here, a visual-auditory motion adaptation paradigm was used to investigate the effect of visual motion adaptation on VEPs and AEPs to leftward motion-onset test stimuli. Effects of visual adaptation to (i) scattered light flashes, and motion in the (ii) same or in the (iii) opposite direction of the test stimulus were compared. For the motion-onset VEPs, i.e. the intra-modal adaptation conditions, direction-specific adaptation was observed--the change-N2 (cN2) and change-P2 (cP2) amplitudes were significantly smaller after motion adaptation in the same than in the opposite direction. For the motion-onset AEPs, i.e. the cross-modal adaptation condition, there was an effect of motion history only in the change-P1 (cP1), and this effect was not direction-specific--cP1 was smaller after scatter than after motion adaptation to either direction. No effects were found for later components of motion-onset AEPs. While the VEP results provided clear evidence for the existence of a direction-specific effect of motion adaptation within the visual modality, the AEP findings suggested merely a motion-related, but not a direction-specific effect. In conclusion, the adaptation of veridical auditory motion detectors by visual motion is not reflected by the AEPs of the present study. © 2015 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  5. Long-term dust aerosol production from natural sources in Iceland.

    Science.gov (United States)

    Dagsson-Waldhauserova, Pavla; Arnalds, Olafur; Olafsson, Haraldur

    2017-02-01

    Iceland is a volcanic island in the North Atlantic Ocean with maritime climate. In spite of moist climate, large areas are with limited vegetation cover where >40% of Iceland is classified with considerable to very severe erosion and 21% of Iceland is volcanic sandy deserts. Not only do natural emissions from these sources influenced by strong winds affect regional air quality in Iceland ("Reykjavik haze"), but dust particles are transported over the Atlantic ocean and Arctic Ocean >1000 km at times. The aim of this paper is to place Icelandic dust production area into international perspective, present long-term frequency of dust storm events in northeast Iceland, and estimate dust aerosol concentrations during reported dust events. Meteorological observations with dust presence codes and related visibility were used to identify the frequency and the long-term changes in dust production in northeast Iceland. There were annually 16.4 days on average with reported dust observations on weather stations within the northeastern erosion area, indicating extreme dust plume activity and erosion within the northeastern deserts, even though the area is covered with snow during the major part of winter. During the 2000s the highest occurrence of dust events in six decades was reported. We have measured saltation and Aeolian transport during dust/volcanic ash storms in Iceland, which give some of the most intense wind erosion events ever measured. Icelandic dust affects the ecosystems over much of Iceland and causes regional haze. It is likely to affect the ecosystems of the oceans around Iceland, and it brings dust that lowers the albedo of the Icelandic glaciers, increasing melt-off due to global warming. The study indicates that Icelandic dust may contribute to the Arctic air pollution. Long-term records of meteorological dust observations from Northeast Iceland indicate the frequency of dust events from Icelandic deserts. The research involves a 60-year period and

  6. Spirit Feels Dust Gust

    Science.gov (United States)

    2007-01-01

    On sol 1149 (March 28, 2007) of its mission, NASA's Mars Exploration Rover Spirit caught a wind gust with its navigation camera. A series of navigation camera images were strung together to create this movie. The front of the gust is observable because it was strong enough to lift up dust. From assessing the trajectory of this gust, the atmospheric science team concludes that it is possible that it passed over the rover. There was, however, no noticeable increase in power associated with this gust. In the past, dust devils and gusts have wiped the solar panels of dust, making it easier for the solar panels to absorb sunlight.

  7. Dust Storms from Degraded Drylands of Asia: Dynamics and Health Impacts

    Directory of Open Access Journals (Sweden)

    Shinji Otani

    2017-11-01

    Full Text Available Asian dust events are massive meteorological phenomena during which dust particles from Chinese and Mongolian deserts are blown into the atmosphere and carried by westerly winds across Northeast Asia. Recently, there has been steady increase in both the frequency and the severity of Asian atmospheric dust events. Concern has been expressed regarding the potential health hazards in affected areas. The principal nature of the damage associated with Asian dust events differs between the emission (sandstorm and downwind (air pollution regions. In the emission region, the health impacts of dust storms are reflected in the high prevalence of respiratory diseases and severe subjective symptoms. Extreme dust storm events may cause a disaster to happen. In downwind regions such as Japan, analysis of Asian dust particles has shown the presence of ammonium ions, sulfate ions, nitrate ions, and heavy metal compounds that are considered not to originate from soil. Asian dust particles have been thought to adsorb anthropogenic atmospheric pollutants during transport. Therefore, Asian dust events coincide with increases in daily hospital admissions and clinical visits for allergic diseases such as asthma, allergic rhinitis, and conjunctivitis. Although the effect of Asian dust on human health in each region is influenced by a variety of different mechanisms, human activities are partly responsible for such negative effects in many situations. We therefore need to address these environmental problems.

  8. The Tranisiting Dust of Boyajian's Star

    Science.gov (United States)

    Bodman, Eva; Ellis, Tyler G.; Boyajian, Tabetha S.; Wright, Jason

    2018-06-01

    From May to October of 2017, Boyajian's Star displayed four days-long dips in observed flux, which are referred to as “Elsie,” “Celeste,” “Skara Brae,” and “Angkor” (Boyajian et al. 2018). This Elsie family dip event was monitored with the Las Cumbres Observatory in three bands, B, r', and i'. Looking at each dip individually, we analyze the multi-band photometry for wavelength dependency in dip depth to constrain properties of the transiting material. We find that all of the dips show non-grey extinction and are consistent with optically thin dust. Interpreting the dips as transiting dust clouds, we constrain the properties of the dust grains and find that the average grain radius is causing the dips is from a separate population.

  9. Peach leaf responses to soil and cement dust pollution.

    Science.gov (United States)

    Maletsika, Persefoni A; Nanos, George D; Stavroulakis, George G

    2015-10-01

    Dust pollution can negatively affect plant productivity in hot, dry and with high irradiance areas during summer. Soil or cement dust were applied on peach trees growing in a Mediterranean area with the above climatic characteristics. Soil and cement dust accumulation onto the leaves decreased the photosynthetically active radiation (PAR) available to the leaves without causing any shade effect. Soil and mainly cement dust deposition onto the leaves decreased stomatal conductance, photosynthetic and transpiration rates, and water use efficiency due possibly to stomatal blockage and other leaf cellular effects. In early autumn, rain events removed soil dust and leaf functions partly recovered, while cement dust created a crust partially remaining onto the leaves and causing more permanent stress. Leaf characteristics were differentially affected by the two dusts studied due to their different hydraulic properties. Leaf total chlorophyll decreased and total phenol content increased with dust accumulation late in the summer compared to control leaves due to intense oxidative stress. The two dusts did not cause serious metal imbalances to the leaves, except of lower leaf K content.

  10. WRF-Chem Model Simulations of Arizona Dust Storms

    Science.gov (United States)

    Mohebbi, A.; Chang, H. I.; Hondula, D.

    2017-12-01

    The online Weather Research and Forecasting model with coupled chemistry module (WRF-Chem) is applied to simulate the transport, deposition and emission of the dust aerosols in an intense dust outbreak event that took place on July 5th, 2011 over Arizona. Goddard Chemistry Aerosol Radiation and Transport (GOCART), Air Force Weather Agency (AFWA), and University of Cologne (UoC) parameterization schemes for dust emission were evaluated. The model was found to simulate well the synoptic meteorological conditions also widely documented in previous studies. The chemistry module performance in reproducing the atmospheric desert dust load was evaluated using the horizontal field of the Aerosol Optical Depth (AOD) from Moderate Resolution Imaging Spectro (MODIS) radiometer Terra/Aqua and Aerosol Robotic Network (AERONET) satellites employing standard Dark Target (DT) and Deep Blue (DB) algorithms. To assess the temporal variability of the dust storm, Particulate Matter mass concentration data (PM10 and PM2.5) from Arizona Department of Environmental Quality (AZDEQ) ground-based air quality stations were used. The promising performance of WRF-Chem indicate that the model is capable of simulating the right timing and loading of a dust event in the planetary-boundary-layer (PBL) which can be used to forecast approaching severe dust events and to communicate an effective early warning.

  11. Assessment of respirable dust exposures in an opencast coal mine.

    Science.gov (United States)

    Onder, M; Yigit, E

    2009-05-01

    All major opencast mining activities produce dust. The major operations that produce dust are drilling, blasting, loading, unloading, and transporting. Dust not only deteriorates the environmental air quality in and around the mining site but also creates serious health hazards. Therefore, assessment of dust levels that arise from various opencast mining operations is required to prevent and minimize the health risks. To achieve this objective, an opencast coal mining area was selected to generate site-specific emission data and collect respirable dust measurement samples. The study covered various mining activities in different locations including overburden loading, stock yard, coal loading, drilling, and coal handling plant. The dust levels were examined to assess miners' exposure to respirable dust in each of the opencast mining areas from 1994 to 2005. The data obtained from the dust measurement studies were evaluated by using analysis of variance (ANOVA) and the Tukey-Kramer procedure. The analyses were performed by using Minitab 14 statistical software. It was concluded that, drilling operations produce higher dust concentration levels and thus, drill operators may have higher incidence of respiratory disorders related to exposure to dust in their work environment.

  12. Galactic dust and extinction

    International Nuclear Information System (INIS)

    Lyngaa, G.

    1979-01-01

    The ratio R between visual extinction and colour excess, is slightly larger than 3 and does not vary much throughout our part of the Galaxy. The distribution of dust in the galactic plane shows, on the large scale, a gradient with higher colour excesses towards l=50 0 than towards l=230 0 . On the smaller scale, much of the dust responsible for extinction is situated in clouds which tend to group together. The correlation between positions of interstellar dust clouds and positions of spiral tracers seems rather poor in our Galaxy. However, concentrated dark clouds as well as extended regions of dust show an inclined distribution similar to the Gould belt of bright stars. (Auth.)

  13. Strength Characteristics of Quarry Dust in Replacement of Sand

    Science.gov (United States)

    Shyam Prakash, K.; Hanumantha Rao, Ch, Dr

    2017-08-01

    The replacement of natural fine aggregate by using quarry dust leads to consumption of generated quarry dust, the requirement of land fill area can be reduced and solves the natural sand scarcity problem. The sand availability as a fine aggregate at low cost which needs the reason to search as a alternative material. Even it causes saddle to dump the crusher dust at one place which causes environmental pollution. The chemical analysis, specific gravity, sieve analysis and compressive strength is identified for various percentage and grades of concrete by replacement of sand with quarry dust.

  14. Measuring Dust Emission from the Mojave Desert (USA) by Daily Remote-Camera Observations and Wind-Erosion Measurements: Bearing on "Unseen" Sources and Global Dust Abundance

    Science.gov (United States)

    Reynolds, R. L.; Urban, F.; Goldstein, H. L.; Fulton, R.

    2017-12-01

    A large gap in understanding the effects of atmospheric dust at all spatial scales is uncertainty about how much and whence dust is emitted annually. Digital recording of dust emission at high spatial and temporal resolution would, together with periodic flux measurements, support improved estimates of local-scale dust flux where infrastructure could support remote internet enabled cameras. Such recording would also elucidate wind-erosion dynamics when combined with meteorological data. Remote camera recording of dust-emitting settings on and around Soda Lake (Mojave Desert) was conducted every 15 minutes during daylight between 10 Nov. 2010 and 31 Dec. 2016 and images uploaded to a web server. Examination of 135,000 images revealed frequent dust events, termed "dust days" when plumes obscured mountains beyond source areas. Such days averaged 68 (sd=10) per year (2011 through 2016). We examined satellite retrievals (MODIS, GOES) for dust events during six cloudless days of highest and longest duration dust emission but none were observed. From Apr. 2000 through May 2013, aeolian sediments collected at three sites were sampled and weighed. Estimates of the emitted mass of silt- and clay-size fractions were made on the basis of measured horizontal mass flux, particle sizes of sediment in collectors, and roughly determined areas of dust generation. Over this period, nearly 4 Tg yr-1 of dust (as particulate matter flood in the basin in late Dec. 2010 that deposited flood sediment across the lake basin. Increased emission was likely related to the availability of fresh, unanchored flood sediment. Within the Mojave and Great Basin deserts of North America, many settings akin to those at Soda Lake similarly emit dust that is rarely detected in satellite retrievals. These findings strongly imply that local and regional dust emissions from western North America are far underestimated and that, by extension to relatively small dust-source areas across all drylands, global

  15. Coal dust symposium

    Energy Technology Data Exchange (ETDEWEB)

    1981-03-01

    This paper gives a report of the paper presented at the symposium held in Hanover on 9 and 10 February 1981. The topics include: the behaviour of dust and coal dust on combustion and explosion; a report on the accidents which occurred at the Laegerdorf cement works' coal crushing and drying plant; current safety requirements at coal crushing and drying plant; and coal crushing and drying. Four papers are individually abstracted. (In German)

  16. Dust devil generation

    International Nuclear Information System (INIS)

    G Onishchenko, O; A Pokhotelov, O; Horton, W; Stenflo, L

    2014-01-01

    The equations describing axi-symmetric nonlinear internal gravity waves in an unstable atmosphere are derived. A hydrodynamic model of a dust devil generation mechanism in such an atmosphere is investigated. It is shown that in an unstably stratified atmosphere the convective plumes with poloidal motion can grow exponentially. Furthermore, it is demonstrated that these convective plumes in an atmosphere with weak large scale toroidal motion are unstable with respect to three-dimensional dust devil generation. (papers)

  17. Vulnerability Assessment of Dust Storms in the United States under a Changing Climate Scenario

    Science.gov (United States)

    Severe weather events, such as flooding, drought, forest fires, and dust storms can have a serious impact on human health. Dust storm events are not well predicted in the United States, however they are expected to become more frequent as global climate warms through the 21st cen...

  18. Dust around the Cool Component of D-Type Symbiotic Binaries

    Science.gov (United States)

    Jurkic, Tomislav; Kotnik-Karuza, Dubravka

    2018-04-01

    D type symbiotic binaries are an excellent astrophysical laboratory for investigation of the dust properties and dust formation under the influence of theMira stellar wind and nova activity and of the mass loss and mass transfer between components in such a widely separated system. We present a study of the properties of circumstellar dust in symbiotic Miras by use of long-term near-IR photometry and colour indices. The published JHKL magnitudes of o Ceti, RX Pup, KM Vel, V366 Car, V835 Cen, RR Tel, HM Sge and R Aqr have been collected, analyzed and corrected for short-term variations caused by Mira pulsations. Assuming spherical temperature distribution of the dust in the close neighbourhood of the Mira, the DUSTY code was used to solve the radiative transfer in order to determine the dust temperature and its properties in each particular case. Common dust properties of the symbiotic Miras have been found, suggesting similar conditions in the condensation region of the studied symbiotic Miras. Silicate dust with the inner dust shell radius determined by the dust condensation and with the dust temperature of 900-1200 K can fully explain the observed colour indices. R Aqr is an exception and showed lower dust temperature of 650 K. Obscuration events visible in light curves can be explained by variable dust optical depth with minimal variations of other dust properties. More active symbioticMiras that underwent recent nova outbursts showed higher dust optical depths and larger maximum grain sizes of the order of μm, which means that the post-nova activity could stimulate the dust formation and the grain growth. Optically thicker dust shells and higher dust condensation temperatures have been found in symbiotic Miras compared to their single counterparts, suggesting different conditions for dust production.

  19. Onset of frequent dust storms in northern China at ~AD 1100.

    Science.gov (United States)

    He, Yuxin; Zhao, Cheng; Song, Mu; Liu, Weiguo; Chen, Fahu; Zhang, Dian; Liu, Zhonghui

    2015-11-26

    Dust storms in northern China strongly affect the living and health of people there and the dusts could travel a full circle of the globe in a short time. Historically, more frequent dust storms occurred during cool periods, particularly the Little Ice Age (LIA), generally attributed to the strengthened Siberian High. However, limited by chronological uncertainties in proxy records, this mechanism may not fully reveal the causes of dust storm frequency changes. Here we present a late Holocene dust record from the Qaidam Basin, where hydrological changes were previously reconstructed, and examine dust records from northern China, including the ones from historical documents. The records, being broadly consistent, indicate the onset of frequent dust storms at ~AD 1100. Further, peaked dust storm events occurred at episodes of high total solar irradiance or warm-dry conditions in source regions, superimposed on the high background of frequent dust storms within the cool LIA period. We thus suggest that besides strong wind activities, the centennial-scale dust storm events over the last 1000 years appear to be linked to the increased availability of dust source. With the anticipated global warming and deteriorating vegetation coverage, frequent occurrence of dust storms in northern China would be expected to persist.

  20. 'Nuisance Dust' - a Case for Recalibration?

    Science.gov (United States)

    Datson, Hugh; Marker, Brian

    2013-04-01

    This paper considers the case for a review and recalibration of limit values and acceptability criteria for 'nuisance dust', a widely encountered but poorly defined and regulated aspect of particulate matter pollution. Specific dust fractions such as PM10 and asbestiforms are well characterised and have limit values enshrined in legislation. National, and international, limit values for acceptable concentrations of PM10 and other fractions of particulate matter have been defined and agreed. In the United Kingdom (UK), these apply to both public and workplace exposures. By contrast, there is no standard definition or universal criteria against which acceptable levels for 'nuisance dust' can be assessed. This has implications for land-use planning and resource utilisation. Without meaningful limit values, inappropriate development might take place too near to residential dwellings or land containing economically important mineral resources may be effectively sterilised. Furthermore, the expression 'nuisance dust' is unhelpful in that 'nuisance' has a specific meaning in environmental law whilst 'nuisance dust' is often taken to mean 'generally visible particulate matter'. As such, it is associated with the social and broader environmental impacts of particulate matter. PM10 concentrations are usually expressed as a mass concentration over time. These can be determined using a range of techniques. While results from different instruments are generally comparable, data obtained from alternative methods for measuring 'nuisance dust' are rarely interchangeable. In the UK, many of the methods typically used are derived from approaches developed under the HMIP (Her Majesty's Inspectorate of Pollution) regime in the 1960s onwards. Typical methods for 'nuisance dust' sampling focus on measurement of dust mass (from the weight of dust collected in an open container over time) or dust soiling (from loss of reflectance and or obscuration of a surface discoloured by dust over

  1. Fractal dust grains in plasma

    International Nuclear Information System (INIS)

    Huang, F.; Peng, R. D.; Liu, Y. H.; Chen, Z. Y.; Ye, M. F.; Wang, L.

    2012-01-01

    Fractal dust grains of different shapes are observed in a radially confined magnetized radio frequency plasma. The fractal dimensions of the dust structures in two-dimensional (2D) horizontal dust layers are calculated, and their evolution in the dust growth process is investigated. It is found that as the dust grains grow the fractal dimension of the dust structure decreases. In addition, the fractal dimension of the center region is larger than that of the entire region in the 2D dust layer. In the initial growth stage, the small dust particulates at a high number density in a 2D layer tend to fill space as a normal surface with fractal dimension D = 2. The mechanism of the formation of fractal dust grains is discussed.

  2. Statistical analysis of temporal and spatial evolution of in-vessel dust particles in KSTAR

    International Nuclear Information System (INIS)

    Kim, Kyung-Rae; Hong, Suk-Ho; Nam, Yong-Un; Jung, Jinil; Kim, Woong-Chae

    2013-01-01

    Images of wide-angle visible standard CCD cameras contain information on in-vessel dusts such as dust creation events (DCEs) that occur during plasma operations, and their velocity. Analyzing the straight line-like dust traces in the shallow cylindrical shell-structured scrape-off layer along the vacuum vessel, a database on the short/long term temporal evolutions, spatial locations of DCEs caused by plasma–dust interaction, and the dust velocity distribution are built. We have studied DCEs of 2010 and 2011 KSTAR campaign

  3. Regularities of dust formation during stone cutting for construction works

    Directory of Open Access Journals (Sweden)

    V.G. Lebedev

    2016-09-01

    Full Text Available When cutting stone, a large amount of dust release, which is a mixture of small, mostly sharp, mineral particles. Shallow dry dust with inhalation causes the pathological changes in organs that are a consequence of infiltration of acute and solids particles. Despite the importance of this problem, the questions of dust generation during the various working processes and its fractions distribution are practically not considered. This determines the time of dust standing in the air and its negative impact on a person. Aim: The aim of this research is to study the process of dusting during stones cutting and dust distribution on fractions regularities and quantification of dust formation process in order to improve the production equipment, staff individual and collective safety equipment. Materials and Methods: Many types of cutting can be divided into two types - a “dry” cutting and cutting with fluid. During “dry” cutting a dust represents a set of micro-chips which are cut off by the abrasive grains. The size of such chips very small: from a micrometer to a few micrometers fraction. Thus, the size of chips causes the possibility of creating dust slurry with low fall velocity, and which is located in the working space in large concentrations. Results: The following characteristic dependences were obtained as a result of research: dependence of the dust fall from the size of the dust particles, size of dust particles from minute feeding and grain range wheel, the specific amount of dust from the number of grit abrasive wheel and the temperature of the dust particles from the feeding at wheel turnover. It was shown that the distribution of chips (dust by size will request of a normal distribution low. Dimensions of chips during cut are in the range of 0.4...6 μm. Thus, dust slurry is formed with time of particles fall of several hours. This creates considerable minute dust concentration - within 0.28∙10^8...1.68∙10^8 units/m3.

  4. Influence of tropical storms in the Northern Indian Ocean on dust entrainment and long-range transport.

    Digital Repository Service at National Institute of Oceanography (India)

    Ramaswamy, V.

    to the winter and summer Shamal Winds, tropical cyclones are an important mechanism of dust entrainment and transport of dust in this region. Elevated dust levels were observed in the northern Arabian Sea during most tropical cyclone events. During the study...

  5. Sahara Dust Cloud

    Science.gov (United States)

    2005-01-01

    [figure removed for brevity, see original site] Dust Particles Click on the image for Quicktime movie from 7/15-7/24 A continent-sized cloud of hot air and dust originating from the Sahara Desert crossed the Atlantic Ocean and headed towards Florida and the Caribbean. A Saharan Air Layer, or SAL, forms when dry air and dust rise from Africa's west coast and ride the trade winds above the Atlantic Ocean. These dust clouds are not uncommon, especially during the months of July and August. They start when weather patterns called tropical waves pick up dust from the desert in North Africa, carry it a couple of miles into the atmosphere and drift westward. In a sequence of images created by data acquired by the Earth-orbiting Atmospheric Infrared Sounder ranging from July 15 through July 24, we see the distribution of the cloud in the atmosphere as it swirls off of Africa and heads across the ocean to the west. Using the unique silicate spectral signatures of dust in the thermal infrared, AIRS can detect the presence of dust in the atmosphere day or night. This detection works best if there are no clouds present on top of the dust; when clouds are present, they can interfere with the signal, making it much harder to detect dust as in the case of July 24, 2005. In the Quicktime movie, the scale at the bottom of the images shows +1 for dust definitely detected, and ranges down to -1 for no dust detected. The plots are averaged over a number of AIRS observations falling within grid boxes, and so it is possible to obtain fractional numbers. [figure removed for brevity, see original site] Total Water Vapor in the Atmosphere Around the Dust Cloud Click on the image for Quicktime movie The dust cloud is contained within a dry adiabatic layer which originates over the Sahara Desert. This Saharan Air Layer (SAL) advances Westward over the Atlantic Ocean, overriding the cool, moist air nearer the surface. This burst of very dry air is visible in the AIRS retrieved total water

  6. Microbes and Microstructure: Dust's Role in the Snowpack Evolution

    Science.gov (United States)

    Lieblappen, R.; Courville, Z.; Fegyveresi, J. M.; Barbato, R.; Thurston, A.

    2017-12-01

    Dust is a primary vehicle for transporting microbial communities to polar and alpine snowpacks both through wind distribution (dry deposition) and snowfall events (wet deposition). The resulting microbial community diversity in the snowpack may then resemble the source material properties rather than its new habitat. Dust also has a strong influence on the microstructural properties of snow, resulting in changes to radiative and mechanical properties. As local reductions in snowpack albedo lead to enhanced melting and a heterogeneous snow surface, the microbial communities are also impacted. Here we study the impact of the changing microstructure in the snowpack, its influence on microbial function, and the fate of dust particles within the snow matrix. We seek to quantify the changes in respiration and water availability with the onset of melt. Polar samples were collected from the McMurdo Ice Shelf, Antarctica in February, 2017, while alpine samples were collected from Silverton, CO from October to May, 2017 as part of the Colorado Dust on Snow (CDOS) network. At each site, coincident meteorological data provides temperature, wind, and radiative measurements. Samples were collected immediately following dust deposition events and after subsequent snowpack evolution. We used x-ray micro-computed tomography to quantify the microstructural evolution of the snow, while also imaging the microstructural distribution of the dust within the snow. The dust was then collected and analyzed for chemical and microbial activity.

  7. Dust mobilization by high-speed vapor flow under LOVA

    International Nuclear Information System (INIS)

    Matsuki, K.; Suzuki, S.; Ebara, S.; Yokomine, T.; Shimizu, A.

    2006-01-01

    In the safety analysis on the International Thermonuclear Experimental Reactor (ITER), the ingress of coolant (ICE) event and the loss of vacuum (LOVA) event are considered as one of the most serious accident. On the assumption of LOVA occurring after ICE, it is inferable that activated dusts are under the wet condition. Transport behavior of in-vessel activated dusts under the wet condition is not well understood in comparison with the dry case. In this study, we experimentally investigated the entrainment behavior of dust under LOVA after ICE. We measured dust entrainment by high-speed humid airflow with phase change. Graphite dusts and glass beads are used as substitutions for mobile inventory. The relations among the relative humidity, the entrainment of particles in the exhaust gas flow and the adhesion rate of dust particles on the pipe wall have been made clear, as has the distribution profile of dust deposition on the pipe wall. The entrainment ratio decreased as the relative humidity increased and increased as the initial pressure difference increased

  8. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  9. Using aircraft measurements to determine the refractive index of Saharan dust during the DODO Experiments

    Directory of Open Access Journals (Sweden)

    C. L. McConnell

    2010-03-01

    Full Text Available Much uncertainty in the value of the imaginary part of the refractive index of mineral dust contributes to uncertainty in the radiative effect of mineral dust in the atmosphere. A synthesis of optical, chemical and physical in-situ aircraft measurements from the DODO experiments during February and August 2006 are used to calculate the refractive index mineral dust encountered over West Africa. Radiative transfer modeling and measurements of broadband shortwave irradiance at a range of altitudes are used to test and validate these calculations for a specific dust event on 23 August 2006 over Mauritania. Two techniques are used to determine the refractive index: firstly a method combining measurements of scattering, absorption, size distributions and Mie code simulations, and secondly a method using composition measured on filter samples to apportion the content of internally mixed quartz, calcite and iron oxide-clay aggregates, where the iron oxide is represented by either hematite or goethite and clay by either illite or kaolinite. The imaginary part of the refractive index at 550 nm (ni550 is found to range between 0.0001 i to 0.0046 i, and where filter samples are available, agreement between methods is found depending on mineral combination assumed. The refractive indices are also found to agree well with AERONET data where comparisons are possible. ni550 is found to vary with dust source, which is investigated with the NAME model for each case. The relationship between both size distribution and ni550 on the accumulation mode single scattering albedo at 550 nm (ω0550 are examined and size distribution is found to have no correlation to ω0550, while ni550 shows a strong linear relationship with ω0550. Radiative transfer modeling was performed with different

  10. Functional PMS2 hybrid alleles containing a pseudogene-specific missense variant trace back to a single ancient intrachromosomal recombination event.

    Science.gov (United States)

    Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

    2010-05-01

    Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.

  11. Dust in planetary nebulae

    International Nuclear Information System (INIS)

    Kwok, S.

    1980-01-01

    A two-component dust model is suggested to explain the infrared emission from planetary nebulae. A cold dust component located in the extensive remnant of the red-giant envelope exterior to the visible nebula is responsible for the far-infrared emission. A ward dust component, which is condensed after the formation of the planetary nebula and confined within the ionized gas shell, emits most of the near- and mid-infrared radiation. The observations of NGC 7027 are shown to be consisten with such a model. The correlation of silicate emission in several planetary nebulae with an approximately +1 spectral index at low radio frequencies suggests that both the silicate and radio emissions originate from the remnant of the circumstellar envelope of th precursor star and are observable only while the planetary nebula is young. It is argued that oxygen-rich stars as well as carbon-rich stars can be progenitors of planetary nebulae

  12. Interstellar dust and extinction

    International Nuclear Information System (INIS)

    Mathis, J.S.

    1990-01-01

    It is noted that the term interstellar dust refers to materials with rather different properties, and that the mean extinction law of Seaton (1979) or Savage and Mathis (1979) should be replaced by the expression given by Cardelli et al. (1989), using the appropriate value of total-to-selective extinction. The older laws were appropriate for the diffuse ISM but dust in clouds differs dramatically in its extinction law. Dust is heavily processed while in the ISM by being included within clouds and cycled back into the diffuse ISM many times during its lifetime. Hence, grains probably reflect only a trace of their origin, although meteoritic inclusions with isotopic anomalies demonstrate that some tiny particles survive intact from a supernova origin to the present. 186 refs

  13. Dust control for draglines

    Energy Technology Data Exchange (ETDEWEB)

    Grad, P.

    2009-09-15

    Monitoring dust levels inside draglines reveals room for improvement in how filtration systems are used and maintained. The Australian firm BMT conducted a field test program to measure airflow parameters, dust fallout rates and dust concentrations, inside and outside the machine house, on four draglines and one shovel. The study involved computational fluid dynamics (CFD) simulations. The article describes how the tests were made and gives results. It was not possible to say which of the two main filtration systems currently used on Australian draglines - Dynavane or Floseps - performs better. It would appear that more frequent maintenance and cleaning would increase the overall filtration performance and systems could be susceptible to repeat clogging in a short time. 2 figs., 1 photos.

  14. DustEM: Dust extinction and emission modelling

    Science.gov (United States)

    Compiègne, M.; Verstraete, L.; Jones, A.; Bernard, J.-P.; Boulanger, F.; Flagey, N.; Le Bourlot, J.; Paradis, D.; Ysard, N.

    2013-07-01

    DustEM computes the extinction and the emission of interstellar dust grains heated by photons. It is written in Fortran 95 and is jointly developed by IAS and CESR. The dust emission is calculated in the optically thin limit (no radiative transfer) and the default spectral range is 40 to 108 nm. The code is designed so dust properties can easily be changed and mixed and to allow for the inclusion of new grain physics.

  15. Relationship between mortality and fine particles during Asian dust, smog-Asian dust, and smog days in Korea.

    Science.gov (United States)

    Kim, Hyun-Sun; Kim, Dong-Sik; Kim, Ho; Yi, Seung-Muk

    2012-01-01

    This study examined the association between all-cause/cardiovascular mortality and PM(2.5) as related to Asian dust (AD), smog-AD, smog, and nonevent days and evaluated the differential risks according to specific events for mortality. The daily records of all-cause/cardiovascular mortality and PM(2.5) from March to May 2003-2006 in Seoul, Korea, were used as independent and dependent variables. Differences in the event effects were assessed using a time-series analysis. Both all-cause and cardiovascular mortalities were significantly associated with PM(2.5) during smog-AD and AD days only. Differences in chemical composition emerging during long-range transport to Korea may explain these observations, especially as regards secondary aerosol, metal-sulfate/or nitrate, and metallic components. These results suggest that exposure to PM(2.5) during specific events is differentially associated with human mortality and that changes in the chemical composition of PM(2.5), occurring during long-range transport, represent important factors in such differential effects on health.

  16. Dust-Plasma Interactions

    International Nuclear Information System (INIS)

    Rosenberg, M.

    2010-01-01

    The objective of our theoretical research under this grant over the past 3 years was to develop new understanding in a range of topics in the physics of dust-plasma interactions, with application to space and the laboratory. We conducted studies related to the physical properties of dust, waves and instabilities in both weakly coupled and strongly coupled dusty plasmas, and innovative possible applications. A major consideration in our choice of topics was to compare theory with experiments or observations, and to motivate new experiments, which we believe is important for developing this relatively new field. Our research is summarized, with reference to our list of journal publications.

  17. Long-term dust climatology in the western United States reconstructed from routine aerosol ground monitoring

    Directory of Open Access Journals (Sweden)

    D. Q. Tong

    2012-06-01

    Full Text Available This study introduces an observation-based dust identification approach and applies it to reconstruct long-term dust climatology in the western United States. Long-term dust climatology is important for quantifying the effects of atmospheric aerosols on regional and global climate. Although many routine aerosol monitoring networks exist, it is often difficult to obtain dust records from these networks, because these monitors are either deployed far away from dust active regions (most likely collocated with dense population or contaminated by anthropogenic sources and other natural sources, such as wildfires and vegetation detritus. Here we propose an approach to identify local dust events relying solely on aerosol mass and composition from general-purpose aerosol measurements. Through analyzing the chemical and physical characteristics of aerosol observations during satellite-detected dust episodes, we select five indicators to be used to identify local dust records: (1 high PM10 concentrations; (2 low PM2.5/PM10 ratio; (3 higher concentrations and percentage of crustal elements; (4 lower percentage of anthropogenic pollutants; and (5 low enrichment factors of anthropogenic elements. After establishing these identification criteria, we conduct hierarchical cluster analysis for all validated aerosol measurement data over 68 IMPROVE sites in the western United States. A total of 182 local dust events were identified over 30 of the 68 locations from 2000 to 2007. These locations are either close to the four US Deserts, namely the Great Basin Desert, the Mojave Desert, the Sonoran Desert, and the Chihuahuan Desert, or in the high wind power region (Colorado. During the eight-year study period, the total number of dust events displays an interesting four-year activity cycle (one in 2000–2003 and the other in 2004–2007. The years of 2003, 2002 and 2007 are the three most active dust periods, with 46, 31 and 24

  18. Control of harmful dust in coal mines

    Energy Technology Data Exchange (ETDEWEB)

    Goddard, B; Bower, K; Mitchell, D

    1973-01-01

    This handbook consists of a series of short chapters devoted to: sources of airborne dust; dust standards and methods of sampling; dust prevention on mechanized faces; ventilation and dust extraction; distribution and use of water; dust control on mechanized faces; dust control in drivages and headings; drilling and shotfiring; dust control in transport; some outbye dust control techniques (hygroscopic salts, impingement curtains); water infusion; personal protective equipment. (CIS Abstr.)

  19. Dust evolution in protoplanetary disks

    OpenAIRE

    Gonzalez , Jean-François; Fouchet , Laure; T. Maddison , Sarah; Laibe , Guillaume

    2007-01-01

    6 pages, 5 figures, to appear in the Proceedings of IAU Symp. 249: Exoplanets: Detection, Formation and Dynamics (Suzhou, China); International audience; We investigate the behaviour of dust in protoplanetary disks under the action of gas drag using our 3D, two-fluid (gas+dust) SPH code. We present the evolution of the dust spatial distribution in global simulations of planetless disks as well as of disks containing an already formed planet. The resulting dust structures vary strongly with pa...

  20. Respirable versus inhalable dust sampling

    International Nuclear Information System (INIS)

    Hondros, J.

    1987-01-01

    The ICRP uses a total inhalable dust figure as the basis of calculations on employee lung dose. This paper was written to look at one aspect of the Olympic Dam dust situation, namely, the inhalable versus respirable fraction of the dust cloud. The results of this study will determine whether it is possible to use respirable dust figures, as obtained during routine monitoring to help in the calculations of employee exposure to internal radioactive contaminants

  1. Paleo-dust insights onto dust-climate interactions

    Science.gov (United States)

    Albani, S.; Mahowald, N. M.

    2017-12-01

    Mineral dust emissions are affected by changing climate conditions, and in turn dust impacts the atmospheric radiation budget, clouds and biogeochemical cycles. Climate and public health dust-related issues call for attention on the fate of the dust cycle in the future, and the representation of the dust cycle is now part of the strategy of the Paleoclimate Modelling Intercomparison Project phase 4 and the Coupled Model Intercomparison Project phase 6 (PMIP4-CMIP6). Since mineral aerosols are one of the most important natural aerosols, understanding past dust responses to climate in the paleoclimate will allow us to better understand mineral aerosol feedbacks with climate and biogeochemistry in the Anthropocene. Modern observations and paleoclimate records offer the possibility of multiple, complementary views on the global dust cycle, and allow to validate and/or constrain the numerical representation of dust in climate and Earth system models. We present our results from a set of simulations with the Community Earth System Model for different climate states, including present and past climates such as the pre-industrial, the mid-Holocene and the Last Glacial Maximum. A set of simulations including a prognostic dust cycle was thoroughly compared with a wide set of present day observations from different platforms and regions, in order to realistically constrain the magnitude of dust load, surface concentration, deposition, optical properties, and particle size distributions. The magnitude of emissions for past climate regimes was constrained based on compilations of paleodust mass accumulation rates and size distributions, as well as based on information on dust provenance. The comparison with a parallel set of simulations without dust allows estimating the impacts of dust on surface climate. We analyze impacts of dust on the mean and variability of surface temperature and precipitation in each climate state, as well as the impacts that changing dust emissions had

  2. Climatology of atmospheric circulation patterns of Arabian dust in western Iran.

    Science.gov (United States)

    Najafi, Mohammad Saeed; Sarraf, B S; Zarrin, A; Rasouli, A A

    2017-08-28

    Being in vicinity of vast deserts, the west and southwest of Iran are characterized by high levels of dust events, which have adverse consequences on human health, ecosystems, and environment. Using ground based dataset of dust events in western Iran and NCEP/NCAR reanalysis data, the atmospheric circulation patterns of dust events in the Arabian region and west of Iran are identified. The atmospheric circulation patterns which lead to dust events in the Arabian region and western Iran were classified into two main categories: the Shamal dust events that occurs in warm period of year and the frontal dust events as cold period pattern. In frontal dust events, the western trough or blocking pattern at mid-level leads to frontogenesis, instability, and air uplift at lower levels of troposphere in the southwest of Asia. Non-frontal is other pattern of dust event in the cold period and dust generation are due to the regional circulation systems at the lower level of troposphere. In Shamal wind pattern, the Saudi Arabian anticyclone, Turkmenistan anticyclone, and Zagros thermal low play the key roles in formation of this pattern. Summer and transitional patterns are two sub-categories of summer Shamal wind pattern. In summer trough pattern, the mid-tropospheric trough leads to intensify the surface thermal systems in the Middle East and causes instability and rising of wind speed in the region. In synthetic pattern of Shamal wind and summer trough, dust is created by the impact of a trough in mid-levels of troposphere as well as existing the mentioned regional systems which are contributed in formation of summer Shamal wind pattern.

  3. Erosion of dust aggregates

    NARCIS (Netherlands)

    Seizinger, A.; Krijt, S.; Kley, W.

    2013-01-01

    Aims: The aim of this work is to gain a deeper insight into how much different aggregate types are affected by erosion. Especially, it is important to study the influence of the velocity of the impacting projectiles. We also want to provide models for dust growth in protoplanetary disks with simple

  4. Dust-Plasma Interactions

    International Nuclear Information System (INIS)

    Rosenberg, Marelene

    2005-01-01

    Our theoretical research on dust-plasma interactions has concentrated on three main areas: (a)studies of grain charging and applications; (b) waves and instabilities in weakly correlated dusty plasma with applications to space and laboratory plasmas; (c) waves in strongly coupled dusty plasmas.

  5. From dust to life

    Science.gov (United States)

    Wickramasinghe, Chandra

    After initially challenging the dirty-ice theory of interstellar grains, Fred Hoyle and the present author proposed carbon (graphite) grains, mixtures of refractory grains, organic polymers, biochemicals and finally bacterial grains as models of interstellar dust. The present contribution summarizes this trend and reviews the main arguments supporting a modern version of panspermia.

  6. The Lunar Environment: Determining the Health Effects of Exposure to Moon Dusts

    Science.gov (United States)

    Khan-Mayberry, Noreen

    2007-01-01

    The moon's surface is covered with a thin layer of fine, charged, reactive dust capable of layer of fine, charged, reactive dust capable of capable of entering habitats and vehicle compartments, where it can result in crewmember health problems. NASA formed the Lunar Airborne Dust Toxicity Advisory Group (LADTAG) to study the effects of exposure to Lunar Dust on human health. To date, no scientifically defensible toxicological studies have been performed on lunar dusts, specifically the determination of exposure limits and their affect on human health. The multi-center LADTAG (Lunar Airborne Dust Toxicology center LADTAG (Lunar Airborne Dust Toxicology Advisory Group) was formed in response to the Office of the Chief Health and Medical Office s (OCHMO) request to develop recommendations for defining risk (OCHMO) request to develop recommendations for defining risk defining risk criteria for human lunar dust exposure.

  7. Radioactive dust concentration around the Ranger uranium mine

    International Nuclear Information System (INIS)

    Kavasnicka, Jiri.

    1988-07-01

    Environmental dust sampling and wind direction/velocity monitory were carried out between July and November 1987 at five points around the Ranger Uranium Mines project near Jabiru, Northern Territory. The measured radioactive dust alpha activities in the air were used to calculate the radioactive dust source-term and develop a site-specific air dispersion model which takes the depletion of the dust plume into account. The above model was used to estimate the effective committed dose equivalent as 15 μSv/year to children in Jabiru East. This corresponds to an increase of 2.6 x 10 -4 Bq. m -3 in the annual average dust alpha activity above the natural background. The dose to the children in Jabiru is about 5 μSv/year, so that the critical group of the public is in Jabiru East. 12 refs., 11 tabs., 2 maps

  8. The ecology of dust: local- to global-scale perspectives

    Energy Technology Data Exchange (ETDEWEB)

    Whicker, Jeffrey J [Los Alamos National Laboratory; Field, Jason P [UA; Belnap, Jayne [NON LANL; Breshears, David D [UA; Neff, Jason [CU; Okin, Gregory S [UCLA; Painter, Thomas H [UNIV OF ARIZONA; Ravi, Sujith [UNIV OF ARIZONA; Reheis, Marith C [UCLA; Reynolds, Richard L [NON LANL

    2009-01-01

    Emission and redistribution of dust due to wind erosion in drylands drives major biogeochemical dynamics and provides important aeolian environmental connectivity at scales from individual plants up to the global scale. Yet, perhaps because most relevant research on aeolian processes has been presented in a geosciences rather than ecological context, most ecological studies do not explicitly consider dust-driven processes. To bridge this disciplinary gap, we provide a general overview of the ecological importance of dust, examine complex interactions between wind erosion and ecosystem dynamics from the plant-interspace scale to regional and global scales, and highlight specific examples of how disturbance affects these interactions and their consequences. Changes in climate and intensification of land use will both likely lead to increased dust production. To address these challenges, environmental scientists, land managers and policy makers need to more explicitly consider dust in resource management decisions.

  9. Quantifying dust plume formation and aerosol size distribution during the Saharan Mineral Dust Experiment in North Africa

    KAUST Repository

    Khan, Basit Ali

    2015-01-01

    Dust particles mixed in the free troposphere have longer lifetimes than airborne particles near the surface. Their cumulative radiative impact on earth’s meteorological processes and climate might be significant despite their relatively small contribution to total dust abundance. One example is the elevated dust--laden Saharan Air Layer (SAL) over the equatorial North Atlantic, which cools the sea surface and likely suppresses hurricane activity. To understand the formation mechanisms of SAL, we combine model simulations and dust observations collected during the first stage of the Saharan Mineral Dust Experiment (SAMUM--I), which sampled dust events that extended from Morocco to Portugal, and investigated the spatial distribution and the microphysical, optical, chemical, and radiative properties of Saharan mineral dust. We employed the Weather Research Forecast model coupled with the Chemistry/Aerosol module (WRF--Chem) to reproduce the meteorological environment and spatial and size distributions of dust. The experimental domain covers northwest Africa including the southern Sahara, Morocco and part of the Atlantic Ocean with 5 km horizontal grid spacing and 51 vertical layers. The experiments were run from 20 May to 9 June 2006, covering the period of most intensive dust outbreaks. Comparisons of model results with available airborne and ground--based observations show that WRF--Chem reproduces observed meteorological fields as well as aerosol distribution across the entire region and along the airplane’s tracks. We evaluated several aerosol uplift processes and found that orographic lifting, aerosol transport through the land/sea interface with steep gradients of meteorological characteristics, and interaction of sea breezes with the continental outflow are key mechanisms that form a surface--detached aerosol plume over the ocean. Comparisons of simulated dust size distributions with airplane and ground--based observations are generally good, but suggest

  10. Short-cut transport path for Asian dust directly to the Arctic: a case study

    International Nuclear Information System (INIS)

    Huang, Zhongwei; Huang, Jianping; Wang, Shanshan; Zhou, Tian; Jin, Hongchun; Hayasaka, Tadahiro

    2015-01-01

    Asian dust can be transported long distances from the Taklimakan or Gobi desert to North America across the Pacific Ocean, and it has been found to have a significant impact on ecosystems, climate, and human health. Although it is well known that Asian dust is transported all over the globe, there are limited observations reporting Asian dust transported to the Arctic. We report a case study of a large-scale heavy dust storm over East Asia on 19 March 2010, as shown by ground-based and space-borne multi-sensor observations, as well as NCEP/NCAR reanalysis data and HYSPLIT trajectories. Our analysis suggests that Asian dust aerosols were transported from northwest China to the Arctic within 5 days, crossing eastern China, Japan and Siberia before reaching the Arctic. The results indicate that Asian dust can be transported for long distances along a previously unreported transport path. Evidence from other dust events over the past decade (2001–2010) also supports our results, indicating that dust from 25.2% of Asian dust events has potentially been transported directly to the Arctic. The transport of Asian dust to the Arctic is due to cyclones and the enhanced East Asia Trough (EAT), which are very common synoptic systems over East Asia. This suggests that many other large dust events would have generated long-range transport of dust to the Arctic along this path in the past. Thus, Asian dust potentially affects the Arctic climate and ecosystem, making climate change in the Arctic much more complex to be fully understood. (letter)

  11. Modelling dust transport in tokamaks

    International Nuclear Information System (INIS)

    Martin, J.D.; Martin, J.D.; Bacharis, M.; Coppins, M.; Counsell, G.F.; Allen, J.E.; Counsell, G.F.

    2008-01-01

    The DTOKS code, which models dust transport through tokamak plasmas, is described. The floating potential and charge of a dust grain in a plasma and the fluxes of energy to and from it are calculated. From this model, the temperature of the dust grain can be estimated. A plasma background is supplied by a standard tokamak edge modelling code (B2SOLPS5.0), and dust transport through MAST (the Mega-Amp Spherical Tokamak) and ITER plasmas is presented. We conclude that micron-radius tungsten dust can reach the separatrix in ITER. (authors)

  12. Detection of Asian Dust Storm Using MODIS Measurements

    Directory of Open Access Journals (Sweden)

    Yong Xie

    2017-08-01

    Full Text Available Every year, a large number of aerosols are released from dust storms into the atmosphere, which may have potential impacts on the climate, environment, and air quality. Detecting dust aerosols and monitoring their movements and evolutions in a timely manner is a very significant task. Satellite remote sensing has been demonstrated as an effective means for observing dust aerosols. In this paper, an algorithm based on the multi-spectral technique for detecting dust aerosols was developed by combining measurements of moderate resolution imaging spectroradiometer (MODIS reflective solar bands and thermal emissive bands. Data from dust events that occurred during the past several years were collected as training data for spectral and statistical analyses. According to the spectral curves of various scene types, a series of spectral bands was selected individually or jointly, and corresponding thresholds were defined for step-by-step scene classification. The multi-spectral algorithm was applied mainly to detect dust storms in Asia. The detection results were validated not only visually with MODIS true color images, but also quantitatively with products of Ozone Monitoring Instrument (OMI and Cloud Aerosol Lidar with Orthogonal Polarization (CALIOP. The validations showed that this multi-spectral detection algorithm was suitable to monitor dust aerosols in the selected study areas.

  13. Trajectory Calculation as Forecasting Support Tool for Dust Storms

    Directory of Open Access Journals (Sweden)

    Sultan Al-Yahyai

    2014-01-01

    Full Text Available In arid and semiarid regions, dust storms are common during windy seasons. Strong wind can blow loose sand from the dry surface. The rising sand and dust is then transported to other places depending on the wind conditions (speed and direction at different levels of the atmosphere. Considering dust as a moving object in space and time, trajectory calculation then can be used to determine the path it will follow. Trajectory calculation is used as a forecast supporting tool for both operational and research activities. Predefined dust sources can be identified and the trajectories can be precalculated from the Numerical Weather Prediction (NWP forecast. In case of long distance transported dust, the tool should allow the operational forecaster to perform online trajectory calculation. This paper presents a case study for using trajectory calculation based on NWP models as a forecast supporting tool in Oman Meteorological Service during some dust storm events. Case study validation results showed a good agreement between the calculated trajectories and the real transport path of the dust storms and hence trajectory calculation can be used at operational centers for warning purposes.

  14. Young Stellar Variability of GM Cephei by Circumstellar Dust Clumps

    Science.gov (United States)

    Huang, Po-Chieh; Chen, Wen-Ping; Hu, Chia-Ling; Burkhonov, Otabek; Ehgamberdiev, Shuhrat; Liu, Jinzhong; Naito, Hiroyuki; Pakstiene, Erika; Qvam, Jan Kare Trandem; Rätz, Stefanie; Semkov, Evgeni

    2018-04-01

    UX Orionis stars are a sub-type of Herbig Ae/be or T Tauri stars exhibiting sporadic extinction of stellar light due to circumstellar dust obscuration. GM Cep is such an UX Orionis star in the young (∼ 4 Myr) open cluster Trumpler 37 at ∼ 900 pc, showing a prominent infrared access, H-alpha emission, and flare activity. Our multi-color photometric monitoring from 2009 to 2016 showed (i) sporadic brightening on a time scale of days due to young stellar accretion, (ii) cyclic, but not strictly periodical, occultation events, each lasting for a couple months, with a probable recurrence time of about two years, (iii) normal dust reddening as the star became redder when dimmer, (iv) the unusual "blueing" phenomena near the brightness minima, during which the star appeared bluer when dimmer, and (v) a noticeable polarization, from 3 to 9 percent in g', r', and i' -bands. The occultation events may be caused by dust clumps, signifying the density inhomogeneity in a young stellar disk from grain coagulation to planetesimal formation. The level of polarization was anti-correlated with the brightness in the bright state, when the dust clump backscattered stellar light. We discussed two potential hypotheses: orbiting dust clumps versus dust clumps along a spiral arm structure.

  15. African dust and the demise of Caribbean coral reefs

    Science.gov (United States)

    Shinn, E.A.; Smith, G.W.; Prospero, J.M.; Betzer, P.; Hayes, M.L.; Garrison, V.; Barber, R.T.

    2000-01-01

    The vitality of Caribbean coral reefs has undergone a continual state of decline since the late 1970s, a period of time coincidental with large increases in transatlantic dust transport. It is proposed that the hundreds of millions of tons/year of soil dust that have been crossing the Atlantic during the last 25 years could be a significant contributor to coral reef decline and may be affecting other ecosystems. Benchmark events, such as near synchronous Caribbean-wide mortalities of acroporid corals and the urchin Diadema in 1983, and coral bleaching beginning in 1987, correlate with the years of maximum dust flux into the Caribbean. Besides crustal elements, in particular Fe, Si, and aluminosilicate clays, the dust can serve as a substrate for numerous species of viable spores, especially the soil fungus Aspergillus. Aspergillus sydowii, the cause of an ongoing Caribbean-wide seafan disease, has been cultured from Caribbean air samples and used to inoculate sea fans.

  16. Dust storm, northern Mexico

    Science.gov (United States)

    1983-01-01

    This large dust storm along the left side of the photo, covers a large portion of the state of Coahuila, Mexico (27.5N, 102.0E). The look angle of this oblique photo is from the south to the north. In the foreground is the Sierra Madre Oriental in the states Coahuila and Nuevo Leon with the Rio Grande River, Amistad Reservoir and Texas in the background.

  17. 3 MV hypervelocity dust accelerator at the Colorado Center for Lunar Dust and Atmospheric Studies.

    Science.gov (United States)

    Shu, Anthony; Collette, Andrew; Drake, Keith; Grün, Eberhard; Horányi, Mihály; Kempf, Sascha; Mocker, Anna; Munsat, Tobin; Northway, Paige; Srama, Ralf; Sternovsky, Zoltán; Thomas, Evan

    2012-07-01

    A hypervelocity dust accelerator for studying micrometeorite impacts has been constructed at the Colorado Center for Lunar Dust and Atmospheric Studies (CCLDAS) at the University of Colorado. Based on the Max-Planck-Institüt für Kernphysik (MPI-K) accelerator, this accelerator is capable of emitting single particles of a specific mass and velocity selected by the user. The accelerator consists of a 3 MV Pelletron generator with a dust source, four image charge pickup detectors, and two interchangeable target chambers: a large high-vacuum test bed and an ultra-high vacuum impact study chamber. The large test bed is a 1.2 m diameter, 1.5 m long cylindrical vacuum chamber capable of pressures as low as 10(-7) torr while the ultra-high vacuum chamber is a 0.75 m diameter, 1.1 m long chamber capable of pressures as low as 10(-10) torr. Using iron dust of up to 2 microns in diameter, final velocities have been measured up to 52 km/s. The spread of the dust particles and the effect of electrostatic focusing have been measured using a long exposure CCD and a quartz target. Furthermore, a new technique of particle selection is being developed using real time digital filtering techniques. Signals are digitized and then cross-correlated with a shaped filter, resulting in a suppressed noise floor. Improvements over the MPI-K design, which include a higher operating voltage and digital filtering for detection, increase the available parameter space of dust emitted by the accelerator. The CCLDAS dust facility is a user facility open to the scientific community to assist with instrument calibrations and experiments.

  18. 3 MV hypervelocity dust accelerator at the Colorado Center for Lunar Dust and Atmospheric Studies

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Anthony; Horanyi, Mihaly; Kempf, Sascha; Thomas, Evan [Colorado Center for Lunar Dust and Atmospheric Studies, Boulder, Colorado 80303 (United States); Department of Physics, University of Colorado, Boulder, Colorado 80309 (United States); Laboratory for Atmospheric and Space Physics, 1234 Innovation Drive, Boulder, Colorado 80303 (United States); Collette, Andrew; Drake, Keith; Northway, Paige [Colorado Center for Lunar Dust and Atmospheric Studies, Boulder, Colorado 80303 (United States); Laboratory for Atmospheric and Space Physics, 1234 Innovation Drive, Boulder, Colorado 80303 (United States); Gruen, Eberhard [Colorado Center for Lunar Dust and Atmospheric Studies, Boulder, Colorado 80303 (United States); MPI fuer Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); Mocker, Anna [Colorado Center for Lunar Dust and Atmospheric Studies, Boulder, Colorado 80303 (United States); MPI fuer Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); IRS, Universitaet Stuttgart, Pfaffenwaldring 31, D-70569 Stuttgart (Germany); Munsat, Tobin [Colorado Center for Lunar Dust and Atmospheric Studies, Boulder, Colorado 80303 (United States); Department of Physics, University of Colorado, Boulder, Colorado 80309 (United States); Srama, Ralf [MPI fuer Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); IRS, Universitaet Stuttgart, Pfaffenwaldring 31, D-70569 Stuttgart (Germany); and others

    2012-07-15

    A hypervelocity dust accelerator for studying micrometeorite impacts has been constructed at the Colorado Center for Lunar Dust and Atmospheric Studies (CCLDAS) at the University of Colorado. Based on the Max-Planck-Instituet fuer Kernphysik (MPI-K) accelerator, this accelerator is capable of emitting single particles of a specific mass and velocity selected by the user. The accelerator consists of a 3 MV Pelletron generator with a dust source, four image charge pickup detectors, and two interchangeable target chambers: a large high-vacuum test bed and an ultra-high vacuum impact study chamber. The large test bed is a 1.2 m diameter, 1.5 m long cylindrical vacuum chamber capable of pressures as low as 10{sup -7} torr while the ultra-high vacuum chamber is a 0.75 m diameter, 1.1 m long chamber capable of pressures as low as 10{sup -10} torr. Using iron dust of up to 2 microns in diameter, final velocities have been measured up to 52 km/s. The spread of the dust particles and the effect of electrostatic focusing have been measured using a long exposure CCD and a quartz target. Furthermore, a new technique of particle selection is being developed using real time digital filtering techniques. Signals are digitized and then cross-correlated with a shaped filter, resulting in a suppressed noise floor. Improvements over the MPI-K design, which include a higher operating voltage and digital filtering for detection, increase the available parameter space of dust emitted by the accelerator. The CCLDAS dust facility is a user facility open to the scientific community to assist with instrument calibrations and experiments.

  19. Dust acoustic shock wave at high dust density

    International Nuclear Information System (INIS)

    Ghosh, Samiran; Sarkar, Susmita; Khan, Manoranjan; Avinash, K.; Gupta, M. R.

    2003-01-01

    Dust acoustic (DA) shock wave at high dust density, i.e., the dust electroacoustic (DEA) or dust Coulomb (DC) shock wave has been investigated incorporating the nonadiabatic dust charge variation. The nonlinear DEA (DC) shock wave is seen to be governed by the Korteweg-de Vries Burger equation, in which the Burger term is proportional to the nonadiabaticity generated dissipation. It is seen that the shock strength decreases but after reaching minimum, it increases as the dust space charge density |q d n d | increases and the shock strength of DA wave is greater than that of DEA (DC) wave. Moreover the DEA (DC) shock width increases appreciably with increase mass m i of the ion component of the dusty plasma but for DA shock wave the effect is weak

  20. [Influence of traffic restriction on road and construction fugitive dust].

    Science.gov (United States)

    Tian, Gang; Li, Gang; Qin, Jian-Ping; Fan, Shou-Bin; Huang, Yu-Hu; Nie, Lei

    2009-05-15

    By monitoring the road and construction dust fall continuously during the "Good Luck Beijing" sport events, the reduction of road and construction dust fall caused by traffic restriction was studied. The contribution rate of road and construction dust to particulate matter of Beijing atmosphere environment, and the emission ratio of it to total local PM10 emission were analyzed. The results show that the traffic restriction reduces road and construction dust fall significantly. The dust fall average value of ring roads was 0.27 g x (m2 x d)(-1) in the "traffic restriction" period, and the values were 0.81 and 0.59 g x (m2 x d)(-1) 1 month and 7 days before. The dust fall average value of major arterial and minor arterial was 0.21 g x (m2 x d)(-1) in the "traffic restriction" period, and the values were 0.54 and 0.58 g x (m2 x d)(-1) 1 month and 7 days before. The roads emission reduced 60%-70% compared with before traffic restriction. The dust fall average values of civil architecture and utility architecture were 0.61 and 1.06 g x (m2 x d)(-1) in the "traffic restriction" period, and the values were 1.15 and 1.55 g x (m2 x d)(-1) 20 days before. The construction dust reduced 30%-47% compared with 20 days before traffic restriction. Road and construction dust emission are the main source of atmosphere particulate matter in Beijing, and its contribution to ambient PM10 concentration is 21%-36%. PM10 emitted from roads and constructions account for 42%-72% and 30%-51% of local emission while the local PM10 account for 50% and 70% of the total emission.

  1. Parameterizing the interstellar dust temperature

    Science.gov (United States)

    Hocuk, S.; Szűcs, L.; Caselli, P.; Cazaux, S.; Spaans, M.; Esplugues, G. B.

    2017-08-01

    The temperature of interstellar dust particles is of great importance to astronomers. It plays a crucial role in the thermodynamics of interstellar clouds, because of the gas-dust collisional coupling. It is also a key parameter in astrochemical studies that governs the rate at which molecules form on dust. In 3D (magneto)hydrodynamic simulations often a simple expression for the dust temperature is adopted, because of computational constraints, while astrochemical modelers tend to keep the dust temperature constant over a large range of parameter space. Our aim is to provide an easy-to-use parametric expression for the dust temperature as a function of visual extinction (AV) and to shed light on the critical dependencies of the dust temperature on the grain composition. We obtain an expression for the dust temperature by semi-analytically solving the dust thermal balance for different types of grains and compare to a collection of recent observational measurements. We also explore the effect of ices on the dust temperature. Our results show that a mixed carbonaceous-silicate type dust with a high carbon volume fraction matches the observations best. We find that ice formation allows the dust to be warmer by up to 15% at high optical depths (AV> 20 mag) in the interstellar medium. Our parametric expression for the dust temperature is presented as Td = [ 11 + 5.7 × tanh(0.61 - log 10(AV) ]χuv1/5.9, where χuv is in units of the Draine (1978, ApJS, 36, 595) UV field.

  2. The relationship between gorgonian coral (Cnidaria: Gorgonacea) diseases and African dust storms

    Science.gov (United States)

    Weir-Brush, J. R.; Garrison, V.H.; Smith, G.W.; Shinn, E.A.

    2004-01-01

    The number of reports of coral diseases has increased throughout the world in the last 20 years. Aspergillosis, which primarily affects Gorgonia ventalina and G. flabellum, is one of the few diseases to be characterized. This disease is caused by Aspergillus sydowii, a terrestrial fungus with a worldwide distribution. Upon infection, colonies may lose tissue, and ultimately, mortality may occur if the infection is not sequestered. The spores of A. sydowii are African dust storms transport and deposit pathogens, we collected air samples from both dust storms and periods of nondust in St. John, U.S. Virgin Islands. Because we focused on fungal pathogens and used A. sydowii as a model, we isolated and cultured fungi on various types of media. Fungi including Aspergillus spp. were isolated from air samples taken from dust events and non-dust events. Twenty-three separate cultures and seven genera were isolated from dust event samples whereas eight cultures from five genera were isolated from non-dust air samples. Three isolates from the Virgin Islands dust event samples morphologically identified as Aspergillus spp. produced signs of aspergillosis in seafans, and the original pathogens were re-isolated from those diseased seafans fulfilling Koch's Postulates. This research supports the hypothesis that African dust storms transport across the Atlantic Ocean and deposit potential coral pathogens in the Caribbean.

  3. Large Salt Dust Storms Follow a 30-Year Rainfall Cycle in the Mar Chiquita Lake (Córdoba, Argentina.

    Directory of Open Access Journals (Sweden)

    Enrique H Bucher

    Full Text Available Starting in 2006, a new source of intense salt dust storms developed in Mar Chiquita (Córdoba, Argentina, the largest saline lake in South America. Storms originate from vast mudflats left by a 30-year expansion-retreat cycle of the lake due to changes in the regional rainfall regime. The annual frequency of salt dust storms correlated with the size of the salt mudflats. Events were restricted to the coldest months, and reached up to 800 km from the source. Occurrence of dust storms was associated with specific surface colors and textures easily identifiable in satellite images. High-emission surfaces were characterized by the presence of sodium sulfate hydrous/anhydrous crystals (mirabilite and thenardite, and a superficial and variable water table, which may result in the periodic development of a characteristic "fluffy" surface derived from salt precipitation-dissolution processes. HYSPLIT model simulation estimates a deposition maximum near the sources (of about 2.5 kg/ha/yr, and a decreasing trend from the emission area outwards, except for the relative secondary maximum modeled over the mountain ranges in southern Bolivia and northern Argentina due to an orographic effect. The 2009 total deposition of salt dust generated in Mar Chiquita was estimated at 6.5 million tons.

  4. Dust plume formation in the free troposphere and aerosol size distribution during the Saharan Mineral Dust Experiment in North Africa

    KAUST Repository

    Khan, Basit Ali

    2015-11-27

    Dust particles mixed in the free troposphere have longer lifetimes than airborne particles near the surface. Their cumulative radiative impact on earth’s meteorological processes and climate might be significant despite their relatively small contribution to total dust abundance. One example is the elevated dust-laden Saharan Air Layer (SAL) over the tropical and subtropical North Atlantic, which cools the sea surface. To understand the formation mechanisms of a dust layer in the free troposphere, this study combines model simulations and dust observations collected during the first stage of the Saharan Mineral Dust Experiment (SAMUM-I), which sampled dust events that extended from Morocco to Portugal, and investigated the spatial distribution and the microphysical, optical, chemical, and radiative properties of Saharan mineral dust. The Weather Research Forecast model coupled with the Chemistry/Aerosol module (WRF-Chem) is employed to reproduce the meteorological environment and spatial and size distributions of dust. The model domain covers northwest Africa and adjacent water with 5 km horizontal grid spacing and 51 vertical layers. The experiments were run from 20 May to 9 June 2006, covering the period of the most intensive dust outbreaks. Comparisons of model results with available airborne and ground-based observations show that WRF-Chem reproduces observed meteorological fields as well as aerosol distribution across the entire region and along the airplane’s tracks. Several mechanisms that cause aerosol entrainment into the free troposphere are evaluated and it is found that orographic lifting, and interaction of sea breeze with the continental outflow are key mechanisms that form a surface-detached aerosol plume over the ocean. The model dust emission scheme is tuned to simultaneously fit the observed total optical depth and the ratio of aerosol optical depths generated by fine and coarse dust modes. Comparisons of simulated dust size distributions with

  5. Dust plume formation in the free troposphere and aerosol size distribution during the Saharan Mineral Dust Experiment in North Africa

    Directory of Open Access Journals (Sweden)

    Basit Khan

    2015-11-01

    Full Text Available Dust particles mixed in the free troposphere have longer lifetimes than airborne particles near the surface. Their cumulative radiative impact on earth's meteorological processes and climate might be significant despite their relatively small contribution to total dust abundance. One example is the elevated dust-laden Saharan Air Layer (SAL over the tropical and subtropical North Atlantic, which cools the sea surface. To understand the formation mechanisms of a dust layer in the free troposphere, this study combines model simulations and dust observations collected during the first stage of the Saharan Mineral Dust Experiment (SAMUM-I, which sampled dust events that extended from Morocco to Portugal, and investigated the spatial distribution and the microphysical, optical, chemical, and radiative properties of Saharan mineral dust. The Weather Research Forecast model coupled with the Chemistry/Aerosol module (WRF-Chem is employed to reproduce the meteorological environment and spatial and size distributions of dust. The model domain covers northwest Africa and adjacent water with 5 km horizontal grid spacing and 51 vertical layers. The experiments were run from 20 May to 9 June 2006, covering the period of the most intensive dust outbreaks. Comparisons of model results with available airborne and ground-based observations show that WRF-Chem reproduces observed meteorological fields as well as aerosol distribution across the entire region and along the airplane's tracks. Several mechanisms that cause aerosol entrainment into the free troposphere are evaluated and it is found that orographic lifting, and interaction of sea breeze with the continental outflow are key mechanisms that form a surface-detached aerosol plume over the ocean. The model dust emission scheme is tuned to simultaneously fit the observed total optical depth and the ratio of aerosol optical depths generated by fine and coarse dust modes. Comparisons of simulated dust size

  6. Methodological approaches to perform a site specific PSA on the effects of comprehensive events; Methodische Ansaetze zur Durchfuehrung einer standortspezifischen PSA zu den Auswirkungen uebergreifender Einwirkungen

    Energy Technology Data Exchange (ETDEWEB)

    Tuerschmann, Michael; Sperbeck, Silvio; Frey, Walter

    2016-12-15

    Main objective of the project 3612R01550 performed on behalf of the Federal Ministry for the Environment, Nature Conservation, Building and Nuclear Safety (BMUB) is the development of an approach for systematic consideration of dependencies in case of internal and external hazards and their combinations in the probabilistic plant model for nuclear power plants. One of the major aspects of a site specific Level 1 PSA carried out for a nuclear power plant outlined in this report is taking comprehensively into account the entire risks resulting from internal and external hazards. In a first step, all the hazards which may occur at the site under investigation have to be identified. This requires a compilation of the potential hazards and their possible combinations: Based on this compilation of generic hazards a site specific list of hazards to be considered in the analysis can be derived based on a screening process taking into account regulatory requirements and insights from site and plant walk-downs. In a second step, the hazards to be considered for the specific site have to be classified with respect to the depth of the probabilistic analyses to be carried out. This classification covers three categories: hazards with a negligible contribution to the overall risk, hazards with such a low risk contribution that a rough quantitative assessment is sufficient, and hazards which need in-depth probabilistic analysis. Based on the available Level 1 PSA model for internal events, a systematic approach for in-depth probabilistic analyses of hazards and their combinations is proposed. In this context, lists of those structures, systems and components, which can be impaired in their required function resulting in a risk increase, are provided. One of these lists contains the equipment, the other one the dependencies to be considered for the corresponding hazard. In addition to the general approach for performing site specific PSA, a procedure for modelling dependencies in

  7. Ecological Restoration Programs Induced Amelioration of the Dust Pollution in North China Plain

    Science.gov (United States)

    Long, X.; Tie, X.; Li, G.; Junji, C.

    2017-12-01

    With Moderate Resolution Imaging Spectroradiometer (MODIS) land cover product (MCD12Q1), we quantitatively evaluate the ecological restoration programs (ERP) induced land cover change in China by calculating gridded the land use fraction (LUF). We clearly capture two obvious vegetation (grass and forest) protective barriers arise between the dust source region DSR and North China Plain NCP from 2011 to 2013. The WRF-DUST model is applied to investigate the impact of ERPs on dust pollution from 2 to 8 March 2016, corresponding to a national dust storm event over China. Despite some model biases, the WRF-DUST model reasonably reproduced the temporal variations of dust storm event, involving IOA of 0.96 and NMB of 2% for DSR, with IOA of 0.83 and NMB of -15% for downwind area of NCP. Generally, the WRF-DUST model well capture the spatial variations and evolutions of dust storm events with episode-average [PMC] correlation coefficient (R) of 0.77, especially the dust storm outbreak and transport evolution, involving daily average [PMC] R of 0.9 and 0.73 on 4-5 March, respectively. It is found that the ERPs generally reduce the dust pollution in NCP, especially for BTH, involving upper dust pollution control benefits of -15.3% (-21.0 μg m-3) for BTH, and -6.2% (-9.3 μg m-3) for NCP. We are the first to conduct model sensitivity studies to quantitatively evaluate the impacts of the ERPs on the dust pollution in NCP. And our narrative is independently based on first-hand sources, whereas government statistics.

  8. Synergistic Use of Remote Sensing and Modeling for Tracing Dust Storms in the Mediterranean

    Directory of Open Access Journals (Sweden)

    D. G. Kaskaoutis

    2012-01-01

    Full Text Available This study focuses on the detection of the dust source region and monitoring of the transport of the dust plume from its primary outflow to final deposition. The application area is the Sahara desert and the eastern Mediterranean, where two dust events occurred during the period 4–6 February 2009, an unusual event for a winter period. The Aqua-MODIS and OMI observations clearly define the spatial distribution of the dust plumes, while the CALIPSO observations of total attenuated backscatter (TAB at 532 nm, depolarization ratio (DR, and attenuated color ratio (1064/532 nm on 5 February 2009 provide a clear view and vertical structure of the dust-laden layer. The dust source region is defined to be near the Chad-Niger-Libyan borders, using satellite observations and model (DREAM output. This dust plume is vertically extended up to 2.5 km and is observed as a mass plume of dust from surface level to that altitude, where the vertical variation of TAB (0.002 to 0.2 and DR (0.2–0.5 implies dust-laden layer with non-spherical particles. CALIPSO profiles show that after the dust plume reached at its highest level, the dust particles start to be deposited over the Mediterranean and the initial dust plume was strongly attenuated, while features of dust were limited below about 1–1.5 km for latitudes northern of ~36° (Greek territory.

  9. Adverse life events, area socioeconomic disadvantage, and psychopathology and resilience in young children: the importance of risk factors' accumulation and protective factors' specificity.

    Science.gov (United States)

    Flouri, Eirini; Tzavidis, Nikos; Kallis, Constantinos

    2010-06-01

    Few studies on resilience in young children model risk appropriately and test theory-led hypotheses about its moderation. This study addressed both issues. Our hypothesis was that for preschool children's emotional/behavioral adjustment in the face of contextual risk protective factors should be located in the cognitive domain. Data were from the first two sweeps of the UK's Millennium Cohort Study. The final study sample was 4,748 three-year-old children clustered in 1,549 Lower layer Super Output Areas in nine strata. Contextual risk was measured at both area (with the Index of Multiple Deprivation) and family (with proximal and distal adverse life events experienced) level. Moderator variables were parenting, verbal and non-verbal ability, developmental milestones, and temperament. Multivariate multilevel models-that allowed for correlated residuals at both individual and area level-and univariate multilevel models estimated risk effects on specific and broad psychopathology. At baseline, proximal family risk, distal family risk and area risk were all associated with broad psychopathology, although the most parsimonious was the proximal family risk model. The area risk/broad psychopathology association remained significant even after family risk was controlled but not after family level socioeconomic disadvantage was controlled. The cumulative family risk was more parsimonious than the specific family risks model. Non-verbal ability moderated the effect of proximal family risk on conduct and emotional problems, and developmental milestones moderated the effect of proximal family risk on conduct problems. The findings highlight the importance of modeling contextual risk appropriately and of locating in the cognitive domain factors that buffer its effect on young children's adjustment.

  10. Comparative mRNA and microRNA expression profiling of three genitourinary cancers reveals common hallmarks and cancer-specific molecular events.

    Directory of Open Access Journals (Sweden)

    Xianxin Li

    Full Text Available Genome-wide gene expression profile using deep sequencing technologies can drive the discovery of cancer biomarkers and therapeutic targets. Such efforts are often limited to profiling the expression signature of either mRNA or microRNA (miRNA in a single type of cancer.Here we provided an integrated analysis of the genome-wide mRNA and miRNA expression profiles of three different genitourinary cancers: carcinomas of the bladder, kidney and testis.Our results highlight the general or cancer-specific roles of several genes and miRNAs that may serve as candidate oncogenes or suppressors of tumor development. Further comparative analyses at the systems level revealed that significant aberrations of the cell adhesion process, p53 signaling, calcium signaling, the ECM-receptor and cell cycle pathways, the DNA repair and replication processes and the immune and inflammatory response processes were the common hallmarks of human cancers. Gene sets showing testicular cancer-specific deregulation patterns were mainly implicated in processes related to male reproductive function, and general disruptions of multiple metabolic pathways and processes related to cell migration were the characteristic molecular events for renal and bladder cancer, respectively. Furthermore, we also demonstrated that tumors with the same histological origins and genes with similar functions tended to group together in a clustering analysis. By assessing the correlation between the expression of each miRNA and its targets, we determined that deregulation of 'key' miRNAs may result in the global aberration of one or more pathways or processes as a whole.This systematic analysis deciphered the molecular phenotypes of three genitourinary cancers and investigated their variations at the miRNA level simultaneously. Our results provided a valuable source for future studies and highlighted some promising genes, miRNAs, pathways and processes that may be useful for diagnostic or

  11. Lead in Chinese villager house dust: Geographical variation and influencing factors

    International Nuclear Information System (INIS)

    Bi, Xiangyang; Liu, Jinling; Han, Zhixuan; Yang, Wenlin

    2015-01-01

    House dust has been recognized as an important contributor to Pb exposure of children. Here we conducted a comprehensive study to investigate geographical variation of Pb in Chinese villager house dust. The influences of outdoor soil Pb concentrations, dates of construction, house decoration materials, heating types, and site specific pollution on Pb concentrations in house dust were evaluated. The concentrations of Pb in 477 house dust samples collected from twenty eight areas throughout China varied from 12 to 2510 mg/kg, with a median concentration of 42 mg/kg. The median Pb concentrations in different geographical areas ranged from 16 (Zhangjiakou, Hebei) to 195 mg/kg (Loudi, Hunan). No correlations were found between the house dust Pb concentrations and the age of houses, as well as house decoration materials. Whereas outdoor soil, coal combustion, and site specific pollution may be potential Pb sources. Principal component analysis (PCA) confirmed that elemental compositions of the house dust were controlled by both anthropogenic and geogenic sources. Using scanning electron microscopy (SEM), the Pb bearing particles in the house dust were also studied. - Highlights: • Geographical variation in house dust Pb concentrations were observed. • Dust Pb concentrations were not associated with house age and decoration materials. • Soil, coal combustion, and site specific pollution were potential Pb sources. • Pb bearing particles were identified by SEM-EDX. - The variations of Pb in Chinese villager house dust were controlled by outdoor soil, coal combustion, and site specific pollution sources.

  12. Is 4/20 an Event-Specific Marijuana Holiday? A Daily Diary Investigation of Marijuana Use and Consequences Among College Students.

    Science.gov (United States)

    Bravo, Adrian J; Pearson, Matthew R; Conner, Bradley T; Parnes, Jamie E

    2017-01-01

    Given the popular association between April 20 ("4/20") and marijuana, the present study examined marijuana use and consequences on 4/20 compared with other days in order to test whether 4/20 is a high-risk, event-specific marijuana use holiday among college student marijuana users. Fifty-nine college student marijuana users from three different, large U.S. universities located in Virginia, New Mexico, and Colorado completed daily brief surveys (<10 minutes) over a 12-day (April 15-April 26) period assessing prior-day marijuana use (i.e., percentage of users who consumed marijuana, number of unique marijuana use sessions, subjective high/intoxication while under the influence of marijuana, and number of grams of marijuana consumed) and marijuana-related consequences. Using oneway repeated-measures analyses of variance, we found that (a) 50% of students reported using marijuana on 4/20, which was significantly more than weekdays (28%) and weekend days (37%); (b) students reported a significantly higher number of unique marijuana use sessions on 4/20 (M = 1.47) compared with weekdays (M = 0.91); and (c) students reported a significantly higher number of grams consumed on 4/20 (M = 0.79) compared with weekdays (M = 0.35) and weekend days (M = 0.47). Our study provides preliminary support that 4/20 is a day associated with increased marijuana use but provides little evidence for an association with more problematic use.

  13. Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

  14. Adaptation of the DP 50 dust meter for measuring dust content under isokinetic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Vitek, J.; Novak, L.

    1985-03-01

    The DP 50 dust meter, developed by the Scientific Coal Research Institute Ostrava-Radvanice, is used for measuring dust content in the air in underground coal mines. Two versions of the system are used: a type developed in 1970 which is placed in a vertical position and used to measure the content of respirable coal particles in the air; and a type developed in 1983 for isokinetic measurement of dust content in the air. The latter is equipped with 8 cone-shaped adapters (with differing size and dimensions of the cone inlet adjusted to air flow rates from 0.25 to 8.00 m/s). Specifications of the 8 adapters are given in a table. The 1983 version of the DP 50 is placed in a horizontal position with the dust meter axis parallel to the direction of air flow ventilating a mine working. Recommendations for installation of dust meters in underground workings and effects of installation on measurement accuracy are discussed. 16 references.

  15. Simulation and analysis of synoptic scale dust storms over the Arabian Peninsula

    Science.gov (United States)

    Beegum, S. Naseema; Gherboudj, Imen; Chaouch, Naira; Temimi, Marouane; Ghedira, Hosni

    2018-01-01

    Dust storms are among the most severe environmental problems in arid and semi-arid regions of the world. The predictability of seven dust events, viz. D1: April 2-4, 2014; D2: February 23-24, 2015; D3: April 1-3, 2015; D4: March 26-28, 2016; D5: August 3-5, 2016; D6: March 13-14, 2017 and D7:March 19-21, 2017, are investigated over the Arabian Peninsula using a regionally adapted chemistry transport model CHIMERE coupled with the Weather Research and Forecast (WRF) model. The hourly forecast products of particulate matter concentrations (PM10) and aerosol optical depths (AOD) are compared against both satellite-based (MSG/SEVRI RGB dust, MODIS Deep Blue Aerosol Optical Depth: DB-AOD, Ozone Monitoring Instrument observed UV Aerosol Absorption Index: OMI-AI) and ground-based (AERONET AOD) remote sensing products. The spatial pattern and the time series of the simulations show good agreement with the observations in terms of the dust intensity as well as the spatiotemporal distribution. The causative mechanisms of these dust events are identified by the concurrent analyses of the meteorological data. From these seven storms, five are associated with synoptic scale meteorological processes, such as prefrontal storms (D1 and D7), postfrontal storms of short (D2), and long (D3) duration types, and a summer shamal storm (D6). However, the storms D4 and D6 are partly associated with mesoscale convective type dust episodes known as haboobs. The socio-economic impacts of the dust events have been assessed by estimating the horizontal visibility, air quality index (AQI), and the dust deposition flux (DDF) from the forecasted dust concentrations. During the extreme dust events, the horizontal visibility drops to near-zero values co-occurred withhazardous levels of AQI and extremely high dust deposition flux (250 μg cm- 2 day- 1).

  16. Dust in H II regions

    International Nuclear Information System (INIS)

    Isobe, S.

    1977-01-01

    Several pieces of evidence indicate that H II regions may contain dust: 1) the continuum light scattered by dust grains (O'Dell and Hubbard, 1965), 2) thermal radiation from dust grains at infrared wavelengths (Ney and Allen, 1969), 3) the abnormal helium abundance in some H II regions (Peimbert and Costero, 1969), etc. Although observations of the scattered continuum suggest that the H II region cores may be dust-free, dust grains and gas must be well mixed in view of the infrared observations. This difficulty may be solved by introducing globules with sizes approximately 0.001 pc. These globules and the molecular clouds adjacent to H II regions are the main sources supplying dust to H II regions. (Auth.)

  17. Large Aperture Electrostatic Dust Detector

    International Nuclear Information System (INIS)

    Skinner, C.H.; Hensley, R.; Roquemore, A.L.

    2007-01-01

    Diagnosis and management of dust inventories generated in next-step magnetic fusion devices is necessary for their safe operation. A novel electrostatic dust detector, based on a fine grid of interlocking circuit traces biased to 30 or 50 v has been developed for the detection of dust particles on remote surfaces in air and vacuum environments. Impinging dust particles create a temporary short circuit and the resulting current pulse is recorded by counting electronics. Up to 90% of the particles are ejected from the grid or vaporized suggesting the device may be useful for controlling dust inventories. We report measurements of the sensitivity of a large area (5x5 cm) detector to microgram quantities of dust particles and review its applications to contemporary tokamaks and ITER.

  18. Photoelectric charging of dust grains

    International Nuclear Information System (INIS)

    Ignatov, A. M.

    2009-01-01

    Photoemission from the surface of a dust grain in vacuum is considered. It is shown that the cutoff in the energy spectrum of emitted electrons leads to the formation of a steady-state electron cloud. The equation describing the distribution of the electric potential in the vicinity of a dust grain is solved numerically. The dust grain charge is found as a function of the grain size.

  19. Modelling soil dust aerosol in the Bodélé depression during the BoDEx campaign

    OpenAIRE

    I. Tegen; B. Heinold; M. Todd; J. Helmert; R. Washington; O. Dubovik; O. Dubovik

    2006-01-01

    We present regional model simulations of the dust emission events during the Bodélé Dust Experiment (BoDEx) that was carried out in February and March 2005 in Chad. A box model version of the dust emission model is used to test different input parameters for the emission model, and to compare the dust emissions computed with observed wind speeds to those calculated with wind speeds from the regional model simulation. While field observations indicate that dust production occurs via self-abras...

  20. Modelling soil dust aerosol in the Bodélé depression during the BoDEx campaign

    OpenAIRE

    Tegen , I.; Heinold , B.; Todd , M.; Helmert , J.; Washington , R.; Dubovik , O.

    2006-01-01

    International audience; We present regional model simulations of the dust emission events during the Bodélé Dust Experiment (BoDEx) that was carried out in February and March 2005 in Chad. A box model version of the dust emission model is used to test different input parameters for the emission model, and to compare the dust emissions computed with observed wind speeds to those calculated with wind speeds from the regional model simulation. While field observations indicate that dust producti...

  1. Modelling soil dust aerosol in the Bodélé depression during the BoDEx campaign

    OpenAIRE

    R. Washington; J. Helmert; M. Todd; B. Heinold; I. Tegen; O. Dubovik

    2006-01-01

    We present regional model simulations of the dust emission events during the Bodélé Dust Experiment (BoDEx) that was carried out in February and March 2005 in Chad. A box model version of the dust emission model is used to test different input parameters for the emission model, and to compare the dust emissions computed with observed wind speeds to those calculated with wind speeds from the regional model simulation. While field observations indicate that dust production occurs via ...

  2. Dust in cosmic plasma environments

    International Nuclear Information System (INIS)

    Mendis, D.A.

    1979-01-01

    Cosmic dust is invariably immersed in a plasma and a radiative environment. Consequently, it is charged to some electrostatic potential which depends on the properties of the environment as well as the nature of the dust. This charging affects the physical and dynamical properties of the dust. In this paper the basic aspects of this dust-plasma interaction in several cosmic environments - including planetary magnetospheres, the heliosphere and the interstellar medium - are discussed. The physical and dynamical consequences of the interaction, as well as the pertinent observational evidence, are reviewed. Finally, the importance of the surface charge during the condensation process in plasma environments is stressed. (Auth.)

  3. Aerosol-ozone correlations during dust transport episodes

    Directory of Open Access Journals (Sweden)

    P. Bonasoni

    2004-01-01

    Full Text Available Its location in the Mediterranean region and its physical characteristics render Mt. Cimone (44°11′ N, 10°42′ E, the highest peak of the Italian northern Apennines (2165 m asl, particularly suitable to study the transport of air masses from the north African desert area to Europe. During these northward transports 12 dust events were registered in measurements of the aerosol concentration at the station during the period June–December 2000, allowing the study of the impact of mineral dust transports on free tropospheric ozone concentrations, which were also measured at Mt. Cimone. Three-dimensional backward trajectories were used to determine the air mass origin, while TOMS Aerosol Index data for the Mt. Cimone area were used to confirm the presence of absorbing aerosol over the measurement site. A trajectory statistical analysis allowed identifying the main source areas of ozone and aerosols. The analysis of these back trajectories showed that central Europe and north and central Italy are the major pollution source areas for ozone and fine aerosol, whereas the north African desert regions were the most important source areas for coarse aerosol and low ozone concentrations. During dust events, the Mt. Cimone mean volume concentration for coarse particles was 6.18 µm3/cm3 compared to 0.63 µm3/cm3 in dust-free conditions, while the ozone concentrations were 4% to 21% lower than the monthly mean background values. Our observations show that surface ozone concentrations were lower than the background values in air masses coming from north Africa, and when these air masses were also rich in coarse particles, the lowest ozone values were registered. Moreover, preliminary results on the possible impact of the dust events on PM10 and ozone values measured in Italian urban and rural areas showed that during the greater number of the considered dust events, significant PM10 increases and ozone decreases have occurred in the Po valley.

  4. Austrian emission inventory for dust

    International Nuclear Information System (INIS)

    Winiwarter, W.; Trenker, C.; Hoeflinger, W.

    2001-09-01

    For the first time, Austrian emissions of anthropogenic particulate matter emissions to the atmosphere have been estimated. Results have been reported as total suspended particles (TSP) as well as for the fractions of particles smaller than 10 μm or 2.5 μm aerodynamic diameter (PM 10 , PM 2.5 ), respectively. Base years for the inventory were 1990, 1995 and 1999. Excluded from this assessment is wind blown dust, which has been considered a natural source here. National statistics have been applied, specifically those also used previously in the Austrian air pollution inventory (OLI). Emission factors have been taken from literature compilations, only for exceptional cases specific Austrian assessments were performed or original literature on emission measurements was consulted. Resuspension of dust by road traffic emerged as the most important source. For the size fraction of PM 10 this source contributed about half of the emissions, when applying the calculation scheme by the U.S. EPA. While this scheme is widely used and well documented, its validity is currently subject of intense scientific debate. As these results do not seem to coincide with ambient air measurements, resuspension of road dust is considered separately and not now included in the national total. The sum of all other sources increases from 75,000 t of TSP in 1990 and 1995 to 77,000 t in 1999, while both PM 10 and PM 2.5 exhibit decreasing tendency (at 45,000 t and 26,000 t in 1999, respectively). The increase in TSP derives from increasing traffic and friction related emissions (tire wear, break wear), decrease of the finer particulate matter is due to reductions in firewood consumption for domestic heating. Most important source sectors are fugitive emissions from material transfer in industry as well as the building industry and the tilling of agricultural land. Common to these sources is the high uncertainty of available data. Wood combustion is the most important of the non

  5. Age-specific risks, severity, time course, and outcome of bleeding on long-term antiplatelet treatment after vascular events: a population-based cohort study.

    Science.gov (United States)

    Li, Linxin; Geraghty, Olivia C; Mehta, Ziyah; Rothwell, Peter M

    2017-07-29

    Lifelong antiplatelet treatment is recommended after ischaemic vascular events, on the basis of trials done mainly in patients younger than 75 years. Upper gastrointestinal bleeding is a serious complication, but had low case fatality in trials of aspirin and is not generally thought to cause long-term disability. Consequently, although co-prescription of proton-pump inhibitors (PPIs) reduces upper gastrointestinal bleeds by 70-90%, uptake is low and guidelines are conflicting. We aimed to assess the risk, time course, and outcomes of bleeding on antiplatelet treatment for secondary prevention in patients of all ages. We did a prospective population-based cohort study in patients with a first transient ischaemic attack, ischaemic stroke, or myocardial infarction treated with antiplatelet drugs (mainly aspirin based, without routine PPI use) after the event in the Oxford Vascular Study from 2002 to 2012, with follow-up until 2013. We determined type, severity, outcome (disability or death), and time course of bleeding requiring medical attention by face-to-face follow-up for 10 years. We estimated age-specific numbers needed to treat (NNT) to prevent upper gastrointestinal bleeding with routine PPI co-prescription on the basis of Kaplan-Meier risk estimates and relative risk reduction estimates from previous trials. 3166 patients (1582 [50%] aged ≥75 years) had 405 first bleeding events (n=218 gastrointestinal, n=45 intracranial, and n=142 other) during 13 509 patient-years of follow-up. Of the 314 patients (78%) with bleeds admitted to hospital, 117 (37%) were missed by administrative coding. Risk of non-major bleeding was unrelated to age, but major bleeding increased steeply with age (≥75 years hazard ratio [HR] 3·10, 95% CI 2·27-4·24; pbleeds (5·53, 2·65-11·54; pbleeds (≥75 years HR 4·13, 2·60-6·57; pbleeds were mostly disabling or fatal (45 [62%] of 73 patients vs 101 [47%] of 213 patients with recurrent ischaemic stroke), and outnumbered

  6. Results of evaluation of tailing dumps dust intensity

    Directory of Open Access Journals (Sweden)

    Masloboev V. A.

    2016-03-01

    Full Text Available A set of most acceptable and well-known methods of dust intensity evaluation has been defined and tested (dependence of Westphal D. L. et al. and DEAD scheme based on the analysis of exiting approaches (deserts, tailing dumps, etc.. The description of the chosen methods has been given. The determination of dynamic velocity u* and velocity at the height of +10 m above the dusting surface u10 which are necessary to evaluate the dust intensity has been demonstrated. The method is based on two-dimensional numerical model of atmosphere aerodynamics in the area of "tailing dumps of ANOF-2 ‒ the town of Apatity". The study provides calculations of horizontal velocity at the height of +10 m above the dusting surface at the wind speed varying from 5 to 23 m/sec. The work also suggests the results of graphical data processing related to tailing grain size distribution from the surface of the firmly established surface of the tailing dumps of ANOF-2. Comparative analysis has been given and the peculiarities of interval (based on grains sizes dust intensity of the tailing dumps of ANOF-2 have been shown using the dependence of Westphal D. L. et al. and DEAD scheme within the wind speed range. The received values of dust intensity at the lower range limit are close to the "maximum specific dust off" value which is used by project specialists for documentation development

  7. Improvement of cement plant dust emission by bag filter system

    Science.gov (United States)

    Wahyu Purnomo, Chandra; Budhijanto, Wiratni; Alfisyah, Muziibu; Triyono

    2018-03-01

    The limestone quarry in PT Indocement Tunggal Prakarsa (ITP) in Cirebon is considered as a complex quarry in terms of chemical composition and material hardness. From the beginning of the plant operation up to the end of 2015, the dust removal was rely on electrostatic precipitator (EP) system. Whenever limestone from specific quarry zones were incorporated into Raw Mill (RM) feed or there was an upset condition, the dust emission increased significantly. Beside higher demand of electricity, an EP system requires lower gas inlet temperature in order to remove the dust effectively which requires larger cooling water in the previous gas conditioning tower to cool down gas from 400 °C to about 100 °C. By considering the drawbacks, the EP system was replaced by a bag filter (BF) system. The BF allows higher temperature of gas inlet and it has higher dust removal efficiency. In this study, the efficiency of the two different dust removal systems is compared. The effect of process variables i.e. RM feed, kiln feed, inlet temperature and pressure, and small size particle fraction to the dust emission are studied by multivariate linier regression analysis. It is observed that the BF system can reduce significantly the dust emission from 30 to 6 mg/m3 and in the same time reducing CO2 emission by 0.24 ton/year from the electricity consumption saving.

  8. Gravitational radiation from dust

    International Nuclear Information System (INIS)

    Isaacson, R.A.; Welling, J.S.; Winicour, J.

    1985-01-01

    A dust cloud is examined within the framework of the general relativistic characteristic initial value problem. Unique gravitational initial data are obtained by requiring that the space-time be quasi-Newtonian. Explicit calculations of metric and matter fields are presented, which include all post-Newtonian corrections necessary to discuss the major physical properties of null infinity. These results establish a curved space version of the Einstein quadrupole formula, in the form ''news function equals third time derivative of transverse quadrupole moment,'' for this system. However, these results imply that some weakened notion of asymptotic flatness is necessary for the description of quasi-Newtonian systems

  9. Dust coagulation in ISM

    Science.gov (United States)

    Chokshi, Arati; Tielens, Alexander G. G. M.; Hollenbach, David

    1989-01-01

    Coagulation is an important mechanism in the growth of interstellar and interplanetary dust particles. The microphysics of the coagulation process was theoretically analyzed as a function of the physical properties of the coagulating grains, i.e., their size, relative velocities, temperature, elastic properties, and the van der Waal interaction. Numerical calculations of collisions between linear chains provide the wave energy in individual particles and the spectrum of the mechanical vibrations set up in colliding particles. Sticking probabilities are then calculated using simple estimates for elastic deformation energies and for the attenuation of the wave energy due to absorption and scattering processes.

  10. Saharan dust levels in Greece and received inhalation doses

    Directory of Open Access Journals (Sweden)

    C. Mitsakou

    2008-12-01

    Full Text Available The desert of Sahara is one of the major sources of mineral dust on Earth, producing around 2×108 tons/yr. Under certain weather conditions, dust particles from Saharan desert get transported over the Mediterranean Sea and most of Europe. The limiting values set by the directive EC/30/1999 of European Union can easily be exceeded by the transport of desert dust particles in the south European Region and especially in urban areas, where there is also significant contribution from anthropogenic sources. In this study, the effects of dust transport on air quality in several Greek urban areas are quantified. PM10 concentration values from stationary monitoring stations are compared to dust concentrations for the 4-year period 2003–2006. The dust concentration values in the Greek areas were estimated by the SKIRON modelling system coupled with embedded algorithms describing the dust cycle. The mean annual dust contribution to daily-averaged PM10 concentration values was found to be around or even greater than 10% in the urban areas throughout the years examined. Natural dust transport may contribute by more than 20% to the annual number of exceedances – PM10 values greater than EU limits – depending on the specific monitoring location. In a second stage of the study, the inhaled lung dose received by the residents in various Greek locations is calculated. The particle deposition efficiency of mineral dust at the different parts of the human respiratory tract is determined by applying a lung dosimetry numerical model, which incorporates inhalation dynamics and aerosol physical processes. The inhalation dose from mineral dust particles was greater in the upper respiratory system (extrathoracic region and less significant in the lungs, especially in the sensitive alveolar region. However, in cases of dust episodes, the amounts of mineral dust deposited along the human lung are comparable to those

  11. Dust confinement and dust acoustic waves in a magnetized plasma

    Science.gov (United States)

    Piel, A.

    2005-10-01

    Systematic laboratory experiments on dust acoustic waves require the confinement of dust particles. Here we report on new experiments in a magnetized plasma region in front of an additional positively biased disk electrode in a background plasma which is generated in argon at 27MHz between a disk and grid electrode. The plasma diffuses through the grid along the magnetic field. The three-dimensional dust distribution is measured with a horizontal sheet of laser light and a CCD camera, which are mounted on a vertical translation stage. Depending on magnetic field and discharge current, cigar or donut-shaped dust clouds are generated, which tend to rotate about the magnetic field direction. Measurements with emissive probes show that the axial confinement of dust particles with diameters between 0.7-2 μm is achieved by a balance of ion-drag force and electric field force. Dust levitation and radial confinement is due to a strong radial electric field. Dust acoustic waves are destabilized by the ion flow or can be stimulated by a periodic bias on the disk electrode. The observed wave dispersion is compared with fluid and kinetic models of the dust acoustic wave.

  12. Gravimetric dust sampling for control purposes and occupational dust sampling.

    CSIR Research Space (South Africa)

    Unsted, AD

    1997-02-01

    Full Text Available Prior to the introduction of gravimetric dust sampling, konimeters had been used for dust sampling, which was largely for control purposes. Whether or not absolute results were achievable was not an issue since relative results were used to evaluate...

  13. Global transport of thermophilic bacteria in atmospheric dust.

    Science.gov (United States)

    Perfumo, Amedea; Marchant, Roger

    2010-04-01

    Aerosols from dust storms generated in the Sahara-Sahel desert area of Africa are transported north over Europe and periodically result in dry dust precipitation in the Mediterranean region. Samples of dust collected in Turkey and Greece following two distinct desert storm events contained viable thermophilic organisms of the genus Geobacillus, namely G. thermoglucosidasius and G. thermodenitrificans, and the recently reclassified Aeribacillus pallidus (formerly Geobacillus pallidus). We present here evidence that African dust storms create an atmospheric bridge between distant geographical regions and that they are also probably the source of thermophilic geobacilli later deposited over northern Europe by rainfall or dust plumes themselves. The same organisms (99% similarity in the 16S rDNA sequence) were found in dust collected in the Mediterranean region and inhabiting cool soils in Northern Ireland. This study also contributes new insights to the taxonomic identification of Geobacillus sp. Attempts to identify these organisms using 16S rRNA gene sequences have revealed that they contain multiple and diverse copies of the ribosomal RNA operon (up to 10 copies with nine different sequences), which dictates care in interpreting data about the systematics of this genus. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  14. Systematic characterization of structural, dynamical and electrical properties of dust devils and implications for dust lifting processes

    Science.gov (United States)

    Franzese, Gabriele; Esposito, Francesca; Lorenz, Ralph D.; Popa, Ciprian; Silvestro, Simone; Deniskina, Natalia; Cozzolino, Fabio

    2017-04-01

    Dust devils are convective vortices able to lift sand and dust grains from the soil surface, even in conditions of low wind speed environment. They have been observed not only on Earth but also on other planets of the solar system; in particular, they are largely studied on Mars. Indeed, the contribution of the dust devils to the Martian climate is a highly debated question. In order to investigate this topic, it is important to understand the nature of the dust lifting mechanism by the vortex and characterize the induced electric field. As part of the development process of DREAMS, the meteorological station on board the Schiapparelli lander of the ExoMars 2016 mission, and of the Dust complex package of the ExoMars 2020 mission, we performed various field campaigns in the Sahara desert (Tafilalt region, Morocco). We deployed a fully equipped meteorological station and, during the 2014 summer, we observed three months of dust devils activity, collecting almost six hundreds events. For each dust devil, we monitored the horizontal wind speed and direction, the vertical wind speed, the pressure drop due to the vortex core, the temperature, the induced electric field and the concentration of dust lifted. This data set is unique in literature and represents up to now the most comprehensive one available for the dusty convective vortices. Here we will present the analysis of the Moroccan data with particular emphasis on the study of the atmospheric electric field variations due to the passage of the vortices. The distribution of the vortex parameters (wind speed and direction, pressure, E-field and dust lifted) are showed and compared, when possible, to the ones observed by the Martian surveys. The connection between the E-field and the other parameters will be presented. In the terrestrial environment, the development of the convective vortices is restricted by the presence of the vegetation and of the urban areas, hence dust devils can impact the climate only on local

  15. Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

    Science.gov (United States)

    Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

    2009-08-26

    Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

  16. Effect of ecological restoration programs on dust concentrations in the North China Plain: a case study

    Science.gov (United States)

    Long, Xin; Tie, Xuexi; Li, Guohui; Cao, Junji; Feng, Tian; Zhao, Shuyu; Xing, Li; An, Zhisheng

    2018-05-01

    In recent decades, the Chinese government has made a great effort in initiating large-scale ecological restoration programs (ERPs) to reduce the dust concentrations in China, especially for dust storm episodes. Using the Moderate Resolution Imaging Spectroradiometer (MODIS) land cover product, the ERP-induced land cover changes are quantitatively evaluated in this study. Two obvious vegetation protective barriers arise throughout China from the southwest to the northeast, which are well known as the Green Great Wall (GGW). Both the grass GGW and forest GGW are located between the dust source region (DSR) and the densely populated North China Plain (NCP). To assess the effect of ERPs on dust concentrations, a regional transport/dust model (WRF-DUST, Weather Research and Forecast model with dust) is applied to investigate the evolution of dust plumes during a strong dust storm episode from 2 to 8 March 2016. The WRF-DUST model generally performs reasonably well in reproducing the temporal variations and spatial distributions of near-surface [PMC] (mass concentration of particulate matter with aerodynamic diameter between 2.5 and 10 µm) during the dust storm event. Sensitivity experiments have indicated that the ERP-induced GGWs help to reduce the dust concentration in the NCP, especially in BTH (Beijing, Tianjin, and Hebei). When the dust storm is transported from the upwind DSR to the downwind NCP, the [PMC] reduction ranges from -5 to -15 % in the NCP, with a maximum reduction of -12.4 % (-19.2 µg m-3) in BTH and -7.6 % (-10.1 µg m-3) in the NCP. We find the dust plumes move up to the upper atmosphere and are transported from the upwind DSR to the downwind NCP, accompanied by dust decrease. During the episode, the forest GGW is nonsignificant in dust concentration control because it is of benefit for dry deposition and not for emission. Conversely, the grass GGW is beneficial in controlling dust erosion and is the dominant reason for [PMC] decrease in the NCP

  17. Effect of ecological restoration programs on dust concentrations in the North China Plain: a case study

    Directory of Open Access Journals (Sweden)

    X. Long

    2018-05-01

    Full Text Available In recent decades, the Chinese government has made a great effort in initiating large-scale ecological restoration programs (ERPs to reduce the dust concentrations in China, especially for dust storm episodes. Using the Moderate Resolution Imaging Spectroradiometer (MODIS land cover product, the ERP-induced land cover changes are quantitatively evaluated in this study. Two obvious vegetation protective barriers arise throughout China from the southwest to the northeast, which are well known as the Green Great Wall (GGW. Both the grass GGW and forest GGW are located between the dust source region (DSR and the densely populated North China Plain (NCP. To assess the effect of ERPs on dust concentrations, a regional transport/dust model (WRF-DUST, Weather Research and Forecast model with dust is applied to investigate the evolution of dust plumes during a strong dust storm episode from 2 to 8 March 2016. The WRF-DUST model generally performs reasonably well in reproducing the temporal variations and spatial distributions of near-surface [PMC] (mass concentration of particulate matter with aerodynamic diameter between 2.5 and 10 µm during the dust storm event. Sensitivity experiments have indicated that the ERP-induced GGWs help to reduce the dust concentration in the NCP, especially in BTH (Beijing, Tianjin, and Hebei. When the dust storm is transported from the upwind DSR to the downwind NCP, the [PMC] reduction ranges from −5 to −15 % in the NCP, with a maximum reduction of −12.4 % (−19.2 µg m−3 in BTH and −7.6 % (−10.1 µg m−3 in the NCP. We find the dust plumes move up to the upper atmosphere and are transported from the upwind DSR to the downwind NCP, accompanied by dust decrease. During the episode, the forest GGW is nonsignificant in dust concentration control because it is of benefit for dry deposition and not for emission. Conversely, the grass GGW is beneficial in controlling dust erosion and is the

  18. Development of a Classification Scheme for Examining Adverse Events Associated with Medical Devices, Specifically the DaVinci Surgical System as Reported in the FDA MAUDE Database.

    Science.gov (United States)

    Gupta, Priyanka; Schomburg, John; Krishna, Suprita; Adejoro, Oluwakayode; Wang, Qi; Marsh, Benjamin; Nguyen, Andrew; Genere, Juan Reyes; Self, Patrick; Lund, Erik; Konety, Badrinath R

    2017-01-01

    To examine the Manufacturer and User Facility Device Experience Database (MAUDE) database to capture adverse events experienced with the Da Vinci Surgical System. In addition, to design a standardized classification system to categorize the complications and machine failures associated with the device. Overall, 1,057,000 DaVinci procedures were performed in the United States between 2009 and 2012. Currently, no system exists for classifying and comparing device-related errors and complications with which to evaluate adverse events associated with the Da Vinci Surgical System. The MAUDE database was queried for events reports related to the DaVinci Surgical System between the years 2009 and 2012. A classification system was developed and tested among 14 robotic surgeons to associate a level of severity with each event and its relationship to the DaVinci Surgical System. Events were then classified according to this system and examined by using Chi-square analysis. Two thousand eight hundred thirty-seven events were identified, of which 34% were obstetrics and gynecology (Ob/Gyn); 19%, urology; 11%, other; and 36%, not specified. Our classification system had moderate agreement with a Kappa score of 0.52. Using our classification system, we identified 75% of the events as mild, 18% as moderate, 4% as severe, and 3% as life threatening or resulting in death. Seventy-seven percent were classified as definitely related to the device, 15% as possibly related, and 8% as not related. Urology procedures compared with Ob/Gyn were associated with more severe events (38% vs 26%, p tool with moderate inter-rater agreement that can be used to better understand device-related adverse events. The majority of robotic related events were mild but associated with the device.

  19. Mimicking Martian dust: An in-vacuum dust deposition system for testing the ultraviolet sensors on the Curiosity rover

    International Nuclear Information System (INIS)

    Sobrado, J. M.; Martín-Soler, J.; Martín-Gago, J. A.

    2015-01-01

    We have designed and developed an in-vacuum dust deposition system specifically conceived to simulate and study the effect of accumulation of Martian dust on the electronic instruments of scientific planetary exploration missions. We have used this device to characterize the dust effect on the UV sensor of the Rover Environmental Monitoring Station in the Mars science Laboratory mission of NASA in similar conditions to those found on Mars surface. The UV sensor includes six photodiodes for measuring the radiation in all UV wavelengths (direct incidence and reflected); it is placed on the body of Curiosity rover and it is severely affected by the dust deposited on it. Our experimental setup can help to estimate the duration of reliable reading of this instrument during operation. We have used an analogous of the Martian dust in chemical composition (magnetic species), color, and density, which has been characterized by X-ray spectroscopy. To ensure a Brownian motion of the dust during its fall and a homogeneous coverage on the instrumentation, the operating conditions of the vacuum vessel, determined by partial pressures and temperature, have to be modified to account for the different gravities of Mars with respect to Earth. We propose that our designed device and operational protocol can be of interest to test optoelectronic instrumentation affected by the opacity of dust, as can be the degradation of UV photodiodes in planetary exploration

  20. Mimicking Martian dust: An in-vacuum dust deposition system for testing the ultraviolet sensors on the Curiosity rover

    Energy Technology Data Exchange (ETDEWEB)

    Sobrado, J. M., E-mail: sobradovj@inta.es; Martín-Soler, J. [Centro de Astrobiología (CAB), INTA-CSIC, Torrejón de Ardoz, 28850 Madrid (Spain); Martín-Gago, J. A. [Centro de Astrobiología (CAB), INTA-CSIC, Torrejón de Ardoz, 28850 Madrid (Spain); Instituto de Ciencias de Materiales de Madrid (ICMM–CSIC), Cantoblanco, 28049 Madrid (Spain)

    2015-10-15

    We have designed and developed an in-vacuum dust deposition system specifically conceived to simulate and study the effect of accumulation of Martian dust on the electronic instruments of scientific planetary exploration missions. We have used this device to characterize the dust effect on the UV sensor of the Rover Environmental Monitoring Station in the Mars science Laboratory mission of NASA in similar conditions to those found on Mars surface. The UV sensor includes six photodiodes for measuring the radiation in all UV wavelengths (direct incidence and reflected); it is placed on the body of Curiosity rover and it is severely affected by the dust deposited on it. Our experimental setup can help to estimate the duration of reliable reading of this instrument during operation. We have used an analogous of the Martian dust in chemical composition (magnetic species), color, and density, which has been characterized by X-ray spectroscopy. To ensure a Brownian motion of the dust during its fall and a homogeneous coverage on the instrumentation, the operating conditions of the vacuum vessel, determined by partial pressures and temperature, have to be modified to account for the different gravities of Mars with respect to Earth. We propose that our designed device and operational protocol can be of interest to test optoelectronic instrumentation affected by the opacity of dust, as can be the degradation of UV photodiodes in planetary exploration.

  1. Study on an intense dust storm over Greece

    Science.gov (United States)

    Kaskaoutis, D. G.; Kambezidis, H. D.; Nastos, P. T.; Kosmopoulos, P. G.

    Springtime constitutes the most favorable period for Sahara dust outbreaks and transport over Eastern Mediterranean. This study investigates the aerosol properties during April 2005 using remote-sensing and ground-based measurements. Three dust events with high aerosol optical depth (AOD) values have been observed during the measuring period, with duration of two days, i.e. 11-12, 16-17 and 25-26 April 2005. In this paper we mainly focus on the intense dust event of 16-17 April 2005, when a thick dust layer transported from Libya affected the whole Greek territory. Very high AOD values obtained from Aqua-MODIS sensor were observed over Greece (mean 2.42 ± 1.25) on 17 April, while the respective mean April value was 0.31 ± 0.09. The AOD at 550 nm (AOD 550) values over Crete were even larger, reaching ˜4.0. As a consequence, the PM 10 concentrations over Athens dramatically increased reaching up to 200 μg m -3. On the other hand, the fine-mode fraction values obtained from Terra-MODIS showed a substantial decrease in the whole Greek area on 17 April with values below 0.2 in the Southern regions. The intense dust layer showed a complex behavior concerning its spatial and temporal evolution and allowed us to study the changes in the optical properties of the desert dust particles along their transport routes due to the mixing processes with other aerosol types. The results from different measurements (ground-based and remote-sensing) did not contradict each other and, therefore, are adequate for monitoring of dust load over the Eastern Mediterranean.

  2. Red Dawn: Characterizing Iron Oxide Minerals in Atmospheric Dust

    Science.gov (United States)

    Yauk, K.; Ottenfeld, C. F.; Reynolds, R. L.; Goldstein, H.; Cattle, S.; Berquo, T. S.; Moskowitz, B. M.

    2012-12-01

    Atmospheric dust is comprised of many components including small amounts of iron oxide minerals. Although the iron oxides make up a small weight percent of the bulk dust, they are important because of their roles in ocean fertilization, controls on climate, and as a potential health hazard to humans. Here we report on the iron oxide mineralogy in dust from a large dust storm, dubbed Red Dawn, which engulfed eastern Australia along a 3000 km front on 23 September 2009. Red Dawn originated from the lower Lake Eyre Basin of South Australia, western New South Wales (NSW) and southwestern Queensland and was the worst dust storm to have hit the city of Sydney in more than 60 years. Dust samples were collected from various locations across eastern Australia (Lake Cowal, Orange, Hornsby, Sydney) following the Red Dawn event. Our dust collection provides a good opportunity to study the physical and mineralogical properties of iron oxides from Red Dawn using a combination of reflectance spectroscopy, Mössbauer spectroscopy (MB), and magnetic measurements. Magnetization measurements from 20-400 K reveal that magnetite/maghemite, hematite and goethite are present in all samples with magnetite occurring in trace amounts (effects (d< 100 nm). Finally, we compared reflectance with a magnetic parameter (hard isothermal remanent magnetization, HIRM) for ferric oxide abundance to assess the degree to which ferric oxide in these samples might absorb solar radiation. In samples for which both parameters were obtained, HIRM and average reflectance over the visible wavelengths are correlated as a group (r2=0.24). These results indicate that the ferric oxide minerals in Red Dawn dust absorb solar radiation. Much of this ferric oxide occurs likely as grain coatings of nanohematite and nanogoethite, thereby providing high surface area to enhance absorption of solar radiation.

  3. Of data and dust

    CERN Multimedia

    Stephanie Hills

    2016-01-01

    The traditional image of an archive is one of dusty old boxes, books and papers. When your archive is digital, dust spells disaster. An innovative environmental sensor designed and built by a CERN IT specialist has become an essential element in the Laboratory’s data-preservation strategy.   The novel air particle monitoring sensor designed by CERN's Julien Leduc. CERN’s archive holds more than 130 petabytes of data from past and present high-energy physics experiments. Some of it is 40 years old, most of it needs to be kept forever, and all of it is held on tape cartridges (over 20,000 of them). The cartridges are held inside tape libraries with robotic arms that load them into tape drives where they can be read and written. Tape cartridges have many advantages over other data storage media, notably cost and long-term reliability, but topping the list of drawbacks is their vulnerability to contamination from airborne dust particles; a tiny piece of g...

  4. Radionuclides in house dust

    Energy Technology Data Exchange (ETDEWEB)

    Fry, F A; Green, N; Dodd, N J; Hammond, D J

    1985-04-01

    Discharges of radionuclides from the British Nuclear Fuel plc (BNFL) reprocessing plant at Sellafield in Cumbria have led to elevated concentrations radionuclides in the local environment. The major routes of exposure of the public are kept under review by the appropriate authorising Government departments and monitoring is carried out both by the departments and by BNFL itself. Recently, there has been increasing public concern about general environmental contamination resulting from the discharges and, in particular, about possible exposure of members of the public by routes not previously investigated in detail. One such postulated route of exposure that has attracted the interest of the public, the press and Parliament arises from the presence of radionuclides within houses. In view of this obvious and widespread concern, the Board has undertaken a sampling programme in a few communities in Cumbria to assess the radiological significance of this source of exposure. From the results of our study, we conclude that, although radionuclides originating rom the BNFL site can be detected in house dust, this source of contamination is a negligible route of exposure for members of the public in West Cumbria. This report presents the results of the Board's study of house dust in twenty homes in Cumbria during the spring and summer of 1984. A more intensive investigation is being carried out by Imperial College. (author)

  5. A model of environmental behaviour of contaminated dust and its application to determining dust fluxes and residence times

    International Nuclear Information System (INIS)

    Allott, R.W.; Kelly, M.; Hewitt, C.N.

    1994-01-01

    A model has been developed to describe the temporal behaviour of the concentrations of a pollutant tracer within the urban environment of Barrow-in-Furness, NW England. The tracer used was 137 Cs derived primarily from wet deposition of the radioactive cloud from the Chernobyl reactor accident. The 137 Cs activity deposited during this primary event was supplemented by a small secondary atmospheric deposition input of resuspended activity. The model was validated against the measured temporal behaviour of 137 Cs in urban dust for two outdoor reservoirs in which the only observed input of dust and activity was by atmospheric deposition. Further modelling studies on other reservoirs (both outdoors and indoors) confirmed the existence of additional input influxes of dust and activity. The model enabled estimates of the magnitudes of these additional fluxes to be made and mean dust mass residence times to be calculated. These residence times correspond to environment half-lives of 170 ± 70 d outdoors and 20 ± 1 d indoors, for reservoirs which only receive a single primary input of a contaminant. Where secondary inputs of pollutants occur, the mean environmental half-lives of the pollutants increase by 50% for outdoor dust reservoirs and over 18-times for indoor reservoirs. This re-contamination of indoor dusts has implications in that attention should be paid to reducing outdoor contamination levels to ensure that attempts to reduce the levels of a pollutant indoors by cleaning are effective. (Author)

  6. Health hazards of cement dust

    International Nuclear Information System (INIS)

    Meo, Sultan A.

    2004-01-01

    ven in the 21st century, millions of people are working daily in a dusty environment. They are exposed to different types of health hazards such as fume, gases and dust, which are risk factors in developing occupational disease. Cement industry is involved in the development of structure of this advanced and modern world but generates dust during its production. Cement dust causes lung function impairment, chronic obstructive lung disease, restrictive lung disease, pneumoconiosis and carcinoma of the lungs, stomach and colon. Other studies have shown that cement dust may enter into the systemic circulation and thereby reach the essentially all the organs of body and affects the different tissues including heart, liver, spleen, bone, muscles and hairs and ultimately affecting their micro-structure and physiological performance. Most of the studies have been previously attempted to evaluate the effects of cement dust exposure on the basis of spirometry or radiology, or both. However, collective effort describing the general effects of cement dust on different organ and systems in humans or animals, or both has not been published. Therefore, the aim of this review is to gather the potential toxic effects of cement dust and to minimize the health risks in cement mill workers by providing them with information regarding the hazards of cement dust. (author)

  7. Dust forecasting system in JMA

    International Nuclear Information System (INIS)

    Mikami, M; Tanaka, T Y; Maki, T

    2009-01-01

    JMAs dust forecasting information, which is based on a GCM dust model, is presented through the JMA website coupled with nowcast information. The website was updated recently and JMA and MOE joint 'KOSA' website was open from April 2008. Data assimilation technique will be introduced for improvement of the 'KOSA' information.

  8. Integrated spatiotemporal characterization of dust sources and outbreaks in Central and East Asia

    Science.gov (United States)

    Darmenova, Kremena T.

    The potential of atmospheric dust aerosols to modify the Earth's environment and climate has been recognized for some time. However, predicting the diverse impact of dust has several significant challenges. One is to quantify the complex spatial and temporal variability of dust burden in the atmosphere. Another is to quantify the fraction of dust originating from human-made sources. This thesis focuses on the spatiotemporal characterization of sources and dust outbreaks in Central and East Asia by integrating ground-based data, satellite multisensor observations, and modeling. A new regional dust modeling system capable of operating over a span of scales was developed. The modeling system consists of a dust module DuMo, which incorporates several dust emission schemes of different complexity, and the PSU/NCAR mesoscale model MM5, which offers a variety of physical parameterizations and flexible nesting capability. The modeling system was used to perform for the first time a comprehensive study of the timing, duration, and intensity of individual dust events in Central and East Asia. Determining the uncertainties caused by the choice of model physics, especially the boundary layer parameterization, and the dust production scheme was the focus of our study. Implications to assessments of the anthropogenic dust fraction in these regions were also addressed. Focusing on Spring 2001, an analysis of routine surface meteorological observations and satellite multi-sensor data was carried out in conjunction with modeling to determine the extent to which integrated data set can be used to characterize the spatiotemporal distribution of dust plumes at a range of temporal scales, addressing the active dust sources in China and Mongolia, mid-range transport and trans-Pacific, long-range transport of dust outbreaks on a case-by-case basis. This work demonstrates that adequate and consistent characterization of individual dust events is central to establishing a reliable

  9. Adapting MODIS Dust Mask Algorithm to Suomi NPP VIIRS for Air Quality Applications

    Science.gov (United States)

    Ciren, P.; Liu, H.; Kondragunta, S.; Laszlo, I.

    2012-12-01

    Despite pollution reduction control strategies enforced by the Environmental Protection Agency (EPA), large regions of the United States are often under exceptional events such as biomass burning and dust outbreaks that lead to non-attainment of particulate matter standards. This has warranted the National Weather Service (NWS) to provide smoke and dust forecast guidance to the general public. The monitoring and forecasting of dust outbreaks relies on satellite data. Currently, Aqua/MODIS (MODerate resolution Imaging Spectrometer) and Terra/MODIS provide measurements needed to derive dust mask and Aerosol Optical Thickness (AOT) products. The newly launched Suomi NPP VIIRS (Visible/Infrared Imaging Radiometer Suite) instrument has a Suspended Matter (SM) product that indicates the presence of dust, smoke, volcanic ash, sea salt, and unknown aerosol types in a given pixel. The algorithm to identify dust is different over land and ocean but for both, the information comes from AOT retrieval algorithm. Over land, the selection of dust aerosol model in the AOT retrieval algorithm indicates the presence of dust and over ocean a fine mode fraction smaller than 20% indicates dust. Preliminary comparisons of VIIRS SM to CALIPSO Vertical Feature Mask (VFM) aerosol type product indicate that the Probability of Detection (POD) is at ~10% and the product is not mature for operational use. As an alternate approach, NESDIS dust mask algorithm developed for NWS dust forecast verification that uses MODIS deep blue, visible, and mid-IR channels using spectral differencing techniques and spatial variability tests was applied to VIIRS radiances. This algorithm relies on the spectral contrast of dust absorption at 412 and 440 nm and an increase in reflectivity at 2.13 μm when dust is present in the atmosphere compared to a clear sky. To avoid detecting bright desert surface as airborne dust, the algorithm uses the reflectances at 1.24 μm and 2.25 μm to flag bright pixels. The

  10. Experimental Determination of Infrared Extinction Coefficients of Interplanetary Dust Particles

    Science.gov (United States)

    Spann, J. F., Jr.; Abbas, M. M.

    1998-01-01

    This technique is based on irradiating a single isolated charged dust particle suspended in balance by an electric field, and measuring the scattered radiation as a function of angle. The observed scattered intensity profile at a specific wavelength obtained for a dust particle of known composition is compared with Mie theory calculations, and the variable parameters relating to the particle size and complex refractive index are adjusted for a best fit between the two profiles. This leads to a simultaneous determination of the particle radius, the complex refractive index, and the scattering and extinction coefficients. The results of these experiments can be utilized to examine the IRAS and DIRBE (Diffuse Infrared Background Experiment) infrared data sets in order to determine the dust particle physical characteristics and distributions by using infrared models and inversion techniques. This technique may also be employed for investigation of the rotational bursting phenomena whereby large size cosmic and interplanetary particles are believed to fragment into smaller dust particles.

  11. Dust in flowing magnetized plasma

    International Nuclear Information System (INIS)

    Pandey, Birendra P.; Samarian, Alex A.; Vladimirov, Sergey V.

    2009-01-01

    Plasma flows occur in almost every laboratory device and interactions of flowing plasmas with near-wall impurities and/or dust significantly affects the efficiency and lifetime of such devices. The charged dust inside the magnetized flowing plasma moves primarily under the influence of the plasma drag and electric forces. Here, the charge on the dust, plasma potential, and plasma density are calculated self-consistently. The electrons are assumed non-Boltzmannian and the effect of electron magnetization and electron-atom collisions on the dust charge is calculated in a self-consistent fashion. For various plasma magnetization parameters viz. the ratio of the electron and ion cyclotron frequencies to their respective collision frequencies, plasma-atom and ionization frequencies, the evolution of the plasma potential and density in the flow region is investigated. The variation of the dust charge profile is shown to be a sensitive function of plasma parameters. (author)

  12. Airborne dust distributions over the Tibetan Plateau and surrounding areas derived from the first year of CALIPSO lidar observations

    Directory of Open Access Journals (Sweden)

    Z. Liu

    2008-08-01

    Full Text Available Using an analysis of the first full year of CALIPSO lidar measurements, this paper derives unprecedented, altitude-resolved seasonal distributions of desert dust transported over the Tibetan Plateau (TP and the surrounding areas. The CALIPSO lidar observations include numerous large dust plumes over the northern slope and eastern part of the TP, with the largest number of dust events occurring in the spring of 2007, and some layers being lofted to altitudes of 11–12 km. Generation of the Tibetan airborne dusts appears to be largely associated with source regions to the north and on the eastern part of the plateau. Examination of the CALIPSO time history reveals an "airborne dust corridor" due to the eastward transport of dusts originating primarily in these source areas. This corridor extends from west to east and shows a seasonality largely modulated by the TP through its dynamical and thermal forcing on the atmospheric flows. On the southern side, desert dust particles originate predominately in Northwest India and Pakistan. The dust transport occurs primarily in dry seasons around the TP western and southern slopes and dust particles become mixed with local polluted aerosols. No significant amount of dust appears to be transported over the Himalayas. Extensive forward trajectory simulations are also conducted to confirm the dust transport pattern from the nearby sources observed by the CALIPSO lidar. Comparisons with the OMI and MODIS measurements show the unique capability of the CALIPSO lidar to provide unambiguous, altitude-resolved dust measurements.

  13. Can Asian Dust Trigger Phytoplankton Blooms in the Oligotrophic Northern South China Sea?

    Science.gov (United States)

    Wang, Sheng Hsiang; Hsu, Nai-Yung Christina; Tsay, Si-Chee; Lin, Neng-Huei; Sayer, Andrew M.; Huang, Shih-Jen; Lau, William K. M.

    2012-01-01

    Satellite data estimate a high dust deposition flux (approximately 18 g m(exp-2 a(exp-1) into the northern South China Sea (SCS). However, observational evidence concerning any biological response to dust fertilization is sparse. In this study, we combined long-term aerosol and chlorophyll-a (Chl-a) measurements from satellite sensors (MODIS and SeaWiFS) with a 16-year record of dust events from surface PM10 observations to investigate dust transport, flux, and the changes in Chl-a concentration over the northern SCS. Our result revealed that readily identifiable strong dust events over this region, although relatively rare (6 cases since 1994) and accounting for only a small proportion of the total dust deposition (approximately 0.28 g m(exp-2 a(exp-1), do occur and could significantly enhance phytoplankton blooms. Following such events, the Chl-a concentration increased up to 4-fold, and generally doubled the springtime background value (0.15 mg m(exp-3). We suggest these heavy dust events contain readily bioavailable iron and enhance the phytoplankton growth in the oligotrophic northern SCS.

  14. Dust Storm Feature Identification and Tracking from 4D Simulation Data

    Science.gov (United States)

    Yu, M.; Yang, C. P.

    2016-12-01

    Dust storms cause significant damage to health, property and the environment worldwide every year. To help mitigate the damage, dust forecasting models simulate and predict upcoming dust events, providing valuable information to scientists, decision makers, and the public. Normally, the model simulations are conducted in four-dimensions (i.e., latitude, longitude, elevation and time) and represent three-dimensional (3D), spatial heterogeneous features of the storm and its evolution over space and time. This research investigates and proposes an automatic multi-threshold, region-growing based identification algorithm to identify critical dust storm features, and track the evolution process of dust storm events through space and time. In addition, a spatiotemporal data model is proposed, which can support the characterization and representation of dust storm events and their dynamic patterns. Quantitative and qualitative evaluations for the algorithm are conducted to test the sensitivity, and capability of identify and track dust storm events. This study has the potential to assist a better early warning system for decision-makers and the public, thus making hazard mitigation plans more effective.

  15. The impact of dust storms on the Arabian Peninsula and the Red Sea

    KAUST Repository

    Jish Prakash, P.

    2015-01-12

    Located in the dust belt, the Arabian Peninsula is a major source of atmospheric dust. Frequent dust outbreaks and some 15 to 20 dust storms per year have profound effects on all aspects of human activity and natural processes in this region. To quantify the effect of severe dust events on radiation fluxes and regional climate characteristics, we simulated the storm that occurred from 18 to 20 March 2012 using a regional weather research forecast model fully coupled with the chemistry/aerosol module (WRF–Chem). This storm swept over a remarkably large area affecting the entire Middle East, northeastern Africa, Afghanistan, and Pakistan. It was caused by a southward propagating cold front, and the associated winds activated the dust production in river valleys of the lower Tigris and Euphrates in Iraq; the coastal areas in Kuwait, Iran, and the United Arab Emirates; the Rub al Khali, An Nafud, and Ad Dahna deserts; and along the Red Sea coast on the west side of the Arabian Peninsula. Our simulation results compare well with available ground-based and satellite observations. We estimate the total amount of dust generated by the storm to have reached 94 Mt. Approximately 78% of this dust was deposited within the calculation domain. The Arabian Sea and Persian Gulf received 5.3 Mt and the Red Sea 1.2 Mt of dust. Dust particles bring nutrients to marine ecosystems, which is especially important for the oligotrophic Northern Red Sea. However, their contribution to the nutrient balance in the Red Sea remains largely unknown. By scaling the effect of one storm to the number of dust storms observed annually over the Red Sea, we estimate the annual dust deposition to the Red Sea, associated with major dust storms, to be 6 Mt.

  16. Field Measurements and Modeling of Dust Transport and Deposition on a Hawaiian Volcano

    Science.gov (United States)

    Douglas, M.; Stock, J. D.; Cerovski-Darriau, C.; Bishaw, K.; Bedford, D.

    2017-12-01

    The western slopes of Hawaii's Mauna Kea volcano are mantled by fine-grained soils that record volcanic airfall and eolian deposition. Where exposed, strong winds transport this sediment across west Hawaii, affecting tourism and local communities by decreasing air and water quality. Operations on US Army's Ke'amuku Maneuver Area (KMA) have the potential to increase dust flux from these deposits. To understand regional dust transport and composition, the USGS established 18 ground monitoring sites and sampling locations surrounding KMA. For over three years, each station measured vertical and horizontal dust flux while co-located anemometers measured wind speed and direction. We use these datasets to develop a model for dust supply and transport to assess whether KMA is a net dust sink or source. We find that horizontal dust flux rates are most highly correlated with entrainment threshold wind speeds of 8 m/s. Using a dust model that partitions measured horizontal dust flux into inward- and outward-directed components, we predict that KMA is currently a net dust sink. Geochemical analysis of dust samples illustrates that organics and pedogenic carbonate make up to 70% of their mass. Measured vertical dust deposition rates of 0.005 mm/m2/yr are similar to deposition rates of 0.004 mm/m2/yr predicted from the divergence of dust across KMA's boundary. These rates are low compared to pre-historic rates of 0.2-0.3 mm/yr estimated from radiocarbon dating of buried soils. Therefore, KMA's soils record persistent deposition both over past millennia and at present at rates that imply infrequent, large dust storms. Such events led to soil-mantled topography in an otherwise rocky Pleistocene volcanic landscape. A substantial portion of fine-grained soils in other leeward Hawaiian Island landscapes may have formed from similar eolian deposition, and not direct weathering of parent rock.

  17. The impact of dust storms on the Arabian Peninsula and the Red Sea

    KAUST Repository

    Jish Prakash, P.; Stenchikov, Georgiy L.; Kalenderski, Stoitchko; Osipov, Sergey; Bangalath, Hamza Kunhu

    2015-01-01

    Located in the dust belt, the Arabian Peninsula is a major source of atmospheric dust. Frequent dust outbreaks and some 15 to 20 dust storms per year have profound effects on all aspects of human activity and natural processes in this region. To quantify the effect of severe dust events on radiation fluxes and regional climate characteristics, we simulated the storm that occurred from 18 to 20 March 2012 using a regional weather research forecast model fully coupled with the chemistry/aerosol module (WRF–Chem). This storm swept over a remarkably large area affecting the entire Middle East, northeastern Africa, Afghanistan, and Pakistan. It was caused by a southward propagating cold front, and the associated winds activated the dust production in river valleys of the lower Tigris and Euphrates in Iraq; the coastal areas in Kuwait, Iran, and the United Arab Emirates; the Rub al Khali, An Nafud, and Ad Dahna deserts; and along the Red Sea coast on the west side of the Arabian Peninsula. Our simulation results compare well with available ground-based and satellite observations. We estimate the total amount of dust generated by the storm to have reached 94 Mt. Approximately 78% of this dust was deposited within the calculation domain. The Arabian Sea and Persian Gulf received 5.3 Mt and the Red Sea 1.2 Mt of dust. Dust particles bring nutrients to marine ecosystems, which is especially important for the oligotrophic Northern Red Sea. However, their contribution to the nutrient balance in the Red Sea remains largely unknown. By scaling the effect of one storm to the number of dust storms observed annually over the Red Sea, we estimate the annual dust deposition to the Red Sea, associated with major dust storms, to be 6 Mt.

  18. Dust in protoplanetary disks: observations*

    Directory of Open Access Journals (Sweden)

    Waters L.B.F.M.

    2015-01-01

    Full Text Available Solid particles, usually referred to as dust, are a crucial component of interstellar matter and of planet forming disks surrounding young stars. Despite the relatively small mass fraction of ≈1% (in the solar neighborhood of our galaxy; this number may differ substantially in other galaxies that interstellar grains represent of the total mass budget of interstellar matter, dust grains play an important role in the physics and chemistry of interstellar matter. This is because of the opacity dust grains at short (optical, UV wavelengths, and the surface they provide for chemical reactions. In addition, dust grains play a pivotal role in the planet formation process: in the core accretion model of planet formation, the growth of dust grains from the microscopic size range to large, cm-sized or larger grains is the first step in planet formation. Not only the grain size distribution is affected by planet formation. Chemical and physical processes alter the structure and chemical composition of dust grains as they enter the protoplanetary disk and move closer to the forming star. Therefore, a lot can be learned about the way stars and planets are formed by observations of dust in protoplanetary disks. Ideally, one would like to measure the dust mass, the grain size distribution, grain structure (porosity, fluffiness, the chemical composition, and all of these as a function of position in the disk. Fortunately, several observational diagnostics are available to derive constrains on these quantities. In combination with rapidly increasing quality of the data (spatial and spectral resolution, a lot of progress has been made in our understanding of dust evolution in protoplanetary disks. An excellent review of dust evolution in protoplanetary disks can be found in Testi et al. (2014.

  19. A Network of AOPs for reduced thyroid hormone synthesis derived from inhibition of Thyroperoxidase - A common Molecular Initiating Event Leading to Species-Specific Indices of Adversity.

    Science.gov (United States)

    This collection of 3 AOPs describe varying outcomes of adversity dependent upon species in response to inhibition of thyroperoxidase (TPO) during development. Chemical inhibition of TPO, the molecular-initiating event (MIE), results in decreased thyroid hormone (TH) synthesis, a...

  20. COAL DUST EMISSION PROBLEM

    Directory of Open Access Journals (Sweden)

    M. M. Biliaiev

    2016-12-01

    Full Text Available Purpose. The article aims to develop 2D numerical models for the prediction of atmospheric pollution during transportation of coal in the railway car, as well as the ways to protect the environment and the areas near to the mainline from the dust emission due to the air injection installation. Methodology. To solve this problem there were developed numerical models based on the use of the equations of motion of an inviscid incompressible fluid and mass transfer. For the numerical integration of the transport equation of the pollutant the implicit alternating-triangular difference scheme was used. For numerical integration of the 2D equation for the velocity potential the method of total approximation was used. The developed numerical models are the basis of established software package. On the basis of the constructed numerical models it was carried out a computational experiment to assess the level of air pollution when transporting bulk cargo by rail when the railway car has the air injection. Findings. 2D numerical models that belong to the class «diagnostic models» were developed. These models take into account the main physical factors affecting the process of dispersion of dust pollution in the atmosphere during transportation of bulk cargo. The developed numerical models make it possible to calculate the dust loss process, taking into account the use of the air injection of the car. They require a small cost of the computer time during practical realization at the low and medium power machines. There were submitted computational calculations to determine pollutant concentrations and the formation of the zone of pollution near the train with bulk cargo in «microscale» scale taking into account the air curtains. Originality. 2D numerical models taking into account the relevant factors influencing the process of dispersion of pollutants in the atmosphere, and the formation of the zone of pollution during transportation of bulk cargo by

  1. Preliminary Safety Analysis of the Gorleben Site: Safety Concept and Application to Scenario Development Based on a Site-Specific Features, Events and Processes (FEP) Database - 13304

    Energy Technology Data Exchange (ETDEWEB)

    Moenig, Joerg; Beuth, Thomas; Wolf, Jens [Gesellschaft fuer Anlagen- und Reaktorsicherheit (GRS) mbH, Theodor-Heuss-Str. 4, D-38122 Braunschweig (Germany); Lommerzheim, Andre [DBE TECHNOLOGY GmbH, Eschenstr. 55, D-31224 Peine (Germany); Mrugalla, Sabine [Federal Institute for Geosciences and Natural Resources (BGR), Stilleweg 2, D-30655 Hannover (Germany)

    2013-07-01

    Based upon the German safety criteria, released in 2010 by the Federal Ministry of the Environment (BMU), a safety concept and a safety assessment concept for the disposal of heat-generating high-level waste have both been developed in the framework of the preliminary safety case for the Gorleben site (Project VSG). The main objective of the disposal is to contain the radioactive waste inside a defined rock zone, which is called containment-providing rock zone. The radionuclides shall remain essentially at the emplacement site, and at the most, a small defined quantity of material shall be able to leave this rock zone. This shall be accomplished by the geological barrier and a technical barrier system, which is required to seal the inevitable penetration of the geological barrier by the construction of the mine. The safe containment has to be demonstrated for probable and less probable evolutions of the site, while evolutions with very low probability (less than 1 % over the demonstration period of 1 million years) need not to be considered. Owing to the uncertainty in predicting the real evolution of the site, plausible scenarios have been derived in a systematic manner. Therefore, a comprehensive site-specific features, events and processes (FEP) data base for the Gorleben site has been developed. The safety concept was directly taken into account, e.g. by identification of FEP with direct influence on the barriers that provide the containment. No effort was spared to identify the interactions of the FEP, their probabilities of occurrence, and their characteristics (values). The information stored in the data base provided the basis for the development of scenarios. The scenario development methodology is based on FEP related to an impairment of the functionality of a subset of barriers, called initial barriers. By taking these FEP into account in their probable characteristics the reference scenario is derived. Thus, the reference scenario describes a

  2. An Extensive Study on Dynamical aspects of Dust Storm over the United Arab Emirates during 18-20 March 2012

    Science.gov (United States)

    Basha, Ghouse; Phanikumar, Devulapalli V.; Ouarda, Taha B. M. J.

    2015-04-01

    On 18 March 2012, a super dust storm event occurred over Middle East (ME) and lasted for several hours. Following to this, another dust storm occurred on early morning of 20 March 2012 with almost higher intensity. Both these storms reduced the horizontal visibility to few hundreds of meters and represented as one of the most intense and long duration dust storms over United Arab Emirates (UAE) in recent times. These storms also reduced the air quality in most parts of the ME implying the shutdown of Airports, schools and hundreds of people were hospitalized with respirational problems. In the context of the above, we have made a detailed study on the dynamical processes leading to triggering of dust storm over UAE and neighboring regions. We have also analyzed its impact on surface, and vertical profiles of background parameters and aerosols during the dust storm period by using ground-based, space borne, dust forecasting model, and reanalysis data sets. The synoptic and dynamic conditions responsible for the occurrence of the dust storm are discussed extensively by using European Centre for Medium-Range Weather Forecasts (ECMWF) ERA interim reanalysis data sets. The Impact of dust storm on surface and upper air radiosonde measurements and aerosol optical properties are also investigated before, during and after the dust storm event. During the dust storm, surface temperature decreased by 15oC when compared to before and after the event. PM10 values significantly increased maximum of about 1600µg/m3. Spatial variation of Aerosol Optical Depth (AOD) from Moderate-resolution Imaging Spectroradiometer (MODIS) and Ozone Monitoring Instrument (OMI) aerosol index (AI) exhibited very high values during the event and source region can be identified of dust transport to our region with this figure. The total attenuated backscatter at 550nm from Cloud-Aerosol Lidar and Infrared Pathfinder Satellite shows the vertical extent of dust up to 8km. The dynamics of this event is

  3. Dust of dark energy

    International Nuclear Information System (INIS)

    Lim, Eugene A.; Sawicki, Ignacy; Vikman, Alexander

    2010-01-01

    We introduce a novel class of field theories where energy always flows along timelike geodesics, mimicking in that respect dust, yet which possess non-zero pressure. This theory comprises two scalar fields, one of which is a Lagrange multiplier enforcing a constraint between the other's field value and derivative. We show that this system possesses no wave-like modes but retains a single dynamical degree of freedom. Thus, the sound speed is always identically zero on all backgrounds. In particular, cosmological perturbations reproduce the standard behaviour for hydrodynamics in the limit of vanishing sound speed. Using all these properties we propose a model unifying Dark Matter and Dark Energy in a single degree of freedom. In a certain limit this model exactly reproduces the evolution history of ΛCDM, while deviations away from the standard expansion history produce a potentially measurable difference in the evolution of structure

  4. Temporal and spatial variation in radioactivity deposition in Japan-influence of the Asian dust-Kosa

    International Nuclear Information System (INIS)

    Igarashi, Yasuhito; Aoyama, Michio; Hirose, Katsumi; Shinoda, Yoshihiro

    2007-01-01

    The possible effect of Asian dust-Kosa in radioactivity deposition, recorded during the recent years, is addressed. The Kosa events were remarkable during 2000 to 2002 in the Far East region, however no significant change was admitted in the MRI radioactivity deposition time series for 90 Sr and 137 Cs. Therefore, we looked at the nationwide distribution and seasonal trends in 90 Sr and 137 Cs depositions by using the data from the Environmental Radioactivity and Radiation Database available on the web. It was found that 137 Cs deposition was larger in northern Japan along the Japan Sea side during spring. The 137 Cs/ 90 Sr activity ratio as well as the 137 Cs specific activity tended to be larger at the high 137 Cs deposition sites. The influence of the Kosa during 2000 to 2002 had larger in northern Japan/Sea of Japan side and the source of the Kosa may be different from the conventional type of the Kosa. The high 137 Cs/ 90 Sr activity ratio and the high 137 Cs specific activity suggest the source area had higher precipitation rate (higher fallout), where the fractionation between the 137 Cs and 90 Sr proceeded. Such area may become new source area for the aeolian dust due possibly to the recent global climate change. This accords with the literature on the source statistics of the Asian dust during the 1990s and the early 2000s. (author)

  5. The radiative impact of desert dust on orographic rain in the Cévennes–Vivarais area: a case study from HyMeX

    Directory of Open Access Journals (Sweden)

    C. Flamant

    2015-11-01

    Full Text Available The study is focused on Intensive Observation Period (IOP 14 of the Hydrological Cycle in the Mediterranean Experiment first Special Observing Period (HyMeX SOP 1 that took place from 17 to 19 October 2012 and was dedicated to the study of orographic rain in the Cévennes–Vivarais (CV target area. During this IOP a dense dust plume originating from northern Africa (the Maghreb and Sahara was observed to be transported over the Balearic Islands towards the south of France. The plume was characterized by an aerosol optical depth between 0.2 and 0.8 at 550 nm, highly variable in time and space over the western Mediterranean Basin. The impact of this dust plume, the biggest event observed during the 2-month-long HyMeX SOP 1, on the precipitation over the CV area has been analyzed using high-resolution simulations from the convection permitting mesoscale model Meso-NH (mesoscale non-hydrostatic model validated against measurements obtained from numerous instruments deployed specifically during SOP 1 (ground-based/airborne water vapor and aerosol lidars, airborne microphysics probes as well as space-borne aerosol products. The 4-day simulation reproduced realistically the temporal and spatial variability (including the vertical distribution of the dust. The dust radiative impact led to an average 0.6 K heating at the altitude of the dust layer in the CV area (and up to +3 K locally and an average 100 J kg−1 increase of most unstable convective available potential energy (and up to +900 J kg−1 locally with respect to a simulation without prescribed dust aerosols. The rainfall amounts and location were only marginally affected by the dust radiative effect, even after 4 days of simulation. The transient nature of this radiative effect in dynamical environments such as those found in the vicinity of heavy precipitation events in the Mediterranean is not sufficient to impact 24 h of accumulated rainfall in the dust simulation.

  6. Ulysses dust measurements near Jupiter.

    Science.gov (United States)

    Grün, E; Zook, H A; Baguhl, M; Fechtig, H; Hanner, M S; Kissel, J; Lindblad, B A; Linkert, D; Linkert, G; Mann, I B

    1992-09-11

    Submicrometer- to micrometer-sized particles were recorded by the Ulysses dust detector within 40 days of the Jupiter flyby. Nine impacts were recorded within 50 Jupiter radii with most of them recorded after closest approach. Three of these impacts are consistent with particles on prograde orbits around Jupiter and the rest are believed to have resulted from gravitationally focused interplanetary dust. From the ratio of the impact rate before the Jupiter flyby to the impact rate after the Jupiter flyby it is concluded that interplanetary dust particles at the distance of Jupiter move on mostly retrograde orbits. On 10 March 1992, Ulysses passed through an intense dust stream. The dust detector recorded 126 impacts within 26 hours. The stream particles were moving on highly inclined and apparently hyperbolic orbits with perihelion distances of >5 astronomical units. Interplanetary dust is lost rather quickly from the solar system through collisions and other mechanisms and must be almost continuously replenished to maintain observed abundances. Dust flux measurements, therefore, give evidence of the recent rates of production from sources such as comets, asteroids, and moons, as well as the possible presence of interstellar grains.

  7. Experiments on Dust Grain Charging

    Science.gov (United States)

    Abbas, M. N.; Craven, P. D.; Spann, J. F.; Tankosic, D.; LeClair, A.; West, E. A.

    2004-01-01

    Dust particles in various astrophysical environments are charged by a variety of mechanisms generally involving collisional processes with other charged particles and photoelectric emission with UV radiation from nearby sources. The sign and the magnitude of the particle charge are determined by the competition between the charging processes by UV radiation and collisions with charged particles. Knowledge of the particle charges and equilibrium potentials is important for understanding of a number of physical processes. The charge of a dust grain is thus a fundamental parameter that influences the physics of dusty plasmas, processes in the interplanetary medium and interstellar medium, interstellar dust clouds, planetary rings, cometary and outer atmospheres of planets etc. In this paper we present some results of experiments on charging of dust grains carried out on a laboratory facility capable levitating micron size dust grains in an electrodynamic balance in simulated space environments. The charging/discharging experiments were carried out by exposing the dust grains to energetic electron beams and UV radiation. Photoelectric efficiencies and yields of micron size dust grains of SiO2, and lunar simulates obtained from NASA-JSC will be presented.

  8. Hypervelocity dust particle impacts observed by the Giotto magnetometer and plasma experiments

    International Nuclear Information System (INIS)

    Neubauer, F.M.; Glassmeier, K.H.; Goldstein, R.; Acuna, M.H.; Musmann, G.; Coates, A.J.

    1990-01-01

    The authors report thirteen very short events in the magnetic field of the inner magnetic pile-up region of comet Halley observed by the Giotto magnetometer experiment together with simultaneous plasma data obtained by the Johnstone plasma analyzer and the ion mass spectrometer experiments. The events are due to dust impacts in the milligram range on the spacecraft at the relative velocity between the cometary dust and the spacecraft of 68 km/sec. They are generally consistent with dust impact events derived from spacecraft attitude perturbations by the Giotto camera [Curdt and Keller, private communication]. Their characteristic shape generally involves a sudden decrease in magnetic field magnitude, a subsequent overshoot beyond initial field values and an asymptotic approach to the initial field somewhat reminiscent of the magnetic field signature after the AMPTE releases in the solar wind. These observations give a new way of analyzing ultra-fast dust particles incident on a spacecraft

  9. Hypervelocity dust particle impacts observed by the Giotto magnetometer and plasma experiments

    Science.gov (United States)

    Neubauer, F. M.; Glassmeier, K.-H.; Coates, A. J.; Goldstein, R.; Acuna, M. H.

    1990-01-01

    This paper describes 13 very short events in the magnetic field of the inner magnetic pile-up region of Comet Halley observed by the Giotto magnetometer experiment together with simultaneous plasma data obtained by the Johnstone plasma analyzer and the ion mass spectrometer experiments. The events are due to dust impacts in the milligram range on the spacecraft at the relative velocity between the cometary dust and the spacecraft of 68 km/sec. They are generally consistent with dust impact events derived from spacecraft attitude perturbations by the Giotto camera. Their characteristic shape generally involves a sudden decrease in magnetic-field magnitude, a subsequent overshoot beyond initial field values, and an asymptotic approach to the initial field (somewhat reminiscent of the magnetic-field signature after the AMPTE releases in the solar wind). These observations give a new way of analyzing ultra-fast dust particles incident on a spacecraft.

  10. A Mosque event

    DEFF Research Database (Denmark)

    Simonsen, Kirsten; Neergaard, Maja de; Koefoed, Lasse Martin

    2017-01-01

    and public imaginations attached to it. And they are connected to a specific event – the opening of the mosque. In the first part, a conceptual framework is presented bringing together literature on three notions: encounters, visibility and the event. Following this, the paper explores the opening event...

  11. Catalogue of requirements for a plant-specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events; Anforderungskatalog fuer anlagenbezogene Ueberpruefungen deutscher Kernkraftwerke unter Beruecksichtigung der Ereignisse in Fukushima-I (Japan)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-03-30

    The catalogue of requirements for a plant-specific safety inspection of German nuclear power plants taking into account the Fukushima-I (Japan) events worked out by the German RSK (reactor safety commission) includes the following inspection topics: natural events like earth quakes, floods, weather-based consequences and possible superposition; civilization-based events like airplane crash, gas release, reactor accident consequences for neighboring units, terroristic impacts, external attacks on computer-based control systems. Further event-independent assumptions have to be considered: station blackout, long-term emergency power supply requirement, failure of auxiliary cooling water supply, efficacy of preventive measures, aggravating boundary conditions for the performance of emergency measures.

  12. Mineral dust emission from the Bodélé Depression, northern Chad, during BoDEx 2005

    Science.gov (United States)

    Todd, Martin C.; Washington, Richard; Martins, José Vanderlei; Dubovik, Oleg; Lizcano, Gil; M'bainayel, Samuel; Engelstaedter, Sebastian

    2007-03-01

    Mineral dust in the atmosphere is an important component of the climate system but is poorly quantified. The Bodélé Depression of northern Chad stands out as the world's greatest source region of mineral dust into the atmosphere. Frequent dust plumes are a distinguishing feature of the region's climate. There is a need for more detailed information on processes of dust emission/transport and dust optical properties to inform model simulations of this source. During the Bodélé Dust Experiment (BoDEx) in 2005, instrumentation was deployed to measure dust properties and boundary layer meteorology. Observations indicate that dust emission events are triggered when near-surface wind speeds exceed 10 ms-1, associated with synoptic-scale variability in the large-scale atmospheric circulation. Dust emission pulses in phase with the diurnal cycle of near-surface winds. Analysis of dust samples shows that the dust consists predominantly of fragments of diatomite sediment. The particle size distribution of this diatomite dust estimated from sun photometer data, using a modified Aeronet retrieval algorithm, indicates a dominant coarse mode (radius centered on 1-2 μm) similar to other Saharan dust observations. Single-scattering albedo values are high, broadly in line with other Saharan dust even though the diatomite composition of dust from the Bodélé is likely to be unusual. The radiative impact of high dust loadings results in a reduction in surface daytime maximum temperature of around 7°C in the Bodélé region. Using optical and physical properties of dust obtained in the field, we estimate the total dust flux emitted from the Bodélé to be 1.18 ± 0.45 Tg per day during a substantial dust event. We speculate that the Bodélé Depression (˜10,800 km2) may be responsible for between 6-18% of global dust emissions, although the uncertainty in both the Bodélé and global estimates remains high.

  13. Direct-reading inhalable dust monitoring--an assessment of current measurement methods.

    Science.gov (United States)

    Thorpe, Andrew; Walsh, Peter T

    2013-08-01

    Direct-reading dust monitors designed specifically to measure the inhalable fraction of airborne dust are not widely available. Current practice therefore often involves comparing the response of photometer-type dust monitors with the concentration measured with a reference gravimetric inhalable sampler, which is used to adjust the dust monitor measurement. However, changes in airborne particle size can result in significant errors in the estimation of inhalable concentration by this method. The main aim of this study was to assess how these dust monitors behave when challenged with airborne dust containing particles in the inhalable size range and also to investigate alternative dust monitors whose response might not be as prone to variations in particle size or that could be adapted to measure inhalable dust concentration. Several photometer-type dust monitors and a Respicon TM, tapered element oscillating microbalance (TEOM) personal dust monitor (PDM) 3600, TEOM 1400, and Dustrak DRX were assessed for the measurement of airborne inhalable dust during laboratory and field trials. The PDM was modified to allow it to sample and measure larger particles in the inhalable size range. During the laboratory tests, the dust monitors and reference gravimetric samplers were challenged inside a large dust tunnel with aerosols of industrial dusts known to present an inhalable hazard and aluminium oxide powders with a range of discrete particle sizes. A constant concentration of each dust type was generated and peak concentrations of larger particles were periodically introduced to investigate the effects of sudden changes in particle size on monitor calibration. The PDM, Respicon, and DataRam photometer were also assessed during field trials at a bakery, joinery, and a grain mill. Laboratory results showed that the Respicon, modified PDM, and TEOM 1400 observed good linearity for all types of dust when compared with measurements made with a reference IOM sampler; the

  14. A dust-free dock

    Energy Technology Data Exchange (ETDEWEB)

    Merrion, D. [E & F Services Ltd. (United Kingdom)

    2002-10-01

    This paper describes the process of unloading coal, petcoke and other dusty products in environmentally-sensitive areas. It presents a case study of the deepwater Port of Foynes on the west coast of Ireland which imports animal feed, fertiliser, coal and cement clinker, where dockside mobile loaders (DMLs) have eliminated spillage and controlled dust, and a record case study of the Humber International Terminal in the UK, where air curtinas, dust suppression grids and EFFEX{reg_sign} filters overcome the dust problems. 2 photos.

  15. Triton's streaks as windblown dust

    Science.gov (United States)

    Sagan, Carl; Chyba, Christopher

    1990-01-01

    Explanations for the surface streaks observed by Voyager 2 on Triton's southern hemisphere are discussed. It is shown that, despite Triton's tenuous atmosphere, low-cohesion dust trains with diameters of about 5 micron or less may be carried into suspension by aeolian surface shear stress, given expected geostrophic wind speeds of about 10 m/s. For geyser-like erupting dust plumes, it is shown that dust-settling time scales and expected wind velocities can produce streaks with length scales in good agreement with those of the streaks. Thus, both geyserlike eruptions or direct lifting by surface winds appear to be viable mechanisms for the origin of the streaks.

  16. [Asthma due to grain dust].

    Science.gov (United States)

    Baur, X; Preisser, A; Wegner, R

    2003-06-01

    The actual literature as well as two case reports described in detail show that grain dust induces asthmatic reactions and ODTS which are obviously not of allergic origin. For diagnosis occupational-type exposure tests are decisive whereas allergological testing usually is not. Endotoxins which are present in the grain dust samples in high concentrations have to be regarded as the major causative components. To avoid irreversible lung function impairment a comprehensive early diagnosis is necessary. Generally, a remarkable reduction of exposure to dust with high levels of airborne endotoxin in agriculture has to be achieved since in many workplaces corresponding exposures are still rather high.

  17. Development of High-Resolution Dynamic Dust Source Function - A Case Study with a Strong Dust Storm in a Regional Model

    Science.gov (United States)

    Kim, Dongchul; Chin, Mian; Kemp, Eric M.; Tao, Zhining; Peters-Lidard, Christa D.; Ginoux, Paul

    2017-01-01

    A high-resolution dynamic dust source has been developed in the NASA Unified-Weather Research and Forecasting (NU-WRF) model to improve the existing coarse static dust source. In the new dust source map, topographic depression is in 1-km resolution and surface bareness is derived using the Normalized Difference Vegetation Index (NDVI) data from Moderate Resolution Imaging Spectroradiometer (MODIS). The new dust source better resolves the complex topographic distribution over the Western United States where its magnitude is higher than the existing, coarser resolution static source. A case study is conducted with an extreme dust storm that occurred in Phoenix, Arizona in 0203 UTC July 6, 2011. The NU-WRF model with the new high-resolution dynamic dust source is able to successfully capture the dust storm, which was not achieved with the old source identification. However the case study also reveals several challenges in reproducing the time evolution of the short-lived, extreme dust storm events.

  18. Development of High-Resolution Dynamic Dust Source Function -A Case Study with a Strong Dust Storm in a Regional Model.

    Science.gov (United States)

    Kim, Dongchul; Chin, Mian; Kemp, Eric M; Tao, Zhining; Peters-Lidard, Christa D; Ginoux, Paul

    2017-06-01

    A high-resolution dynamic dust source has been developed in the NASA Unified-Weather Research and Forecasting (NU-WRF) model to improve the existing coarse static dust source. In the new dust source map, topographic depression is in 1-km resolution and surface bareness is derived using the Normalized Difference Vegetation Index (NDVI) data from Moderate Resolution Imaging Spectroradiometer (MODIS). The new dust source better resolves the complex topographic distribution over the Western United States where its magnitude is higher than the existing, coarser resolution static source. A case study is conducted with an extreme dust storm that occurred in Phoenix, Arizona in 02-03 UTC July 6, 2011. The NU-WRF model with the new high-resolution dynamic dust source is able to successfully capture the dust storm, which was not achieved with the old source identification. However the case study also reveals several challenges in reproducing the time evolution of the short-lived, extreme dust storm events.

  19. Effect of wind speed and relative humidity on atmospheric dust concentrations in semi-arid climates.

    Science.gov (United States)

    Csavina, Janae; Field, Jason; Félix, Omar; Corral-Avitia, Alba Y; Sáez, A Eduardo; Betterton, Eric A

    2014-07-15

    Atmospheric particulate have deleterious impacts on human health. Predicting dust and aerosol emission and transport would be helpful to reduce harmful impacts but, despite numerous studies, prediction of dust events and contaminant transport in dust remains challenging. In this work, we show that relative humidity and wind speed are both determinants in atmospheric dust concentration. Observations of atmospheric dust concentrations in Green Valley, AZ, USA, and Juárez, Chihuahua, México, show that PM10 concentrations are not directly correlated with wind speed or relative humidity separately. However, selecting the data for high wind speeds (>4m/s at 10 m elevation), a definite trend is observed between dust concentration and relative humidity: dust concentration increases with relative humidity, reaching a maximum around 25% and it subsequently decreases with relative humidity. Models for dust storm forecasting may be improved by utilizing atmospheric humidity and wind speed as main drivers for dust generation and transport. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Bounded dust-acoustic waves in a cylindrically bounded collisional dusty plasma with dust charge variation

    International Nuclear Information System (INIS)

    Wei Nanxia; Xue Jukui

    2006-01-01

    Taking into account the boundary, particle collisions, and dust charging effects, dust-acoustic waves in a uniform cylindrically bounded dusty plasma is investigated analytically, and the dispersion relation for the dust-acoustic wave is obtained. The effects of boundary, dust charge variation, particle collision, and dust size on the dust-acoustic wave are discussed in detail. Due to the bounded cylindrical boundary effects, the radial wave number is discrete, i.e., the spectrum is discrete. It is shown that the discrete spectrum, the adiabatic dust charge variation, dust grain size, and the particle collision have significant effects on the dust-acoustic wave

  1. Direct Measurement of Dust Attenuation in z approx. 1.5 Star-Forming Galaxies from 3D-HST: Implications for Dust Geometry and Star Formation Rates

    Science.gov (United States)

    Price, Sedona H.; Kriek, Mariska; Brammer, Gabriel B; Conroy, Charlie; Schreiber, Natascha M. Foerster; Franx, Marijn; Fumagalli, Mattia; Lundren, Britt; Momcheva, Ivelina; Nelson, Erica J.; hide

    2013-01-01

    The nature of dust in distant galaxies is not well understood, and until recently few direct dust measurements have been possible. We investigate dust in distant star-forming galaxies using near-infrared grism spectra of the 3D-HST survey combined with archival multi-wavelength photometry. These data allow us to make a direct comparison between dust towards star-forming regions (measured using Balmer decrements) and the integrated dust properties (derived by comparing spectral energy distributions [SEDs] with stellar population and dust models) for a statistically significant sample of distant galaxies. We select a sample of 163 galaxies between 1.36 or = 5 and measure Balmer decrements from stacked spectra. First, we stack spectra in bins of integrated stellar dust attenuation, and find that there is extra dust extinction towards star-forming regions (AV,HII is 1.81 times the integrated AV, star), though slightly lower than found for low-redshift starburst galaxies. Next, we stack spectra in bins of specific star formation rate (log sSFR), star formation rate (log SFR), and stellar mass (logM*). We find that on average AV,HII increases with SFR and mass, but decreases with increasing sSFR. The amount of extra extinction also decreases with increasing sSFR and decreasing stellar mass. Our results are consistent with the two-phase dust model - in which galaxies contain both a diffuse and a stellar birth cloud dust component - as the extra extinction will increase once older stars outside the star-forming regions become more dominant. Finally, using our Balmer decrements we derive dust-corrected H(alpha) SFRs, and find evidence that SED fitting produces incorrect SFRs if very rapidly declining SFHs are included in the explored parameter space. Subject headings: dust, extinction- galaxies: evolution- galaxies: high-redshift

  2. The causes and consequences of blown-up coal dust

    International Nuclear Information System (INIS)

    Vrins, E.L.M.; Van Zuylen, E.J.

    1991-11-01

    The goal of the Dutch National Research Program Coal (NOK), which started in 1983, is to eliminate technical, economic and ecological objections, connected with the large-scale use of coal. The Blown-up Coal Dust program, which is completed in 1991, aimed at problems that arise, due to the dispersion of coal dust in the vicinity of coal storage and transshipment areas. The accumulated knowledge is categorized according to the route the dust itself follows, starting with activities that cause the dust and continuing up to the effects, of which nuisance in the neighborhood is the most important. The successive chapters are: Activities, Emission, Concentration, Deposition, Pollution and Nuisance and other effects. Inventories of available knowledge, models and measuring equipment have been carried out for each part. The models describe the connection between the various stages of the progress of the dust, from cause to consequence. Newly developed measuring equipment was tested in practice. Various analysis techniques were used and evaluated, such as gravimetric, chemical and optical analysis. A specific coal dust analysis technique is not available. 15 figs., 23 tabs., 1 appendix, 263 refs

  3. Dust particle formation in silane plasmas

    NARCIS (Netherlands)

    Sorokin, M.

    2005-01-01

    Dust can be found anywhere: in the kitchen, in the car, in space… Not surprisingly we also see dust in commercial and laboratory plasmas. Dust can be introduced in the plasma, but it can also grow there by itself. In the microelectronics industry, contamination of the processing plasma by dust is an

  4. Linkages between observed, modeled Saharan dust loading and meningitis in Senegal during 2012 and 2013

    Science.gov (United States)

    Diokhane, Aminata Mbow; Jenkins, Gregory S.; Manga, Noel; Drame, Mamadou S.; Mbodji, Boubacar

    2016-04-01

    The Sahara desert transports large quantities of dust over the Sahelian region during the Northern Hemisphere winter and spring seasons (December-April). In episodic events, high dust concentrations are found at the surface, negatively impacting respiratory health. Bacterial meningitis in particular is known to affect populations that live in the Sahelian zones, which is otherwise known as the meningitis belt. During the winter and spring of 2012, suspected meningitis cases (SMCs) were with three times higher than in 2013. We show higher surface particular matter concentrations at Dakar, Senegal and elevated atmospheric dust loading in Senegal for the period of 1 January-31 May during 2012 relative to 2013. We analyze simulated particulate matter over Senegal from the Weather Research and Forecasting (WRF) model during 2012 and 2013. The results show higher simulated dust concentrations during the winter season of 2012 for Senegal. The WRF model correctly captures the large dust events from 1 January-31 March but has shown less skill during April and May for simulated dust concentrations. The results also show that the boundary conditions are the key feature for correctly simulating large dust events and initial conditions are less important.

  5. Experiment on dust acoustic solitons in strongly coupled dusty plasma

    International Nuclear Information System (INIS)

    Boruah, Abhijit; Sharma, Sumita Kumari; Bailung, Heremba

    2015-01-01

    Dusty plasma, which contains nanometer to micrometer sized dust particles along with electrons and ions, supports a low frequency wave called Dust Acoustic wave, analogous to ion acoustic wave in normal plasma. Due to high charge and low temperature of the dust particles, dusty plasma can easily transform into a strongly coupled state when the Coulomb interaction potential energy exceeds the dust kinetic energy. Dust acoustic perturbations are excited in such strongly coupled dusty plasma by applying a short negative pulse (100 ms) of amplitude 5 - 20 V to an exciter. The perturbation steepens due to nonlinear effect and forms a solitary structure by balancing dispersion present in the medium. For specific discharge conditions, excitation amplitude above a critical value, the perturbation is found to evolve into a number of solitons. The experimental results on the excitation of multiple dust acoustic solitons in the strongly coupled regime are presented in this work. The experiment is carried out in radio frequency discharged plasma produced in a glass chamber at a pressure 0.01 - 0.1 mbar. Few layers of dust particles (∼ 5 μm in diameter) are levitated above a grounded electrode inside the chamber. Wave evolution is observed with the help of green laser sheet and recorded in a high resolution camera at high frame rate. The high amplitude soliton propagates ahead followed by smaller amplitude solitons with lower velocity. The separation between the solitons increases as time passes by. The characteristics of the observed dust acoustic solitons such as amplitude-velocity and amplitude- Mach number relationship are compared with the solutions of Korteweg-de Vries (KdV) equation. (author)

  6. Wood-related occupations, wood dust exposure, and sinonasal cancer.

    Science.gov (United States)

    Hayes, R B; Gerin, M; Raatgever, J W; de Bruyn, A

    1986-10-01

    A case-control study was conducted to examine the relations between type of woodworking and the extent of wood dust exposure to the risks for specific histologic types of sinonasal cancer. In cooperation with the major treatment centers in the Netherlands, 116 male patients newly diagnosed between 1978 and 1981 with primary malignancies of epithelial origin of this site were identified for study. Living controls were selected from the municipal registries, and deceased controls were selected from the national death registry. Interviews were completed for 91 (78%) cases and 195 (75%) controls. Job histories were coded by industry and occupation. An index of exposure was developed to classify the extent of occupational exposure to wood dust. When necessary, adjustment was made for age and usual cigarette use. The risk for nasal adenocarcinoma was elevated by industry for the wood and paper industry (odds ratio (OR) = 11.9) and by occupation for those employed in furniture and cabinet making (OR = 139.8), in factory joinery and carpentry work (OR = 16.3), and in association with high-level wood dust exposure (OR = 26.3). Other types of nasal cancer were not found to be associated with wood-related industries or occupations. A moderate excess in risk for squamous cell cancer (OR = 2.5) was associated with low-level wood dust exposure; however, no dose-response relation was evident. The association between wood dust and adenocarcinoma was strongest for those employed in wood dust-related occupations between 1930 and 1941. The risk of adenocarcinoma did not appear to decrease for at least 15 years after termination of exposure to wood dust. No cases of nasal adenocarcinoma were observed in men whose first exposure to wood dust occurred after 1941.

  7. Estimation of Graphite Dust Production in ITER TBM

    International Nuclear Information System (INIS)

    Kang, Ji Ho; Kim, Eung Seon

    2013-01-01

    This scheme uses simple equations and the calculation time is much less than others. However, the contact equation requires a specially tuned material properties and instability of system matrix were reported. Second, only a couple of pebbles were modeled using FEM(Finite Element Method) and appropriate boundary and loading conditions are imposed. This scheme gives a detailed information of stress distribution of the pebbles and the stability of calculation is well established. However, the calculation cost is fairly high and only a few pebble can be analyzed in detail at a time with specifically assigned contact conditions. In this study, a prediction model of graphite dust production in ITER(International Thermonuclear Experimental Reactor) TBM(Test Blanket Module) using FEM was introduced and the amount of dust production for an operation cycle was estimated. In this study, graphite dust generation in the reflector zone of ITER TBM was estimated using FE analysis. A unit-cell model was defined to simulate normal contact forces and slip distances on contact points between the center pebble and the surrounding pebbles. The dust production was calculated using Archard equation. The simulation was repeated with different friction coefficient of graphite material to investigate the effect of friction on the dust production. The calculation result showed that the amount of dust production was 2.22∼3.67e-4 g/m 3 which was almost linearly proportional to the friction coefficient of graphite material. The amount of graphite dust production was considered too much small for a dust explosion

  8. Saharan and Arabian Dust Aerosols: A Comparative Case Study of Lidar Ratio

    Directory of Open Access Journals (Sweden)

    Córdoba-Jabonero Carmen

    2016-01-01

    Full Text Available This work presents a first comparative study of the Lidar Ratio (LR values obtained for dust particles in two singular dust-influenced regions: the Canary Islands (Spain, close to the African coast in the North Atlantic Ocean, frequently affected by Saharan dust intrusions, and the Kuwait area (Arabian Peninsula as usually influenced by Arabian dust storms. Synergetic lidar and sun-photometry measurements are carried out in two stations located in these particular regions for that purpose. Several dusty cases were observed during 2014 in both stations and, just for illustration, two specific dusty case studies have been selected and analyzed to be shown in this work. In general, mean LR values of 54 sr and 40 sr were obtained in these studies cases for Saharan and Arabian dust particles, respectively. Indeed, these results are in agreement with other studies performed for dust particles arriving from similar desert areas. In particular, the disparity found in Saharan and Arabian dust LR values can be based on the singular composition of the suspended dust aerosols over each station. These results can be useful for CALIPSO extinction retrievals, where a single LR value (40 sr is assumed for pure dust particles independently on the dust source region.

  9. Ice Nucleating Particle Properties in the Saharan Air Layer Close to the Dust Source

    Science.gov (United States)

    Boose, Y.; Garcia, I. M.; Rodríguez, S.; Linke, C.; Schnaiter, M.; Nickovic, S.; Lohmann, U.; Kanji, Z. A.; Sierau, B.

    2015-12-01

    In August 2013 and 2014 measurements of ice nucleating particle (INP) concentrations, aerosol particle size distributions, chemistry and fluorescence were conducted at the Izaña Atmospheric Observatory located at 2373 m asl on Tenerife, west off the African shore. During summer, the observatory is frequently within the Saharan Air Layer and thus often exposed to dust. Absolute INP concentrations and activated fractions at T=-40 to -15°C and RHi=100-150 % were measured. In this study, we discuss the in-situ measured INP properties with respect to changes in the chemical composition, the biological content, the source regions as well as transport pathways and thus aging processes of the dust aerosol. For the first time, ice crystal residues were also analyzed with regard to biological content by means of their autofluorescence signal close to a major dust source region. Airborne dust samples were collected with a cyclone for additional offline analysis in the laboratory under similar conditions as in the field. Both, in-situ and offline dust samples were chemically characterized using single-particle mass spectrometry. The DREAM8 dust model extended with dust mineral fractions was run to simulate meteorological and dust aerosol conditions for ice nucleation. Results show that the background aerosol at Izaña was dominated by carbonaceous particles, which were hardly ice-active under the investigated conditions. When Saharan dust was present, INP concentrations increased by up to two orders of magnitude even at water subsaturated conditions at T≤-25°C. Differences in the ice-activated fraction were found between different dust periods which seem to be linked to variations in the aerosol chemical composition (dust mixed with changing fractions of sea salt and differences in the dust aerosol itself). Furthermore, two biomass burning events in 2014 were identified which led to very low INP concentrations under the investigated temperature and relative humidity

  10. Climate change and climate systems influence and control the atmospheric dispersion of desert dust: implications for human health

    Science.gov (United States)

    Griffin, Dale W.; Ragaini, Richard C.

    2010-01-01

    The global dispersion of desert dust through Earth’s atmosphere is greatly influenced by temperature. Temporal analyses of ice core data have demonstrated that enhanced dust dispersion occurs during glacial events. This is due to an increase in ice cover, which results in an increase in drier terrestrial cover. A shorter temporal analysis of dust dispersion data over the last 40 years has demonstrated an increase in dust transport. Climate systems or events such as the North Atlantic Oscillation, the Indian Ocean subtropical High, Pacific Decadal Oscillation, and El Nino-Sothern Oscillation are known to influence global short-term dust dispersion occurrence and transport routes. Anthropogenic influences on dust transport include deforestation, harmful use of topsoil for agriculture as observed during the American Dust Bowl period, and the creation of dry seas (Aral Sea) and lakes (Lake Owens in California and Lake Chad in North Africa) through the diversion of source waters (for irrigation and drinking water supplies). Constituents of desert dust both from source regions (pathogenic microorganisms, organic and inorganic toxins) and those scavenged through atmospheric transport (i.e., industrial and agricultural emissions) are known to directly impact human and ecosystem health. This presentation will present a review of global scale dust storms and how these events can be both a detriment and benefit to various organisms in downwind environments.

  11. Modelling soil dust aerosol in the Bodélé depression during the BoDEx campaign

    Science.gov (United States)

    Tegen, I.; Heinold, B.; Todd, M.; Helmert, J.; Washington, R.; Dubovik, O.

    2006-09-01

    We present regional model simulations of the dust emission events during the Bodélé Dust Experiment (BoDEx) that was carried out in February and March 2005 in Chad. A box model version of the dust emission model is used to test different input parameters for the emission model, and to compare the dust emissions computed with observed wind speeds to those calculated with wind speeds from the regional model simulation. While field observations indicate that dust production occurs via self-abrasion of saltating diatomite flakes in the Bodélé, the emission model based on the assumption of dust production by saltation and using observed surface wind speeds as input parameters reproduces observed dust optical thicknesses well. Although the peak wind speeds in the regional model underestimate the highest wind speeds occurring on 10-12 March 2005, the spatio-temporal evolution of the dust cloud can be reasonably well reproduced by this model. Dust aerosol interacts with solar and thermal radiation in the regional model; it is responsible for a decrease in maximum daytime temperatures by about 5 K at the beginning the dust storm on 10 March 2005. This direct radiative effect of dust aerosol accounts for about half of the measured temperature decrease compared to conditions on 8 March. Results from a global dust model suggest that the dust from the Bodélé is an important contributor to dust crossing the African Savannah region towards the Gulf of Guinea and the equatorial Atlantic, where it can contribute up to 40% to the dust optical thickness.

  12. Modelling soil dust aerosol in the Bodélé depression during the BoDEx campaign

    Directory of Open Access Journals (Sweden)

    I. Tegen

    2006-01-01

    Full Text Available We present regional model simulations of the dust emission events during the Bodélé Dust Experiment (BoDEx that was carried out in February and March 2005 in Chad. A box model version of the dust emission model is used to test different input parameters for the emission model, and to compare the dust emissions computed with observed wind speeds to those calculated with wind speeds from the regional model simulation. While field observations indicate that dust production occurs via self-abrasion of saltating diatomite flakes in the Bodélé, the emission model based on the assumption of dust production by saltation and using observed surface wind speeds as input parameters reproduces observed dust optical thicknesses well. Although the peak wind speeds in the regional model underestimate the highest wind speeds occurring on 10–12 March 2005, the spatio-temporal evolution of the dust cloud can be reasonably well reproduced by this model. Dust aerosol interacts with solar and thermal radiation in the regional model; it is responsible for a decrease in maximum daytime temperatures by about 5 K at the beginning the dust storm on 10 March 2005. This direct radiative effect of dust aerosol accounts for about half of the measured temperature decrease compared to conditions on 8 March. Results from a global dust model suggest that the dust from the Bodélé is an important contributor to dust crossing the African Savannah region towards the Gulf of Guinea and the equatorial Atlantic, where it can contribute up to 40% to the dust optical thickness.

  13. Loess and Eolian Dust Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Records of past environment derived from Loess and Eolian dust (silt-sized material deposited on the Earth surface by the surface winds. Parameter keywords describe...

  14. 75 FR 3881 - Combustible Dust

    Science.gov (United States)

    2010-01-25

    ..., rubber, drugs, dried blood, dyes, certain textiles, and metals (such as aluminum and magnesium..., furniture manufacturing, metal processing, fabricated metal products and machinery manufacturing, pesticide... standard that will comprehensively address the fire and explosion hazards of combustible dust. The Agency...

  15. Rethinking wood dust safety standards

    OpenAIRE

    Ratnasingam, Jega; Wai, Lim Tau; Ramasamy, Geetha; Ioras, Florin; Tadin, Ishak; Universiti Putra Malaysia; Buckinghamshire New University; Centre for Occupational Safety and Health Singapore

    2015-01-01

    The current universal work safety and health standards pertaining to wood dust in factories lack the localisation required. As a study has shown, there is a urgent need to reevaluate the current guidelines and practices.

  16. Effect of cement dust pollution on certain physical parameters of maize crop and soils

    Energy Technology Data Exchange (ETDEWEB)

    Parthasarathy, S; Arunachalam, N; Natarajan, K; Oblisami, G; Rangaswami, G

    1975-04-01

    A study was undertaken in the fields near a cement factory where the cement dust is the prime pollutant to the field crops and soils. Cement dust deposit varied with the distance from the kiln and fourth and fifth leaves of maize had comparatively more dust than the first three leaves from the top. The cement dust deposited plants showed a suppression in most of the characters like leaf size, number and size of cobs and plant height when compared to plants in non-polluted fields. On comparison with the physical characters of the soils from the control field the soil from cement dust polluted field showed a decrease in water holding capacity and pore space while thermal conductivity and specific heat were more. Artificial mixtures of red and black soils with cement dust showed similar trend as those of the field sample, the black soil being affected more seriously than the red soil.

  17. PREVAILING DUST-TRANSPORT DIRECTIONS ON COMET 67P/CHURYUMOV–GERASIMENKO

    Energy Technology Data Exchange (ETDEWEB)

    Kramer, Tobias; Noack, Matthias [Konrad-Zuse-Zentrum für Informationstechnik, Takustrasse 7, D-14195 Berlin (Germany)

    2015-11-10

    Dust transport and deposition behind larger boulders on the comet 67P/Churyumov–Gerasimenko (67P/C–G) have been observed by the Rosetta mission. We present a mechanism for dust-transport vectors based on a homogeneous surface activity model incorporating in detail the topography of 67P/C–G. The combination of gravitation, gas drag, and Coriolis force leads to specific dust transfer pathways, which for higher dust velocities fuel the near-nucleus coma. By distributing dust sources homogeneously across the whole cometary surface, we derive a global dust-transport map of 67P/C–G. The transport vectors are in agreement with the reported wind-tail directions in the Philae descent area.

  18. Physical properties of five grain dust types.

    OpenAIRE

    Parnell, C B; Jones, D D; Rutherford, R D; Goforth, K J

    1986-01-01

    Physical properties of grain dust derived from five grain types (soybean, rice, corn, wheat, and sorghum) were measured and reported. The grain dusts were obtained from dust collection systems of terminal grain handling facilities and were assumed to be representative of grain dust generated during the handling process. The physical properties reported were as follows: particle size distributions and surface area measurements using a Coulter Counter Model TAII; percent dust fractions less tha...

  19. Efficient radiative transfer in dust grain mixtures

    OpenAIRE

    Wolf, S.

    2002-01-01

    The influence of a dust grain mixture consisting of spherical dust grains with different radii and/or chemical composition on the resulting temperature structure and spectral energy distribution of a circumstellar shell is investigated. The comparison with the results based on an approximation of dust grain parameters representing the mean optical properties of the corresponding dust grain mixture reveal that (1) the temperature dispersion of a real dust grain mixture decreases substantially ...

  20. Comparison of the physical and chemical characteristics of fine road dust at different urban sites.

    Science.gov (United States)

    Lee, Kwang Yul; Batmunkh, Tsatsral; Joo, Hung Soo; Park, Kihong

    2018-04-18

    The size distribution and chemical components of a fine fraction (road dust collected at urban sites in Korea (Gwangju) and Mongolia (Ulaanbaatar) where distinct urban characteristics exist were measured. A clear bimodal size distribution was observed for the resuspended fine road dust at the urban sites in Korea. The first mode peaked at 100-110 nm, and the second peak was observed at 435-570 nm. Ultrafine mode (~30 nm) was found for the fine road dust at the Mongolia site, which was significantly affected by residential coal/biomass burning. The contribution of the water-soluble ions to the fine road dust was higher at the sites in Mongolia (15.8-16.8%) than at those in Korea (1.2-4.8%). Sulfate and chloride were the most dominant ionic species for the fine road dust in Mongolia. As (arsenic) was also much higher for the Mongolian road dust than the others. The sulfate, chloride, and As mainly come from coal burning activity, suggesting that coal and biomass combustion in Mongolia during the heating season should affect the size and chemical components of the fine road dust. Cu (copper) and Zn (zinc), carbonaceous particles (organic carbon [OC] and elemental carbon [EC]) increased at sites in Korea, suggesting that the fine road dust at these sites was significantly affected by the high volume of traffic (engine emission and brake/tire wear). Our results suggest that chemical profiles for road dust specific to certain sites should be applied to more accurately apportion road dust source contributing to the ambient particulate matter. Size and chemical characteristics of fine road dust at sites having distinct urban characteristics were examined. Residential coal and biomass burning and traffic affected physiochemical properties of the fine road dust. Different road dust profiles at different sites should be needed to determine the ambient PM2.5 sources more accurately.

  1. Spacesuit Integrated Carbon Nanotube Dust Mitigation System for Lunar Exploration

    Science.gov (United States)

    Manyapu, Kavya Kamal

    Lunar dust proved to be troublesome during the Apollo missions. The lunar dust comprises of fine particles, with electric charges imparted by solar winds and ultraviolet radiation. As such, it adheres readily, and easily penetrates through smallest crevices into mechanisms. During Apollo missions, the powdery dust substantially degraded the performance of spacesuits by abrading suit fabric and clogging seals. Dust also degraded other critical equipment such as rovers, thermal control and optical surfaces, solar arrays, and was thus shown to be a major issue for surface operations. Even inside the lunar module, Apollo astronauts were exposed to this dust when they removed their dust coated spacesuits. This historical evidence from the Apollo missions has compelled NASA to identify dust mitigation as a critical path. This important environmental challenge must be overcome prior to sending humans back to the lunar surface and potentially to other surfaces such as Mars and asteroids with dusty environments. Several concepts were successfully investigated by the international research community for preventing deposition of lunar dust on rigid surfaces (ex: solar cells, thermal radiators). However, applying these technologies for flexible surfaces and specifically to spacesuits has remained an open challenge, due to the complexity of the suit design, geometry, and dynamics. The research presented in this dissertation brings original contribution through the development and demonstration of the SPacesuit Integrated Carbon nanotube Dust Ejection/Removal (SPIcDER) system to protect spacesuits and other flexible surfaces from lunar dust. SPIcDER leverages the Electrodynamic Dust Shield (EDS) concept developed at NASA for use on solar cells. For the SPIcDER research, the EDS concept is customized for application on spacesuits and flexible surfaces utilizing novel materials and specialized design techniques. Furthermore, the performance of the active SPIcDER system is enhanced

  2. Grain dust and the lungs.

    Science.gov (United States)

    Chan-Yeung, M.; Ashley, M. J.; Grzybowski, S.

    1978-01-01

    Grain dust is composed of a large number of materials, including various types of grain and their disintegration products, silica, fungi, insects and mites. The clinical syndromes described in relation to exposure to grain dust are chronic bronchitis, grain dust asthma, extrinsic allergic alveolitis, grain fever and silo-filler's lung. Rhinitis and conjunctivitis are also common in grain workers. While the concentration and the quality of dust influence the frequency and the type of clinical syndrome in grain workers, host factors are also important. Of the latter, smoking is the most important factor influencing the frequency of chronic bronchitis. The role of atopy and of bronchial hyperreactivity in grain dust asthma has yet to be assessed. Several well designed studies are currently being carried out in North America not only to delineate the frequency of the respiratory abnormalities, the pathogenetic mechanisms and the host factors, but also to establish a meaningful threshold limit concentration for grain dust. Images p1272-a PMID:348288

  3. Charged dust structures in plasmas

    International Nuclear Information System (INIS)

    Cramer, N.F.; Vladimirov, S.V.

    1999-01-01

    We report here on theoretical investigations of the mechanical-electrostatic modes of vibration of a dust-plasma crystal, extending earlier work on the transverse modes of a horizontal line of grains (where the ions flow vertically downward to a plane horizontal cathode), the modes of two such lines of grains, and the modes of a vertical string of grains. The last two arrangements have the unique feature that the effect of the background plasma on the mutual grain interaction is asymmetric because of the wake downstream of the grains studied in. The characteristic frequencies of the vibrations are dependent on the parameters of the plasma and the dust grains, such as the Debye length and the grain charge, and so measurement of the frequencies could provide diagnostics of these quantities. Although the current boom in dusty plasma research is driven mainly by such industrial applications as plasma etching, sputtering and deposition, the physical outcomes of investigations in this rapidly expanding field cover many important topics in space physics and astrophysics as well. Examples are the interaction of dust with spacecraft, the structure of planetary rings, star formation, supernova explosions and shock waves. In addition, the study of the influence of dust in environmental research, such as in the Earth's ionosphere and atmosphere, is important. The unique binding of dust particles in a plasma opens possibilities for so-called super-chemistry, where the interacting bound elements are not atoms but dust grains

  4. Suspended dust in Norwegian cities

    International Nuclear Information System (INIS)

    2001-01-01

    According to calculations, at least 80 000 people in Oslo and 8 000 in Trondheim were annoyed by too much suspended dust in 2000. The dust concentration is greatest in the spring, presumably because dust is swirling up from melting snow and ice on the streets. Car traffic is the main source of the dust, except for some of the most highly exposed regions where wood-firing from old stoves contributes up to 70 percent of the dust. National targets for air quality include suspended dust, nitrogen dioxide, sulphur dioxide and benzene. Calculations show that nitrogen dioxide emissions exceeding the limit affected 4 000 people in Oslo and 1 000 people in Trondheim. The sulphur dioxide emissions in the major cities did non exceed the national quality limit; they did exceed the limit in some of the smaller industrial centres. In Trondheim, measurements show that the national limit for benzene was exceeded. Most of the emission of nitrogen dioxide comes from the road traffic. Local air pollution at times causes considerable health- and well-being problems in the larger cities and industrial centres, where a great part of the population may be at risk of early death, infection of the respiratory passage, heart- and lung diseases and cancer

  5. Discernible rhythm in the spatio/temporal distributions of transatlantic dust

    Directory of Open Access Journals (Sweden)

    Y. Ben-Ami

    2012-03-01

    Full Text Available The differences in North African dust emission regions and transport routes, between the boreal winter and summer, are thoroughly documented. Here we re-examine the spatial and temporal characteristics of dust transport over the tropical and subtropical North Atlantic Ocean, using 10 yr of satellite data, in order to better characterize the different dust transport periods. We see a robust annual triplet: a discernible rhythm of "transatlantic dust weather".

    The proposed annual partition is composed of two heavy loading periods, associated here with a northern-route period and southern-route period, and one light-loading period, accompanied by unusually low average optical depth of dust. The two dusty periods are quite different in character: their duration, transport routes, characteristic aerosol loading and frequency of pronounced dust episodes.

    The southern-route period lasts ~4 months. It is characterized by a relatively steady southern positioning, low frequency of dust events, low background values and high variance in dust loading. The northern-route period lasts ~6.5 months and is associated with a steady drift northward of ~0.1 latitude day−1, reaching ~1500 km north of the southern-route. The northern period is characterized by higher frequency of dust events, higher (and variable background and smaller variance in dust loading. It is less episodic than the southern period.

    Transitions between the periods are brief. Separation between the southern and northern periods is marked by northward latitudinal shift in dust transport and by moderate reduction in the overall dust loading. The second transition, between the northern and southern periods, commences with an abrupt reduction in dust loading and rapid shift southward of ~0.2 latitude day−1, and ~1300 km in total.

    Based on cross-correlation analyses, we attribute the observed rhythm to the contrast between the

  6. The impact of post-event information on study-related memories: an exploration of the roles of judgemental anchoring, specific expectations about change, and motivational influences.

    Science.gov (United States)

    Sedlmeier, Peter; Jaeger, Sonia

    2007-01-01

    We explored how well common theories about the impact of post-event information on memories explain recollections that occur naturally in university students' study routines. Instead of starting from a familiar research paradigm, such as those used in hindsight-bias research, the present study used a situation common to university students, and examined how well three candidate explanations--judgemental anchoring, implicit theories of change, and motivational influences--could explain the results we obtained in a long-term memory study that included three sessions, six months apart. We found that about two thirds of the memories of study-related issues were indeed biased, and that the impact of post-event information being used as an anchor is the most plausible explanation for the results. There were also some indications that memory biases might have been due, at least in part, to motivational factors.

  7. Tripolar vortices of dust-drift waves in dusty plasma with shear flow

    International Nuclear Information System (INIS)

    Chen Yinhua; Wang Ge

    2002-01-01

    Nonlinear equations governing dust-drift waves in magnetized dusty plasma with transverse shear flow are derived. For the specific profiles of flow and the plasma equilibrium density, a new type of solution in the form of tripolar vortices is found. The results show that the peak magnitude of tripolar vortices increases with increasing shear intensity and dust content

  8. Wood Dust in Joineries and Furniture Manufacturing : An Exposure Determinant and Intervention Study

    NARCIS (Netherlands)

    Douwes, Jeroen; Cheung, Kerry; Prezant, Bradley; Sharp, Mark; Corbin, Marine; McLean, Dave; 't Mannetje, Andrea; Schlunssen, Vivi; Sigsgaard, Torben; Kromhout, Hans; LaMontagne, Anthony D; Pearce, Neil; McGlothlin, James D

    Objectives: To assess wood dust exposures and determinants in joineries and furniture manufacturing and to evaluate the efficacy of specific interventions on dust emissions under laboratory conditions. Also, in a subsequent follow-up study in a small sample of joinery workshops, we aimed to develop,

  9. Video tracking and post-mortem analysis of dust particles from all tungsten ASDEX Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Endstrasser, N., E-mail: Nikolaus.Endstrasser@ipp.mpg.de [Max-Planck-Insitut fuer Plasmaphysik, EURATOM Association, Boltzmannstrasse 2, D-85748 Garching (Germany); Brochard, F. [Institut Jean Lamour, Nancy-Universite, Bvd. des Aiguillettes, F-54506 Vandoeuvre (France); Rohde, V., E-mail: Volker.Rohde@ipp.mpg.de [Max-Planck-Insitut fuer Plasmaphysik, EURATOM Association, Boltzmannstrasse 2, D-85748 Garching (Germany); Balden, M. [Max-Planck-Insitut fuer Plasmaphysik, EURATOM Association, Boltzmannstrasse 2, D-85748 Garching (Germany); Lunt, T.; Bardin, S.; Briancon, J.-L. [Institut Jean Lamour, Nancy-Universite, Bvd. des Aiguillettes, F-54506 Vandoeuvre (France); Neu, R. [Max-Planck-Insitut fuer Plasmaphysik, EURATOM Association, Boltzmannstrasse 2, D-85748 Garching (Germany)

    2011-08-01

    2D dust particle trajectories are extracted from fast framing camera videos of ASDEX Upgrade (AUG) by a new time- and resource-efficient code and classified into stationary hot spots, single-frame events and real dust particle fly-bys. Using hybrid global and local intensity thresholding and linear trajectory extrapolation individual particles could be tracked up to 80 ms. Even under challenging conditions such as high particle density and strong vacuum vessel illumination all particles detected for more than 50 frames are tracked correctly. During campaign 2009 dust has been trapped on five silicon wafer dust collectors strategically positioned within the vacuum vessel of the full tungsten AUG. Characterisation of the outer morphology and determination of the elemental composition of 5 x 10{sup 4} particles were performed via automated SEM-EDX analysis. A dust classification scheme based on these parameters was defined with the goal to link the particles to their most probable production sites.

  10. Externalities from lignite mining-related dust emissions

    International Nuclear Information System (INIS)

    Papagiannis, A.; Roussos, D.; Menegaki, M.; Damigos, D.

    2014-01-01

    During the last three decades, several studies have been conducted in order to assess the external costs of electricity production from fossil fuels, especially coal and lignite. Nevertheless, these studies usually ignore the impacts generated by the upstream mining works. This paper contributes to existing literature and attempts to fill this gap by exploring the externalities of lignite mining owing to the emission of suspended particulate matter. To this end, a ‘bottom-up’ approach is implemented, using as case study the largest operational lignite surface mine at the Lignite Center of Western Macedonia (Greece). The results indicate that annual air pollution externalities of lignite mining are of the order of 3€/ton of lignite, which corresponds to around 5.0 €/MW h. The estimated costs are significantly lower, i.e. up to 80%, when dust deposition is considered in air dispersion models. In any case, these findings should be seen as a starting point for discussion owing to the lack of specific emission rates for Greek lignite mines. - Highlights: • Externalities from lignite mining-related dust emissions are 3 €/t of lignite. • Externalities of mining correspond to around 5.0 €/MW h. • Externalities are significantly lower, up to 80%, if dust deposition is considered. • There is lack of specific dust emission rates for lignite mining. • There are high discrepancies in existing dust emission rates for lignite mining

  11. The Dust Settles

    Institute of Scientific and Technical Information of China (English)

    DAVID SPARKES

    2010-01-01

    @@ I think my Beijing sleep patterns are nearly back to normal. It has taken a few weeks, but in the wake of the world's greatest sporting event, the need to pass entire work nights without slumber has be-come a distant memory.

  12. Interannual Variability in Dust Deposition, Radiative Forcing, and Snowmelt Rates in the Colorado River Basin

    Science.gov (United States)

    Skiles, M.; Painter, T. H.; Deems, J. S.; Barrett, A. P.

    2011-12-01

    .043 mg/g higher dust concentration at the subalpine site. The smaller magnitude of difference at GMSP, 0.61 mg/g higher concentration in 2010, indicates that there is variability in dust sources and loading between study plots. Observations from both sites indicate that dust concentrations are not correlated with total number of dust events and that dust loading and concentrations are highly variable. The interannual and study plot variation helps broaden our understanding of the dynamics and implications of dust in snow in the Colorado River Basin.

  13. Paracas dust storms: Sources, trajectories and associated meteorological conditions

    Science.gov (United States)

    Briceño-Zuluaga, F.; Castagna, A.; Rutllant, J. A.; Flores-Aqueveque, V.; Caquineau, S.; Sifeddine, A.; Velazco, F.; Gutierrez, D.; Cardich, J.

    2017-09-01

    Dust storms that develop along the Pisco-Ica desert in Southern Peru, locally known as ;Paracas; winds have ecological, health and economic repercussions. Here we identify dust sources through MODIS (Moderate Resolution Imaging Spectroradiometer) imagery and analyze HYSPLIT (Hybrid Single Particles Lagrangian Integrated Trajectory) model trajectories and dispersion patterns, along with concomitant synoptic-scale meteorological conditions from National Centers for Environmental Prediction/National Center for Atmospheric Research reanalysis (NCEP/NCAR). Additionally, surface pressure data from the hourly METeorological Aerodrome Report (METAR) at Arica (18.5°S, 70.3°W) and Pisco (13.7°S, 76.2°W) were used to calculate Alongshore (sea-level) Pressure Gradient (APG) anomalies during Paracas dust storms, their duration and associated wind-speeds and wind directions. This study provides a review on the occurrence and strength of the Paracas dust storms as reported in the Pisco airfield for five-year period and their correspondence with MODIS true-color imagery in terms of dust-emission source areas. Our results show that most of the particle fluxes moving into the Ica-Pisco desert area during Paracas wind events originate over the coastal zone, where strong winds forced by steep APGs develop as the axis of a deep mid-troposphere trough sets in along north-central Chile. Direct relationships between Paracas wind intensity, number of active dust-emission sources and APGs are also documented, although the scarcity of simultaneous METAR/MODIS data for clearly observed MODIS dust plumes prevents any significant statistical inference. Synoptic-scale meteorological composites from NCEP/NCAR reanalysis data show that Paracas wind events (steep APGs) are mostly associated with the strengthening of anticyclonic conditions in northern Chile, that can be attributed to cold air advection associated with the incoming trough. Compared to the MODIS images, HYSPLIT outputs were able

  14. Response of a Habitat-Forming Marine Plant to a Simulated Warming Event Is Delayed, Genotype Specific, and Varies with Phenology.

    Directory of Open Access Journals (Sweden)

    Laura K Reynolds

    Full Text Available Growing evidence shows that increasing global temperature causes population declines and latitudinal shifts in geographical distribution for plants living near their thermal limits. Yet, even populations living well within established thermal limits of a species may suffer as the frequency and intensity of warming events increase with climate change. Adaptive response to this stress at the population level depends on the presence of genetic variation in thermal tolerance in the populations in question, yet few data exist to evaluate this. In this study, we examined the immediate effects of a moderate warming event of 4.5°C lasting 5 weeks and the legacy effects after a 5 week recovery on different genotypes of the marine plant Zostera marina (eelgrass. We conducted the experiment in Bodega Bay, CA USA, where average summer water temperatures are 14-15°C, but extended warming periods of 17-18°C occur episodically. Experimental warming increased shoot production by 14% compared to controls held at ambient temperature. However, after returning temperature to ambient levels, we found strongly negative, delayed effects of warming on production: shoot production declined by 27% and total biomass decreased by 50% relative to individuals that had not been warmed. While all genotypes' production decreased in the recovery phase, genotypes that grew the most rapidly under benign thermal conditions (control were the most susceptible to the detrimental effects of warming. This suggests a potential tradeoff in relative performance at normal vs. elevated temperatures. Modest short-term increases in water temperature have potentially prolonged negative effects within the species' thermal envelope, but genetic variation within these populations may allow for population persistence and adaptation. Further, intraspecific variation in phenology can result in maintenance of population diversity and lead to enhanced production in diverse stands given sufficient

  15. Study on treatment of dust by dismantling

    International Nuclear Information System (INIS)

    Torikai, K.; Suzuki, K.

    1987-01-01

    In dismantling of nuclear reactors, various kinds of treatment of dust generated by cutting or dismantling concrete structures of components of reactors are evaluated for safety, cost, and performance comparing the work in air with water. A method of dust treatment for work in air is discussed. The dry method has an easy operation in practice and a good performance in the equipment, but has problem on the prevention from radioactive contamination by diffusion of dust in air. For the purpose of advancing the strong points and eliminating the weak points in dry method, an improved venturi scrubber system is proposed for dismantling work as a dust collecting system. The system consists of dust absorbing pipe, dust collector, separator of dust and water and dust transfer equipment to a storage of waste. This system would be expected to have better performance and lower operating cost in decommissioning nuclear reactors, especially, the number of dust filters, for example, HEPA filters, will be considerably saved

  16. Interannual Similarity in the Martian Atmosphere During the Dust Storm Season

    Science.gov (United States)

    Kass, D. M.; Kleinboehl, A.; McCleese, D. J.; Schofield, J. T.; Smith, M. D.

    2016-01-01

    We find that during the dusty season on Mars (southern spring and summer) of years without a global dust storm there are three large regional-scale dust storms. The storms are labeled A, B, and C in seasonal order. This classification is based on examining the zonal mean 50 Pa (approximately 25 km) daytime temperature retrievals from TES/MGS and MCS/MRO over 6 Mars Years. Regional-scale storms are defined as events where the temperature exceeds 200 K. Examining the MCS dust field at 50 Pa indicates that warming in the Southern Hemisphere is dominated by direct heating, while northern high latitude warming is a dynamical response. A storms are springtime planet encircling Southern Hemisphere events. B storms are southern polar events that begin near perihelion and last through the solstice. C storms are southern summertime events starting well after the end of the B storm. C storms show the most interannual variability.

  17. High velocity collisions between large dust aggregates at the limit for growing planetesimals

    Science.gov (United States)

    Wurm, G.; Teiser, J.; Paraskov, G.

    2007-08-01

    Planetesimals are km-size bodies supposed to be formed in protoplanetary disks as planetary precursors [1]. The most widely considered mechanism for their formation is based on mutual collisions of smaller bodies, a process which starts with the aggregation of (sub)-micron size dust particles. In the absence of events that lithify the growing dust aggregates, only the surface forces between dust particles provide adhesion and internal strength of the objects. It has been assumed that this might be a disadvantage as dust aggregates are readily destroyed by rather weak collisions. In fact, experimental research on dust aggregation showed that for collisions in the m/s range (sub)-mm size dust aggregates impacting a larger body do show a transition from sticking to rebound and/or fragmentation in collisions and no growth occurs at the large velocities [2, 3]. This seemed to be incompatible with typical collision velocities of small dust aggregates with m-size bodies which are expected to be on the order 50 m/s in protoplanetary disks [4]. We recently found that the experimental results cannot be scaled from m/s to tens of m/s collisions. In contrast to the assumptions and somewhat counterintuitive, it is the fragility of dust aggregates that allows growth at higher collision velocities. In impact experiments Wurm et al. [5] showed that between 13 m/s and 25 m/s a larger compact (target) body consisting of micron-size SiO2 dust particles accreted 50 % of the mass of a 1 cm dust projectile consisting of the same dust. For slower impacts the projectile only rebounded or fragmented slightly.

  18. Asthma severity, child security, and child internalizing: using story stem techniques to assess the meaning children give to family and disease-specific events.

    Science.gov (United States)

    Winter, Marcia A; Fiese, Barbara H; Spagnola, Mary; Anbar, Ran D

    2011-12-01

    Children with persistent asthma are at increased risk for mental health problems. Although mechanisms of effect are not yet known, it may be that children are less trusting of the family as a source of support and security when they have more severe asthma. This study tested whether asthma severity is related to children's perceptions of insecurity in the family, and whether insecurity is in turn associated with child adjustment. Children (N = 168; mean age = 8 years) completed story stems pertaining to routine family events (e.g., mealtimes) and ambiguous but potentially threatening asthma events such as tightness in the chest. Responses were evaluated for the extent to which appraisals portrayed the family as responding in cohesive, security-provoking ways. Asthma severity was assessed by both objective lung function testing and primary caregiver report. Caregivers reported child symptomatology. Beyond medication adherence, caregiver education, and child age and gender, greater asthma severity predicted more internalizing and externalizing symptoms. Greater asthma severity, assessed using spirometry (but not parent report), was related to less secure child narratives of the family, which in turn related to more child internalizing symptoms. Results suggest that asthma can take a considerable toll on children's feelings of security and mental health. Furthermore, given the difficulty in assessing young children's perceptions, this study helps demonstrate the potential of story stem techniques in assessing children's appraisals of illness threat and management in the family.

  19. Four Interstellar Dust Candidates from the Stardust Interstellar Dust Collector

    Science.gov (United States)

    Westphal, A. J.; Allen, C.; Bajt, S.; Bechtel, H. A.; Borg, J.; Brenker, F.; Bridges, J.; Brownlee, D. E.; Burchell, M.; Burghammer, M.; hide

    2011-01-01

    In January 2006, the Stardust sample return capsule returned to Earth bearing the first solid samples from a primitive solar system body, Comet 81P/Wild2, and a collector dedicated to the capture and return of contemporary interstellar dust. Both collectors were approx. 0.1 sq m in area and were composed of aerogel tiles (85% of the collecting area) and aluminum foils. The Stardust Interstellar Dust Collector (SIDC) was exposed to the interstellar dust stream for a total exposure factor of 20 sq m/day. The Stardust Interstellar Preliminary Examination (ISPE) is a consortium-based project to characterize the collection using nondestructive techniques. The goals and restrictions of the ISPE are described . A summary of analytical techniques is described.

  20. Use of SEVIRI images and derived products in a WMO Sand and dust Storm Warning System

    Energy Technology Data Exchange (ETDEWEB)

    MartInez, M A; Ruiz, J; Cuevas, E [Agencia Estatal de MeteorologIa (AEMET) (Spain)], E-mail: mig@inm.es

    2009-03-01

    The Visible/IR images of SEVIRI (Spinning Enhanced Visible and Infrared Imager), on board Meteosat Second Generation (MSG) satellites, are used to monitor dust events. Satellite-based detection of dust is a difficult problem due in part to the observing-system limitations. The main difficulty is that the dust can be confused with water/ice clouds. SEVIRI is not as optimal for the viewing of dust as SEAWIFS or MODIS, due to the fact that both of them count with additional short-wavelength channels. However, the SEVIRI 15-minute loop images can detect small dust plumes as well as subtle changes from one image to the next. A description of how the AEMET, former INM, is developing the environment to support MSG satellite imagery to the WMO/GEO Sand and Dust Storm Warning System (SDS WS) for Europe, Africa and Middle East Regional Centre will be briefly presented, together with some on-going operational developments to best monitor dust events.

  1. Cosmic dust investigations. Pt. 2

    International Nuclear Information System (INIS)

    Simpson, J.A.; Tuzzolino, A.J.

    1989-01-01

    A series of experiments have been completed using accelerator dust particles in the mass range ≅ 10 -9 -10 -6 g and velocity range ≅ 2-12 km/s to measure the velocity loss and degree of fragmentation for dust particles penetrating 6 and 28 μm thick polyvinylidene fluoride (PVDF) dust detectors. These measurements prove that even for a ratio of PVDF foil thickness to particle diameter as large as 0.6, the velocity loss and fragmentation is far less than expected from earlier reports in the literature. For 6 μm thick foils the velocity loss is ≤5%. These experiments are based on an extension of our earlier work which showed that two PVDF foils spaced a given distance apart could provide accurate time-of-flight (TOF) information due to the fast pulse rise time of PVDF detector response. We also report on our present state of development of PVDF position-sensing detectors which identify the x, y coordinates of particle impact, using detector and electronic pulse techniques adapted from our semiconductor position-sensing cosmic-ray detectors. Typical position errors of ≅ 1 mm are readily achieved. Finally, we have combined the above developments into a dust-particle telescope which accurately (≅ 1 0 angular accuracy) measures the trajectory of the incident particle as well as its mass and incident velocity, irrespective of whether it is a charged or neutral particle. We discuss how this practical dust telescope can be combined with dust capture cells for space flight and later recovery for laboratory determination of elemental and isotopic composition of captured dust. We also describe a simpler trajectory array based on discrete mosaics of thin detectors which would measure trajectories with a mean angular error of ≅ 4 0 . We discuss the application of these instruments for distinguishing between interplanetary dust of cometary and asteroidal origin, and for measurements on a space station, from near-Earth trapped dust of artificial origin. (orig.)

  2. Modeling the Impact Ejected Dust Contribution to the Lunar Exosphere: Results from Experiments and Ground Truth from LADEE

    Science.gov (United States)

    Hermalyn, B.; Colaprete, A.

    2013-12-01

    A considerable body of evidence indicates the presence of lofted regolith dust above the lunar surface. These observations range from multiple in-situ and orbital horizon glow detections to direct measurement of dust motion on the surface, as by the Apollo 17 Lunar Ejecta and Meteorites (LEAM) experiment. Despite this evidence, the specific mechanisms responsible for the lofting of regolith are still actively debated. These include impact ejection, electrostatic lofting, effects of high energy radiation, UV/X- rays, and interplay with solar wind plasma. These processes are highly relevant to one of the two main scientific objectives of the Lunar Atmosphere and Dust Environment Explorer (LADEE) mission (due to launch September, 2013): to directly measure the lunar exospheric dust environment and its spatial and temporal variability towards the goal of better understanding the dust flux. Of all the proposed mechanisms taking place on the lunar surface, the only unequivocal ongoing process is impact cratering. Hypervelocity impact events, which mobilize and redistribute regolith across planetary surfaces, are arguably the most pervasive geologic process on rocky bodies. While many studies of dust lofting state that the impact flux rate is orders of magnitude too low to account for the lunar horizon glow phenomenon and discount its contribution, it is imperative to re-examine these assumptions in light of new data on impact ejecta, particularly from the contributions from mesoscale (impactor size on the order of grain size) and macroscale (impactor > grain size) cratering. This is in large part due to a previous lack of data, for while past studies have established a canonical ejecta model for main-stage ejection of sand targets from vertical impacts, only recent studies have been able to begin quantitatively probing the intricacies of the ejection process outside this main-stage, vertical regime. In particular, it is the high-speed early-time ejecta that will reach

  3. THE VISUALIZATION METHOD OF THE 3D CONCENTRATION DISTRIBUTION OF ASIAN DUST IN THE GOOGLE EARTH

    Directory of Open Access Journals (Sweden)

    W. Okuda

    2012-07-01

    Full Text Available The Asian dust (called "Kosa" in Japan transported from desert areas in the northern China often covers over East Asia in the late winter and spring seasons. In this study, first of all, for dust events observed at various places in Japan on April 1, 2007 and March 21, 2010, the long-range transport simulation of Asian dust from desert areas in the northern China to Japan is carried out. Next, the method for representing 3D dust clouds by means of the image overlay functionality provided in the Google Earth is described. Since it is very difficult to display 3D dust clouds along the curvature of the Earth on the global scale, the 3D dust cloud distributed at the altitude of about 6300m was divided into many thin layers, each of which is the same thickness. After each of layers was transformed to the image layer, each image layer was displayed at the appropriate altitude in the Google Earth. Thus obtained image layers were displayed every an hour in the Google Earth. Finally, it is shown that 3D Asian dust clouds generated by the method described in this study are represented as smooth 3D cloud objects even if we looked at Asian dust clouds transversely in the Google Earth.

  4. Identification of dust storm source areas in West Asia using multiple environmental datasets.

    Science.gov (United States)

    Cao, Hui; Amiraslani, Farshad; Liu, Jian; Zhou, Na

    2015-01-01

    Sand and Dust storms are common phenomena in arid and semi-arid areas. West Asia Region, especially Tigris-Euphrates alluvial plain, has been recognized as one of the most important dust source areas in the world. In this paper, a method is applied to extract SDS (Sand and Dust Storms) sources in West Asia region using thematic maps, climate and geography, HYSPLIT model and satellite images. Out of 50 dust storms happened during 2000-2013 and collected in form of MODIS images, 27 events were incorporated as demonstrations of the simulated trajectories by HYSPLIT model. Besides, a dataset of the newly released Landsat images was used as base-map for the interpretation of SDS source regions. As a result, six main clusters were recognized as dust source areas. Of which, 3 clusters situated in Tigris-Euphrates plain were identified as severe SDS sources (including 70% dust storms in this research). Another cluster in Sistan plain is also a potential source area. This approach also confirmed six main paths causing dust storms. These paths are driven by the climate system including Siberian and Polar anticyclones, monsoon from Indian Subcontinent and depression from north of Africa. The identification of SDS source areas and paths will improve our understandings on the mechanisms and impacts of dust storms on socio-economy and environment of the region. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Open-air sprays for capturing and controlling airborne float coal dust on longwall faces

    Science.gov (United States)

    Beck, T.W.; Seaman, C.E.; Shahan, M.R.; Mischler, S.E.

    2018-01-01

    Float dust deposits in coal mine return airways pose a risk in the event of a methane ignition. Controlling airborne dust prior to deposition in the return would make current rock dusting practices more effective and reduce the risk of coal-dust-fueled explosions. The goal of this U.S. National Institute for Occupational Safety and Health study is to determine the potential of open-air water sprays to reduce concentrations of airborne float coal dust, smaller than 75 µm in diameter, in longwall face airstreams. This study evaluated unconfined water sprays in a featureless tunnel ventilated at a typical longwall face velocity of 3.6 m/s (700 fpm). Experiments were conducted for two nozzle orientations and two water pressures for hollow cone, full cone, flat fan, air atomizing and hydraulic atomizing spray nozzles. Gravimetric samples show that airborne float dust removal efficiencies averaged 19.6 percent for all sprays under all conditions. The results indicate that the preferred spray nozzle should be operated at high fluid pressures to produce smaller droplets and move more air. These findings agree with past respirable dust control research, providing guidance on spray selection and spray array design in ongoing efforts to control airborne float dust over the entire longwall ventilated opening. PMID:29348700

  6. Open-air sprays for capturing and controlling airborne float coal dust on longwall faces.

    Science.gov (United States)

    Beck, T W; Seaman, C E; Shahan, M R; Mischler, S E

    2018-01-01

    Float dust deposits in coal mine return airways pose a risk in the event of a methane ignition. Controlling airborne dust prior to deposition in the return would make current rock dusting practices more effective and reduce the risk of coal-dust-fueled explosions. The goal of this U.S. National Institute for Occupational Safety and Health study is to determine the potential of open-air water sprays to reduce concentrations of airborne float coal dust, smaller than 75 µm in diameter, in longwall face airstreams. This study evaluated unconfined water sprays in a featureless tunnel ventilated at a typical longwall face velocity of 3.6 m/s (700 fpm). Experiments were conducted for two nozzle orientations and two water pressures for hollow cone, full cone, flat fan, air atomizing and hydraulic atomizing spray nozzles. Gravimetric samples show that airborne float dust removal efficiencies averaged 19.6 percent for all sprays under all conditions. The results indicate that the preferred spray nozzle should be operated at high fluid pressures to produce smaller droplets and move more air. These findings agree with past respirable dust control research, providing guidance on spray selection and spray array design in ongoing efforts to control airborne float dust over the entire longwall ventilated opening.

  7. Charged dust in saturn's magnetosphere

    International Nuclear Information System (INIS)

    Mendis, D.A.; Hill, J.R.; Houpis, H.L.F.

    1983-01-01

    Gravito-electrodynamic theory of charged dust grains is used to explain a variety of phenomena in those portions of the Saturnian ring system that are known to be dominated by fine (micron- and submicron-sized) dust, and in which collisional forces and Coulomb drag can be neglected. Among the phenomena discussed are the formation and evolution of the rotating near-radial spokes in the B-ring, the formation of waves in the F-ring, the cause of eccentricities of certain isolated ringlets, and the origin and morphology of the broad diffuse E-ring. Several novel processes predicted by the gravitoelectrodynamic theory, including 'magneto-gravitational capture' of exogenic dust by the magnetosphere, '1:1 magneto-gravitational orbital resonances' of charged dust with nearby satellites, and 'gyro-orbital resonances,' are used to explain individual observations. The effect of a ring current associated with this charged dust is also evaluated. Finally, the cosmogonic implications of the magneto-gravitational theory are briefly discussed. While several (although not all) of these processes have been discussed by one or more of the present authors elsewhere, the purpose of this paper is to synthesize all these processes within the framework of gravito-electrodynamics, and also to show its range of applicability within Saturn's ring system

  8. Dust modelling of fast flyby missions - Implications of in situ measurements

    Science.gov (United States)

    Carey, W. C.; McDonnell, J. A. M.

    Using the Divine approach to modelling of cometary dust distributions within the dust envelope, together with the Reference Model parameters established by the Comet Halley Environment Working Group, predicted flux and fluence values are presented for each of the Giotto Dust Impact Detection System (DIDSY) subsystems. Implications for returned DIDSY data are discussed with particular reference to mass-size distribution and particle fluence as a function of time. It is also shown that the first particle impact event recorded by any of the DIDSY subsystems is likely to be of sufficient mass to penetrate the front shield of the Giotto spacecraft.

  9. Physical properties of five grain dust types.

    Science.gov (United States)

    Parnell, C B; Jones, D D; Rutherford, R D; Goforth, K J

    1986-01-01

    Physical properties of grain dust derived from five grain types (soybean, rice, corn, wheat, and sorghum) were measured and reported. The grain dusts were obtained from dust collection systems of terminal grain handling facilities and were assumed to be representative of grain dust generated during the handling process. The physical properties reported were as follows: particle size distributions and surface area measurements using a Coulter Counter Model TAII; percent dust fractions less than 100 micron of whole dust; bulk density; particle density; and ash content. PMID:3709482

  10. Using 87Sr/86Sr Ratios of Carbonate Minerals in Dust to Quantify Contributions from Desert Playas to the Urban Wasatch Front, Utah, USA

    Science.gov (United States)

    Goodman, M.; Carling, G. T.; Fernandez, D. P.; Rey, K.; Hale, C. A.; Nelson, S.; Hahnenberger, M.

    2017-12-01

    Desert playas are important dust sources globally, with potential harmful health impacts for nearby urban areas. The Wasatch Front (population >2 million) in western Utah, USA, is located directly downwind of several playas that contribute to poor air quality on dust event days. Additionally, the exposed lakebed of nearby Great Salt Lake is a growing dust source as water levels drop in response to drought and river diversions. To investigate contributions of playa dust to the Wasatch Front, we sampled dust emissions from the exposed lakebed of Great Salt Lake and seven playas in western Utah, including Sevier Dry Lake, and dust deposition at four locations stretching 160 km from south to north along the Wasatch Front, including Provo, Salt Lake City, Ogden, and Logan. The samples were analyzed for mineralogy, bulk chemistry, and 87Sr/86Sr ratios for source apportionment. The mineralogy of playa dust and Wasatch Front dust samples was dominated by quartz, feldspar, chlorite and calcite. Bulk geochemical composition was similar for all playa dust sources, with higher anthropogenic metal concentrations in the Wasatch Front. Strontium isotope (87Sr/86Sr) ratios in the carbonate fraction of the dust samples were variable in the playa dust sources, ranging from 0.7105 in Sevier Dry Lake to 0.7150 in Great Salt Lake, providing a powerful tool for apportioning dust. Based on 87Sr/86Sr mixing models, Great Salt Lake contributed 0% of the dust flux at Provo, 20% of the dust flux at Salt Lake City, and 40% of the dust flux at Ogden and Logan during Fall 2015. Contrastingly, Great Salt Lake dust was less important in Spring of 2016, contributing 0% of the dust flux at Provo and City and Logan. Two major dust events that occurred on 3 November 2015 and 23 April 2016 had similar wind and climate conditions as understood by HYSPLIT backward trajectories, meaning that seasonal variability in dust emissions is due to playa surface conditions rather than meteorologic conditions

  11. New approaches to dust mitigation in the Antelope Valley

    Energy Technology Data Exchange (ETDEWEB)

    Farber, R.J.; Kim, B.M.; Grantz, D.A.; Vaughn, D.L.; Zink, T.; Skadberg, K.; Cowherd, C.; Grelinger, M.A.; Campbell, R.; De Salvio, A.; VanCuren, T.; Bort, J.

    1999-07-01

    The arid deserts of the southwestern US experience a frequent dust problem which can lead to PM10 violations. Blowing dust is also one of the major air quality problems of the arid deserts. From 1992 through the present, a group of research scientists have been investigating new techniques for mitigating the windblown dust in the Mojave Desert and more specifically the Antelope Valley near Palmdale and Lancaster, CA. This paper summarizes the progress made toward dust suppression in the Antelope Valley during the initial research phase from 1992 through 1996. During this period, there were both successes and failures. Stabilizing disturbed desert lands in a water-starved environment is challenging. The initial attempts focused on revegetation of native plants by seedings. There were mixed results depending on both the magnitude and timing of the rainfall. Various types of windfences were also erected and their effectiveness was studied using BSNE's. In the present program, the objectives have been broadened to include mitigating dust from all types of disturbed lands, not only abandoned farmlands. Techniques include new approaches to revegetation using seedlings, varying water treatments and soil amendments. An array of chemical suppressants are also being evaluated for cost-effectiveness as a function of longevity. Various geometries of wind fences have also been erected in blow sand areas and are being evaluated for cost-effectiveness using an interesting evaluation scheme. This portion of the paper provides a progress report of these latest dust mitigation techniques. This current research program is due to conclude about 2002. The end product of this decade research program will be a cookbook of dust mitigation solutions for various users including regulatory agencies, the USDA NRCS, farmers and construction interests.

  12. Physical properties of suspended dust during moist and low wind conditions in Iceland

    Czech Academy of Sciences Publication Activity Database

    Dagsson-Waldhauserova, P.; Arnalds, O.; Olafsson, H.; Škrabalová, L.; Sigurdardottir, G. M.; Braniš, M.; Hladil, Jindřich; Skála, Roman; Navrátil, Tomáš; Chadimová, Leona; Lowis of Menar, S.; Thorsteinsson, T.; Carlsen, H. K.; Jonsdottir, I.

    2014-01-01

    Roč. 27, č. 1 (2014), s. 25-39 ISSN 1670-567X Institutional support: RVO:67985831 Keywords : atmospheric measurements * dust storm event * surface heating * dust aerosol * climate aspects Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.188, year: 2014 http://www.ias.is/landbunadur/wgsamvef.nsf/Attachment/IAS%20-%204%20kafli%20Pavla/$file/IAS%20-%204%20kafli%20Pavla.pdf

  13. Experimental study on effects of drilling parameters on respirable dust production during roof bolting operations.

    Science.gov (United States)

    Jiang, Hua; Luo, Yi; McQuerrey, Joe

    2018-02-01

    Underground coalmine roof bolting operators exhibit a continued risk for overexposure to airborne levels of respirable coal and crystalline silica dust from the roof drilling operation. Inhaling these dusts can cause coal worker's pneumoconiosis and silicosis. This research explores the effect of drilling control parameters, specifically drilling bite depth, on the reduction of respirable dust generated during the drilling process. Laboratory drilling experiments were conducted and results demonstrated the feasibility of this dust control approach. Both the weight and size distribution of the dust particles collected from drilling tests with different bite depths were analyzed. The results showed that the amount of total inhalable and respirable dust was inversely proportional to the drilling bite depth. Therefore, control of the drilling process to achieve proper high-bite depth for the rock can be an important approach to reducing the generation of harmful dust. Different from conventional passive engineering controls, such as mist drilling and ventilation approaches, this approach is proactive and can cut down the generation of respirable dust from the source. These findings can be used to develop an integrated drilling control algorithm to achieve the best drilling efficiency as well as reducing respirable dust and noise.

  14. Synoptic characteristics of dust over the southwest of Iran

    Science.gov (United States)

    Katiraie-Boroujerdy, P.; Ghahri, F.; Ranjbar Saadatabadi, A.

    2012-12-01

    Iran is frequently affected by dust events because it is located in arid and semiarid belt of the world. As Khozestan province is in the vicinity of large deserts and also due to especial atmospheric conditions the frequency of dust in this area is increased in the recent years. Therefore it has the destructive affect on the healthcare, economy, social and etc. The study is based on the, sea level, 850 mb and 500 mb weather charts, surface wind field and observations weather data during the period of 1968-2008. By numerical simulation with WRF modeling it has tried to high light provide an answer to how this event produced and reached to Ahwaz. It has been shown in this 40 years, dust events by high strength and frequency occur in July in Ahwaz. Synoptic patterns revealed that for making sever dust event Persian Gulf thermal trough extends to the north west of Iraq and European ridge extends over the Black sea and large part of the Turkey by passing waves of middle level Mediterranean trough from northwest of Iraq and east of Syria. Numerical simulation shows strong surface flow over source regions in northwest of Iraq and east of Syria, creation westerly low level jet in low-lying areas and the increase in friction velocity in the source regions. In the deserts of Iraq and north east of Syria increase in friction velocity to its highest value (approx 0.6 m/s) causes reduction in visibility and by decrease to lowest value (approx 0.4 m/s) visibility reaches up to 600 meters in Ahwaz.

  15. EVOLUTION OF THE DUST IN V4332 SAGITTARII

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Dipankar P. K.; Ashok, N. M. [Astronomy and Astrophysics Division, Physical Research Laboratory, Ahmedabad, 380009 (India); Nuth, Joseph A. III [NASA/GSFC, Mail Code: 690, Greenbelt, MD 20771 (United States); Misselt, Karl A.; Su, K. Y. L. [Steward Observatory, University of Arizona, Tucson, AZ 85721-0065 (United States); Varricatt, Watson P. [United Kingdom Infrared Telescope, 660 N. Aohoku Place, University Park Hilo, Hawaii-96720 (United States); Sand, David [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Marion, G. H. [University of Texas at Austin, 1 University Station C1400, Austin, TX 78712-0259 (United States); Marengo, Massimo [Physics and Astronomy Department, Iowa State University, Ames, IA 50011 (United States)

    2015-12-01

    An eruptive nova-like event took place in 1994 in the stellar-merger candidate V4332 Sgr. Following the eruption, dust consisting of refractory silicate-rich dust grains containing a significant component of AlO bonding was formed sometime between 1998 and 2003. Observations using Spitzer between 2005 and 2009 show significant changes in the 10 μm silicate stretch feature. There is a deepening of the 10 μm silicate stretch as well as the development of a feature between about 13 and 20 μm consistent with a blend of the MgO and FeO stretching features and the O–Si–O bending mode of increasingly ordered silicate dust. Near-infrared observations show the presence of AlO and water vapor in the outflow in 2003, 2004, and 2005: the AlO has significantly decreased in spectra obtained in 2014 while the water vapor remains largely unchanged. An attempt is made to correlate these observations and understand the significance of these changes using DUSTY modeling. The observations appear consistent with the kinetically controlled condensation of highly underoxidized SiO/AlO/Fe/Mg dust grains in the outflow followed by the continuous evolution of the initial condensate due to thermal annealing and oxidation of the dust via reaction with ambient O, OH, and H{sub 2}O in the expanding, cooling shell. Periodic monitoring of this dust shell over the mid-infrared spectral range could yield useful information on the evolution of underoxidized silicate condensates exposed to hot water vapor in more conventional circumstellar environments.

  16. Calculation of risk for workers in dust working site

    Directory of Open Access Journals (Sweden)

    Geldová Erika

    2004-03-01

    Full Text Available The fibrogeneous dust is considered as a specific harmful substance in the mine working site. Such kind of dust cumulates in lungs and this fact usually results in lungs dusting, so - called pneumoconiosis. Thus, dustiness risk poses a probability of lungs damage by pneumoconiosis. For the calculation of dustiness risk it is needed to know the following data: the value of average dustiness kC in the working site per a definite time period, the dispersivity of dust “D” (it determines a portion of dust particles with a diameter under 5 µm, so - called respirable particles and the percentage content of quartz Qr in the respirable grain size fraction.The contribution presents the calculation of dustiness risk “R” according to the equation (1, where “R” is in percentage, “ša” is the analytically specific harmfulness and “KDc” is the total cumulative dust dose received by worker in time of its dust exposure.The total cumulative dust dose is calculated on the basis of the equation (4, where “kc” is the average dust concentration in the assessed time period, t–time of exposure, V –average amount of air inspired by exposed worker per time unit ( standardized on the value of 1,2 m3h-1,10-6-recalculation from mg to kg for “KDc”.If the values of “Qr”, “D” and “kc” during the worker exposure on a definite workplace are constant, the dustiness risk “R” is calculated according to the equation (1 and (5 respectively. In the case of “n” time intervals in that the values “Qr”, “D” and “kc” are known the dustiness risk “R” is calculated according to the equation (7. The total personal risk of worker is given by the equation (8.Conclusively, the influence of parameters change namely “Qr”, “D” and “kc” on the value of dustiness risk per equal time period is reported.

  17. Role of dust alkalinity in acid mobilization of iron

    Directory of Open Access Journals (Sweden)

    A. Ito

    2010-10-01

    Full Text Available Atmospheric processing of mineral aerosols by acid gases (e.g., SO2, HNO3, N2O5, and HCl may play a key role in the transformation of insoluble iron (Fe in the oxidized or ferric (III form to soluble forms (e.g., Fe(II, inorganic soluble species of Fe(III, and organic complexes of iron. On the other hand, mineral dust particles have a potential of neutralizing the acidic species due to the alkaline buffer ability of carbonate minerals (e.g., CaCO3 and MgCO3. Here we demonstrate the impact of dust alkalinity on the acid mobilization of iron in a three-dimensional aerosol chemistry transport model that includes a mineral dissolution scheme. In our model simulations, most of the alkaline dust minerals cannot be entirely consumed by inorganic acids during the transport across the North Pacific Ocean. As a result, the inclusion of alkaline compounds in aqueous chemistry substantially limits the iron dissolution during the long-range transport to the North Pacific Ocean: only a small fraction of iron (<0.2% dissolves from hematite in the coarse-mode dust aerosols with 0.45% soluble iron initially. On the other hand, a significant fraction of iron (1–2% dissolves in the fine-mode dust aerosols due to the acid mobilization of the iron-containing minerals externally mixed with carbonate minerals. Consequently, the model quantitatively reproduces higher iron solubility in smaller particles as suggested by measurements over the Pacific Ocean. It implies that the buffering effect of alkaline content in dust aerosols might help to explain the inverse relationship between aerosol iron solubility and particle size. We also demonstrate that the iron solubility is sensitive to the chemical specification of iron-containing minerals in dust. Compared with the dust sources, soluble iron from combustion sources contributes to a relatively marginal effect for deposition of soluble iron over the North

  18. Glass Frit Clumping And Dusting

    International Nuclear Information System (INIS)

    Steimke, J. L.

    2013-01-01

    DWPF mixes a slurry of glass frit (Frit 418) and dilute (1.5 wt%) formic acid solution with high level waste in the Slurry Mix Evaporator (SME). There would be advantages to introducing the frit in a non-slurry form to minimize water addition to the SME, however, adding completely dry frit has the potential to generate dust which could clog filters or condensers. Prior testing with another type of frit, Frit 320, and using a minimal amount of water reduced dust generation, however, the formation of hard clumps was observed. To examine options and behavior, a TTQAP [McCabe and Stone, 2013] was written to initiate tests that would address these concerns. Tests were conducted with four types of glass frit; Frit 320, DWPF Frit 418, Bekeson Frit 418 and Multi-Aspirator Frit 418. The last two frits are chemically identical to DWPF Frit 418 but smaller particles were removed by the respective vendors. Test results on Frit Clumping and Dusting are provided in this report. This report addresses the following seven questions. Short answers are provided below with more detailed answers to follow. 1. Will the addition of a small amount of water, 1.5 wt%, to dry DWPF Frit 418 greatly reduce the dust generation during handling at DWPF? a. Yes, a small scale test showed that adding a little water to the frit greatly reduced dust generation during handling. 2. Will the addition of small amounts of water to the frit cause clumping that will impair frit handling at DWPF? a. No, not with Frit 418. Although clumps were observed to form when 1.5 wt% water was mixed with DWPF Frit 418, then compressed and air-dried overnight, the clumps were easily crushed and did not form the hardened material noted when Frit 320 was tested. 3. What is the measured size distribution of dust generated when dry frit is handled? (This affects the feasibility and choice of processing equipment for removing the dust generating fraction of the frit before it is added to the SME.) a. The size distribution for

  19. Glass Frit Clumping And Dusting

    Energy Technology Data Exchange (ETDEWEB)

    Steimke, J. L.

    2013-09-26

    DWPF mixes a slurry of glass frit (Frit 418) and dilute (1.5 wt%) formic acid solution with high level waste in the Slurry Mix Evaporator (SME). There would be advantages to introducing the frit in a non-slurry form to minimize water addition to the SME, however, adding completely dry frit has the potential to generate dust which could clog filters or condensers. Prior testing with another type of frit, Frit 320, and using a minimal amount of water reduced dust generation, however, the formation of hard clumps was observed. To examine options and behavior, a TTQAP [McCabe and Stone, 2013] was written to initiate tests that would address these concerns. Tests were conducted with four types of glass frit; Frit 320, DWPF Frit 418, Bekeson Frit 418 and Multi-Aspirator Frit 418. The last two frits are chemically identical to DWPF Frit 418 but smaller particles were removed by the respective vendors. Test results on Frit Clumping and Dusting are provided in this report. This report addresses the following seven questions. Short answers are provided below with more detailed answers to follow. 1. Will the addition of a small amount of water, 1.5 wt%, to dry DWPF Frit 418 greatly reduce the dust generation during handling at DWPF? a. Yes, a small scale test showed that adding a little water to the frit greatly reduced dust generation during handling. 2. Will the addition of small amounts of water to the frit cause clumping that will impair frit handling at DWPF? a. No, not with Frit 418. Although clumps were observed to form when 1.5 wt% water was mixed with DWPF Frit 418, then compressed and air-dried overnight, the clumps were easily crushed and did not form the hardened material noted when Frit 320 was tested. 3. What is the measured size distribution of dust generated when dry frit is handled? (This affects the feasibility and choice of processing equipment for removing the dust generating fraction of the frit before it is added to the SME.) a. The size distribution for

  20. Dust and smoke pollution monitoring in industrial unit

    International Nuclear Information System (INIS)

    Shamsi, S.S.

    1995-01-01

    Dust and smoke are the two most commonly emitted industrial pollutants which are visible to the naked eye. Cement plants and power generation plants, based on coal and fuel oil etc. are the most common examples of industry emitting these pollutants. In this article these pollutants have been briefly described and some monitoring instruments for dust and smoke emissions have been specific. These instruments are especially suitable for power station and the cement industry etc. Automotive in urban areas. However, this paper does not include equipment for automotive exhaust pollution. (author)

  1. Dust deposit in recirculation regions

    International Nuclear Information System (INIS)

    Griemert, R.

    1985-03-01

    The present report shows investigations, which have been carried out in a closed duct at forward and backward facing steps. Distribution of fluid velocity and fluid fluctuations in and normal to main flow direction as well as the distribution of Reynolds shear stress have been measured. The mass transfer downstream of a backward facing step has been investigated as well. By using graphite-, copper-, tin- and rubber dust, conditions of deposition have been defined experimentally. A serie of photos shows the filling of a recirculation region downstream of a backward facing step with graphite dust. The present investigations allow to avoid deposition of dust in recirculation regions by selecting the fluid numbers in an appropriate way. (orig.) [de

  2. Dust Storm Hits Canary Islands

    Science.gov (United States)

    2002-01-01

    A thick pall of sand and dust blew out from the Sahara Desert over the Atlantic Ocean yesterday (January 6, 2002), engulfing the Canary Islands in what has become one of the worst sand storms ever recorded there. In this scene, notice how the dust appears particularly thick in the downwind wake of Tenerife, the largest of the Canary Islands. Perhaps the turbulence generated by the air currents flowing past the island's volcanic peaks is churning the dust back up into the atmosphere, rather than allowing it to settle toward the surface. This true-color image was captured by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite, on January 7, 2002. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  3. Mechanisms of metal dusting corrosion

    DEFF Research Database (Denmark)

    Hummelshøj, Thomas Strabo

    In this thesis the early stages of metal dusting corrosion is addressed; the development of carbon expanded austenite, C, and the decomposition hereof into carbides. Later stages of metal dusting corrosion are explored by a systematic study of stainless steel foils exposed to metal dusting...... deformed stainless steel flakes is transformed to expanded martensite/austenite during low-temperature carburization. Various experimental procedures to experimentally determine the concentration dependent diffusion coefficient of carbon in expanded austenite are evaluated. The most promising procedure...... powders and flakes. The nature of the decomposition products, carbides of the form M23C6 and M7C3, were evaluated by X-ray diffraction, light optical microscopy, scanning electron microscopy and thermodynamic modelling. The decomposition was found to be dependent on several parameters such as thermal...

  4. Geochemical characterization of critical dust source regions in the American West

    Science.gov (United States)

    Aarons, Sarah M.; Blakowski, Molly A.; Aciego, Sarah M.; Stevenson, Emily I.; Sims, Kenneth W. W.; Scott, Sean R.; Aarons, Charles

    2017-10-01

    The generation, transport, and deposition of mineral dust are detectable in paleoclimate records from land, ocean, and ice, providing valuable insight into earth surface conditions and cycles on a range of timescales. Dust deposited in marine and terrestrial ecosystems can provide critical nutrients to nutrient-limited ecosystems, and variations in dust provenance can indicate changes in dust production, sources and transport pathways as a function of climate variability and land use change. Thus, temporal changes in locations of dust source areas and transport pathways have implications for understanding interactions between mineral dust, global climate, and biogeochemical cycles. This work characterizes dust from areas in the American West known for dust events and/or affected by increasing human settlement and livestock grazing during the last 150 years. Dust generation and uplift from these dust source areas depends on climate and land use practices, and the relative contribution of dust has likely changed since the expansion of industrialization and agriculture into the western United States. We present elemental and isotopic analysis of 28 potential dust source area samples analyzed using Thermal Ionization Mass Spectrometry (TIMS) for 87Sr/86Sr and 143Nd/144Nd composition and Multi-Collector Inductively Coupled Plasma Mass Spectrometer (MC-ICPMS) for 176Hf/177Hf composition, and ICPMS for major and trace element concentrations. We find significant variability in the Sr, Nd, and Hf isotope compositions of potential source areas of dust throughout western North America, ranging from 87Sr/86Sr = 0.703699 to 0.740236, εNd = -26.6 to 2.4, and εHf = -21.7 to -0.1. We also report differences in the trace metal and phosphorus concentrations in the geologic provinces sampled. This research provides an important resource for the geochemical tracing of dust sources and sinks in western North America, and will aid in modeling the biogeochemical impacts of increased

  5. House dust mites in the city of Lima, Peru.

    Science.gov (United States)

    Croce, M; Costa-Manso, E; Baggio, D; Croce, J

    2000-01-01

    Since mites are the most common house dust allergens, knowledge about the species most prevalent in a region is important for diagnostic and specific immunotherapy purposes. In order to establish the prevalence of house dust mites in different city districts, 100 house dust samples were collected from different parts of Lima. Lima is a city of tropical climate located along the coast of the Pacific Ocean. The relative air humidity is 80-90% and the various districts studied are located at altitudes ranging from 37-355 meters. The mite Blomia tropicalis was the organism most frequently detected, being present in 59% of the house dust samples. Dermatophagoides pteronyssinus occupied second place (15.9%), followed by Chortoglyphus arcuatus and Tyrophagus putrescentiae. These four mites, taken together, represented more than 90% of the mites detected. No specimen of the species Dermatophagoides farinae was detected. We conclude that B. tropicalis and D. pteronyssinus are the most common house dust mites in Lima. Considering the high prevalence of B. tropicalis in Lima and the fact that its cross-reactivity with antigens of the mites of the family Pyroglyphidae is minimal, we conclude that sensitization to this mite should be investigated separately in allergic patients living in Lima.

  6. Dust prevention in bulk material transportation and handling

    Science.gov (United States)

    Kirichenko, A. V.; Kuznetsov, A. L.; Pogodin, V. A.

    2017-10-01

    The environmental problem of territory and atmosphere pollution caused by transportation and handling of dust-generating bulk cargo materials is quite common for the whole world. The reducing of weight of fine class coal caused by air blowing reaches the level of 0.5-0.6 t per railcar over the 500 km transportation distance, which is equal to the loss of 1 % of the total weight. The studies showed that all over the country in the process of the railroad transportation, the industry loses 3-5 metric tonnes of coal annually. There are several common tactical measurers to prevent dust formation: treating the dust-producing materials at dispatch point with special liquid solutions; watering the stacks and open handling points of materials; frequent dust removing and working area cleaning. Recently there appeared several new radical measures for pollution prevention in export of ore and coal materials via sea port terminals, specifically: wind-dust protection screens, the container cargo handling system of delivery materials to the hold of the vessels. The article focuses on the discussion of these measures.

  7. Blowing dust and highway safety in the southwestern United States: Characteristics of dust emission "hotspots" and management implications.

    Science.gov (United States)

    Li, Junran; Kandakji, Tarek; Lee, Jeffrey A; Tatarko, John; Blackwell, John; Gill, Thomas E; Collins, Joe D

    2018-04-15

    Despite the widespread media attention of chain-reaction traffic incidents and property damage caused by windblown dust in the U.S. and elsewhere in the world, very few studies have provided in-depth analysis on this issue. Remote sensing and field observations reveal that wind erosion in the southwestern U.S. typically occurs in localized source areas, characterized as "hotspots", while most of the landscape is not eroding. In this study, we identified the spatial and temporal distribution patterns of hotspots that may contribute dust blowing onto highways in the southwestern U.S. We further classified the hotspots for the potential of blowing dust production based upon field observations and wind erosion modeling. Results of land use and land cover show that shrubland, grassland, and cropland accounted for 42%, 31%, and 21% of the overall study area, respectively. However, of the 620 total hotspots identified, 164 (26%), 141 (22%), and 234 (38%) are located on shrubland, grassland, and cropland, respectively. Barren land represented 0.9% of the land area but 8% of the dust hotspots. While a majority of these hotspots are located close to highways, we focused on 55 of them, which are located hotspot sites are dominated by sand and silt particles with threshold shear velocities ranging from 0.17-0.78m s -1 , largely depending on the land use of the hotspot sites. Dust emission modeling showed that 13 hotspot sites could produce annual emissions >3.79kg m -2 , yielding highly hazardous dust emissions to ground transportation with visibility hotspots are critical information for highway authorities to make informed and timely management decisions when wind events strike. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Intergalactic dust and quasar distribution

    International Nuclear Information System (INIS)

    Soltan, A.

    1979-01-01

    Non-homogeneous intergalactic extinction may considerably affect the quasar distribution. Especially samples of quasars isolated on the basis of B-V colours are subject to this phenomenon. Apparent grouping and close pairs of quasars reported in the literature may be a result of intergalactic dust. Using surface distribution of faint blue objects selected by Hawkins and Reddish it is estimated that intergalactic extinction in B should reach approximately 1 mag out to the redshift of approximately 1. This is slightly larger than predicted by theory and comparable to the mean dust density derived from observations. (Author)

  9. The distribution of interstellar dust

    International Nuclear Information System (INIS)

    Clocchiatti, A.; Marraco, H.G.

    1986-01-01

    We propose the interstellar matter structural function as a tool to derive the features of the interstellar dust distribution. We study that function resolving some ideal dust distribution models. Later we describe the method used to find a reliable computing algorithm for the observational case. Finally, we describe the steps to build a model for the interstellar matter composed by spherically symmetrical clouds. The density distribution for each of these clouds is D(r) = D 0 .esup(-r/r 0 ) 2 . The preliminary results obtained are summarised. (author)

  10. Ground and satellite-based remote sensing of mineral dust using AERI spectra and MODIS thermal infrared window brightness temperatures

    Science.gov (United States)

    Hansell, Richard Allen, Jr.

    The radiative effects of dust aerosol on our climate system have yet to be fully understood and remain a topic of contemporary research. To investigate these effects, detection/retrieval methods for dust events over major dust outbreak and transport areas have been developed using satellite and ground-based approaches. To this end, both the shortwave and longwave surface radiative forcing of dust aerosol were investigated. The ground-based remote sensing approach uses the Atmospheric Emitted Radiance Interferometer brightness temperature spectra to detect mineral dust events and to retrieve their properties. Taking advantage of the high spectral resolution of the AERI instrument, absorptive differences in prescribed thermal IR window sub-band channels were exploited to differentiate dust from cirrus clouds. AERI data collected during the UAE2 at Al-Ain UAE was employed for dust retrieval. Assuming a specified dust composition model a priori and using the light scattering programs of T-matrix and the finite difference time domain methods for oblate spheroids and hexagonal plates, respectively, dust optical depths have been retrieved and compared to those inferred from a collocated and coincident AERONET sun-photometer dataset. The retrieved optical depths were then used to determine the dust longwave surface forcing during the UAE2. Likewise, dust shortwave surface forcing is investigated employing a differential technique from previous field studies. The satellite-based approach uses MODIS thermal infrared brightness temperature window data for the simultaneous detection/separation of mineral dust and cirrus clouds. Based on the spectral variability of dust emissivity at the 3.75, 8.6, 11 and 12 mum wavelengths, the D*-parameter, BTD-slope and BTD3-11 tests are combined to identify dust and cirrus. MODIS data for the three dust-laden scenes have been analyzed to demonstrate the effectiveness of this detection/separation method. Detected daytime dust and cloud

  11. Event Investigation

    International Nuclear Information System (INIS)

    Korosec, D.

    2000-01-01

    The events in the nuclear industry are investigated from the license point of view and from the regulatory side too. It is well known the importance of the event investigation. One of the main goals of such investigation is to prevent the circumstances leading to the event and the consequences of the event. The protection of the nuclear workers against nuclear hazard, and the protection of general public against dangerous effects of an event could be achieved by systematic approach to the event investigation. Both, the nuclear safety regulatory body and the licensee shall ensure that operational significant events are investigated in a systematic and technically sound manner to gather information pertaining to the probable causes of the event. One of the results should be appropriate feedback regarding the lessons of the experience to the regulatory body, nuclear industry and general public. In the present paper a general description of systematic approach to the event investigation is presented. The systematic approach to the event investigation works best where cooperation is present among the different divisions of the nuclear facility or regulatory body. By involving management and supervisors the safety office can usually improve their efforts in the whole process. The end result shall be a program which serves to prevent events and reduce the time and efforts solving the root cause which initiated each event. Selection of the proper method for the investigation and an adequate review of the findings and conclusions lead to the higher level of the overall nuclear safety. (author)

  12. Electrostatic Dust Detector with Improved Sensitivity

    International Nuclear Information System (INIS)

    Boyle, D.P.; Skinner, C.H.; Roquemore, A.L.

    2008-01-01

    Methods to measure the inventory of dust particles and to remove dust if it approaches safety limits will be required in next-step tokamaks such as ITER. An electrostatic dust detector, based on a fine grid of interlocking circuit traces, biased to 30 or 50 V, has been developed for the detection of dust on remote surfaces in air and vacuum environments. Gaining operational experience of dust detection on surfaces in tokamaks is important, however the level of dust generated in contemporary short-pulse tokamaks is comparatively low and high sensitivity is necessary to measure dust on a shot-by-shot basis. We report on modifications in the detection electronics that have increased the sensitivity of the electrostatic dust detector by a factor of up to 120, - a level suitable for measurements on contemporary tokamaks.

  13. Infrared Observations of Cometary Dust and Nuclei

    Science.gov (United States)

    Lisse, Carey

    2004-01-01

    This bibliography lists citations for publications published under the grant. Subjects of the publications include cometary dust, instellar and interplanetary dust, comet nuclei and comae, Comet Hale-Bopp, infrared observations of comets, mass loss, and comet break-up.

  14. The global distribution of mineral dust

    International Nuclear Information System (INIS)

    Tegen, I; Schepanski, K

    2009-01-01

    Dust aerosol particles produced by wind erosion in arid and semi arid regions affect climate and air quality, but the magnitude of these effects is largely unquantified. The major dust source regions include the Sahara, the Arabian and Asian deserts; global annual dust emissions are currently estimated to range between 1000 and 3000 Mt/yr. Dust aerosol can be transported over long distances of thousands of kilometers, e.g. from source regions in the Saharan desert over the North Atlantic, or from the Asian deserts towards the Pacific Ocean. The atmospheric dust load varies considerably on different timescales. While dust aerosol distribution and dust effects are important on global scales, they strongly depend on dust emissions that are controlled on small spatial and temporal scales.

  15. Exact solutions for rotating charged dust

    International Nuclear Information System (INIS)

    Islam, J.N.

    1984-01-01

    Earlier work by the author on rotating charged dust is summarized. An incomplete class of exact solutions for differentially rotating charged dust in Newton-Maxwell theory for the equal mass and charge case that was found earlier is completed. A new global exact solution for cylindrically symmetric differentially rotating charged dust in Newton-Maxwell theory is presented. Lastly, a new exact solution for cylindrically symmetric rigidly rotating charged dust in general relativity is given. (author)

  16. Studies of dust shells around stars

    International Nuclear Information System (INIS)

    Bedijn, P.J.

    1977-01-01

    This thesis deals with some aspects of circumstellar dust shells. This dust shell, emitting infrared radiation, is described by way of its absorptive and emissive properties as well as by the transfer of radiation through the dust shell itself. Model calculations are compared to experimental results and agree reasonably well. The author also discusses the dynamics of the extended shells of gas and dust around newly formed stars

  17. Biogeochemical Impact of Long-Range Transported Dust over Northern South China Sea

    Science.gov (United States)

    Tsay, Si-Chee; Wang, S. H.; Hsu, N. C.

    2011-01-01

    Transpacific transport and impact of Asian dust aerosols have been well documented (e.g., results from ACE-Asia and regional follow-on campaigns), but little is known about dust invasion to the South China Sea (SCS). On 19-21 March 2010, a fierce Asian dust storm affected large areas from the Gobi deserts to the West Pacific, including Taiwan and Hong Kong. As a pilot study of the 7-SEAS (Seven South East Asian Studies) in the northern SCS, detailed characteristics of long-range transported dust aerosols were first observed by a comprehensive set of ground-based instruments deployed at the Dongsha islands (20deg42'52" N, 116deg43'51" E). Aerosol measurements such as particle mass concentrations, size distribution, optical properties, hygroscopicity, and vertical profiles help illustrate the evolution of this dust outbreak. Our results indicate that these dust particles were mixed with anthropogenic and marine aerosols, and transported near the surface. Satellite assessment of biogeochemical impact of dust deposition into open oceans is hindered by our current inability in retrieving areal dust properties and ocean colors over an extensive period of time, particularly under the influence of cloudy conditions. In this paper, we analyze the changes of retrieved Chlorophyll-a (Chl-a) concentration over the northern SCS, considered as oligotophic waters in the spring, from long-term SeaWiFS measurements since 1997. Over the past decade, six long-range transported dust events are identified based on spatiotemporal evolutions of PM10 measurements from regional monitoring stations, with the aid of trajectory analysis. Multi-year composites of Chl-a imagery for dust event and non-dust background during March-April are applied to overcome insufficient retrievals of Chl-a due to cloudy environment. Due to anthropogenic modification within a shallow boundary layer off the densely populated and industrial southeast coast of China, the iron ion activat