[Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

Science.gov (United States)

Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

2016-01-01

Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Development of swine-specific DNA markers for biosensor-based halal authentication.

Science.gov (United States)

Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

2012-06-29

The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

A nuclear DNA-based species determination and DNA quantification assay for common poultry species.

Science.gov (United States)

Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S

2014-12-01

DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.

Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

1999-01-01

Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

Science.gov (United States)

Freeman, S.; Pham, M.; Rodriguez, R.J.

1993-01-01

Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

Fragmentation in DNA double-strand breaks

International Nuclear Information System (INIS)

Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

2005-01-01

DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

Supramolecular gel electrophoresis of large DNA fragments.

Science.gov (United States)

Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

2017-10-01

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Species-specific identification from incomplete sampling: applying DNA barcodes to monitoring invasive solanum plants.

Science.gov (United States)

Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong

2013-01-01

Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.

DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

Science.gov (United States)

García-Vilchis, David; Aranda-Anzaldo, Armando

2017-12-01

Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

Directory of Open Access Journals (Sweden)

Van Esbroeck Marjan

2011-03-01

Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

Reliable discrimination of 10 ungulate species using high resolution melting analysis of faecal DNA.

Directory of Open Access Journals (Sweden)

Ana Ramón-Laca

Full Text Available Identifying species occupying an area is essential for many ecological and conservation studies. Faecal DNA is a potentially powerful method for identifying cryptic mammalian species. In New Zealand, 10 species of ungulate (Order: Artiodactyla have established wild populations and are managed as pests because of their impacts on native ecosystems. However, identifying the ungulate species present within a management area based on pellet morphology is unreliable. We present a method that enables reliable identification of 10 ungulate species (red deer, sika deer, rusa deer, fallow deer, sambar deer, white-tailed deer, Himalayan tahr, Alpine chamois, feral sheep, and feral goat from swabs of faecal pellets. A high resolution melting (HRM assay, targeting a fragment of the 12S rRNA gene, was developed. Species-specific primers were designed and combined in a multiplex PCR resulting in fragments of different length and therefore different melting behaviour for each species. The method was developed using tissue from each of the 10 species, and was validated in blind trials. Our protocol enabled species to be determined for 94% of faecal pellet swabs collected during routine monitoring by the New Zealand Department of Conservation. Our HRM method enables high-throughput and cost-effective species identification from low DNA template samples, and could readily be adapted to discriminate other mammalian species from faecal DNA.

Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

Science.gov (United States)

Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

2017-11-01

The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

Science.gov (United States)

Treulen, F; Uribe, P; Boguen, R; Villegas, J V

2016-02-01

Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

Science.gov (United States)

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Complementary DNA-amplified fragment length polymorphism ...

African Journals Online (AJOL)

Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

Science.gov (United States)

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

Science.gov (United States)

Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

2018-02-01

To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

High efficiency hydrodynamic DNA fragmentation in a bubbling system

NARCIS (Netherlands)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

2017-01-01

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

Science.gov (United States)

Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

2018-03-12

Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

OpenAIRE

Harmey, Judith H.; Harmey, Matthew A.

1993-01-01

We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

Science.gov (United States)

Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

2014-12-01

Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

Directory of Open Access Journals (Sweden)

Carol Coughlan

2015-01-01

Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

Detecting fragmentation extinction thresholds for forest understory plant species in peninsular Spain.

Science.gov (United States)

Rueda, Marta; Moreno Saiz, Juan Carlos; Morales-Castilla, Ignacio; Albuquerque, Fabio S; Ferrero, Mila; Rodríguez, Miguel Á

2015-01-01

Ecological theory predicts that fragmentation aggravates the effects of habitat loss, yet empirical results show mixed evidences, which fail to support the theory instead reinforcing the primary importance of habitat loss. Fragmentation hypotheses have received much attention due to their potential implications for biodiversity conservation, however, animal studies have traditionally been their main focus. Here we assess variation in species sensitivity to forest amount and fragmentation and evaluate if fragmentation is related to extinction thresholds in forest understory herbs and ferns. Our expectation was that forest herbs would be more sensitive to fragmentation than ferns due to their lower dispersal capabilities. Using forest cover percentage and the proportion of this percentage occurring in the largest patch within UTM cells of 10-km resolution covering Peninsular Spain, we partitioned the effects of forest amount versus fragmentation and applied logistic regression to model occurrences of 16 species. For nine models showing robustness according to a set of quality criteria we subsequently defined two empirical fragmentation scenarios, minimum and maximum, and quantified species' sensitivity to forest contraction with no fragmentation, and to fragmentation under constant forest cover. We finally assessed how the extinction threshold of each species (the habitat amount below which it cannot persist) varies under no and maximum fragmentation. Consistent with their preference for forest habitats probability occurrences of all species decreased as forest cover contracted. On average, herbs did not show significant sensitivity to fragmentation whereas ferns were favored. In line with theory, fragmentation yielded higher extinction thresholds for two species. For the remaining species, fragmentation had either positive or non-significant effects. We interpret these differences as reflecting species-specific traits and conclude that although forest amount is of

Detecting fragmentation extinction thresholds for forest understory plant species in peninsular Spain.

Directory of Open Access Journals (Sweden)

Marta Rueda

Full Text Available Ecological theory predicts that fragmentation aggravates the effects of habitat loss, yet empirical results show mixed evidences, which fail to support the theory instead reinforcing the primary importance of habitat loss. Fragmentation hypotheses have received much attention due to their potential implications for biodiversity conservation, however, animal studies have traditionally been their main focus. Here we assess variation in species sensitivity to forest amount and fragmentation and evaluate if fragmentation is related to extinction thresholds in forest understory herbs and ferns. Our expectation was that forest herbs would be more sensitive to fragmentation than ferns due to their lower dispersal capabilities. Using forest cover percentage and the proportion of this percentage occurring in the largest patch within UTM cells of 10-km resolution covering Peninsular Spain, we partitioned the effects of forest amount versus fragmentation and applied logistic regression to model occurrences of 16 species. For nine models showing robustness according to a set of quality criteria we subsequently defined two empirical fragmentation scenarios, minimum and maximum, and quantified species' sensitivity to forest contraction with no fragmentation, and to fragmentation under constant forest cover. We finally assessed how the extinction threshold of each species (the habitat amount below which it cannot persist varies under no and maximum fragmentation. Consistent with their preference for forest habitats probability occurrences of all species decreased as forest cover contracted. On average, herbs did not show significant sensitivity to fragmentation whereas ferns were favored. In line with theory, fragmentation yielded higher extinction thresholds for two species. For the remaining species, fragmentation had either positive or non-significant effects. We interpret these differences as reflecting species-specific traits and conclude that although

Fragmentation of sperm DNA using the TUNEL method.

Science.gov (United States)

Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

2014-11-01

To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

Generation of species-specific DNA probes for Leishmania aethiopica

NARCIS (Netherlands)

Laskay, T.; Kiessling, R.; Rinke deWit, T. F.; Wirth, D. F.

1991-01-01

We report here the cloning of kinetoplast DNA (kDNA) sequences from Leishmania aethiopica in order to develop a specific and sensitive method for the identification of the parasite. Analysis of the cloned kDNA sequences showed different taxonomic specificities demonstrating sequence diversity within

Agarose gel electrophoresis for the separation of DNA fragments.

Science.gov (United States)

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

Interbreeding and DNA analysis of sibling species within the Bactrocera dorsalis complex

International Nuclear Information System (INIS)

Tan, Keng-Hong

2003-01-01

Bactrocera dorsalis and B. papayae interbreed readily and produce viable offspring under laboratory conditions. Under laboratory observation of B. carambolae and B. papayae interbreeding, the average number of eggs laid by hybrid females was lower than that of B. papayae females but higher than that of B. carambolae females of intra-specific crosses. For inter- and intra-specific mating, the copulatory period is dependent on the female species involved - female B. carambolae copulates significantly longer than that of B. papayae female. Aedeagal and aculeus length of hybrids are intermediate between those of their respective parental species. Hybrid males have one to four sex pheromonal components after consumption of methyl eugenol; 2-6% of them possess a combination of endogenous pheromonal components specific to B. carambolae and components derived from methyl eugenol typical of B. papayae. Based on the latter, four wild males captured from different parts of Peninsular Malaysia possessed combination of the sex pheromonal components. DNA analysis using PCR techniques was very useful in differentiating pest species. Using AFLP polymorphism of amplified DNA fragment plus calculated Nei's genetic distance showed that natural hybrid of B. carambolae and B. papayae was closer to B. dorsalis than to the parental species. Using exon primed, intron crossing PCR, one of the three alleles of actin gene intron of B. dorsalis has identical DNA sequence to one of three allelic introns of the same gene in B. papayae which suggests that the two species are not distinct genetic species. A Hobo-like transposon element was detected in a population from Penang Island, while in a population from the mainland of Peninsular Malaysia, a mariner-like transposon element was detected. (author)

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

Science.gov (United States)

Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

2014-08-01

This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

Evolution of divergent DNA recognition specificities in VDE homing endonucleases from two yeast species.

Science.gov (United States)

Posey, Karen L; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S

2004-01-01

Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 --> T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites.

Evolution of divergent DNA recognition specificities in VDE homing endonucleases from two yeast species

Science.gov (United States)

Posey, Karen L.; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S.

2004-01-01

Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 → T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites. PMID:15280510

Importance of riparian remnants for frog species diversity in a highly fragmented rainforest.

Science.gov (United States)

Rodríguez-Mendoza, Clara; Pineda, Eduardo

2010-12-23

Tropical forests undergo continuous transformation to other land uses, resulting in landscapes typified by forest fragments surrounded by anthropogenic habitats. Small forest fragments, specifically strip-shaped remnants flanking streams (referred to as riparian remnants), can be particularly important for the maintenance and conservation of biodiversity within highly fragmented forests. We compared frog species diversity between riparian remnants, other forest fragments and cattle pastures in a tropical landscape in Los Tuxtlas, Mexico. We found similar species richness in the three habitats studied and a similar assemblage structure between riparian remnants and forest fragments, although species composition differed by 50 per cent. Frog abundance was halved in riparian remnants compared with forest fragments, but was twice that found in pastures. Our results suggest that riparian remnants play an important role in maintaining a portion of frog species diversity in a highly fragmented forest, particularly during environmentally stressful (hot and dry) periods. In this regard, however, the role of riparian remnants is complementary, rather than substitutive, with respect to the function of other forest fragments within the fragmented forest.

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

Science.gov (United States)

Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

2013-10-01

Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

Bacterial natural transformation by highly fragmented and damaged DNA

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

2013-01-01

for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

Species and gender differentiation between and among domestic ...

African Journals Online (AJOL)

A mitochondial DNA marker (mt700) and one restriction enzyme, Rsa1 were used in the PCR-RFLP species identification of game meat obtained from two National Parks in Tanzania. Species-specific reference DNA fragment patterns were obtained using fresh meat from ten wildlife and four domesticated species.

DNA barcoding commercially important fish species of Turkey.

Science.gov (United States)

Keskın, Emre; Atar, Hasan H

2013-09-01

DNA barcoding was used in the identification of 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. A total of 1765 DNA barcodes using a 654-bp-long fragment of the mitochondrial cytochrome c oxidase subunit I gene were generated for 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. These species belong to 70 genera, 40 families and 19 orders from class Actinopterygii, and all were associated with a distinct DNA barcode. Nine and 12 of the COI barcode clusters represent the first species records submitted to the BOLD and GenBank databases, respectively. All COI barcodes (except sequences of first species records) were matched with reference sequences of expected species, according to morphological identification. Average nucleotide frequencies of the data set were calculated as T = 29.7%, C = 28.2%, A = 23.6% and G = 18.6%. Average pairwise genetic distance among individuals were estimated as 0.32%, 9.62%, 17,90% and 22.40% for conspecific, congeneric, confamilial and within order, respectively. Kimura 2-parameter genetic distance values were found to increase with taxonomic level. For most of the species analysed in our data set, there is a barcoding gap, and an overlap in the barcoding gap exists for only two genera. Neighbour-joining trees were drawn based on DNA barcodes and all the specimens clustered in agreement with their taxonomic classification at species level. Results of this study supported DNA barcoding as an efficient molecular tool for a better monitoring, conservation and management of fisheries. © 2013 John Wiley & Sons Ltd.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

1995-01-01

Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

Mitochondrial DNA in wildlife forensic science: Species identification of tissues

Science.gov (United States)

Cronin, Matthew A.; Palmisciano, Daniel A.; Vyse, Ernest R.; Cameron, David G.

1991-01-01

A common problem in wildlife law enforcement is identifying the species of origin of carcasses, meat, or blood when morphological characters such as hair or bones are not available. Immunological and protein electrophoretic (allozyme or general protein) procedures have been used in species identification with considerable success (Bunch et al. 1976, McClymont et al. 1982, Wolfe 1983, Mardini 1984, Pex and Wolfe 1985, Dratch 1986), However, immunological tests often are not sensitive enough to distinguish closely related species. Furthermore, electrophoretically detectable protein polymorphisms may be lacking in certain populations or species and may not be species-specific.Analysis of DNA in human and wildlife forensics has been shown to be a potentially powerful tool for identification of individuals (Jeffreys et al. 1985, Vassartet al. 1987, Thommasen et al. 1989). Differences in copy number and nucleotide sequence of repetitive sequences in the nuclear (chromosomal) DNA result in hypervariability and individual-specific patterns which have been termed DNA "fingerprints." However, these patterns may be too variable for species identification necessitating analyses of more conservative parts of the genome.Mitochondrial DNA (mtDNA) is haploid, maternally inherited, similar in nucleotide sequence among conspecifics from the same geographic region, and more suitable for species identification, in contrast to hypervariable DNA fingerprints. MtDNA has several characteristics which make it useful as a species-specific marker. In mammals, individuals have a single mtDNA genotype shared by all tissues. Because mtDNA is haploid and reflects only maternal ancestry, the mtDNA gene number in a population is 4 times less than the nuclear gene number (Birky et al. 1983). This can result in relatively rapid loss or fixation of mtDNA genotypes so that all individuals in a population may be descended from a single ancestral female in as few as 4N (N = population size) generations

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

International Nuclear Information System (INIS)

Kosaka, T.; Kuwabara, M.; Koide, F.

1992-01-01

Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

Environmental DNA for Detection of Endangered Grouper Species (Epinephelus spp.

Directory of Open Access Journals (Sweden)

Servet A. Doğdu

2016-09-01

Full Text Available Marine ecosystems nestle species or populations known to be threatened due to human overexploitation. Reliable detection and monitoring of threatened organisms is crucial for data-driven conservation actions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA obtained directly from seawater samples to detect endangered grouper species (Epinephelus spp.. Cytochrome c oxidase subunit I (COI fragment of mtDNA was used to detect groupers species in the Mediterranean Coasts. We conducted eDNA sampling at sites by underwater diving across the range of the Grouper species habitats in Northeastern Mediterranean (Antalya-Kas Region and Iskenderun Bay. eDNA was isolated from 2 liter seawater samples which were vacuum-filtered onto 0.45-mm membrane filters. Filters were then folded inwards, placed in 2 ml tubes and stored at -20 oC until DNA extraction, which took place within 24 hours. DNA was extracted from the water sample filters using the DNeasy Blood and Tissue Kit (Qiagen, USA. Manufacturer’s protocols were used during all steps. PCR amplification of eDNA samples were done using selective primers of COI region of mitochondrial DNA, and next-generation DNA sequencing of PCR application was conducted. For the successfully obtained COI sequences, maximum matching rates were revealed as 80% for Epinephelus marginatus, 78,95% for Epinephelus aeneus, 73,48% for Epinephelus costae, 63,45% for Epinephelus caninus, 60,12% for Mycteroperca rubra and 57,12% for Hyporthodus haifensis. Despite the methodological challenges inherent in eDNA analysis, the results demonstrated that eDNA method may be proved to step towards a new beginning to detect and monitor endangered grouper species.

Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

Directory of Open Access Journals (Sweden)

Jiabing Ji

Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

Rates of species loss from Amazonian forest fragments

Science.gov (United States)

Ferraz, Gonçalo; Russell, Gareth J.; Stouffer, Philip C.; Bierregaard, Richard O.; Pimm, Stuart L.; Lovejoy, Thomas E.

2003-01-01

In the face of worldwide habitat fragmentation, managers need to devise a time frame for action. We ask how fast do understory bird species disappear from experimentally isolated plots in the Biological Dynamics of Forest Fragments Project, central Amazon, Brazil. Our data consist of mist-net records obtained over a period of 13 years in 11 sites of 1, 10, and 100 hectares. The numbers of captures per species per unit time, analyzed under different simplifying assumptions, reveal a set of species-loss curves. From those declining numbers, we derive a scaling rule for the time it takes to lose half the species in a fragment as a function of its area. A 10-fold decrease in the rate of species loss requires a 1,000-fold increase in area. Fragments of 100 hectares lose one half of their species in <15 years, too short a time for implementing conservation measures. PMID:14614134

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Science.gov (United States)

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

Science.gov (United States)

Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

2009-05-01

Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

International Nuclear Information System (INIS)

Lau How Mooi

1998-01-01

Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

International Nuclear Information System (INIS)

Dallas, J.F.

1988-01-01

A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

New Method for Simultaneous Species-Specific Identification of Equine Strongyles (Nematoda, Strongylida) by Reverse Line Blot Hybridization▿

Science.gov (United States)

Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.

2007-01-01

The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168

Internal Transcribed Spacer (ITS), an ideal DNA barcode for species ...

African Journals Online (AJOL)

Background: DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. Materials and Methods: In the present study, four potential DNA barcodes, namely rbcL, matK, ...

Mobile phone radiation induces reactive oxygen species production and DNA damage in human spermatozoa in vitro.

Directory of Open Access Journals (Sweden)

Geoffry N De Iuliis

Full Text Available BACKGROUND: In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. PRINCIPAL FINDINGS: Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR tuned to 1.8 GHz and covering a range of specific absorption rates (SAR from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001. Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. CONCLUSIONS: RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications

Real-time Tracking of DNA Fragment Separation by Smartphone.

Science.gov (United States)

Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

2017-06-01

Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

DNA barcoding of shark meats identify species composition and CITES-listed species from the markets in Taiwan.

Science.gov (United States)

Liu, Shang-Yin Vanson; Chan, Chia-Ling Carynn; Lin, Oceana; Hu, Chieh-Shen; Chen, Chaolun Allen

2013-01-01

An increasing awareness of the vulnerability of sharks to exploitation by shark finning has contributed to a growing concern about an unsustainable shark fishery. Taiwan's fleet has the 4th largest shark catch in the world, accounting for almost 6% of the global figures. Revealing the diversity of sharks consumed by Taiwanese is important in designing conservation plans. However, fins make up less than 5% of the total body weight of a shark, and their bodies are sold as filets in the market, making it difficult or impossible to identify species using morphological traits. In the present study, we adopted a DNA barcoding technique using a 391-bp fragment of the mitochondrial cytochrome oxidase I (COI) gene to examine the diversity of shark filets and fins collected from markets and restaurants island-wide in Taiwan. Amongst the 548 tissue samples collected and sequenced, 20 major clusters were apparent by phylogenetic analyses, each of them containing individuals belonging to the same species (most with more than 95% bootstrap values), corresponding to 20 species of sharks. Additionally, Alopias pelagicus, Carcharhinus falciformis, Isurus oxyrinchus, and Prionace glauca consisted of 80% of the samples we collected, indicating that these species might be heavily consumed in Taiwan. Approximately 5% of the tissue samples used in this study were identified as species listed in CITES Appendix II, including two species of Sphyrna, C. longimanus and Carcharodon carcharias. DNA barcoding provides an alternative method for understanding shark species composition when species-specific data is unavailable. Considering the global population decline, stock assessments of Appendix II species and highly consumed species are needed to accomplish the ultimate goal of shark conservation.

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

Science.gov (United States)

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Ribosomal DNA variation in finger millet and wild species of Eleusine (Poaceae).

Science.gov (United States)

Hilu, K W; Johnson, J L

1992-04-01

Finger millet is an important cereal crop in the semi-arid regions of Africa and India. The crop belongs to the grass genus Eleusine, which includes nine annual and perennial species native to Africa except for the New World species E. tristachya. Ribosomal DNA (rDNA) variation in finger millet and related wild species was used to provide information on the origin of the genomes of this tetraploid crop and point out genetic relationships of the crop to other species in the genus. The restriction endonucleases used revealed a lack of variability in the rDNA spacer region in domesticated finger millet. All the rDNA variants of the crop were found in the proposed direct tetraploid ancestor, E. coracana subsp. africana. Wild and domesticated finger millet displayed the phenotypes found in diploid E. indica. Diploid Eleusine tristachya showed some similarity to the crop in some restriction sites. The remaining species were quite distinct in rDNA fragment patterns. The study supports the direct origin of finger millet from subspecies africana shows E. indica to be one of the genome donors of the crop, and demonstrates that none of the other species examined could have donated the second genome of the crop. The rDNA data raise the possibility that wild and domesticated finger millet could have originated as infraspecific polyploid hybrids from different varieties of E. indica.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Self-DNA inhibitory effects: Underlying mechanisms and ecological implications.

Science.gov (United States)

Cartenì, Fabrizio; Bonanomi, Giuliano; Giannino, Francesco; Incerti, Guido; Vincenot, Christian Ernest; Chiusano, Maria Luisa; Mazzoleni, Stefano

2016-01-01

DNA is usually known as the molecule that carries the instructions necessary for cell functioning and genetic inheritance. A recent discovery reported a new functional role for extracellular DNA. After fragmentation, either by natural or artificial decomposition, small DNA molecules (between ∼50 and ∼2000 bp) exert a species specific inhibitory effect on individuals of the same species. Evidence shows that such effect occurs for a wide range of organisms, suggesting a general biological process. In this paper we explore the possible molecular mechanisms behind those findings and discuss the ecological implications, specifically those related to plant species coexistence.

Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

Science.gov (United States)

2005-10-01

1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

Directory of Open Access Journals (Sweden)

Barbara Dariš

2018-02-01

Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

Science.gov (United States)

Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

2004-10-01

Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

Science.gov (United States)

Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

2011-01-01

Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

[Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

Science.gov (United States)

Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

2016-09-01

Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

DNA barcoding of shark meats identify species composition and CITES-listed species from the markets in Taiwan.

Directory of Open Access Journals (Sweden)

Shang-Yin Vanson Liu

Full Text Available BACKGROUND: An increasing awareness of the vulnerability of sharks to exploitation by shark finning has contributed to a growing concern about an unsustainable shark fishery. Taiwan's fleet has the 4th largest shark catch in the world, accounting for almost 6% of the global figures. Revealing the diversity of sharks consumed by Taiwanese is important in designing conservation plans. However, fins make up less than 5% of the total body weight of a shark, and their bodies are sold as filets in the market, making it difficult or impossible to identify species using morphological traits. METHODS: In the present study, we adopted a DNA barcoding technique using a 391-bp fragment of the mitochondrial cytochrome oxidase I (COI gene to examine the diversity of shark filets and fins collected from markets and restaurants island-wide in Taiwan. RESULTS: Amongst the 548 tissue samples collected and sequenced, 20 major clusters were apparent by phylogenetic analyses, each of them containing individuals belonging to the same species (most with more than 95% bootstrap values, corresponding to 20 species of sharks. Additionally, Alopias pelagicus, Carcharhinus falciformis, Isurus oxyrinchus, and Prionace glauca consisted of 80% of the samples we collected, indicating that these species might be heavily consumed in Taiwan. Approximately 5% of the tissue samples used in this study were identified as species listed in CITES Appendix II, including two species of Sphyrna, C. longimanus and Carcharodon carcharias. CONCLUSION: DNA barcoding provides an alternative method for understanding shark species composition when species-specific data is unavailable. Considering the global population decline, stock assessments of Appendix II species and highly consumed species are needed to accomplish the ultimate goal of shark conservation.

Unraveling the drivers of community dissimilarity and species extinction in fragmented landscapes.

Science.gov (United States)

Banks-Leite, Cristina; Ewers, Robert M; Metzger, Jean Paul

2012-12-01

Communities in fragmented landscapes are often assumed to be structured by species extinction due to habitat loss, which has led to extensive use of the species-area relationship (SAR) in fragmentation studies. However, the use of the SAR presupposes that habitat loss leads species to extinction but does not allow for extinction to be offset by colonization of disturbed-habitat specialists. Moreover, the use of SAR assumes that species richness is a good proxy of community changes in fragmented landscapes. Here, we assessed how communities dwelling in fragmented landscapes are influenced by habitat loss at multiple scales; then we estimated the ability of models ruled by SAR and by species turnover in successfully predicting changes in community composition, and asked whether species richness is indeed an informative community metric. To address these issues, we used a data set consisting of 140 bird species sampled in 65 patches, from six landscapes with different proportions of forest cover in the Atlantic Forest of Brazil. We compared empirical patterns against simulations of over 8 million communities structured by different magnitudes of the power-law SAR and with species-specific rules to assign species to sites. Empirical results showed that, while bird community composition was strongly influenced by habitat loss at the patch and landscape scale, species richness remained largely unaffected. Modeling results revealed that the compositional changes observed in the Atlantic Forest bird metacommunity were only matched by models with either unrealistic magnitudes of the SAR or by models ruled by species turnover, akin to what would be observed along natural gradients. We show that, in the presence of such compositional turnover, species richness is poorly correlated with species extinction, and z values of the SAR strongly underestimate the effects of habitat loss. We suggest that the observed compositional changes are driven by each species reaching its

Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

Science.gov (United States)

Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

1996-12-01

Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.

DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

DEFF Research Database (Denmark)

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

Isolation of a sex-linked DNA sequence in cranes.

Science.gov (United States)

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

Mitochondrial DNA variation and genetic relationships of Populus species.

Science.gov (United States)

Barrett, J W; Rajora, O P; Yeh, F C; Dancik, B P; Strobeck, C

1993-02-01

We examined variation in and around the region coding for the cytochrome c oxidase I (coxI) and ATPase 6 (atp6) genes in the mitochondrial genomes of four Populus species (P. nigra, P. deltoides, P. maximowiczii, and P. tremuloides) and the natural hybrid P. x canadensis (P. deltoides x P. nigra). Total cellular DNAs of these poplars were digested with 16 restriction endonucleases and probed with maize mtDNA-specific probes (CoxI and Atp6). The only variant observed for Atp6 was interspecific, with P. maximowiczii separated from the other species as revealed by EcoRI digestions. No intraspecific mtDNA variation was observed among individuals of P. nigra, P. maximowiczii, P. x canadensis, or P. tremuloides for the CoxI probe. However, two varieties of P. deltoides were distinct because of a single site change in the KpnI digestions, demonstrating that P. deltoides var. deltoides (eastern cottonwood) and var. occidentalis (plains cottonwood) have distinct mitochondrial genomes in the region of the coxI gene. Populus x canadensis shared the same restriction fragment patterns as its suspected maternal parent P. deltoides. Nucleotide substitutions per base in and around the coxI and atp6 genes among the Populus species and the hybrid ranged from 0.0017 to 0.0077. The interspecific estimates of nucleotide substitution per base suggested that P. tremuloides was furthest removed from P. deltoides and P. x canadensis and least diverged from P. nigra. Populus maximowiczii was placed between these two clusters.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

Energy Technology Data Exchange (ETDEWEB)

Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

2000-06-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

International Nuclear Information System (INIS)

Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

2000-01-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

Science.gov (United States)

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

International Nuclear Information System (INIS)

Jackson, Christopher B.; Gallati, Sabina; Schaller, André

2012-01-01

Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

Energy Technology Data Exchange (ETDEWEB)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

International Nuclear Information System (INIS)

Jones, J.L.; Bulford, B.B.

1990-07-01

The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

International Nuclear Information System (INIS)

Sage, E.; Moustacchi, E.

1987-01-01

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

Science.gov (United States)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

Science.gov (United States)

Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

2016-06-20

Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

Directory of Open Access Journals (Sweden)

Gosalvez Jaime

2009-04-01

Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

International Nuclear Information System (INIS)

Hentosh, P.; Henner, W.D.; Reynolds, R.J.

1985-01-01

DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

Directory of Open Access Journals (Sweden)

Erwan Quéméré

Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

DEFF Research Database (Denmark)

Peng, Xu; Brügger, Kim; Shen, Biao

2003-01-01

terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...... recognizes both main families of repeat sequences in S. solfataricus. The recombinant protein, expressed in Escherichia coli, showed the same binding properties to the SRSR repeat as the native one. The SSO454 protein exhibits a tripartite internal repeat structure which yields a good sequence match...... with a helix-turn-helix DNA-binding motif. Although this putative motif is shared by other archaeal proteins, orthologs of SSO454 were only detected in species within the Sulfolobus genus and in the closely related Acidianus genus. We infer that the genus-specific protein induces an opening of the structure...

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

Science.gov (United States)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

Energy Technology Data Exchange (ETDEWEB)

Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

2012-06-01

Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny.

Science.gov (United States)

Yu, Xiang-Qin; Drew, Bryan T; Yang, Jun-Bo; Gao, Lian-Ming; Li, De-Zhu

2017-01-01

Schima is an ecologically and economically important woody genus in tea family (Theaceae). Unresolved species delimitations and phylogenetic relationships within Schima limit our understanding of the genus and hinder utilization of the genus for economic purposes. In the present study, we conducted comparative analysis among the complete chloroplast (cp) genomes of 11 Schima species. Our results indicate that Schima cp genomes possess a typical quadripartite structure, with conserved genomic structure and gene order. The size of the Schima cp genome is about 157 kilo base pairs (kb). They consistently encode 114 unique genes, including 80 protein-coding genes, 30 tRNAs, and 4 rRNAs, with 17 duplicated in the inverted repeat (IR). These cp genomes are highly conserved and do not show obvious expansion or contraction of the IR region. The percent variability of the 68 coding and 93 noncoding (>150 bp) fragments is consistently less than 3%. The seven most widely touted DNA barcode regions as well as one promising barcode candidate showed low sequence divergence. Eight mutational hotspots were identified from the 11 cp genomes. These hotspots may potentially be useful as specific DNA barcodes for species identification of Schima. The 58 cpSSR loci reported here are complementary to the microsatellite markers identified from the nuclear genome, and will be leveraged for further population-level studies. Phylogenetic relationships among the 11 Schima species were resolved with strong support based on the cp genome data set, which corresponds well with the species distribution pattern. The data presented here will serve as a foundation to facilitate species identification, DNA barcoding and phylogenetic reconstructions for future exploration of Schima.

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

International Nuclear Information System (INIS)

Evenson, Donald P.; Wixon, Regina

2005-01-01

Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

Directory of Open Access Journals (Sweden)

Raupach Michael J

2010-09-01

Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

Science.gov (United States)

Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

2010-09-13

The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

Science.gov (United States)

Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

2017-05-11

Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

Science.gov (United States)

Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

2014-02-01

trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

Science.gov (United States)

Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

2006-12-01

The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

DEFF Research Database (Denmark)

Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

2013-01-01

It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

Charge-transfer interactions of Cr species with DNA.

Science.gov (United States)

Nowicka, Anna M; Matysiak-Brynda, Edyta; Hepel, Maria

2017-10-01

Interactions of Cr species with nucleic acids in living organisms depend strongly on Cr oxidation state and the environmental conditions. As the effects of these interactions range from benign to pre-mutagenic to carcinogenic, careful assessment of the hazard they pose to human health is necessary. We have investigated methods that would enable quantifying the DNA damage caused by Cr species under varying environmental conditions, including UV, O 2 , and redox potential, using simple instrumental techniques which could be in future combined into a field-deployable instrumentation. We have employed electrochemical quartz crystal nanogravimetry (EQCN), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) to evaluate the extent of DNA damage expressed in terms of guanine oxidation yield (η) and changes in specific characteristics provided by these techniques. The effects of the interactions of Cr species with DNA were analyzed using a model calf thymus DNA (ctDNA) film on a gold electrode (Au@ctDNA) in different media, including: (i) Cr(VI), (ii) Cr(VI) reduced at -0.2V, (iii) Cr(III)+UV radiation+O 2 , and Cr(III), obtaining the η values: 7.4±1.4, 1.5±0.4, 1.1±0.31%, and 0%, respectively, thus quantifying the hazard posed. The EIS measurements have enabled utilizing the decrease in charge-transfer resistance (R ct ) for ferri/ferrocyanide redox probe at an Au@ctDNA electrode to assess the oxidative ctDNA damage by Cr(VI) species. In this case, circular dichroism indicates an extensive damage to the ctDNA hydrogen bonding. On the other hand, Cr(III) species have not induced any damage to ctDNA, although the EQCN measurements show an electrostatic binding to DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

NARCIS (Netherlands)

Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

1996-01-01

We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species.

Science.gov (United States)

Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V

2017-07-21

DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

Directory of Open Access Journals (Sweden)

George Anifandis

2018-05-01

Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

The nuclear higher-order structure defined by the set of topological relationships between DNA and the nuclear matrix is species-specific in hepatocytes.

Science.gov (United States)

Silva-Santiago, Evangelina; Pardo, Juan Pablo; Hernández-Muñoz, Rolando; Aranda-Anzaldo, Armando

2017-01-15

During the interphase the nuclear DNA of metazoan cells is organized in supercoiled loops anchored to constituents of a nuclear substructure or compartment known as the nuclear matrix. The stable interactions between DNA and the nuclear matrix (NM) correspond to a set of topological relationships that define a nuclear higher-order structure (NHOS). Current evidence suggests that the NHOS is cell-type-specific. Biophysical evidence and theoretical models suggest that thermodynamic and structural constraints drive the actualization of DNA-NM interactions. However, if the topological relationships between DNA and the NM were the subject of any biological constraint with functional significance then they must be adaptive and thus be positively selected by natural selection and they should be reasonably conserved, at least within closely related species. We carried out a coarse-grained, comparative evaluation of the DNA-NM topological relationships in primary hepatocytes from two closely related mammals: rat and mouse, by determining the relative position to the NM of a limited set of target sequences corresponding to highly-conserved genomic regions that also represent a sample of distinct chromosome territories within the interphase nucleus. Our results indicate that the pattern of topological relationships between DNA and the NM is not conserved between the hepatocytes of the two closely related species, suggesting that the NHOS, like the karyotype, is species-specific. Copyright © 2016 Elsevier B.V. All rights reserved.

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

International Nuclear Information System (INIS)

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

1990-01-01

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

International Nuclear Information System (INIS)

Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

2006-01-01

Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

Ionization and fragmentation of DNA-RNA bases: a density functional theory study

International Nuclear Information System (INIS)

Sadr-Arani, Leila

2014-01-01

Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

Science.gov (United States)

Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

2017-11-01

Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

Diverse responses of species to landscape fragmentation in a simple food chain.

Science.gov (United States)

Liao, Jinbao; Bearup, Daniel; Blasius, Bernd

2017-09-01

Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

Site-specific fragmentation of polystyrene molecule using size-selected Ar gas cluster ion beam

International Nuclear Information System (INIS)

Moritani, Kousuke; Mukai, Gen; Hashinokuchi, Michihiro; Mochiji, Kozo

2009-01-01

The secondary ion mass spectrum (SIMS) of a polystyrene thin film was investigated using a size-selected Ar gas cluster ion beam (GCIB). The fragmentation in the SIM spectrum varied by kinetic energy per atom (E atom ); the E atom dependence of the secondary ion intensity of the fragment species of polystyrene can be essentially classified into three types based on the relationship between E atom and the dissociation energy of a specific bonding site in the molecule. These results indicate that adjusting E atom of size-selected GCIB may realize site-specific bond breaking within a molecule. (author)

IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2013-03-01

Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

DNA probes for distinguishing Psychodopygus wellcomei from Psychodopygus complexus (Diptera: Psychodidae

Directory of Open Access Journals (Sweden)

P. D. Ready

1991-03-01

Full Text Available Genomic DNA fragments from males of Psychodopygus wellcomei were isolated and shown to be useful as sensitive diagnostic probles for positively separting individuals of this species from those of Ps. complexus. These two members of the Ps. squamiventris series are found sympatrically in foci of cutaneous leishmaniasis in the hill forests of southern Pará State. Of the two species, only Ps. welcomei is thought to be an important vector of Leishmania braziliensis sensu stricto, buth this is based on circumstantial evidence because of the difficulties of identifying female sandflies wothin the series. The diagnostic probes were isolated from a library of Ps. wellcomei built by ligationg short fragments of Sau 3A-resistricted, genomic DNA into the plasmid vector PUC 18. Differential screening of 1316 library clones with total genomic DNA of Ps. Wellcomei and Ps. complexus identified 5 recombinants, with cross-hybridizing inserts of repetitive DNA, that showed strong specificity for Ps. wellcomei. As little as 0.4% of the DNA extracted from an individual sandfly (=ca. 0.5 namograms was specifically detected. The diagnostic probes were used to identify as Ps. wellcomei a wild-caught female sandfly found infected with L. braziliensis s.s., providing only the second positive association between these two species.

Persistence of environmental DNA in freshwater ecosystems.

Directory of Open Access Journals (Sweden)

Tony Dejean

Full Text Available The precise knowledge of species distribution is a key step in conservation biology. However, species detection can be extremely difficult in many environments, specific life stages and in populations at very low density. The aim of this study was to improve the knowledge on DNA persistence in water in order to confirm the presence of the focus species in freshwater ecosystems. Aquatic vertebrates (fish: Siberian sturgeon and amphibian: Bullfrog tadpoles were used as target species. In control conditions (tanks and in the field (ponds, the DNA detectability decreases with time after the removal of the species source of DNA. DNA was detectable for less than one month in both conditions. The density of individuals also influences the dynamics of DNA detectability in water samples. The dynamics of detectability reflects the persistence of DNA fragments in freshwater ecosystems. The short time persistence of detectable amounts of DNA opens perspectives in conservation biology, by allowing access to the presence or absence of species e.g. rare, secretive, potentially invasive, or at low density. This knowledge of DNA persistence will greatly influence planning of biodiversity inventories and biosecurity surveys.

Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

Science.gov (United States)

Ghosh, S; Majumder, P B; Sen Mandi, S

2011-02-08

The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs.

Effect of DNA sequence, ionic strength, and cationic DNA affinity binders on the methylation of DNA by N-methyl-N-nitrosourea

International Nuclear Information System (INIS)

Wurdeman, R.L.; Gold, B.

1988-01-01

DNA alkylation by N-alkyl-N-nitrosoureas is generally accepted to be responsible for their mutagenic, carcinogenic, and antineoplastic activities. The exact nature of the ultimate alkylating intermediate is still controversial, with a variety of species having been nominated. The sequence specificity for DNA alkylation by simple N-alkyl-N-nitrosoureas has not been reported, although such information is basic in understanding the specific point mutations induced by these compounds in oncogene targets. These two points are addressed by using N-methyl-N-nitrosourea methylation of a 576 base-pair 32 P-end-labeled DNA restriction fragment and high-resolution polyacrylamide sequencing gels. This method provides information on the formation of N 7 -methylguanine, by the generation of single-strand breaks upon exposure to piperidine

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

Science.gov (United States)

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Immigration rates in fragmented landscapes--empirical evidence for the importance of habitat amount for species persistence.

Directory of Open Access Journals (Sweden)

Thomas Püttker

Full Text Available BACKGROUND: The total amount of native vegetation is an important property of fragmented landscapes and is known to exert a strong influence on population and metapopulation dynamics. As the relationship between habitat loss and local patch and gap characteristics is strongly non-linear, theoretical models predict that immigration rates should decrease dramatically at low levels of remaining native vegetation cover, leading to patch-area effects and the existence of species extinction thresholds across fragmented landscapes with different proportions of remaining native vegetation. Although empirical patterns of species distribution and richness give support to these models, direct measurements of immigration rates across fragmented landscapes are still lacking. METHODOLOGY/PRINCIPAL FINDINGS: Using the Brazilian Atlantic forest marsupial Gray Slender Mouse Opossum (Marmosops incanus as a model species and estimating demographic parameters of populations in patches situated in three landscapes differing in the total amount of remaining forest, we tested the hypotheses that patch-area effects on population density are apparent only at intermediate levels of forest cover, and that immigration rates into forest patches are defined primarily by landscape context surrounding patches. As expected, we observed a positive patch-area effect on M. incanus density only within the landscape with intermediate forest cover. Density was independent of patch size in the most forested landscape and the species was absent from the most deforested landscape. Specifically, the mean estimated numbers of immigrants into small patches were lower in the landscape with intermediate forest cover compared to the most forested landscape. CONCLUSIONS/SIGNIFICANCE: Our results reveal the crucial importance of the total amount of remaining native vegetation for species persistence in fragmented landscapes, and specifically as to the role of variable immigration rates in

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

Science.gov (United States)

Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

2017-01-01

Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

Directory of Open Access Journals (Sweden)

Olga Makarova

Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).

Science.gov (United States)

Zhao, Ya-E; Wu, Li-Ping

2012-06-01

For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor

Science.gov (United States)

Zhao, Wei; Jardine, Paul J.

2015-01-01

ABSTRACT During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. IMPORTANCE During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful

An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor.

Science.gov (United States)

Zhao, Wei; Jardine, Paul J; Grimes, Shelley

2015-12-01

During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful molecular motor

The use of genus-specific amplicon pyrosequencing to assess phytophthora species diversity using eDNA from soil and water in Northern Spain.

Science.gov (United States)

Català, Santiago; Pérez-Sierra, Ana; Abad-Campos, Paloma

2015-01-01

Phytophthora is one of the most important and aggressive plant pathogenic genera in agriculture and forestry. Early detection and identification of its pathways of infection and spread are of high importance to minimize the threat they pose to natural ecosystems. eDNA was extracted from soil and water from forests and plantations in the north of Spain. Phytophthora-specific primers were adapted for use in high-throughput Sequencing (HTS). Primers were tested in a control reaction containing eight Phytophthora species and applied to water and soil eDNA samples from northern Spain. Different score coverage threshold values were tested for optimal Phytophthora species separation in a custom-curated database and in the control reaction. Clustering at 99% was the optimal criteria to separate most of the Phytophthora species. Multiple Molecular Operational Taxonomic Units (MOTUs) corresponding to 36 distinct Phytophthora species were amplified in the environmental samples. Pyrosequencing of amplicons from soil samples revealed low Phytophthora diversity (13 species) in comparison with the 35 species detected in water samples. Thirteen of the MOTUs detected in rivers and streams showed no close match to sequences in international sequence databases, revealing that eDNA pyrosequencing is a useful strategy to assess Phytophthora species diversity in natural ecosystems.

Site-specifically modified oligodeoxyribonucleotides as templates for Escherichia coli DNA polymerase I

International Nuclear Information System (INIS)

O'Connor, D.; Stoehrer, G.

1985-01-01

Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and nick-mers, conditions of single-strand-directed DNA synthesis and nick-translation could be created. The results show that the polymerase can bypass both types of lesions. Bypass occurs on a single-stranded template but is facilitated on a nicked, double-stranded template. Only purines, with guanine more favored than adenine, are incorporated across both lesions. The results indicate that site-specifically modified oligonucleotides can be sensitive probes for the action of polymerases on damaged templates. They also suggest a function for polymerase I, in its nick-translation capacity, during DNA repair and mutagenesis

DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

International Nuclear Information System (INIS)

Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

1986-01-01

A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

International Nuclear Information System (INIS)

Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

2010-01-01

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

Energy Technology Data Exchange (ETDEWEB)

Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

2010-01-05

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

Assessing DNA Barcodes for Species Identification in North American Reptiles and Amphibians in Natural History Collections.

Science.gov (United States)

Chambers, E Anne; Hebert, Paul D N

2016-01-01

High rates of species discovery and loss have led to the urgent need for more rapid assessment of species diversity in the herpetofauna. DNA barcoding allows for the preliminary identification of species based on sequence divergence. Prior DNA barcoding work on reptiles and amphibians has revealed higher biodiversity counts than previously estimated due to cases of cryptic and undiscovered species. Past studies have provided DNA barcodes for just 14% of the North American herpetofauna, revealing the need for expanded coverage. This study extends the DNA barcode reference library for North American herpetofauna, assesses the utility of this approach in aiding species delimitation, and examines the correspondence between current species boundaries and sequence clusters designated by the BIN system. Sequences were obtained from 730 specimens, representing 274 species (43%) from the North American herpetofauna. Mean intraspecific divergences were 1% and 3%, while average congeneric sequence divergences were 16% and 14% in amphibians and reptiles, respectively. BIN assignments corresponded with current species boundaries in 79% of amphibians, 100% of turtles, and 60% of squamates. Deep divergences (>2%) were noted in 35% of squamate and 16% of amphibian species, and low divergences (reptiles and 23% of amphibians, patterns reflected in BIN assignments. Sequence recovery declined with specimen age, and variation in recovery success was noted among collections. Within collections, barcodes effectively flagged seven mislabeled tissues, and barcode fragments were recovered from five formalin-fixed specimens. This study demonstrates that DNA barcodes can effectively flag errors in museum collections, while BIN splits and merges reveal taxa belonging to deeply diverged or hybridizing lineages. This study is the first effort to compile a reference library of DNA barcodes for herpetofauna on a continental scale.

Cells with dysfunctional telomeres are susceptible to reactive oxygen species hydrogen peroxide via generation of multichromosomal fusions and chromosomal fragments bearing telomeres

Energy Technology Data Exchange (ETDEWEB)

Woo, Seon Rang [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Department of Biochemistry, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Park, Jeong-Eun; Juhn, Kyoung-Mi; Ju, Yeun-Jin; Jeong, Jaemin [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Kang, Chang-Mo; Yun, Hyun Jin [Division of Radiation Effect, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Yun, Mi Yong; Shin, Hyun-Jin; Joo, Hyun-Yoo; Park, Eun-Ran; Park, In-Chul; Hong, Sung Hee; Hwang, Sang-Gu [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Kim, Haekwon [Department of Biotechnology, Seoul Woman' s University, Seoul 139-774 (Korea, Republic of); Cho, Myung-Haing [Laboratory of Toxicology, College of Veterinary Medicine, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Sang Hoon [Department of Biology, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Park, Gil Hong [Department of Biochemistry, College of Medicine, Korea University, Seoul 136-705 (Korea, Republic of); Lee, Kee-Ho, E-mail: khlee@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of)

2012-01-06

Highlights: Black-Right-Pointing-Pointer Under conditions of telomere erosion, cells become extremely sensitive to H{sub 2}O{sub 2}. Black-Right-Pointing-Pointer Chromosomal regions adjacent to telomeres are cleaved by H{sub 2}O{sub 2} under such conditions. Black-Right-Pointing-Pointer H{sub 2}O{sub 2} thus causes multichromosomal fusions and generation of small chromosomal fragments. Black-Right-Pointing-Pointer N-acetylcysteine prevents H{sub 2}O{sub 2}-induced chromosomal aberrations. -- Abstract: During genotoxic stress, reactive oxygen species hydrogen peroxide (H{sub 2}O{sub 2}) is a prime mediator of the DNA damage response. Telomeres function both to assist in DNA damage repair and to inhibit chromosomal end-to-end fusion. Here, we show that telomere dysfunction renders cells susceptible to H{sub 2}O{sub 2}, via generation of multichromosomal fusion and chromosomal fragments. H{sub 2}O{sub 2} caused formation of multichromosomal end-to-end fusions involving more than three chromosomes, preferentially when telomeres were erosive. Interestingly, extensive chromosomal fragmentation (yielding small-sized fragments) occurred only in cells exhibiting such multichromosomal fusions. Telomeres were absent from fusion points, being rather present in the small fragments, indicating that H{sub 2}O{sub 2} cleaves chromosomal regions adjacent to telomeres. Restoration of telomere function or addition of the antioxidant N-acetylcysteine prevented development of chromosomal aberrations and rescued the observed hypersensitivity to H{sub 2}O{sub 2}. Thus, chromosomal regions adjacent to telomeres become sensitive to reactive oxygen species hydrogen peroxide when telomeres are dysfunctional, and are cleaved to produce multichromosomal fusions and small chromosomal fragments bearing the telomeres.

Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

DEFF Research Database (Denmark)

Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

1998-01-01

. The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

Science.gov (United States)

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

Identification of species based on DNA barcode using k-mer feature vector and Random forest classifier.

Science.gov (United States)

Meher, Prabina Kumar; Sahu, Tanmaya Kumar; Rao, A R

2016-11-05

DNA barcoding is a molecular diagnostic method that allows automated and accurate identification of species based on a short and standardized fragment of DNA. To this end, an attempt has been made in this study to develop a computational approach for identifying the species by comparing its barcode with the barcode sequence of known species present in the reference library. Each barcode sequence was first mapped onto a numeric feature vector based on k-mer frequencies and then Random forest methodology was employed on the transformed dataset for species identification. The proposed approach outperformed similarity-based, tree-based, diagnostic-based approaches and found comparable with existing supervised learning based approaches in terms of species identification success rate, while compared using real and simulated datasets. Based on the proposed approach, an online web interface SPIDBAR has also been developed and made freely available at http://cabgrid.res.in:8080/spidbar/ for species identification by the taxonomists. Copyright © 2016 Elsevier B.V. All rights reserved.

Environmental DNA (eDNA metabarcoding assays to detect invasive invertebrate species in the Great Lakes.

Directory of Open Access Journals (Sweden)

Katy E Klymus

Full Text Available Describing and monitoring biodiversity comprise integral parts of ecosystem management. Recent research coupling metabarcoding and environmental DNA (eDNA demonstrate that these methods can serve as important tools for surveying biodiversity, while significantly decreasing the time, expense and resources spent on traditional survey methods. The literature emphasizes the importance of genetic marker development, as the markers dictate the applicability, sensitivity and resolution ability of an eDNA assay. The present study developed two metabarcoding eDNA assays using the mtDNA 16S RNA gene with Illumina MiSeq platform to detect invertebrate fauna in the Laurentian Great Lakes and surrounding waterways, with a focus for use on invasive bivalve and gastropod species monitoring. We employed careful primer design and in vitro testing with mock communities to assess ability of the markers to amplify and sequence targeted species DNA, while retaining rank abundance information. In our mock communities, read abundances reflected the initial input abundance, with regressions having significant slopes (p<0.05 and high coefficients of determination (R2 for all comparisons. Tests on field environmental samples revealed similar ability of our markers to measure relative abundance. Due to the limited reference sequence data available for these invertebrate species, care must be taken when analyzing results and identifying sequence reads to species level. These markers extend eDNA metabarcoding research for molluscs and appear relevant to other invertebrate taxa, such as rotifers and bryozoans. Furthermore, the sphaeriid mussel assay is group-specific, exclusively amplifying bivalves in the Sphaeridae family and providing species-level identification. Our assays provide useful tools for managers and conservation scientists, facilitating early detection of invasive species as well as improving resolution of mollusc diversity.

Gene prediction in metagenomic fragments: A large scale machine learning approach

Directory of Open Access Journals (Sweden)

Morgenstern Burkhard

2008-04-01

Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

Detecting an elusive invasive species: a diagnostic PCR to detect Burmese python in Florida waters and an assessment of persistence of environmental DNA.

Science.gov (United States)

Piaggio, Antoinette J; Engeman, Richard M; Hopken, Matthew W; Humphrey, John S; Keacher, Kandy L; Bruce, William E; Avery, Michael L

2014-03-01

Recent studies have demonstrated that detection of environmental DNA (eDNA) from aquatic vertebrates in water bodies is possible. The Burmese python, Python bivittatus, is a semi-aquatic, invasive species in Florida where its elusive nature and cryptic coloration make its detection difficult. Our goal was to develop a diagnostic PCR to detect P. bivittatus from water-borne eDNA, which could assist managers in monitoring this invasive species. First, we used captive P. bivittatus to determine whether reptilian DNA could be isolated and amplified from water samples. We also evaluated the efficacy of two DNA isolation methods and two DNA extraction kits commonly used in eDNA preparation. A fragment of the mitochondrial cytochrome b gene from P. bivittatus was detected in all water samples isolated with the sodium acetate precipitate and the QIAamp DNA Micro Kit. Next, we designed P. bivittatus-specific primers and assessed the degradation rate of eDNA in water. Our primers did not amplify DNA from closely related species, and we found that P. bivittatus DNA was consistently detectable up to 96 h. Finally, we sampled water from six field sites in south Florida. Samples from five sites, where P. bivittatus has been observed, tested positive for eDNA. The final site was negative and had no prior documented evidence of P. bivittatus. This study shows P. bivittatus eDNA can be isolated from water samples; thus, this method is a new and promising technique for the management of invasive reptiles. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India.

Science.gov (United States)

Gaikwad, Swapnil; Warudkar, Ashwin; Shouche, Yogesh

2017-09-01

DNA barcoding has emerged as an additional tool for taxonomy and as an aid to taxonomic impediments. Due to their extensive morphological variation, spiders are taxonomically challenging. Therefore, all over the world, attempts are being made to DNA barcode species of spiders. Till now no attempts were made to DNA barcode Indian spiders despite their rich diversity. We have generated DNA barcodes for 60 species (n = 112) of spiders for the first time from India. Although only 17 species were correctly identified at the species level, DNA barcoding correctly discriminated 99% of the species studied here. We have also found high intraspecies nucleotide divergence in Plexippus paykulli suggesting cryptic diversity that needs to be studied in detail. Our study also showed non-specific amplification of the Cytochrome Oxidase I (COI) gene of endosymbiont bacteria Wolbachia. However, these cases are very rare and could be resolved by the use of modified or group specific primers.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

HDP2: a ribosomal DNA (NTS-ETS) sequence as a target for species-specific molecular diagnosis of intestinal taeniasis in humans.

Science.gov (United States)

Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa

2018-02-27

Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of

Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

Science.gov (United States)

Tomasello, Salvatore; Heubl, Günther

2017-07-01

The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

Science.gov (United States)

Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

2018-03-23

To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

Halal authenticity of gelatin using species-specific PCR.

Science.gov (United States)

Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

2015-10-01

Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents.

Science.gov (United States)

Murray, V

1999-01-01

This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

Science.gov (United States)

Fraser, L; Strzezek, J

2007-07-15

In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

Environmental DNA (eDNA From the Wake of the Whales: Droplet Digital PCR for Detection and Species Identification

Directory of Open Access Journals (Sweden)

C. Scott Baker

2018-04-01

Full Text Available Genetic sampling for identification of species, subspecies or stock of whales, dolphins and porpoises at sea remains challenging. Most samples have been collected with some form of a biopsy dart requiring a close approach of a vessel while the individual is at the surface. Here we have adopted droplet digital (ddPCR technology for detection and species identification of cetaceans using environmental (eDNA collected from seawater. We conducted a series of eDNA sampling experiments during 25 encounters with killer whales, Orcinus orca, in Puget Sound (the Salish Sea. The regular habits of killer whales in these inshore waters allowed us to locate pods and collect seawater, at an initial distance of 200 m and at 15-min intervals, for up to 2 h after the passage of the whales. To optimize detection, we designed a set of oligonucleotide primers and probes to target short fragments of the mitochondrial (mtDNA control region, with a focus on identification of known killer whale ecotypes. We confirmed the potential to detect eDNA in the wake of the whales for up to 2 h, despite movement of the water mass by several kilometers due to tidal currents. Re-amplification and sequencing of the eDNA barcode confirmed that the ddPCR detection included the “southern resident community” of killer whales, consistent with the calls from hydrophone recordings and visual observations.

Nuclear introns outperform mitochondrial DNA in inter-specific phylogenetic reconstruction: Lessons from horseshoe bats (Rhinolophidae: Chiroptera).

Science.gov (United States)

Dool, Serena E; Puechmaille, Sebastien J; Foley, Nicole M; Allegrini, Benjamin; Bastian, Anna; Mutumi, Gregory L; Maluleke, Tinyiko G; Odendaal, Lizelle J; Teeling, Emma C; Jacobs, David S

2016-04-01

Despite many studies illustrating the perils of utilising mitochondrial DNA in phylogenetic studies, it remains one of the most widely used genetic markers for this purpose. Over the last decade, nuclear introns have been proposed as alternative markers for phylogenetic reconstruction. However, the resolution capabilities of mtDNA and nuclear introns have rarely been quantified and compared. In the current study we generated a novel ∼5kb dataset comprising six nuclear introns and a mtDNA fragment. We assessed the relative resolution capabilities of the six intronic fragments with respect to each other, when used in various combinations together, and when compared to the traditionally used mtDNA. We focused on a major clade in the horseshoe bat family (Afro-Palaearctic clade; Rhinolophidae) as our case study. This old, widely distributed and speciose group contains a high level of conserved morphology. This morphological stasis renders the reconstruction of the phylogeny of this group with traditional morphological characters complex. We sampled multiple individuals per species to represent their geographic distributions as best as possible (122 individuals, 24 species, 68 localities). We reconstructed the species phylogeny using several complementary methods (partitioned Maximum Likelihood and Bayesian and Bayesian multispecies-coalescent) and made inferences based on consensus across these methods. We computed pairwise comparisons based on Robinson-Foulds tree distance metric between all Bayesian topologies generated (27,000) for every gene(s) and visualised the tree space using multidimensional scaling (MDS) plots. Using our supported species phylogeny we estimated the ancestral state of key traits of interest within this group, e.g. echolocation peak frequency which has been implicated in speciation. Our results revealed many potential cryptic species within this group, even in taxa where this was not suspected a priori and also found evidence for mtDNA

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

Science.gov (United States)

Holley, W. R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.

Science.gov (United States)

Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P

1986-02-01

Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations.

Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

Science.gov (United States)

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

Science.gov (United States)

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-09-24

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

Science.gov (United States)

Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

2010-01-01

Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

The dual challenges of generality and specificity when developing environmental DNA markers for species and subspecies of Oncorhynchus

Science.gov (United States)

Taylor M. Wilcox; Kellie J. Carim; Kevin S. McKelvey; Michael Young; Michael K. Schwartz

2015-01-01

Environmental DNA (eDNA) sampling is a powerful tool for detecting invasive and native aquatic species. Often, species of conservation interest co-occur with other, closely related taxa. Here, we developed qPCR (quantitative PCR) markers which distinguish westslope cutthroat trout (Oncorhynchus clarkii lewsi), Yellowstone cutthroat trout (O. clarkii bouvieri...

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

Science.gov (United States)

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping

Directory of Open Access Journals (Sweden)

Maruoka Shuichiro

2008-12-01

Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models

Identification of a third feline Demodex species through partial sequencing of the 16S rDNA and frequency of Demodex species in 74 cats using a PCR assay.

Science.gov (United States)

Ferreira, Diana; Sastre, Natalia; Ravera, Iván; Altet, Laura; Francino, Olga; Bardagí, Mar; Ferrer, Lluís

2015-08-01

Demodex cati and Demodex gatoi are considered the two Demodex species of cats. However, several reports have identified Demodex mites morphologically different from these two species. The differentiation of Demodex mites is usually based on morphology, but within the same species different morphologies can occur. DNA amplification/sequencing has been used effectively to identify and differentiate Demodex mites in humans, dogs and cats. The aim was to develop a PCR technique to identify feline Demodex mites and use this technique to investigate the frequency of Demodex in cats. Demodex cati, D. gatoi and Demodex mites classified morphologically as the third unnamed feline species were obtained. Hair samples were taken from 74 cats. DNA was extracted; a 330 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of D. cati and D. gatoi shared >98% identity with those published on GenBank. The sequence of the third unnamed species showed 98% identity with a recently published feline Demodex sequence and only 75.2 and 70.9% identity with D. gatoi and D. cati sequences, respectively. Demodex DNA was detected in 19 of 74 cats tested; 11 DNA sequences corresponded to Demodex canis, five to Demodex folliculorum, three to D. cati and two to Demodex brevis. Three Demodex species can be found in cats, because the third unnamed Demodex species is likely to be a distinct species. Apart from D. cati and D. gatoi, DNA from D. canis, D. folliculorum and D. brevis was found on feline skin. © 2015 ESVD and ACVD.

Population diversity of ammonium oxidizers investigated by specific PCR amplification

Science.gov (United States)

Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

1997-01-01

The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

Genotypic characterization of Rickettsiae by DNA probes generated from Rickettsia Prowazekii DNA

International Nuclear Information System (INIS)

Demkin, V.V.; Rydkina, E.B.; Likhoded, L.Ya.; Ignatovich, V.F.; Genig, V.A.; Balayeva, N.M.

1994-01-01

Southern blot analysis of HindIII-cleaved rickettsial DNA was used for genotypic characterization of the typhus group (TG) species (R. prowazekii, R. typhi, R. canada) and a few species were of the spotted fever group (SFG)rickettsiae (R. sibirica, R. conorii, R. akari). Four different DNA probes were employed. PBH11 and PBH13 probes were morphospecific HindIII fragment of R prowazekii DNA. MW218 probe contained the gene for 51 K antigen and MW264 probe contained the citrate synthase gene of R. prowazekii. All the probes hybridized with the tested TG and SFG rickettsial DNAs, forming from 1 to 5 bands, but they did not with R. tsutsudamushi or C. burnetii DNAs. All the probes demonstrated specific hybridization pattern with TG species and R. akari. PBH11. PBH13 and MW264 probes clearly distinguished R. sibirica and R. conorii from the other tested rickettsiae, but not from each other. However, these two species differed slightly with MW218 probe. Several strains of each species were analyzed in this way and except for strains of R. conorii identical intra-species pattern were obtained. These data lead us to consider the obtained hybridization patterns as criteria for genotypic identification. (author)

Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

International Nuclear Information System (INIS)

Yakura, Kimitaka; Tanifuji, Shigeyuki.

1983-01-01

EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

Ecological impacts of tropical forest fragmentation: how consistent are patterns in species richness and nestedness?

Science.gov (United States)

Hill, Jane K; Gray, Michael A; Khen, Chey Vun; Benedick, Suzan; Tawatao, Noel; Hamer, Keith C

2011-11-27

Large areas of tropical forest now exist as remnants scattered across agricultural landscapes, and so understanding the impacts of forest fragmentation is important for biodiversity conservation. We examined species richness and nestedness among tropical forest remnants in birds (meta-analysis of published studies) and insects (field data for fruit-feeding Lepidoptera (butterflies and moths) and ants). Species-area relationships were evident in all four taxa, and avian and insect assemblages in remnants typically were nested subsets of those in larger areas. Avian carnivores and nectarivores and predatory ants were more nested than other guilds, implying that the sequential loss of species was more predictable in these groups, and that fragmentation alters the trophic organization of communities. For butterflies, the ordering of fragments to achieve maximum nestedness was by fragment area, suggesting that differences among fragments were driven mainly by extinction. In contrast for moths, maximum nestedness was achieved by ordering species by wing length; species with longer wings (implying better dispersal) were more likely to occur at all sites, including low diversity sites, suggesting that differences among fragments were driven more strongly by colonization. Although all four taxa exhibited high levels of nestedness, patterns of species turnover were also idiosyncratic, and thus even species-poor sites contributed to landscape-scale biodiversity, particularly for insects.

Rapid Identification of Seven Waterborne Exophiala Species by RCA DNA Padlock Probes.

Science.gov (United States)

Najafzadeh, M J; Vicente, V A; Feng, Peiying; Naseri, A; Sun, Jiufeng; Rezaei-Matehkolaei, A; de Hoog, G S

2018-03-05

The black yeast genus Exophiala includes numerous potential opportunistic species that potentially cause systematic and disseminated infections in immunocompetent individuals. Species causing systemic disease have ability to grow at 37-40 °C, while others consistently lack thermotolerance and are involved in diseases of cold-blooded, waterborne vertebrates and occasionally invertebrates. We explain a fast and sensitive assay for recognition and identification of waterborne Exophiala species without sequencing. The ITS rDNA region of seven Exophiala species (E. equina, E. salmonis, E. opportunistica, E. pisciphila, E. aquamarina, E. angulospora and E. castellanii) along with the close relative Veronaea botryosa was sequenced and aligned for the design of specific padlock probes for the detection of characteristic single-nucleotide polymorphisms. The assay demonstrated to successfully amplify DNA of target fungi, allowing detection at the species level. Amplification products were visualized on 1% agarose gels to confirm specificity of probe-template binding. Amounts of reagents were reduced to prevent the generation of false positive results. The simplicity, tenderness, robustness and low expenses provide padlock probe assay (RCA) a definite place as a very practical method among isothermal approaches for DNA diagnostics.

Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

Science.gov (United States)

Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

1976-09-01

Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

Is Drosophila-microbe association species-specific or region specific? A study undertaken involving six Indian Drosophila species.

Science.gov (United States)

Singhal, Kopal; Khanna, Radhika; Mohanty, Sujata

2017-06-01

The present work aims to identify the microbial diversity associated with six Indian Drosophila species using next generation sequencing (NGS) technology and to discover the nature of their distribution across species and eco-geographic regions. Whole fly gDNA of six Drosophila species were used to generate sequences in an Illumina platform using NGS technology. De novo based assembled raw reads were blasted against the NR database of NCBI using BLASTn for identification of their bacterial loads. We have tried to include Drosophila species from different taxonomical groups and subgroups and from three different eco-climatic regions India; four species belong to Central India, while the rest two, D. melanogaster and D. ananassae, belong to West and South India to determine both their species-wise and region-wide distribution. We detected the presence of 33 bacterial genera across all six study species, predominated by the class Proteobacteria. Amongst all, D. melanogaster was found to be the most diverse by carrying around 85% of the bacterial diversity. Our findings infer both species-specific and environment-specific nature of the bacterial species inhabiting the Drosophila host. Though the present results are consistent with most of the earlier studies, they also remain incoherent with some. The present study outcome on the host-bacteria association and their species specific adaptation may provide some insight to understand the host-microbial interactions and the phenotypic implications of microbes on the host physiology. The knowledge gained may be importantly applied into the recent insect and pest population control strategy going to implement through gut microflora in India and abroad.

Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

Science.gov (United States)

Wehrmann, A; Eggeling, L; Sahm, H

1994-12-01

In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

DEFF Research Database (Denmark)

Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

2008-01-01

A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

Neurospora ribosomal DNA sequences are indistinguishable within cell types but distinguishable among heterothallic species

International Nuclear Information System (INIS)

Chambers, C.; Dutta, S.K.

1983-01-01

High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with 32 P-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid

Sequence-specific capture of protein-DNA complexes for mass spectrometric protein identification.

Directory of Open Access Journals (Sweden)

Cheng-Hsien Wu

Full Text Available The regulation of gene transcription is fundamental to the existence of complex multicellular organisms such as humans. Although it is widely recognized that much of gene regulation is controlled by gene-specific protein-DNA interactions, there presently exists little in the way of tools to identify proteins that interact with the genome at locations of interest. We have developed a novel strategy to address this problem, which we refer to as GENECAPP, for Global ExoNuclease-based Enrichment of Chromatin-Associated Proteins for Proteomics. In this approach, formaldehyde cross-linking is employed to covalently link DNA to its associated proteins; subsequent fragmentation of the DNA, followed by exonuclease digestion, produces a single-stranded region of the DNA that enables sequence-specific hybridization capture of the protein-DNA complex on a solid support. Mass spectrometric (MS analysis of the captured proteins is then used for their identification and/or quantification. We show here the development and optimization of GENECAPP for an in vitro model system, comprised of the murine insulin-like growth factor-binding protein 1 (IGFBP1 promoter region and FoxO1, a member of the forkhead rhabdomyosarcoma (FoxO subfamily of transcription factors, which binds specifically to the IGFBP1 promoter. This novel strategy provides a powerful tool for studies of protein-DNA and protein-protein interactions.

Understory Bird Communities in Amazonian Rainforest Fragments: Species Turnover through 25 Years Post-Isolation in Recovering Landscapes

Science.gov (United States)

Stouffer, Philip C.; Johnson, Erik I.; Bierregaard, Richard O.; Lovejoy, Thomas E.

2011-01-01

Inferences about species loss following habitat conversion are typically drawn from short-term surveys, which cannot reconstruct long-term temporal dynamics of extinction and colonization. A long-term view can be critical, however, to determine the stability of communities within fragments. Likewise, landscape dynamics must be considered, as second growth structure and overall forest cover contribute to processes in fragments. Here we examine bird communities in 11 Amazonian rainforest fragments of 1–100 ha, beginning before the fragments were isolated in the 1980s, and continuing through 2007. Using a method that accounts for imperfect detection, we estimated extinction and colonization based on standardized mist-net surveys within discreet time intervals (1–2 preisolation samples and 4–5 post-isolation samples). Between preisolation and 2007, all fragments lost species in an area-dependent fashion, with loss of as few as <10% of preisolation species from 100-ha fragments, but up to 70% in 1-ha fragments. Analysis of individual time intervals revealed that the 2007 result was not due to gradual species loss beginning at isolation; both extinction and colonization occurred in every time interval. In the last two samples, 2000 and 2007, extinction and colonization were approximately balanced. Further, 97 of 101 species netted before isolation were detected in at least one fragment in 2007. Although a small subset of species is extremely vulnerable to fragmentation, and predictably goes extinct in fragments, developing second growth in the matrix around fragments encourages recolonization in our landscapes. Species richness in these fragments now reflects local turnover, not long-term attrition of species. We expect that similar processes could be operating in other fragmented systems that show unexpectedly low extinction. PMID:21731616

Understory bird communities in Amazonian rainforest fragments: species turnover through 25 years post-isolation in recovering landscapes.

Directory of Open Access Journals (Sweden)

Philip C Stouffer

Full Text Available Inferences about species loss following habitat conversion are typically drawn from short-term surveys, which cannot reconstruct long-term temporal dynamics of extinction and colonization. A long-term view can be critical, however, to determine the stability of communities within fragments. Likewise, landscape dynamics must be considered, as second growth structure and overall forest cover contribute to processes in fragments. Here we examine bird communities in 11 Amazonian rainforest fragments of 1-100 ha, beginning before the fragments were isolated in the 1980s, and continuing through 2007. Using a method that accounts for imperfect detection, we estimated extinction and colonization based on standardized mist-net surveys within discreet time intervals (1-2 preisolation samples and 4-5 post-isolation samples. Between preisolation and 2007, all fragments lost species in an area-dependent fashion, with loss of as few as <10% of preisolation species from 100-ha fragments, but up to 70% in 1-ha fragments. Analysis of individual time intervals revealed that the 2007 result was not due to gradual species loss beginning at isolation; both extinction and colonization occurred in every time interval. In the last two samples, 2000 and 2007, extinction and colonization were approximately balanced. Further, 97 of 101 species netted before isolation were detected in at least one fragment in 2007. Although a small subset of species is extremely vulnerable to fragmentation, and predictably goes extinct in fragments, developing second growth in the matrix around fragments encourages recolonization in our landscapes. Species richness in these fragments now reflects local turnover, not long-term attrition of species. We expect that similar processes could be operating in other fragmented systems that show unexpectedly low extinction.

A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

Directory of Open Access Journals (Sweden)

Manesh Kumar Panner Selvam

2018-03-01

Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

Science.gov (United States)

Cibik, R; Lepage, E; Talliez, P

2000-06-01

For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

NARCIS (Netherlands)

ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning.

Science.gov (United States)

Fu, J J; Mei, Z Q; Tania, M; Yang, L Q; Cheng, J L; Khan, M A

2015-05-25

The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

Introduction of threatened species in a fragmented and deteriorated landscape

NARCIS (Netherlands)

Vergeer, P.

2005-01-01

In The Netherlands, heathlands and species-rich grassland are strongly reduced in both area and habitat quality mainly due to fragmentation, eutrophication and acidification. As a result, many plant and animal species have become (locally) extinct, or are threatened by extinction as they are forced

Using Environmental DNA to Improve Species Distribution Models for Freshwater Invaders

Directory of Open Access Journals (Sweden)

Teja P. Muha

2017-12-01

Full Text Available Species Distribution Models (SDMs have been reported as a useful tool for the risk assessment and modeling of the pathways of dispersal of freshwater invasive alien species (IAS. Environmental DNA (eDNA is a novel tool that can help detect IAS at their early stage of introduction and additionally improve the data available for a more efficient management. SDMs rely on presence and absence of the species in the study area to infer the predictors affecting species distributions. Presence is verified once a species is detected, but confirmation of absence can be problematic because this depends both on the detectability of the species and the sampling strategy. eDNA is a technique that presents higher detectability and accuracy in comparison to conventional sampling techniques, and can effectively differentiate between presence or absence of specific species or entire communities by using a barcoding or metabarcoding approach. However, a number of potential bias can be introduced during (i sampling, (ii amplification, (iii sequencing, or (iv through the usage of bioinformatics pipelines. Therefore, it is important to report and conduct the field and laboratory procedures in a consistent way, by (i introducing eDNA independent observations, (ii amplifying and sequencing control samples, (iii achieving quality sequence reads by appropriate clean-up steps, (iv controlling primer amplification preferences, (v introducing PCR-free sequence capturing, (vi estimating primer detection capabilities through controlled experiments and/or (vii post-hoc introduction of “site occupancy-detection models.” With eDNA methodology becoming increasingly routine, its use is strongly recommended to retrieve species distributional data for SDMs.

DNA Probes Show Genetic Variation in Cyanobacterial Symbionts of the Azolla Fern and a Closer Relationship to Free-Living Nostoc Strains than to Free-Living Anabaena Strains

Science.gov (United States)

Plazinski, Jacek; Zheng, Qi; Taylor, Rona; Croft, Lynn; Rolfe, Barry G.; Gunning, Brian E. S.

1990-01-01

Twenty-two isolates of Anabaena azollae derived from seven Azolla species from various geographic and ecological sources were characterized by DNA-DNA hybridization. Cloned DNA fragments derived from the genomic sequences of three different A. azollae isolates were used to detect restriction fragment length polymorphism among all symbiotic anabaenas. DNA clones were radiolabeled and hybridized against southern blot transfers of genomic DNAs of different isolates of A. azollae digested with restriction endonucleases. Eight DNA probes were selected to identify the Anabaena strains tested. Two were strain specific and hybridized only to A. azollae strains isolated from Azolla microphylla or Azolla caroliniana. One DNA probe was section specific (hybridized only to anabaenas isolated from Azolla ferns representing the section Euazolla), and five other probes gave finer discrimination among anabaenas representing various ecotypes of Azolla species. These cloned genomic DNA probes identified 11 different genotypes of A. azollae isolates. These included three endosymbiotic genotypes within Azolla filiculoides species and two genotypes within both A. caroliniana and Azolla pinnata endosymbionts. Although we were not able to discriminate among anabaenas extracted from different ecotypes of Azolla nilotica, Azolla mexicina, Azolla rubra and Azolla microphylla species, each of the endosymbionts was easily identified as a unique genotype. When total DNA isolated from free-living Anabaena sp. strain PCC7120 was screened, none of the genomic DNA probes gave detectable positive hybridization. Total DNA of Nostoc cycas PCC7422 hybridized with six of eight genomic DNA fragments. These data imply that the dominant symbiotic organism in association with Azolla spp. is more closely related to Nostoc spp. than to free-living Anabaena spp. Images PMID:16348182

Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

Directory of Open Access Journals (Sweden)

Muylaert An

2002-07-01

Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

Specificity of DNA import into isolated mitochondria from plants and mammals

Directory of Open Access Journals (Sweden)

Koulintchenko M. V.

2014-01-01

Full Text Available Aim. Investigation of different features of DNA import into plant and human mitochondria, for a better understanding of mitochondrial genetics and generation of biotechnological tools. Methods. DNA up-take experiments with isolated plant mitochondria, using as substrates various sequences associated or not with the specific terminal inverted repeats (TIRs present at each end of the plant mitochondrial linear plasmids. Results. It was established that the DNA import efficiency has a non-linear dependence on DNA size. It was shown that import into plant mitochondria of DNA molecules of «medium» sizes, i. e. between 4 and 7 kb, barely has any sequence specificity: neither TIRs from the 11.6 kb Brassica plasmid, nor TIRs from the Zea mays S-plasmids influenced DNA import into Solanum tuberosum mitochondria. Conclusions. The data obtained support the hypothesis about species-specific import mechanism operating under the mitochondrial linear plasmids transfer into plant mitochondria.

Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

International Nuclear Information System (INIS)

Peltomaa, Riikka; Vaghini, Silvia; Patiño, Belén; Benito-Peña, Elena; Moreno-Bondi, María C.

2016-01-01

Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

Energy Technology Data Exchange (ETDEWEB)

Peltomaa, Riikka; Vaghini, Silvia [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Patiño, Belén [Department of Microbiology III, Faculty of Biology, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Benito-Peña, Elena, E-mail: elenabp@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Moreno-Bondi, María C., E-mail: mcmbondi@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain)

2016-09-07

Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

21 CFR 866.5520 - Immunoglobulin G (Fab fragment specific) immunological test system.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fab fragment specific... Test Systems § 866.5520 Immunoglobulin G (Fab fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fab fragment specific) immunological test system is a device that consists...

21 CFR 866.5540 - Immunoglobulin G (Fd fragment specific) immunological test system.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fd fragment specific... Test Systems § 866.5540 Immunoglobulin G (Fd fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fd fragment specific) immunological test system is a device that consists of...

21 CFR 866.5530 - Immunoglobulin G (Fc fragment specific) immunological test system.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Immunoglobulin G (Fc fragment specific... Test Systems § 866.5530 Immunoglobulin G (Fc fragment specific) immunological test system. (a) Identification. An immunoglobulin G (Fc fragment specific) immunological test system is a device that consists of...

Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

Science.gov (United States)

Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

2013-10-01

Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899.

A novel SERRS sandwich-hybridization assay to detect specific DNA target.

Directory of Open Access Journals (Sweden)

Cécile Feuillie

Full Text Available In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR. In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics.

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

Directory of Open Access Journals (Sweden)

Beiyu Liu

2009-09-01

Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

Directory of Open Access Journals (Sweden)

Agustín García-Peiró

2014-01-01

Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Selecting a Conservation Surrogate Species for Small Fragmented Habitats Using Ecological Niche Modelling

Directory of Open Access Journals (Sweden)

K. Anne-Isola Nekaris

2015-01-01

Full Text Available Flagship species are traditionally large, charismatic animals used to rally conservation efforts. Accepted flagship definitions suggest they need only fulfil a strategic role, unlike umbrella species that are used to shelter cohabitant taxa. The criteria used to select both flagship and umbrella species may not stand up in the face of dramatic forest loss, where remaining fragments may only contain species that do not suit either set of criteria. The Cinderella species concept covers aesthetically pleasing and overlooked species that fulfil the criteria of flagships or umbrellas. Such species are also more likely to occur in fragmented habitats. We tested Cinderella criteria on mammals in the fragmented forests of the Sri Lankan Wet Zone. We selected taxa that fulfilled both strategic and ecological roles. We created a shortlist of ten species, and from a survey of local perceptions highlighted two finalists. We tested these for umbrella characteristics against the original shortlist, utilizing Maximum Entropy (MaxEnt modelling, and analysed distribution overlap using ArcGIS. The criteria highlighted Loris tardigradus tardigradus and Prionailurus viverrinus as finalists, with the former having highest flagship potential. We suggest Cinderella species can be effective conservation surrogates especially in habitats where traditional flagship species have been extirpated.

DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

Directory of Open Access Journals (Sweden)

José Gregorio Martínez

Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

Science.gov (United States)

Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

2016-08-05

This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

Science.gov (United States)

Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

1991-01-01

Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

Biofilm extracellular DNA enhances mixed species biofilms of Staphylococcus epidermidis and Candida albicans.

Science.gov (United States)

Pammi, Mohan; Liang, Rong; Hicks, John; Mistretta, Toni-Ann; Versalovic, James

2013-11-14

Polymicrobial infections are responsible for significant mortality and morbidity in adults and children. Staphylococcus epidermidis and Candida albicans are the most frequent combination of organisms isolated from polymicrobial infections. Vascular indwelling catheters are sites for mixed species biofilm formation and pose a significant risk for polymicrobial infections. We hypothesized that enhancement of biofilms in a mixed species environment increases patient mortality and morbidity. Mixed species biofilms of S. epidermidis and C. albicans were evaluated in vitro and in a subcutaneous catheter infection model in vivo. Mixed species biofilms were enhanced compared to single species biofilms of either S. epidermidis or C. albicans. A mixed species environment increased catheter infection and increased dissemination of S. epidermidis in mice. Microarrays were used to explore differential gene expression of S. epidermidis in the mixed species biofilms. In mixed species biofilms, compared to single species S. epidermidis biofilms, 2.7% of S. epidermidis genes were upregulated and 6% were down regulated. Staphylococcal autolysis repressors lrgA and lrgB were down regulated 36-fold and 27-fold respectively. The role of biofilm extracellular DNA was investigated by quantitation and by evaluating the effects of DNAse in a concentration and time dependent manner. S. epidermidis specific eDNA was increased in mixed species biofilms and further confirmed by degradation with DNAse. Mixed-species biofilms are enhanced and associated with increased S. epidermidis-specific eDNA in vitro and greater systemic dissemination of S. epidermidis in vivo. Down regulation of the lrg operon, a repressor of autolysis, associated with increased eDNA suggests a possible role for bacterial autolysis in mixed species biofilms. Enhancement and systemic dissemination of S. epidermidis may explain adverse outcomes after clinical polymicrobial infections of S. epidermidis and C. albicans.

Biofilm extracellular DNA enhances mixed species biofilms of Staphylococcus epidermidis and Candida albicans

Science.gov (United States)

2013-01-01

Background Polymicrobial infections are responsible for significant mortality and morbidity in adults and children. Staphylococcus epidermidis and Candida albicans are the most frequent combination of organisms isolated from polymicrobial infections. Vascular indwelling catheters are sites for mixed species biofilm formation and pose a significant risk for polymicrobial infections. We hypothesized that enhancement of biofilms in a mixed species environment increases patient mortality and morbidity. Results Mixed species biofilms of S. epidermidis and C. albicans were evaluated in vitro and in a subcutaneous catheter infection model in vivo. Mixed species biofilms were enhanced compared to single species biofilms of either S. epidermidis or C. albicans. A mixed species environment increased catheter infection and increased dissemination of S. epidermidis in mice. Microarrays were used to explore differential gene expression of S. epidermidis in the mixed species biofilms. In mixed species biofilms, compared to single species S. epidermidis biofilms, 2.7% of S. epidermidis genes were upregulated and 6% were down regulated. Staphylococcal autolysis repressors lrgA and lrgB were down regulated 36-fold and 27-fold respectively. The role of biofilm extracellular DNA was investigated by quantitation and by evaluating the effects of DNAse in a concentration and time dependent manner. S. epidermidis specific eDNA was increased in mixed species biofilms and further confirmed by degradation with DNAse. Conclusions Mixed-species biofilms are enhanced and associated with increased S. epidermidis-specific eDNA in vitro and greater systemic dissemination of S. epidermidis in vivo. Down regulation of the lrg operon, a repressor of autolysis, associated with increased eDNA suggests a possible role for bacterial autolysis in mixed species biofilms. Enhancement and systemic dissemination of S. epidermidis may explain adverse outcomes after clinical polymicrobial infections of S

Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

Science.gov (United States)

Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

2010-03-31

The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Patch size effects on plant species decline in an experimentally fragmented landscape.

Science.gov (United States)

Collins, Cathy D; Holt, Robert D; Foster, Bryan L

2009-09-01

Understanding local and global extinction is a fundamental objective of both basic and applied ecology. Island biogeography theory (IBT) and succession theory provide frameworks for understanding extinction in changing landscapes. We explore the relative contribution of fragment size vs. succession on species' declines by examining distributions of abundances for 18 plant species declining over time in an experimentally fragmented landscape in northeast Kansas, U.S.A. If patch size effects dominate, early-successional species should persist longer on large patches, but if successional processes dominate, the reverse should hold, because in our system woody plant colonization is accelerated on large patches. To compare the patterns in abundance among patch sizes, we characterize joint shifts in local abundance and occupancy with a new metric: rank occupancy-abundance profiles (ROAPs). As succession progressed, statistically significant patch size effects emerged for 11 of 18 species. More early-successional species persisted longer on large patches, despite the fact that woody encroachment (succession) progressed faster in these patches. Clonal perennial species persisted longer on large patches compared to small patches. All species that persisted longer on small patches were annuals that recruit from the seed bank each year. The degree to which species declined in occupancy vs. abundance varied dramatically among species: some species declined first in occupancy, others remained widespread or even expanded their distribution, even as they declined in local abundance. Consequently, species exhibited various types of rarity as succession progressed. Understanding the effect of fragmentation on extinction trajectories requires a species-by-species approach encompassing both occupancy and local abundance. We propose that ROAPs provide a useful tool for comparing the distribution of local abundances among landscape types, years, and species.

INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

Science.gov (United States)

Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

2016-01-01

DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

Science.gov (United States)

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

Dna c-values of 20 invasive alien species and 3 native species in south china

Directory of Open Access Journals (Sweden)

Gong Ni

2014-01-01

Full Text Available Cultivated fields and forests in South China are experiencing serious damage due to invasive alien plants. We investigated the relation between DNA C-values and invasiveness. The DNA C-values of 23 species ranged from 0.39 pg to 3.37 pg. Herbs, perennials and native species had higher mean DNA C-values than shrubs, annuals and invasive alien species. DNA C-values decreased with increasing invasiveness. Paederia scandens, a harmful native species, has the lowest DNA C-value among the perennials, indicating that native species with low nuclear content may also possess an invasive potential.

Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

Science.gov (United States)

Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

1994-11-01

Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.

Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

Directory of Open Access Journals (Sweden)

Vasco Elbrecht

Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

Assessment of Digoxin-Specific Fab Fragment Dosages in Digoxin Poisoning.

Science.gov (United States)

Nordt, Sean Patrick; Clark, Richard F; Machado, Carol; Cantrell, F Lee

2016-01-01

Digoxin poisoning still remains a common cause of morbidity and mortality. Fortunately, digoxin-specific Fab fragments are commercially available as an antidote. However, these Fab fragments are several thousand dollars per vial. There is a standardized formula to calculate appropriate Fab fragment dosage based on the serum digoxin concentration. This can greatly reduce the amount of Fab fragment administered. There is also an empiric dosing guideline recommending 6-10 vials be given; however, this may result in higher amounts of Fab fragments being administered than required. We performed this study to assess the amounts of digoxin-specific Fab fragments administered in the treatment of digoxin poisonings recorded in a poison control system database from January 1, 2000, to December 31, 2009, in which digoxin serum concentrations were available. This was a retrospective study of 278 patients, 107 with acute poisonings (group A) and 171 following chronic poisoning (group B). In group A, the calculated Fab dose was higher than the calculated dose based on available concentrations in 39 (36%) of group A and 15 (9%) of group B patients. The average wholesale price cost of the excessive dosages ranged from $4818 to as high as $50,589 per patient. Our data suggests that clinician education on digoxin poisoning and the use of the standardized formula to calculate the Fab dose may decrease over utilization and decrease costs associated with the administration of digoxin-specific Fab fragments in the treatment of digoxin poisonings.

PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

Science.gov (United States)

Ristaino, Jean B.; Madritch, Michael; Trout, Carol L.; Parra, Gregory

1998-01-01

We have developed a PCR procedure to amplify DNA for quick identification of the economically important species from each of the six taxonomic groups in the plant pathogen genus Phytophthora. This procedure involves amplification of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS) with the ITS primers ITS 5 and ITS 4. Restriction digests of the amplified DNA products were conducted with the restriction enzymes RsaI, MspI, and HaeIII. Restriction fragment patterns were similar after digestions with RsaI for the following species: P. capsici and P. citricola; P. infestans, P. cactorum, and P. mirabilis; P. fragariae, P. cinnamomi, and P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated P. capsici from P. citricola and separated P. cactorum from P. infestans and P. mirabilis. Restriction digests with HaeIII separated P. citrophthora from P. cryptogea, P. cinnamomi from P. fragariae and P. megasperma on peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were identical with all restriction enzymes tested. A unique DNA sequence from the ITS region I in P. capsici was used to develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici, P. citricola, and P. citrophthora and not 13 other species in the genus. Restriction digests with MspI separated P. capsici from the other two species. PCR was superior to traditional isolation methods for detection of P. capsici in infected bell pepper tissue in field samples. The techniques described will provide a powerful tool for identification of the major species in the genus Phytophthora. PMID:9501434

Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

Energy Technology Data Exchange (ETDEWEB)

Matsushita, Y., E-mail: kurita@cs.tut.ac.jp; Murakawa, T., E-mail: kurita@cs.tut.ac.jp; Shimamura, K., E-mail: kurita@cs.tut.ac.jp; Oishi, M., E-mail: kurita@cs.tut.ac.jp; Ohyama, T., E-mail: kurita@cs.tut.ac.jp; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Tempaku-cho, Toyohashi, Aichi, 441-8580 (Japan)

2015-02-27

The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

International Nuclear Information System (INIS)

Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

2015-01-01

The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

Science.gov (United States)

Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

2011-01-01

The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

International Nuclear Information System (INIS)

Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

2012-01-01

Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

Energy Technology Data Exchange (ETDEWEB)

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2012-04-20

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Development and validation of PCR-based assays for diagnosis of American cutaneous leishmaniasis and identificatio nof the parasite species

Directory of Open Access Journals (Sweden)

Grazielle Cardoso da Graça

2012-08-01

Full Text Available In this study, PCR assays targeting different Leishmania heat-shock protein 70 gene (hsp70 regions, producing fragments ranging in size from 230-390 bp were developed and evaluated to determine their potential as a tool for the specific molecular diagnosis of cutaneous leishmaniasis (CL. A total of 70 Leishmania strains were analysed, including seven reference strains (RS and 63 previously typed strains. Analysis of the RS indicated a specific region of 234 bp in the hsp70 gene as a valid target that was highly sensitive for detection of Leishmania species DNA with capacity of distinguishing all analyzed species, after polymerase chain reaction-restriction fragment length polymorfism (PCR-RFLP. This PCR assay was compared with other PCR targets used for the molecular diagnosis of leishmaniasis: hsp70 (1400-bp region, internal transcribed spacer (ITS1 and glucose-6-phosphate dehydrogenase (G6pd. A good agreement among the methods was observed concerning the Leishmania species identification. Moreover, to evaluate the potential for molecular diagnosis, we compared the PCR targets hsp70-234 bp, ITS1, G6pd and mkDNA using a panel of 99 DNA samples from tissue fragments collected from patients with confirmed CL. Both PCR-hsp70-234 bp and PCR-ITS1 detected Leishmania DNA in more than 70% of the samples. However, using hsp70-234 bp PCR-RFLP, identification of all of the Leishmania species associated with CL in Brazil can be achieved employing a simpler and cheaper electrophoresis protocol.

Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

International Nuclear Information System (INIS)

Wei Kang; Liu Xueying; Zhu Xuefen

1984-01-01

The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

Inner-shell excitation and site specific fragmentation of poly(methylmethacrylate) thin film

Science.gov (United States)

Tinone, Marcia C. K.; Tanaka, Kenichiro; Maruyama, Junya; Ueno, Nobuo; Imamura, Motoyasu; Matsubayashi, Nobuyuki

1994-04-01

Soft x-ray excitations in the 250-600 eV photon energy range on poly(methylmethacrylate) (PMMA) result in ionic fragmentation of the original polymer with the most intense ions corresponding to CH+3, H+, CH+2, CH+, CHO+, and COOCH+3. The photon energy dependence of ion desorption from thin films of PMMA was measured to investigate the primary steps in radiation induced decomposition following carbon and oxygen 1s electron excitations using monochromatic pulsed-synchrotron radiation. It was clearly found that the decomposition depends on the nature of the electronic states created in the excited species. The fragmentation pattern changes depending on the transitions of the 1s electron to a Rydberg orbital, an unoccupied molecular orbital or the ionization continuum. Moreover, the fragmentation occurs specifically around the site of the atom where the optical excitation takes place. Excitations from carbon and oxygen 1s to σ* states seem to be specially efficient for ion production as observed in the case of CH+3, CH+2, and CH+ at 288.7 and 535.6 eV, and in the case of CHO+ at 539.3 eV.

Dna c-values of 20 invasive alien species and 3 native species in south china

OpenAIRE

Gong Ni; Wang Yu-Tao; Björn Lars Olof; Li Shao-Shan

2014-01-01

Cultivated fields and forests in South China are experiencing serious damage due to invasive alien plants. We investigated the relation between DNA C-values and invasiveness. The DNA C-values of 23 species ranged from 0.39 pg to 3.37 pg. Herbs, perennials and native species had higher mean DNA C-values than shrubs, annuals and invasive alien species. DNA C-values decreased with increasing invasiveness. Paederia scandens, a harmful native species, has the lo...

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

Structure and DNA-binding of meiosis-specific protein Hop2

Science.gov (United States)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

Gamma-irradiation produces active chlorine species (ACS) in physiological solutions: Secoisolariciresinol diglucoside (SDG) scavenges ACS - A novel mechanism of DNA radioprotection.

Science.gov (United States)

Mishra, Om P; Popov, Anatoliy V; Pietrofesa, Ralph A; Christofidou-Solomidou, Melpo

2016-09-01

Secoisolariciresinol diglucoside (SDG), the main lignan in whole grain flaxseed, is a potent antioxidant and free radical scavenger with known radioprotective properties. However, the exact mechanism of SDG radioprotection is not well understood. The current study identified a novel mechanism of DNA radioprotection by SDG in physiological solutions by scavenging active chlorine species (ACS) and reducing chlorinated nucleobases. The ACS scavenging activity of SDG was determined using two highly specific fluoroprobes: hypochlorite-specific 3'-(p-aminophenyl) fluorescein (APF) and hydroxyl radical-sensitive 3'-(p-hydroxyphenyl) fluorescein (HPF). Dopamine, an SDG structural analog, was used for proton (1)H NMR studies to trap primary ACS radicals. Taurine N-chlorination was determined to demonstrate radiation-induced generation of hypochlorite, a secondary ACS. DNA protection was assessed by determining the extent of DNA fragmentation and plasmid DNA relaxation following exposure to ClO(-) and radiation. Purine base chlorination by ClO(-) and γ-radiation was determined by using 2-aminopurine (2-AP), a fluorescent analog of 6-aminopurine. Chloride anions (Cl(-)) consumed >90% of hydroxyl radicals in physiological solutions produced by γ-radiation resulting in ACS formation, which was detected by (1)H NMR. Importantly, SDG scavenged hypochlorite- and γ-radiation-induced ACS. In addition, SDG blunted ACS-induced fragmentation of calf thymus DNA and plasmid DNA relaxation. SDG treatment before or after ACS exposure decreased the ClO(-) or γ-radiation-induced chlorination of 2-AP. Exposure to γ-radiation resulted in increased taurine chlorination, indicative of ClO(-) generation. NMR studies revealed formation of primary ACS radicals (chlorine atoms (Cl) and dichloro radical anions (Cl2¯)), which were trapped by SDG and its structural analog dopamine. We demonstrate that γ-radiation induces the generation of ACS in physiological solutions. SDG treatment scavenged

Structural organization of the human glucocorticoid receptor determined by one- and two-dimensional gel electrophoresis of proteolytic receptor fragments

International Nuclear Information System (INIS)

Smith, A.C.; Harmon, J.M.

1987-01-01

The structural organization of the steroid-binding protein of the IM-9 cell glucocorticoid receptor was investigated by using one- and two-dimensional gel electrophoresis of proteolytic receptor fragments. One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of receptor fragments isolated after trypsin digestion of immunopurified [ 3 H]dexamethasone 21-mesylate ([ 3 H]DM-) labeled receptor revealed the presence of a stable 26.5-kilodalton (kDa) steroid-containing non-DNA-binding fragment, derived from a larger, less stable, 29-kDa fragment. The 26.5-kDa tryptic fragment appeared to be completely contained within a 41-kDa, steroid-containing, DNA-binding species isolated after chymotrypsin digestion of the intact protein. Two-dimensional electrophoretic analysis of the [ 3 H]DM-labeled tryptic fragments resolved two 26.5-kDa and two 29-kDa components. This was the same number of isoforms seen in the intact protein, indicating that the charge heterogeneity of the steroid-binding protein is the result of modification within the steroid-containing, non-DNA-binding, 26.5-kDa tryptic fragment. Two-dimensional analysis of the 41-kDa [ 3 H]DM-labeled chymotryptic species revealed a pattern of isoforms more complex than that seen either in the intact protein or in the steroid-containing tryptic fragments. These results suggest that the 41-kDa [ 3 H]DM-labeled species resolved by one-dimensional SDS-PAGE after chymotrypsin digestion may be composed of several distinct proteolytic fragments

Development of a Species-specific PCR Assay for Three Xanthomonas Species, Causing Bulb and Flower Diseases, Based on Their Genome Sequences

Directory of Open Access Journals (Sweden)

Chang-Gi Back

2015-09-01

Full Text Available In this study, we developed a species-specific PCR assay for rapid and accurate detection of three Xanthomonas species, X. axonopodis pv. poinsettiicola (XAP, X. hyacinthi (XH and X. campestris pv. zantedeschiae (XCZ, based on their draft genome sequences. XAP, XH and XCZ genomes consist of single chromosomes that contain 5,221, 4,395 and 7,986 protein coding genes, respectively. Species-specific primers were designed from variable regions of the draft genome sequence data and assessed by a PCR-based detection method. These primers were also tested for specificity against 17 allied Xanthomonas species as well as against the host DNA and the microbial community of the host surface. Three primer sets were found to be very specific and no amplification product was obtained with the host DNA and the microbial community of the host surface. In addition, a detection limit of 1 pg/μl per PCR reaction was detected when these primer sets were used to amplify corresponding bacterial DNAs. Therefore, these primer sets and the developed species-specific PCR assay represent a valuable, sensitive, and rapid diagnostic tool that can be used to detect three specific pathogens at early stages of infection and may help control diseases.

Association of pteridophyte species in two fragments of Atlantic Coastal Forest in the Brazilian Northeast

Directory of Open Access Journals (Sweden)

Iva Carneiro Leão Barros

2006-09-01

Full Text Available This study aims to investigate fern flora similarity and fern species relationships in the study areas, in terms of their substrates, habitat types, and life forms. The study was conducted in the Água Azul forest fragment, municipality of Timbaúba, Pernambuco, and the Maria Maior forest fragment, municipality of São José da Laje, Alagoas. The Jaccard similarity index was used for cluster analysis. The 112 species that occur in the two areas were used for numerical analysis. The floristic similarity was great (J=43.75%, principally due to similarities in the two areas vegetational types, as was expected due to their geographic proximity to one another and their similar climatic conditions. Five groups of associated species were determined for the Água Azul fragment and six groups for the Maria Maior fragment. In general, the ecological factors that determined fern species associations were habitat and type of substrate.

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

Science.gov (United States)

Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

2003-02-01

ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

Classic metapopulations are rare among common beetle species from a naturally fragmented landscape.

Science.gov (United States)

Driscoll, Don A; Kirkpatrick, Jamie B; McQuillan, Peter B; Bonham, Kevin J

2010-01-01

1. The general importance of metacommunity and metapopulation theories is poorly understood because few studies have examined responses of the suite of species that occupy the same fragmented landscape. In this study, we examined the importance of spatial ecological theories using a large-scale, naturally fragmented landscape. 2. We measured the occurrence and abundance of 44 common beetle species in 31 natural rainforest fragments in Tasmania, Australia. We tested for an effect on beetle distribution of geographic variables (patch area, patch isolation and amount of surrounding habitat) and of environmental variables based on plant species, after first accounting for spatial autocorrelation using principal coordinates of neighbour matrices. The environmental variables described a productivity gradient and a post-fire succession from eucalypt-dominated forest to late-successional rainforest. 3. Few species had distributions consistent with a metapopulation. However, the amount of surrounding habitat and patch isolation influenced the occurrence or abundance of 30% of beetle species, implying that dispersal into or out of patches was an important process. 4. Three species showed a distribution that could arise by interactions with dominant competitors or predators with higher occurrence in small patches. 5. Environmental effects were more commonly observed than spatial effects. Twenty-three per cent of species showed evidence of habitat-driven, deterministic metapopulations. Furthermore, almost half of the species were influenced by the plant succession or productivity gradient, including effects at the within-patch, patch and regional scales. The beetle succession involved an increase in the frequency of many species, and the addition of new species, with little evidence of species turnover. Niche-related ecological theory such as the species-sorting metacommunity theory was therefore the most broadly applicable concept. 6. We conclude that classic and source

DNA barcode-based molecular identification system for fish species.

Science.gov (United States)

Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

2010-12-01

In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

Mitogenomic analyses from ancient DNA

DEFF Research Database (Denmark)

Paijmans, Johanna L. A.; Gilbert, Tom; Hofreiter, Michael

2013-01-01

The analysis of ancient DNA is playing an increasingly important role in conservation genetic, phylogenetic and population genetic analyses, as it allows incorporating extinct species into DNA sequence trees and adds time depth to population genetics studies. For many years, these types of DNA...... analyses (whether using modern or ancient DNA) were largely restricted to the analysis of short fragments of the mitochondrial genome. However, due to many technological advances during the past decade, a growing number of studies have explored the power of complete mitochondrial genome sequences...... yielded major progress with regard to both the phylogenetic positions of extinct species, as well as resolving population genetics questions in both extinct and extant species....

Simultaneous discrimination of species and strains in Lactobacillus rhamnosus using species-specific PCR combined with multiplex mini-sequencing technology.

Science.gov (United States)

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina; Chu, Wen-Shen

2015-12-01

This study described the use of species-specific PCR in combination with SNaPshot mini-sequencing to achieve species identification and strain differentiation in Lactobacillus rhamnosus. To develop species-specific PCR and strain subtyping primers, the dnaJ gene was used as a target, and its corresponding sequences were analyzed both in Lb. rhamnosus and in a subset of its phylogenetically closest species. The results indicated that the species-specific primer pair was indeed specific for Lb. rhamnosus, and the mini-sequencing assay was able to unambiguously distinguish Lb. rhamnosus strains into different haplotypes. In conclusion, we have successfully developed a rapid, accurate and cost-effective assay for inter- and intraspecies discrimination of Lb. rhamnosus, which can be applied to achieve efficient quality control of probiotic products. Copyright © 2015 Elsevier Ltd. All rights reserved.

Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

Science.gov (United States)

Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

2016-01-01

The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

International Nuclear Information System (INIS)

Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

1989-01-01

Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

Science.gov (United States)

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Discrimination of Shark species by simple PCR of 5S rDNA repeats

OpenAIRE

Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

2008-01-01

Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Comparison of four species-delimitation methods applied to a DNA barcode data set of insect larvae for use in routine bioassessment for use in routine bioassessment

Science.gov (United States)

Species delimitation (grouping individuals into distinct taxonomic groups) is an essential part of evolutionary, conservation, and molecular ecology. Deoxyribonucleic acid (DNA) barcodes, short fragments of the cytochrome c oxidase subunit I (COI) gene, are being used in environm...

Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.

Science.gov (United States)

Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing

2015-06-15

Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Description of an as yet unclassified DNA virus from diseased Cyprinus carpio species.

Science.gov (United States)

Hutoran, Marina; Ronen, Ariel; Perelberg, Ayana; Ilouze, Maya; Dishon, Arnon; Bejerano, Izhak; Chen, Nissim; Kotler, Moshe

2005-02-01

Numerous deaths of koi and common carp (Cyprinus carpio) were observed on many farms throughout Israel, resulting in severe financial losses. The lethal viral disease observed is highly contagious and extremely virulent, but morbidity and mortality are restricted to koi and common carp populations. Diseased fish exhibit fatigue and gasping movements in shallow water. Infected fish had interstitial nephritis and gill necrosis as well as petechial hemorrhages in the liver and other symptoms that were not consistent with viral disease, suggesting a secondary infection. Here we report the isolation of carp nephritis and gill necrosis virus (CNGV), which is the etiologic agent of this disease. The virus propagates and induces severe cytopathic effects by 5 days postinfection in fresh koi or carp fin cell cultures (KFC and CFC, respectively), but not in epithelioma papillosum cyprini cells. The virus harvested from KFC cultures induced the same clinical signs, with a mortality of 75 to 95%, upon inoculation into naive koi and common carp. Using PCR, we provide final proof that the isolated virus is indeed the etiologic agent of food and ornamental carp mortalities in fish husbandry. Electron microscopy revealed viral cores with icosahedral morphology of 100 to 110 nm that resembled herpesviruses. Electron micrographs of purified pelleted CNGV sections, together with viral sensitivities to ether and Triton X-100, suggested that it is an enveloped virus. However, the genome of the isolated virus is a double-stranded DNA (dsDNA) molecule of 270 to 290 kbp, which is larger than known herpesviruses. The viral DNA seems highly divergent and bears only small fragments (16 to 45 bp) that are similar to the genomes of several DNA viruses. Nevertheless, amino acid sequences encoded by CNGV DNA fragments bear similarities primarily to members of the Poxviridae and Herpesviridae and to other large dsDNA viruses. We suggest, therefore, that the etiologic agent of this disease may

Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

Science.gov (United States)

Campbell, A J; Gasser, R B; Chilton, N B

1995-03-01

In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

NARCIS (Netherlands)

Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

1991-01-01

Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

Science.gov (United States)

Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

2010-11-01

Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

Host-specific effects of soil microbial filtrates prevail over those of arbuscular mycorrhizae in a fragmented landscape.

Science.gov (United States)

Pizano, Camila; Mangan, Scott A; Graham, James H; Kitajima, Kaoru

2017-09-01

Plant-soil interactions have been shown to determine plant community composition in a wide range of environments. However, how plants distinctly interact with beneficial and detrimental organisms across mosaic landscapes containing fragmented habitats is still poorly understood. We experimentally tested feedback responses between plants and soil microbial communities from adjacent habitats across a disturbance gradient within a human-modified tropical montane landscape. In a greenhouse experiment, two components of soil microbial communities were amplified; arbuscular mycorrhizal fungi (AMF) and a filtrate excluding AMF spores from the soils of pastures (high disturbance), coffee plantations (intermediate disturbance), and forest fragments (low disturbance), using potted seedlings of 11 plant species common in these habitats (pasture grass, coffee, and nine native species). We then examined their effects on growth of these same 11 host species with reciprocal habitat inoculation. Most plant species received a similar benefit from AMF, but differed in their response to the filtrates from the three habitats. Soil filtrate from pastures had a net negative effect on plant growth, while filtrates from coffee plantations and forests had a net positive effect on plant growth. Pasture grass, coffee, and five pioneer tree species performed better with the filtrate from "away" (where these species rarely occur) compared to "home" (where these species typically occur) habitat soils, while four shade-tolerant tree species grew similarly with filtrates from different habitats. These results suggest that pastures accumulate species-specific soil enemies, while coffee plantations and forests accumulate beneficial soil microbes that benefit pioneer native plants and coffee, respectively. Thus, compared to AMF, soil filtrates exerted stronger habitat and host-specific effects on plants, being more important mediators of plant-soil feedbacks across contrasting habitats. © 2017 by

Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

Science.gov (United States)

Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

2015-01-01

Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations

OXA-258 from Achromobacter ruhlandii: a Species Specific Marker

OpenAIRE

Papalia, Mariana Andrea; Almuzara, Marisa; Cejas, Daniela; Traglia, German Matias; Ramirez, Maria Soledad; Galanternik, Laura; Vay, Carlos Alberto; Gutkind, Gabriel Osvaldo; Radice, Marcela Alejandra

2015-01-01

A new blaOXA-258 gene is described as species specific taxonomic marker for Achromobacter ruhlandii isolates (all recovered from cystic fibrosis patients). Even if the OXA-258 differs from OXA-114 variants, isolates could be misidentified as A. xiloxosidans by the amplification of an inner fragment from the OXA coding gene. A robust Identification of A. ruhlandii can be achieved by sequencing this single OXA gene as well as a more laborious recently proposed MLST scheme Fil: Papalia, Maria...

EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

Directory of Open Access Journals (Sweden)

S. Yu. Borovets

2017-01-01

Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

Science.gov (United States)

Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

2012-01-01

Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

Integrating early detection with DNA barcoding: species identification of a non-native monitor lizard (Squamata: Varanidae) carcass in Mississippi, U.S.A.

Science.gov (United States)

Reed, Robert N.; Hopken, Matthew W.; Steen, David A.; Falk, Bryan G.; Piaggio, Antoinette J.

2016-01-01

Early detection of invasive species is critical to increasing the probability of successful management. At the primary stage of an invasion, invasive species are easier to control as the population is likely represented by just a few individuals. Detection of these first few individuals can be challenging, particularly if they are cryptic or otherwise characterized by low detectability. The engagement of members of the public may be critical to early detection as there are far more citizen s on the landscape than trained biologists. However, it can be difficult to assess the credibility of public reporting, especially when a diagnostic digital image or a physical specimen in good condition are lacking. DNA barcoding can be used for verification when morphological identification of a specimen is not possible or uncertain (i.e., degraded or partial specimen). DNA barcoding relies on obtaining a DNA sequence from a relatively small fragment of mitochondrial DNA and comparing it to a database of sequences containing a variety of expertly identified species. He rein we report the successful identification of a degraded specimen of a non-native, potentially invasive reptile species (Varanus niloticus) via DNA barcoding, after discovery and reporting by a member of the public.

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Identification of Meconopsis species by a DNA barcode sequence ...

African Journals Online (AJOL)

Deoxyribonucleic acid (DNA) barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Species identification is necessary for the authentication of traditional plant based medicines. Although a consensus has not been agreed regarding which DNA sequences can be used as ...

Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

Science.gov (United States)

Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

1992-01-01

Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Directory of Open Access Journals (Sweden)

Jorge A. Bertolotto

2016-06-01

Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Science.gov (United States)

Bertolotto, Jorge A.; Umazano, Juan P.

2016-06-01

In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

Science.gov (United States)

Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

2012-05-01

The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

Science.gov (United States)

de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

2015-03-01

Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

DNA fingerprinting of pearls to determine their origins.

Directory of Open Access Journals (Sweden)

Joana B Meyer

Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

Metagenome Fragment Classification Using -Mer Frequency Profiles

Directory of Open Access Journals (Sweden)

Gail Rosen

2008-01-01

Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

DNA damage by reactive species: Mechanisms, mutation and repair

Indian Academy of Sciences (India)

DNA is continuously attacked by reactive species that can affect its structure and function severely. Structural modifications to DNA mainly arise from modifications in its bases that primarily occur due to their exposure to different reactive species. Apart from this, DNA strand break, inter- and intra-strand crosslinks and ...

Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

Science.gov (United States)

Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

2017-12-01

In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea).

Science.gov (United States)

Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa

2012-05-01

This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.

Chromosome-specific DNA Repeat Probes

Energy Technology Data Exchange (ETDEWEB)

Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

2006-03-16

In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

Science.gov (United States)

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Testing DNA barcode performance in 1000 species of European lepidoptera: large geographic distances have small genetic impacts.

Science.gov (United States)

Huemer, Peter; Mutanen, Marko; Sefc, Kristina M; Hebert, Paul D N

2014-01-01

This study examines the performance of DNA barcodes (mt cytochrome c oxidase 1 gene) in the identification of 1004 species of Lepidoptera shared by two localities (Finland, Austria) that are 1600 km apart. Maximum intraspecific distances for the pooled data were less than 2% for 880 species (87.6%), while deeper divergence was detected in 124 species. Despite such variation, the overall DNA barcode library possessed diagnostic COI sequences for 98.8% of the taxa. Because a reference library based on Finnish specimens was highly effective in identifying specimens from Austria, we conclude that barcode libraries based on regional sampling can often be effective for a much larger area. Moreover, dispersal ability (poor, good) and distribution patterns (disjunct, fragmented, continuous, migratory) had little impact on levels of intraspecific geographic divergence. Furthermore, the present study revealed that, despite the intensity of past taxonomic work on European Lepidoptera, nearly 20% of the species shared by Austria and Finland require further work to clarify their status. Particularly discordant BIN (Barcode Index Number) cases should be checked to ascertain possible explanatory factors such as incorrect taxonomy, hybridization, introgression, and Wolbachia infections.

Testing DNA barcode performance in 1000 species of European lepidoptera: large geographic distances have small genetic impacts.

Directory of Open Access Journals (Sweden)

Peter Huemer

Full Text Available This study examines the performance of DNA barcodes (mt cytochrome c oxidase 1 gene in the identification of 1004 species of Lepidoptera shared by two localities (Finland, Austria that are 1600 km apart. Maximum intraspecific distances for the pooled data were less than 2% for 880 species (87.6%, while deeper divergence was detected in 124 species. Despite such variation, the overall DNA barcode library possessed diagnostic COI sequences for 98.8% of the taxa. Because a reference library based on Finnish specimens was highly effective in identifying specimens from Austria, we conclude that barcode libraries based on regional sampling can often be effective for a much larger area. Moreover, dispersal ability (poor, good and distribution patterns (disjunct, fragmented, continuous, migratory had little impact on levels of intraspecific geographic divergence. Furthermore, the present study revealed that, despite the intensity of past taxonomic work on European Lepidoptera, nearly 20% of the species shared by Austria and Finland require further work to clarify their status. Particularly discordant BIN (Barcode Index Number cases should be checked to ascertain possible explanatory factors such as incorrect taxonomy, hybridization, introgression, and Wolbachia infections.

Effect of superoxide dismutase supplementation on sperm DNA fragmentation

Directory of Open Access Journals (Sweden)

Luciano Negri

2017-10-01

Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

International Nuclear Information System (INIS)

Al-Gubory, Kais H.

2005-01-01

The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

Bulked segregant analysis of the pirarucu (Arapaima gigas) genome for identification of sex-specific molecular markers.

Science.gov (United States)

Almeida, I G; Ianella, P; Faria, M T; Paiva, S R; Caetano, A R

2013-12-04

Arapaima gigas (Osteoglossidae) is one of the largest fish species in the Amazon Basin, attaining lengths of over 2.5 m and weights of over 100 kg. Its flesh is prized, and it has great potential for production in aquaculture systems. However, live pirarucu cannot be reliably sexed visually, even after sexual development, since this species does not have clear external sexual dimorphism. Simple and inexpensive methods for sexing immature pirarucu based on DNA markers would facilitate production of this species in commercial operations. We analyzed A. gigas male and female DNA pools with 566 RAPD primers, generating 2609 fragments, with an estimated 1341 segregating polymorphic markers, and an estimated average spacing of 714 kb, which corresponds to less than 0.1% of the species' genome. Two putative sex-specific fragments were initially identified in bulked samples; but they were not confirmed in a study of individual male and female samples. We suggest that A. gigas has developed a non-chromosomal system of sex determination or, alternatively, that the species has undergone a recent loss of the chromosome carrying the sex-determining locus.

A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

Directory of Open Access Journals (Sweden)

Leclerc Xavier

2009-04-01

Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

DNA polymerase beta participates in mitochondrial DNA repair

DEFF Research Database (Denmark)

Sykora, P; Kanno, S; Akbari, M

2017-01-01

We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

DNA barcoding for species assignment: the case of Mediterranean marine fishes.

Directory of Open Access Journals (Sweden)

Monica Landi

Full Text Available DNA barcoding enhances the prospects for species-level identifications globally using a standardized and authenticated DNA-based approach. Reference libraries comprising validated DNA barcodes (COI constitute robust datasets for testing query sequences, providing considerable utility to identify marine fish and other organisms. Here we test the feasibility of using DNA barcoding to assign species to tissue samples from fish collected in the central Mediterranean Sea, a major contributor to the European marine ichthyofaunal diversity.A dataset of 1278 DNA barcodes, representing 218 marine fish species, was used to test the utility of DNA barcodes to assign species from query sequences. We tested query sequences against 1 a reference library of ranked DNA barcodes from the neighbouring North East Atlantic, and 2 the public databases BOLD and GenBank. In the first case, a reference library comprising DNA barcodes with reliability grades for 146 fish species was used as diagnostic dataset to screen 486 query DNA sequences from fish specimens collected in the central basin of the Mediterranean Sea. Of all query sequences suitable for comparisons 98% were unambiguously confirmed through complete match with reference DNA barcodes. In the second case, it was possible to assign species to 83% (BOLD-IDS and 72% (GenBank of the sequences from the Mediterranean. Relatively high intraspecific genetic distances were found in 7 species (2.2%-18.74%, most of them of high commercial relevance, suggesting possible cryptic species.We emphasize the discriminatory power of COI barcodes and their application to cases requiring species level resolution starting from query sequences. Results highlight the value of public reference libraries of reliability grade-annotated DNA barcodes, to identify species from different geographical origins. The ability to assign species with high precision from DNA samples of disparate quality and origin has major utility in several

125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

International Nuclear Information System (INIS)

Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

1987-01-01

The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

Characterization of Tumor-Avid Antibody Fragments Genetically Engineered for Mono-Specific Radionuclide Chelation

International Nuclear Information System (INIS)

Quinn, T.P.

2003-01-01

The successful clinical application of targeted-radiopharmaceuticals depends on the development of molecules that optimize tumor specific radionuclide deposition and minimize non-specific organ irradiation. To this end, this proposal outlines a research effort to identify and evaluate novel antibodies and antibody fragments that bind breast tumors. The tumor-avid antibodies will be investigated for as imaging and therapeutic agents and to gain a better understanding of the pharmacokinetics and metabolism of radiolabeled tumor-avid antibody fragments through the use of site-specifically labeled molecules. Antibodies or antibody fragments, that bind breast carcinoma carbohydrate antigens, will be obtained from hybridoma or bacteriophage library screening. More specifically, antibody fragments that bind the carcinoma-associated Thomsen-Friedenreich (T) antigen will be radiolabeled with 99m Tc and 188 Re at a natural amino acid chelation site and will be investigated in vivo for their abilities to target human breast tumors. In addition, site-specific radiolabeled antibody fragments will be biosynthesized using misacylated suppressor tRNAs. Homogeneously radiolabeled populations of antibody fragments will be used to investigate the effects of radionuclide location and chelation chemistries on their biodistribution and metabolism. It is hypothesized that site-specifically radiolabeled antibody fragments will possess enhanced tumor imaging and therapeutic properties due to optimal label location and conjugation chemistries. New insights into the factors that govern antibody metabolism in vivo are also expected from this work. Results from these studies should enhance our ability to design and synthesize radiolabeled antibody fragments that have improved pharmacokinetic properties. The studies in this proposal involve basic research into the development of antibody-based radiopharmaceuticals, with the ultimate goal of application in humans. This type of basic nuclear

DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

DEFF Research Database (Denmark)

Christensen, H.; Angen, Øystein; Mutters, R.

2000-01-01

The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

Science.gov (United States)

Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

2014-01-01

Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

International Nuclear Information System (INIS)

Holley, W.R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

Real-Time PCR Quantification of Chloroplast DNA Supports DNA Barcoding of Plant Species.

Science.gov (United States)

Kikkawa, Hitomi S; Tsuge, Kouichiro; Sugita, Ritsuko

2016-03-01

Species identification from extracted DNA is sometimes needed for botanical samples. DNA quantification is required for an accurate and effective examination. If a quantitative assay provides unreliable estimates, a higher quantity of DNA than the estimated amount may be used in additional analyses to avoid failure to analyze samples from which extracting DNA is difficult. Compared with conventional methods, real-time quantitative PCR (qPCR) requires a low amount of DNA and enables quantification of dilute DNA solutions accurately. The aim of this study was to develop a qPCR assay for quantification of chloroplast DNA from taxonomically diverse plant species. An absolute quantification method was developed using primers targeting the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene using SYBR Green I-based qPCR. The calibration curve was generated using the PCR amplicon as the template. DNA extracts from representatives of 13 plant families common in Japan. This demonstrates that qPCR analysis is an effective method for quantification of DNA from plant samples. The results of qPCR assist in the decision-making will determine the success or failure of DNA analysis, indicating the possibility of optimization of the procedure for downstream reactions.

DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

Science.gov (United States)

Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

2015-01-01

Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

Science.gov (United States)

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

The phylogenetic position of Lygodactylus angularis and the utility of using the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

Directory of Open Access Journals (Sweden)

Riccardo Castiglia

2011-06-01

Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.

Application of environmental DNA to detect an endangered marine skate species in the wild.

Science.gov (United States)

Weltz, Kay; Lyle, Jeremy M; Ovenden, Jennifer; Morgan, Jessica A T; Moreno, David A; Semmens, Jayson M

2017-01-01

Environmental DNA (eDNA) techniques have only recently been applied in the marine environment to detect the presence of marine species. Species-specific primers and probes were designed to detect the eDNA of the endangered Maugean skate (Zearaja maugeana) from as little as 1 L of water collected at depth (10-15 m) in Macquarie Harbour (MH), Tasmania. The identity of the eDNA was confirmed as Z. maugeana by sequencing the qPCR products and aligning these with the target sequence for a 100% match. This result has validated the use of this eDNA technique for detecting a rare species, Z. maugeana, in the wild. Being able to investigate the presence, and possibly the abundance, of Z. maugeana in MH and Bathurst harbour (BH), would be addressing a conservation imperative for the endangered Z. maugeana. For future application of this technique in the field, the rate of decay was determined for Z. maugeana eDNA under ambient dissolved oxygen (DO) levels (55% saturation) and lower DO (20% saturation) levels, revealing that the eDNA can be detected for 4 and 16 hours respectively, after which eDNA concentration drops below the detection threshold of the assay. With the rate of decay being influenced by starting eDNA concentrations, it is recommended that samples be filtered as soon as possible after collection to minimize further loss of eDNA prior to and during sample processing.

Application of environmental DNA to detect an endangered marine skate species in the wild.

Directory of Open Access Journals (Sweden)

Kay Weltz

Full Text Available Environmental DNA (eDNA techniques have only recently been applied in the marine environment to detect the presence of marine species. Species-specific primers and probes were designed to detect the eDNA of the endangered Maugean skate (Zearaja maugeana from as little as 1 L of water collected at depth (10-15 m in Macquarie Harbour (MH, Tasmania. The identity of the eDNA was confirmed as Z. maugeana by sequencing the qPCR products and aligning these with the target sequence for a 100% match. This result has validated the use of this eDNA technique for detecting a rare species, Z. maugeana, in the wild. Being able to investigate the presence, and possibly the abundance, of Z. maugeana in MH and Bathurst harbour (BH, would be addressing a conservation imperative for the endangered Z. maugeana. For future application of this technique in the field, the rate of decay was determined for Z. maugeana eDNA under ambient dissolved oxygen (DO levels (55% saturation and lower DO (20% saturation levels, revealing that the eDNA can be detected for 4 and 16 hours respectively, after which eDNA concentration drops below the detection threshold of the assay. With the rate of decay being influenced by starting eDNA concentrations, it is recommended that samples be filtered as soon as possible after collection to minimize further loss of eDNA prior to and during sample processing.

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Detection of Different DNA Animal Species in Commercial Candy Products.

Science.gov (United States)

Muñoz-Colmenero, Marta; Martínez, Jose Luis; Roca, Agustín; Garcia-Vazquez, Eva

2016-03-01

Candy products are consumed all across the world, but there is not much information about their composition. In this study we have used a DNA-based approach for determining the animal species occurring in 40 commercial candies of different types. We extracted DNA and performed PCR amplification, cloning and sequencing for obtaining species-informative DNA sequences. Eight species were identified including fish (hake and anchovy) in 22% of the products analyzed. Bovine and porcine were the most abundant appearing in 27 samples each one. Most products contained a mixture of species. Marshmallows (7), jelly-types, and gummies (20) contained a significantly higher number of species than hard candies (9). We demonstrated the presence of DNA animal species in candy product which allow consumers to make choices and prevent allergic reaction. © 2016 Institute of Food Technologists®

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

Science.gov (United States)

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

Tropical Forest Fragmentation Limits Movements, but Not Occurrence of a Generalist Pollinator Species.

Directory of Open Access Journals (Sweden)

Noelia L Volpe

Full Text Available Habitat loss and fragmentation influence species distributions and therefore ecological processes that depend upon them. Pollination may be particularly susceptible to fragmentation, as it depends on frequent pollinator movement. Unfortunately, most pollinators are too small to track efficiently which has precluded testing the hypothesis that habitat fragmentation reduces or eliminates pollen flow by disrupting pollinator movement. We used radio-telemetry to examine space use of the green hermit hummingbird (Phaethornis guy, an important 'hub' pollinator of understory flowering plants across substantial portions of the neotropics and the primary pollinator of a keystone plant which shows reduced pollination success in fragmented landscapes. We found that green hermits strongly avoided crossing large stretches of non-forested matrix and preferred to move along stream corridors. Forest gaps as small as 50 m diminished the odds of movement by 50%. Green hermits occurred almost exclusively inside the forest, with the odds of occurrence being 8 times higher at points with >95% canopy cover compared with points having <5% canopy cover. Nevertheless, surprisingly. the species occurred in fragmented landscapes with low amounts of forest (~30% within a 2 km radius. Our results indicate that although green hermits are present even in landscapes with low amounts of tropical forest, movement within these landscapes ends up strongly constrained by forest gaps. Restricted movement of pollinators may be an underappreciated mechanism for widespread declines in pollination and plant fitness in fragmented landscapes, even when in the presence of appropriate pollinators.

Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products

Directory of Open Access Journals (Sweden)

Botti Sara

2010-08-01

Full Text Available Abstract Background DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Results Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. Conclusions The described method is largely independent of the degree of degradation of DNA source and can thus be applied to

Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products.

Science.gov (United States)

Botti, Sara; Giuffra, Elisabetta

2010-08-23

DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce) and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. The described method is largely independent of the degree of degradation of DNA source and can thus be applied to processed seafood. Moreover, the method is highly flexible

Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

Science.gov (United States)

Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

2017-01-01

Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

Science.gov (United States)

Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

2009-07-01

Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

Forest species in an agricultural landscape in The Netherlands: effects of habitat fragmentation

NARCIS (Netherlands)

Grashof-Bokdam, C.

1997-01-01

For 312 forest patches on sandy soils in the Netherlands, effects of fragmentation are studied of forest habitat in the past on the present occurrence of forest plato species. Using regression techniques, the numbers of forest edge, interior, zoochorous and anemochorous species, as well as

The Use of Cytochrome b Gene as a Specific Marker of the Rat Meat (Rattus norvegicus on Meat and Meat Products

Directory of Open Access Journals (Sweden)

C. Sumantri

2012-04-01

Full Text Available Falsification of the origin of livestock meat and its processed with rat meat is a problem that must be overcome to ensure food safety. One way that is often used to detect forgeries by using cytochrome b gene as a marker. The purpose of this study was to create a specific primer derived from cytochrome b sequences in rat (Rattus norvegicus as the DNA marker to detect any contamination of rat meat on fresh livestock meat and its processed meat products. Meatballs were made from beef meat with the addition of rat 1%-25%, and the meatballs were obtained from traditional markets. DNA extraction was conducted from seven species (goat, chicken, cattle, sheep, pig, horse, and rat by using phenol-chloroform. The highest success rate in detecting the presence of rat meat in a mixture of beef meatballs at concentration of 15% was 100%. The specific fragment of cytochrome b gene in R. norvegicus has no similarity with the cytochrome b gene from six other species, so it can be used as molecular markers to detect the presence of rat meat contamination in the processed of meat products. Amplified fragment length for goats, chickens, cattle, sheep, pigs, horses, and rats 157, 227, 274, 331, 398, 439 and 603 bp respectively. The amplification of cytochrome b gene in seven species of animals with different fragment length indicated the specificity of cytochrome b gene sequences among species.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

Science.gov (United States)

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

Science.gov (United States)

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

Directory of Open Access Journals (Sweden)

Olufunmilola Ibironke

2012-01-01

Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

Does tropical forest fragmentation increase long-term variability of butterfly communities?

Directory of Open Access Journals (Sweden)

Allison K Leidner

2010-03-01

Full Text Available Habitat fragmentation is a major driver of biodiversity loss. Yet, the overall effects of fragmentation on biodiversity may be obscured by differences in responses among species. These opposing responses to fragmentation may be manifest in higher variability in species richness and abundance (termed hyperdynamism, and in predictable changes in community composition. We tested whether forest fragmentation causes long-term hyperdynamism in butterfly communities, a taxon that naturally displays large variations in species richness and community composition. Using a dataset from an experimentally fragmented landscape in the central Amazon that spanned 11 years, we evaluated the effect of fragmentation on changes in species richness and community composition through time. Overall, adjusted species richness (adjusted for survey duration did not differ between fragmented forest and intact forest. However, spatial and temporal variation of adjusted species richness was significantly higher in fragmented forests relative to intact forest. This variation was associated with changes in butterfly community composition, specifically lower proportions of understory shade species and higher proportions of edge species in fragmented forest. Analysis of rarefied species richness, estimated using indices of butterfly abundance, showed no differences between fragmented and intact forest plots in spatial or temporal variation. These results do not contradict the results from adjusted species richness, but rather suggest that higher variability in butterfly adjusted species richness may be explained by changes in butterfly abundance. Combined, these results indicate that butterfly communities in fragmented tropical forests are more variable than in intact forest, and that the natural variability of butterflies was not a buffer against the effects of fragmentation on community dynamics.

Does Tropical Forest Fragmentation Increase Long-Term Variability of Butterfly Communities?

Science.gov (United States)

Leidner, Allison K.; Haddad, Nick M.; Lovejoy, Thomas E.

2010-01-01

Habitat fragmentation is a major driver of biodiversity loss. Yet, the overall effects of fragmentation on biodiversity may be obscured by differences in responses among species. These opposing responses to fragmentation may be manifest in higher variability in species richness and abundance (termed hyperdynamism), and in predictable changes in community composition. We tested whether forest fragmentation causes long-term hyperdynamism in butterfly communities, a taxon that naturally displays large variations in species richness and community composition. Using a dataset from an experimentally fragmented landscape in the central Amazon that spanned 11 years, we evaluated the effect of fragmentation on changes in species richness and community composition through time. Overall, adjusted species richness (adjusted for survey duration) did not differ between fragmented forest and intact forest. However, spatial and temporal variation of adjusted species richness was significantly higher in fragmented forests relative to intact forest. This variation was associated with changes in butterfly community composition, specifically lower proportions of understory shade species and higher proportions of edge species in fragmented forest. Analysis of rarefied species richness, estimated using indices of butterfly abundance, showed no differences between fragmented and intact forest plots in spatial or temporal variation. These results do not contradict the results from adjusted species richness, but rather suggest that higher variability in butterfly adjusted species richness may be explained by changes in butterfly abundance. Combined, these results indicate that butterfly communities in fragmented tropical forests are more variable than in intact forest, and that the natural variability of butterflies was not a buffer against the effects of fragmentation on community dynamics. PMID:20224772

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

International Nuclear Information System (INIS)

Datta, K.; Dizdaroglu, M.; Jaruga, P.; Neumann, R.D.; Winters, T.A.

2003-01-01

Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125 I in a plasmid bound by a 125 I-labeled triplex forming oligonucleotide ( 125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125 I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence

The identification of genes specific to Prevotella intermedia and Prevotella nigrescens using genomic subtractive hybridization.

Science.gov (United States)

Masakiyo, Yoshiaki; Yoshida, Akihiro; Shintani, Yasuyuki; Takahashi, Yusuke; Ansai, Toshihiro; Takehara, Tadamichi

2010-06-01

Prevotella intermedia and Prevotella nigrescens, which are often isolated from periodontal sites, were once considered two different genotypes of P. intermedia. Although the genomic sequence of P. intermedia was determined recently, little is known about the genetic differences between P. intermedia and P. nigrescens. The subtractive hybridization technique is a powerful method for generating a set of DNA fragments differing between two closely related bacterial strains or species. We used subtractive hybridization to identify the DNA regions specific to P. intermedia ATCC 25611 and P. nigrescens ATCC 25261. Using this method, four P. intermedia ATCC 25611-specific and three P. nigrescens ATCC 25261-specific regions were determined. From the species-specific regions, insertion sequence (IS) elements were isolated for P. intermedia. IS elements play an important role in the pathogenicity of bacteria. For the P. intermedia-specific regions, the genes adenine-specific DNA-methyltransferase and 8-amino-7-oxononanoate synthase were isolated. The P. nigrescens-specific region contained a Flavobacterium psychrophilum SprA homologue, a cell-surface protein involved in gliding motility, Prevotella melaninogenica ATCC 25845 glutathione peroxide, and Porphyromonas gingivalis ATCC 33277 leucyl-tRNA synthetase. The results demonstrate that the subtractive hybridization technique was useful for distinguishing between the two closely related species. Furthermore, this technique will contribute to our understanding of the virulence of these species. 2009 Elsevier Ltd. All rights reserved.