WorldWideScience

Sample records for species-specific dna fragment

  1. Species-specific responses to landscape fragmentation: implications for management strategies.

    Science.gov (United States)

    Blanchet, Simon; Rey, Olivier; Etienne, Roselyne; Lek, Sovan; Loot, Géraldine

    2010-05-01

    Habitat fragmentation affects the integrity of many species, but little is known about species-specific sensitivity to fragmentation. Here, we compared the genetic structure of four freshwater fish species differing in their body size (Leuciscus cephalus; Leuciscus leuciscus; Gobio gobio and Phoxinus phoxinus) between a fragmented and a continuous landscape. We tested if, overall, fragmentation affected the genetic structure of these fish species, and if these species differed in their sensitivity to fragmentation. Fragmentation negatively affected the genetic structure of these species. Indeed, irrespective of the species identity, allelic richness and heterozygosity were lower, and population divergence was higher in the fragmented than in the continuous landscape. This response to fragmentation was highly species-specific, with the smallest fish species (P. phoxinus) being slightly affected by fragmentation. On the contrary, fish species of intermediate body size (L. leuciscus and G. gobio) were highly affected, whereas the largest fish species (L. cephalus) was intermediately affected by fragmentation. We discuss the relative role of dispersal ability and effective population size on the responses to fragmentation we report here. The weirs studied here are of considerable historical importance. We therefore conclude that restoration programmes will need to consider both this societal context and the biological characteristics of the species sharing this ecosystem.

  2. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  3. Subcloning of DNA fragments.

    Science.gov (United States)

    Struhl, K

    2001-05-01

    The essence of recombinant DNA technology is the joining of two or more separate segments of DNA to generate a single DNA molecule that is capable of autonomous replication in a given host. The simplest constructions of hybrid DNA molecules involve the cloning of insert sequences into plasmid or bacteriophage cloning vectors. The insert sequences can derive from essentially any organism, and they may be isolated directly from the genome, from mRNA, or from previously cloned DNA segments (in which case, the procedure is termed subcloning). Alternatively, insert DNAs can be created directly by DNA synthesis. This unit provides protocols for the subcloning of DNA fragments and ligation of DNA fragments in gels.

  4. Species-specific detection of Candida tropicalis using evolutionary conserved intein DNA sequences.

    Science.gov (United States)

    Rajasekharan, S K; Ray, A K; Ramesh, S; Kannappan Mohanvel, S

    2018-02-10

    Inteins (internal proteins) are self-splicing transportable genetic elements present in conserved regions of housekeeping genes. The study highlights the importance of intein as a potential diagnostic marker for species-specific identification of Candida tropicalis, a rapidly emerging opportunistic human pathogen. Initial steps of primer validation, sequence alignment, phylogenetic tree analysis, gel electrophoresis and real-time polymerase chain reaction (PCR) assays were performed to confirm the specificity of the designed primers. The primers were selective for C. tropicalis with 100% inclusivity and showed no cross-species or cross-genera matches. The established technique is a prototype for developing multifaceted PCR assays and for point-of-care testing in near future. Development of molecular markers for specific detection of microbial pathogens using real-time polymerase chain reaction (PCR) is an appealing and challenging technique. A real-time PCR is an emerging technology frequently used to detect the aetiologic agents. In recent times, designing species-specific primers for pathogen detection is gaining momentum. The method offers rapid, accurate and cost-effective strategy to identify the target, thus providing sufficient time to instigate appropriate chemotherapy. The study highlights the use of intein DNA sequence as molecular markers for species-specific identification of Candida tropicalis. The study also offers a prototype model for developing multifaceted PCR assays using intein DNA sequences, and provides a developmental starting point for point-of-care testing in near future. © 2018 The Society for Applied Microbiology.

  5. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  6. An extremely sensitive species-specific ARMs PCR test for the presence of tiger bone DNA.

    Science.gov (United States)

    Wetton, Jon H; Tsang, Carol S F; Roney, Chris A; Spriggs, Adrian C

    2004-02-10

    The survival of the tiger (Panthera tigris) is seriously threatened by poaching to provide raw materials for Traditional Chinese Medicines (TCMs). Most highly prized are the tiger's bones, which are used in combination with other animal and plant derivatives in pills and plasters for the treatment of rheumatism and other ailments. Hundreds of patent remedies have been produced which claim to contain tiger bone, but proof of its presence is needed, if legislation prohibiting the trade in endangered species is to be enforced. A highly sensitive tiger-specific real-time PCR assay has been developed to address this problem. Using primers specific to the tiger mitochondrial cytochrome b gene, successful amplification has been reliably achieved from blood, hair and bone as well as from a range of TCMs spiked with 0.5% tiger bone. Although capable of detecting fewer than 10 substrate molecules, the seven varieties of TCM pills and plasters tested showed no detectable trace of tiger DNA before spiking. Furthermore, sequencing several "tiger bone" fragments seized from TCM shops has shown that they actually originated from cattle and pigs. The potential effects of traditional bone preparation methods, evidence that much lower concentrations are used than alleged on TCM packaging, and substitution of bones from other species all suggest a low likelihood of detecting tiger DNA in patent medicines. Despite this, the basic methods have been thoroughly proven and can be readily applied to derivatives from other CITES protected species providing a rapid and highly sensitive forensic test for species of origin. Potential applications to the monitoring of wild populations are demonstrated by the successful identification of shed hairs and faecal samples.

  7. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  8. Species-specific identification from incomplete sampling: applying DNA barcodes to monitoring invasive solanum plants.

    Science.gov (United States)

    Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong

    2013-01-01

    Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.

  9. Lack of satellite DNA species-specific homogenization and relationship to chromosomal rearrangements in monitor lizards (Varanidae, Squamata).

    Science.gov (United States)

    Prakhongcheep, Ornjira; Thapana, Watcharaporn; Suntronpong, Aorarat; Singchat, Worapong; Pattanatanang, Khampee; Phatcharakullawarawat, Rattanin; Muangmai, Narongrit; Peyachoknagul, Surin; Matsubara, Kazumi; Ezaz, Tariq; Srikulnath, Kornsorn

    2017-08-16

    Satellite DNAs (stDNAs) are highly repeated sequences that constitute large portions of any genome. The evolutionary dynamics of stDNA (e.g. copy number, nucleotide sequence, location) can, therefore, provide an insight into genome organization and evolution. We investigated the evolutionary origin of VSAREP stDNA in 17 monitor lizards (seven Asian, five Australian, and five African) at molecular and cytogenetic level. Results revealed that VSAREP is conserved in the genome of Asian and Australian varanids, but not in African varanids, suggesting that these sequences are either differentiated or lost in the African varanids. Phylogenetic and arrangement network analyses revealed the existence of at least four VSAREP subfamilies. The similarity of each sequence unit within the same VSAREP subfamily from different species was higher than those of other VSAREP subfamilies belonging to the same species. Additionally, all VSAREP subfamilies isolated from the three Australian species (Varanus rosenbergi, V. gouldii, and V. acanthurus) were co-localized near the centromeric or pericentromeric regions of the macrochromosomes, except for chromosomes 3 and 4 in each Australian varanid. However, their chromosomal arrangements were different among species. The VSAREP stDNA family lack homogenized species-specific nucleotide positions in varanid lineage. Most VSAREP sequences were shared among varanids within the four VSAREP subfamilies. This suggests that nucleotide substitutions in each varanid species accumulated more slowly than homogenization rates in each VSAREP subfamily, resulting in non-species-specific evolution of stDNA profiles. Moreover, changes in location of VSAREP stDNA in each Australian varanid suggests a correlation with chromosomal rearrangements, leading to karyotypic differences among these species.

  10. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  11. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  13. Using niche-modelling and species-specific cost analyses to determine a multispecies corridor in a fragmented landscape

    Science.gov (United States)

    Zurano, Juan Pablo; Selleski, Nicole; Schneider, Rosio G.

    2017-01-01

    Misiones, Argentina, contains the largest remaining tract of Upper Paraná Atlantic Forest ecoregion; however, ~50% of native forest is unprotected and located in a mosaic of plantations, agriculture, and pastures. Existing protected areas are becoming increasingly isolated due to ongoing habitat modification. These factors, combined with lower than expected regional carnivore densities, emphasize the need to understand the effect of fragmentation on animal movement and connectivity between protected areas. Using detection dogs and genetic analyses of scat, we collected data on jaguars (Panthera onca), pumas (Puma concolor), ocelots (Leopardus pardalis), oncillas (Leopardus tigrinus), and bush dogs (Speothos venaticus) across habitats that varied in vegetation, disturbance, human proximity, and protective status. With MaxEnt we evaluated habitat use, habitat suitability, and potential species richness for the five carnivores across northern-central Misiones, Argentina. Through a multifaceted cost analysis that included unique requirements of each carnivore and varying degrees of overlap among them, we determined the optimal location for primary/secondary corridors that would link the northern-central zones of the Green Corridor in Misiones and identified areas within these corridors needing priority management. A secondary analysis, comparing these multispecies corridors with the jaguar’s unique requirements, demonstrated that this multispecies approach balanced the preferences of all five species and effectively captured areas required by this highly restricted and endangered carnivore. We emphasize the potential importance of expanding beyond a single umbrella or focal species when developing biological corridors that aim to capture the varied ecological requirements of coexisting species and ecological processes across the landscape. Detection dogs and genetic analyses of scat allow data on multiple species to be collected efficiently across multiple habitat

  14. DNA fragmentation by charged particle tracks

    Science.gov (United States)

    Stenerlöw, B.; Höglund, E.; Carlsson, J.

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons ( 60Co) or 125 keV/μm nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome.

  15. Nucleosomal DNA fragments in autoimmune diseases

    NARCIS (Netherlands)

    Holdenrieder, Stefan; Eichhorn, Peter; Beuers, Ulrich; Samtleben, Walter; Schoenermarck, Ulf; Zachoval, Reinhart; Nagel, Dorothea; Stieber, Petra

    2006-01-01

    The inadequate response of immune cells to circulating apoptotic products, such as nucleosomal DNA fragments, is assumed to be a potent stimulus for the production of autoantibodies during the pathogenesis and progression of systemic lupus erythematosus (SLE). Here, we analyzed the levels of

  16. The human immunodeficiency virus-1 protein Tat and its discrete fragments evoke selective release of acetylcholine from human and rat cerebrocortical terminals through species-specific mechanisms.

    Science.gov (United States)

    Feligioni, Marco; Raiteri, Luca; Pattarini, Roberto; Grilli, Massimo; Bruzzone, Santina; Cavazzani, Paolo; Raiteri, Maurizio; Pittaluga, Anna

    2003-07-30

    The effect of the human immunodeficiency virus-1 protein Tat was investigated on neurotransmitter release from human and rat cortical nerve endings. Tat failed to affect the release of several neurotransmitters, such as glutamate, GABA, norepinephrine, and others, but it evoked the release of [3H]ACh via increase of cytosolic [Ca2+]. In human nerve terminals, the Tat effect partly depends on Ca2+ entry through voltage-sensitive Ca2+ channels, because Cd2+ halved the Tat-evoked release. Activation of group I metabotropic glutamate receptors (mGluR) and mobilization of Ca2+ from IP3-sensitive intraterminal stores are also involved, because the Tat effect was prevented by mGluR antagonists 2-methyl-6-(phenylethynyl)pyridine hydrochloride and 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester and by the IP3 receptor antagonists heparin and xestospongin C. Furthermore, the group I selective mGlu agonist (RS)-3,5-dihydroxyphenylglycine enhanced [3H]ACh release. In rat nerve terminals, the Tat-evoked release neither depends on external Ca2+ ions entry nor on IP3-mediated mechanisms. Tat seems to cause mobilization of Ca2+ from ryanodine-sensitive internal stores because its effect was prevented by both 8-bromo-cyclic adenosine diphosphate-ribose and dantrolene. The Tat-evoked release from human synaptosomes was mimicked by the peptide sequences Tat 32-62, Tat 49-86, and Tat 41-60. In contrast, the Tat 49-86 and Tat 61-80 fragments, but not the Tat 32-62 fragment, were active in rat synaptosomes. In conclusion, Tat elicits Ca2+-dependent [3H]ACh release by species-specific intraterminal mechanisms by binding via discrete amino acid sequences to different receptive sites on human and rat cholinergic terminals.

  17. Species specific polymerase chain reaction (PCR) assay for ...

    African Journals Online (AJOL)

    A highly specific single step polymerase chain reaction (PCR) is described for the detection of pig (Sus domesticus) meat. A PCR assay was successfully optimized for amplification of 629 and 322-bp DNA fragment extracted from pig meat using designed species-specific primer pairs based on mitochondrial D-loop and 12S ...

  18. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  19. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis.

    Science.gov (United States)

    Wang, M; Park, J S; Ishiai, M; Hurwitz, J; Lee, S H

    2000-12-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) alpha and delta. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol alpha-primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis.

  20. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often <100 bp) and may persist in the environment for more than half a million years. Fragmented DNA is recognized as nutrient source f...... quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake...

  1. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  2. DNA fragmentation in spermatozoa and its relationship with impaired spermatogenesis

    Directory of Open Access Journals (Sweden)

    S. A. Rudneva

    2014-01-01

    Full Text Available Sperm cells DNA fragmentation is one of the factors of male sub-/infertility discovered recently. At present, pathophysiological mechanisms that cause DNA fragmentation have not been studied completely. It is suggested that they may be caused with defects of chromatin remodeling, apoptosis, and oxidative stress. Spermiological examination was performed in 461 infertile men. With 23 % of the patients examined, the frequency of sperm cells DNA fragmentation comprises over 15 %, with that, 18 % of the patients demonstrated its range from 15.1 to 30 %, and with 5 % of patients, it exceeded 30 %. We found that the amount of sperm cells with fragmented DNA with severe forms of pathozoospermia is higher that with less manifested disturbances of spermatogenesis. Negative dynamics was revealed regarding the change in sperm concentration in men that have increased frequency of DNA fragmentation. Obtained results confirm the suggestion of the correlation between some semen parameters (concentration, motility, and morphology and sperm DNA fragmentation. Thus, one can state that the DNA fragmentation parameter of sperm cells has a certain diagnostic and forecasting value for married couples with reproduction disorders.

  3. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  4. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  5. Bacterial species determination from DNA-DNA hybridization by using genome fragments and DNA microarrays.

    Science.gov (United States)

    Cho, J C; Tiedje, J M

    2001-08-01

    Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments of approximately 1 kb from each strain were spotted on microarrays. Genomes from 12 well-characterized fluorescent Pseudomonas strains were labeled with Cy dyes and hybridized to the arrays. Cluster analysis of the hybridization profiles revealed taxonomic relationships between bacterial strains tested at species to strain level resolution, suggesting that this approach is useful for the identification of bacteria as well as determining the genetic distance among bacteria. Since arrays can contain thousands of DNA spots, a single array has the potential for broad identification capacity. In addition, the method does not require laborious cross-hybridizations and can provide an open database of hybridization profiles, avoiding the limitations of traditional DNA-DNA hybridization.

  6. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  7. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  8. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  9. Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation

    Energy Technology Data Exchange (ETDEWEB)

    Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.

    1995-01-25

    Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

  10. Bacterial natural transformation by highly fragmented and damaged DNA.

    Science.gov (United States)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic A A; Mayar, J Victor Moreno; Rasmussen, Simon; Dahl, Tais W; Rosing, Minik T; Poole, Anthony M; Sicheritz-Ponten, Thomas; Brunak, Søren; Inselmann, Sabrina; de Vries, Johann; Wackernagel, Wilfried; Pybus, Oliver G; Nielsen, Rasmus; Johnsen, Pål Jarle; Nielsen, Kaare Magne; Willerslev, Eske

    2013-12-03

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often bacterial evolution. Here, we show that fragmented DNA molecules (≥ 20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations generated by uptake of short DNA fragments escape mismatch repair. Moreover, double-nucleotide polymorphisms appear more common among genomes of transformable than nontransformable bacteria. Our findings reveal that short and damaged, including truly ancient, DNA molecules, which are present in large quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.

  11. Fast and sensitive determination of camel’s and goat's meat and milk using species-specific genetic markers

    OpenAIRE

    Abdel-Rahman S.M.; Elmaghraby A.M.; Haggag A.S.

    2015-01-01

    For the fast and sensitive determination of camel's and goat's meat and milk, species-specific regions (SSR) of follicle stimulating hormone receptor (FSHR) gene in both camel and goat were amplified using PCR technique. DNA was extracted from small amount of muscles (0.05 gm) and very little of fresh milk (100 μl) to amplify specific DNA sequences of FSHR gene in both camel and goat using designed species-specific primer pairs. PCR amplified fragment size ...

  12. DNA fragmentation and sperm head morphometry in cat epididymal spermatozoa.

    Science.gov (United States)

    Vernocchi, Valentina; Morselli, Maria Giorgia; Lange Consiglio, Anna; Faustini, Massimo; Luvoni, Gaia Cecilia

    2014-10-15

    Sperm DNA fragmentation is an important parameter to assess sperm quality and can be a putative fertility predictor. Because the sperm head consists almost entirely of DNA, subtle differences in sperm head morphometry might be related to DNA status. Several techniques are available to analyze sperm DNA fragmentation, but they are labor-intensive and require expensive instrumentations. Recently, a kit (Sperm-Halomax) based on the sperm chromatin dispersion test and developed for spermatozoa of different species, but not for cat spermatozoa, became commercially available. The first aim of the present study was to verify the suitability of Sperm-Halomax assay, specifically developed for canine semen, for the evaluation of DNA fragmentation of epididymal cat spermatozoa. For this purpose, DNA fragmentation indexes (DFIs) obtained with Sperm-Halomax and terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) were compared. The second aim was to investigate whether a correlation between DNA status, sperm head morphology, and morphometry assessed by computer-assisted semen analysis exists in cat epididymal spermatozoa. No differences were observed in DFIs obtained with Sperm-Halomax and TUNEL. This result indicates that Sperm-Halomax assay provides a reliable evaluation of DNA fragmentation of epididymal feline spermatozoa. The DFI seems to be independent from all the measured variables of sperm head morphology and morphometry. Thus, the evaluation of the DNA status of spermatozoa could effectively contribute to the completion of the standard analysis of fresh or frozen semen used in assisted reproductive technologies. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Purification and cloning of DNA fragments fractionated on agarose gels.

    Science.gov (United States)

    Griffin, H G; Gasson, M J

    1995-04-01

    Purification of DNA fragments from acrylamide or agarose gels is a commonly used technique in the molecular biology laboratory. This article describes a rapid, efficient, and inexpensive method of purifying DNA fractions from an agarose gel. The purified DNA is suitable for use in a wide range of applications including ligation using DNA ligase. The procedure uses standard high-melting-temperature agarose and normal TBE electrophoresis buffer. In addition, the protocol does not involve the use of highly toxic organic solvents such as phenol.

  14. Modified Classical Graph Algorithms for the DNA Fragment Assembly Problem

    Directory of Open Access Journals (Sweden)

    Guillermo M. Mallén-Fullerton

    2015-09-01

    Full Text Available DNA fragment assembly represents an important challenge to the development of efficient and practical algorithms due to the large number of elements to be assembled. In this study, we present some graph theoretical linear time algorithms to solve the problem. To achieve linear time complexity, a heap with constant time operations was developed, for the special case where the edge weights are integers and do not depend on the problem size. The experiments presented show that modified classical graph theoretical algorithms can solve the DNA fragment assembly problem efficiently.

  15. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    . The degrading DNA is fragmented and damaged, often to less than one hundred base pairs. Such DNA is only recognized as microbial nutrients and is not considered as direct contributors to bacterial evolutionary processes. The main study shows natural transformation by very short DNA (≥20bp). Further we also show...... it by damaged short DNA with abasic sites, crosslinks, and miscoding lesions, which are the most common damages in environmental DNA. This is emphasized by successful natural transformation by 43,000-year-old DNA. We find that the process is a simple variant of natural transformation. On top, we illustrate...... with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...

  16. Sperm DNA fragmentation and oxidation are independent of malondialdheyde

    Science.gov (United States)

    2011-01-01

    Background There is clinical evidence to show that sperm DNA damage could be a marker of sperm quality and extensive data exist on the relationship between DNA damage and male fertility status. Detecting such damage in sperm could provide new elements besides semen parameters in diagnosing male infertility. We aimed to assess sperm DNA fragmentation and oxidation and to study the association between these two markers, routine semen parameters and malondialdehyde formation. Methods Semen samples from 55 men attending the Histology-Embryology Laboratory of Sfax Faculty of Medicine, Tunisia, for semen investigations were analysed for sperm DNA fragmentation and oxidation using flow cytometry. The Sperm was also assessed spectrophotometrically for malondialdehyde formation. Results Within the studied group, 21 patients were nonasthenozoospermic (sperm motility ≥ 50%) and 34 patients were considered asthenozoospermic (sperm motility < 50%). A positive correlation was found between sperm DNA fragmentation and oxidation (p = 0.01; r = 0.33). We also found a negative correlation between sperm DNA fragmentation and some sperm parameters: total motility (p = 0.001; r = -0.43), rapid progressive motility (type a motility) (p = 0.04; r = -0.27), slow progressive motility (type b motility) (p = 0.03; r = -0.28), and vitality (p < 0.001; r = -0.65). Sperm DNA fragmentation was positively correlated with coiled tail (p = 0.01; r = 0.34). The two parameters that were found to be correlated with oxidative DNA damage were leucocytes concentrations (p = 0.01; r = 0.38) and broken neck (p = 0.02; r = 0.29). Sperm MDA levels were negatively correlated with sperm concentration (p < 0.001; r = -0.57), total motility (p = 0.01; r = -0.35) and type a motility (p = 0.03; r = -0.32); but not correlated with DNA fragmentation and DNA oxidation. Conclusions Our results support the evidence that oxidative stress plays a key role in inducing DNA damage; but nuclear alterations and

  17. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  18. Clinical aspects of sperm DNA fragmentation detection and male infertility.

    Science.gov (United States)

    Evenson, Donald P; Wixon, Regina

    2006-03-15

    Over the past 25 years, various methods have been developed to measure sperm DNA strand breaks in situ. Currently, there are four major tests of sperm DNA fragmentation, including the Comet, Tunel, sperm chromatin structure assay (SCSA) and the acridine orange test (AOT). The Comet assay is a light microscope technique where the sperm cells are mixed with melted agarose and then placed on a glass slide. The cells are lysed and then subjected to horizontal electrophoresis. The Tunel assay, another light microscope technique, transfers labeled nucleotide to the 3'OH group of a broken DNA strand with the use of terminal deoxynucleotidyl transferase. The fluorescence intensity of each scored sperm is determined as a "yes" or "no" for sperm on a light microscope slide or by channels of fluorescent intensity in a flow cytometer. The light microscope-based AOT, uses the metachromatic properties of acridine orange to stain sperm cells. The SCSA treats sperm with low pH to denature DNA at the sites of DNA strand breaks, followed by acridine orange (AO) staining of green for native DNA and red for denatured DNA as measured by flow cytometry (FCM) as well as % sperm with high DNA stainability (HDS: immature sperm with intact DNA related to decreased fertilization rates). The SCSA method has defined a 27-30% DNA fragmentation index (DFI) as the point in which a man is placed into a statistical category of taking a longer time to in vivo pregnancy, intra uterine insemination (IUI) and more routine in vitro fertilization (IVF) cycles or no pregnancy. Current data suggest that intracytoplasmic sperm injection (ICSI) may help overcome the diminished pregnancy prognosis with high DFI over the other ART or natural methods.

  19. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  20. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Small DNA pieces in C. elegans are intermediates of DNA fragmentation during apoptosis.

    Directory of Open Access Journals (Sweden)

    P Joseph Aruscavage

    2010-06-01

    Full Text Available While studying small noncoding RNA in C. elegans, we discovered that protocols used for isolation of RNA are contaminated with small DNA pieces. After electrophoresis on a denaturing gel, the DNA fragments appear as a ladder of bands, approximately 10 nucleotides apart, mimicking the pattern of nuclease digestion of DNA wrapped around a nucleosome. Here we show that the small DNA pieces are products of the DNA fragmentation that occurs during apoptosis, and correspondingly, are absent in mutant strains incapable of apoptosis. In contrast, the small DNA pieces are present in strains defective for the engulfment process of apoptosis, suggesting they are produced in the dying cell prior to engulfment. While the small DNA pieces are also present in a number of strains with mutations in predicted nucleases, they are undetectable in strains containing mutations in nuc-1, which encodes a DNase II endonuclease. We find that the small DNA pieces can be labeled with terminal deoxynucleotidyltransferase only after phosphatase treatment, as expected if they are products of DNase II cleavage, which generates a 3' phosphate. Our studies reveal a previously unknown intermediate in the process of apoptotic DNA fragmentation and thus bring us closer to defining this important pathway.

  2. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  3. Rapid, species-specific detection of uropathogen 16S rDNA and rRNA at ambient temperature by dot-blot hybridization and an electrochemical sensor array.

    Science.gov (United States)

    Sun, Chien-Pin; Liao, Joseph C; Zhang, Yao-Hua; Gau, Vincent; Mastali, Mitra; Babbitt, Jane T; Grundfest, Warren S; Churchill, Bernard M; McCabe, Edward R B; Haake, David A

    2005-01-01

    Development of rapid molecular approaches for pathogen detection is key to improving treatment of infectious diseases. For this study, the kinetics and temperature-dependence of DNA probe hybridization to uropathogen species-specific sequences were examined. A set of oligonucleotide probes were designed based on variable regions of the 16S gene of the Escherichia coli, Proteus mirabilis, Klebsiella oxytoca, and Pseudomonas aeruginosa. A universal bacterial probe and probes-specific for gram-positive and gram-negative organisms were also included. The oligonucleotide probes discriminated among 16S genes derived from 11 different species of uropathogenic bacteria applied to nylon membranes in a dot-blot format. Significant binding of oligonucleotide probes to target DNA and removal of nonspecific binding by membrane washing could both be achieved rapidly, requiring as little as 10 min. An oligonucleotide probe from the same species-specific region of the E. coli 16S gene was used as a capture probe in a novel electrochemical 16-sensor array based on microfabrication technology. Sequence-specific hybridization of target uropathogen 16S rDNA was detected through horseradish peroxidase acting as an electrochemical transducer via a second, detector probe. The sensor array demonstrated rapid, species-specific hybridization in a time course consistent with the rapid kinetics of the dot-blot hybridization studies. As in the dot-blot hybridization studies, species-specific detection of bacterial nucleic acids using the sensor array approach was demonstrated both at 65 degrees C and at room temperature. These results demonstrate that molecular hybridization approaches can be adapted to rapid, room temperature conditions ideal for an electrochemical sensor array platform.

  4. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  5. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  6. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis

    Science.gov (United States)

    Wang, Mu; Park, Jang-Su; Ishiai, Masamichi; Hurwitz, Jerard; Lee, Suk-Hee

    2000-01-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) α and δ. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol α–primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis. PMID:11095685

  7. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  8. Use of species-specific PCR for the identification of 10 sea cucumber species

    Science.gov (United States)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  9. Complexities of bloom dynamics in the toxic dinoflagellate Alexandrium fundyense revealed through DNA measurements by imaging flow cytometry coupled with species-specific rRNA probes

    Science.gov (United States)

    Brosnahan, Michael L.; Farzan, Shahla; Keafer, Bruce A.; Sosik, Heidi M.; Olson, Robert J.; Anderson, Donald M.

    2014-05-01

    Measurements of the DNA content of different protist populations can shed light on a variety of processes, including cell division, sex, prey ingestion, and parasite invasion. Here, we modified an Imaging FlowCytobot (IFCB), a custom-built flow cytometer that records images of microplankton, to measure the DNA content of large dinoflagellates and other high-DNA content species. The IFCB was also configured to measure fluorescence from Cy3-labeled rRNA probes, aiding the identification of Alexandrium fundyense (syn. A. tamarense Group I), a photosynthetic dinoflagellate that causes paralytic shellfish poisoning (PSP). The modified IFCB was used to analyze samples from the development, peak and termination phases of an inshore A. fundyense bloom (Salt Pond, Eastham, MA, USA), and from a rare A. fundyense ‘red tide’ that occurred in the western Gulf of Maine, offshore of Portsmouth, NH (USA). Diploid or G2 phase (‘2C’) A. fundyense cells were frequently enriched at the near-surface, suggesting an important role for aggregation at the air-sea interface during sexual events. Also, our analysis showed that large proportions of A. fundyense cells in both the Salt Pond and red tide blooms were planozygotes during bloom decline, highlighting the importance of sexual fusion to bloom termination. At Salt Pond, bloom decline also coincided with a dramatic rise in infections by the parasite genus Amoebophrya. The samples that were most heavily infected contained many large cells with higher DNA-associated fluorescence than 2C vegetative cells, but these cells' nuclei were also frequently consumed by Amoebophrya trophonts. Neither large cell size nor increased DNA-associated fluorescence could be replicated by infecting an A. fundyense culture of vegetative cells. Therefore, we attribute these characteristics of the large Salt Pond cells to planozygote maturation rather than Amoebophrya infection, though an interaction between infection and planozygote maturation may

  10. Revealing large metagenomic regions through long DNA fragment hybridization capture.

    Science.gov (United States)

    Gasc, Cyrielle; Peyret, Pierre

    2017-03-14

    High-throughput DNA sequencing technologies have revolutionized genomic analysis, including the de novo assembly of whole genomes from single organisms or metagenomic samples. However, due to the limited capacity of short-read sequence data to assemble complex or low coverage regions, genomes are typically fragmented, leading to draft genomes with numerous underexplored large genomic regions. Revealing these missing sequences is a major goal to resolve concerns in numerous biological studies. To overcome these limitations, we developed an innovative target enrichment method for the reconstruction of large unknown genomic regions. Based on a hybridization capture strategy, this approach enables the enrichment of large genomic regions allowing the reconstruction of tens of kilobase pairs flanking a short, targeted DNA sequence. Applied to a metagenomic soil sample targeting the linA gene, the biomarker of hexachlorocyclohexane (HCH) degradation, our method permitted the enrichment of the gene and its flanking regions leading to the reconstruction of several contigs and complete plasmids exceeding tens of kilobase pairs surrounding linA. Thus, through gene association and genome reconstruction, we identified microbial species involved in HCH degradation which constitute targets to improve biostimulation treatments. This new hybridization capture strategy makes surveying and deconvoluting complex genomic regions possible through large genomic regions enrichment and allows the efficient exploration of metagenomic diversity. Indeed, this approach enables to assign identity and function to microorganisms in natural environments, one of the ultimate goals of microbial ecology.

  11. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  12. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  13. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    Science.gov (United States)

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  14. Spatial and temporal regulation of DNA fragmentation in the aleurone of germinating barley

    NARCIS (Netherlands)

    Wang, M.; Oppedijk, B.J.; Caspers, M.P.M.; Lamers, G.E.M.; Boot, M.J.; Geerlings, D.N.G.; Bakhuizen, B.; Meijer, A.H.; Duijn, B. van

    1998-01-01

    During germination of barley grains, the appearance of DNA fragmentation started in aleurone cells near the embryo and extended to the distal end in a time-dependent manner. DNA fragmentation was demonstrated to occur only after the expression of α-amylase mRNA in the aleurone layer. In addition,

  15. Nanopore-based assay for detection of methylation in double-stranded DNA fragments.

    Science.gov (United States)

    Shim, Jiwook; Kim, Younghoon; Humphreys, Gwendolyn I; Nardulli, Ann M; Kosari, Farhad; Vasmatzis, George; Taylor, William R; Ahlquist, David A; Myong, Sua; Bashir, Rashid

    2015-01-27

    DNA methylation is an epigenetic modification of DNA in which methyl groups are added at the 5-carbon position of cytosine. Aberrant DNA methylation, which has been associated with carcinogenesis, can be assessed in various biological fluids and potentially can be used as markers for detection of cancer. Analytically sensitive and specific assays for methylation targeting low-abundance and fragmented DNA are needed for optimal clinical diagnosis and prognosis. We present a nanopore-based direct methylation detection assay that circumvents bisulfite conversion and polymerase chain reaction amplification. Building on our prior work, we used methyl-binding proteins (MBPs), which selectively label the methylated DNA. The nanopore-based assay selectively detects methylated DNA/MBP complexes through a 19 nm nanopore with significantly deeper and prolonged nanopore ionic current blocking, while unmethylated DNA molecules were not detectable due to their smaller diameter. Discrimination of hypermethylated and unmethylated DNA on 90, 60, and 30 bp DNA fragments was demonstrated using sub-10 nm nanopores. Hypermethylated DNA fragments fully bound with MBPs are differentiated from unmethylated DNA at 2.1- to 6.5-fold current blockades and 4.5- to 23.3-fold transport durations. Furthermore, these nanopore assays can detect the CpG dyad in DNA fragments and could someday profile the position of methylated CpG sites on DNA fragments.

  16. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  17. Relative stability of transgene DNA fragments from GM rapeseed in mixed ruminal cultures.

    Science.gov (United States)

    Sharma, Ranjana; Alexander, Trevor W; John, S Jacob; Forster, Robert J; McAllister, Tim A

    2004-05-01

    The use of transgenic crops as feeds for ruminant animals has prompted study of the possible uptake of transgene fragments by ruminal micro-organisms and/or intestinal absorption of fragments surviving passage through the rumen. The persistence in buffered ruminal contents of seven different recombinant DNA fragments from GM rapeseed expressing the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) transgene was tracked using PCR. Parental and transgenic (i.e. glyphosphate-tolerant; Roundup Ready, Monsanto Company, St Louis, MO, USA) rapeseed were incubated for 0, 2, 4, 8, 12, 24 and 48 h as whole seeds, cracked seeds, rapeseed meal, and as pelleted, barley-based diets containing 65 g rapeseed meal/kg. The seven transgene fragments ranged from 179 to 527 bp and spanned the entire 1363 bp EPSPS transgene. A 180 bp ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit fragment and a 466 bp 16S rDNA fragment were used as controls for endogenous rapeseed DNA and bacterial DNA respectively. The limit of detection of the PCR assay, established using negative controls spiked with known quantities of DNA, was 12.5 pg. Production of gas and NH3 was monitored throughout the incubation and confirmed active in vitro fermentation. Bacterial DNA was detected in all sample types at all time points. Persistence patterns of endogenous (Rubisco) and recombinant (EPSPS) rapeseed DNA were inversely related to substrate digestibility (amplifiable for 48, 8 and 4 h in whole or cracked seeds, meal and diets respectively), but did not differ between parental and GM rapeseed, nor among fragments. Detection of fragments was representative of persistence of the whole transgene. No EPSPS fragments were amplifiable in microbial DNA, suggesting that transformation had not occurred during the 48 h incubation. Uptake of transgenic DNA fragments by ruminal bacteria is probably precluded or time-limited by rapid degradation of plant DNA upon plant cell lysis.

  18. Microfluidic chip for stacking, separation and extraction of multiple DNA fragments.

    Science.gov (United States)

    Wu, Ruige; Seah, Y P; Wang, Zhiping

    2016-03-11

    A disposable integrated microfluidic device was developed for rapid sample stacking, separation and extraction of multiple DNA fragments from a relatively large amount of sample. Isotachophoresis hyphenated gel electrophoresis (ITP-GE) was used to pre-concentrate and separate DNA fragments, followed by extraction of pure DNA fragments with electroelution on-chip. DNA fragments of 200bp, 500bp and 1kbp were successfully separated and collected in the extraction chamber within 25min. The extraction efficiency obtained from the chip was 49.9%, 52.1% and 53.7% for 200bp, 500bp and 1kbp DNA fragments, respectively. The extracted DNA fragments exhibited compatibility with downstream enzymatic reactions, for example PCR. The chip was also used to extract DNA fragments with specific size range from sheared genomic DNA and demonstrated similar performance to that using traditional gel cutting method. The whole assay can finish in 32min, 6 times faster than traditional method. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Influence of the electrokinetic injection conditions on the separation of DNA fragments in capillary electrophoresis

    OpenAIRE

    Catai Jonatan Ricardo; Carrilho Emanuel

    2004-01-01

    In genetic analysis by capillary electrophoresis with polymer solutions there are many variables that affect separation of the DNA fragments. A very critical one is the sample injection process, which can considerably affect the peak efficiency and the resolution. In this work, we have studied the influence of the DNA sample composition and the electrokinetic injection conditions in the separation of DNA fragments by capillary electrophoresis using replaceable polymer solutions. The studies w...

  20. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  2. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  3. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    Organisms release DNA both when they live and die. Eventually the DNA disintegrates entirely or it is re-metabolized. There is a constant deposition and decomposition that maintains an environmental pool with large quantities of extracellular DNA, some of which can be thousands of years old. The ...... in chemistry. In addition to qualitative DNA sequencing, statistical analysis of the numerous sequencing reads yields quantitative measurements of DNA modifying reactions....

  4. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium fredii RT19].

    Science.gov (United States)

    Bian, X L; Ge, S C; Yang, S S

    2000-01-01

    A 23 kb DNA fragment related to salt tolerance was obtained from the gene library of S. fredii strain RT19. In this study, BamH I was selected to digest 23 kb DNA fragment into different length of DNA fragments. The resulting fragments were ligated with plasmid pML122, then the recombinant plasmids were transformed to competent cells of E. coli S17-1 on selective medium and three transformants TR were obtained. Two-parental mating experiments were carried out with these transformants as donor and salt sensitive S. fredii strain RC3-3 as recipient, and the transconjugant BR2 was selected on FY plates containing gentamycin and 0.4 mol/L NaCl. Thus, a 4.4 kb DNA fragment related to salt tolerance was obtained. Based on its physical map, six restriction fragments were subcloned into plasmid pUC18 for DNA sequencing. Subsequently, sequencing and analysis of 4.4 kb DNA fragment showed that fixO, fixN genes and three ORFs were obtained.

  5. New approach to assess sperm DNA fragmentation dynamics: Fine-tuning mathematical models.

    Science.gov (United States)

    Ortiz, Isabel; Dorado, Jesús; Morrell, Jane; Gosálvez, Jaime; Crespo, Francisco; Jiménez, Juan M; Hidalgo, Manuel

    2017-01-01

    Sperm DNA fragmentation (sDF) has been proved to be an important parameter in order to predict in vitro the potential fertility of a semen sample. Colloid centrifugation could be a suitable technique to select those donkey sperm more resistant to DNA fragmentation after thawing. Previous studies have shown that to elucidate the latent damage of the DNA molecule, sDF should be assessed dynamically, where the rate of fragmentation between treatments indicates how resistant the DNA is to iatrogenic damage. The rate of fragmentation is calculated using the slope of a linear regression equation. However, it has not been studied if sDF dynamics fit this model. The objectives of this study were to evaluate the effect of different after-thawing centrifugation protocols on sperm DNA fragmentation and elucidate the most accurate mathematical model (linear regression, exponential or polynomial) for DNA fragmentation over time in frozen-thawed donkey semen. After submitting post-thaw semen samples to no centrifugation (UDC), sperm washing (SW) or single layer centrifugation (SLC) protocols, sDF values after 6 h of incubation were significantly lower in SLC samples than in SW or UDC. Coefficient of determination (R 2 ) values were significantly higher for a second order polynomial model than for linear or exponential. The highest values for acceleration of fragmentation (aSDF) were obtained for SW, followed by SLC and UDC. SLC after thawing seems to preserve longer DNA longevity in comparison to UDC and SW. Moreover, the fine-tuning of models has shown that sDF dynamics in frozen-thawed donkey semen fit a second order polynomial model, which implies that fragmentation rate is not constant and fragmentation acceleration must be taken into account to elucidate hidden damage in the DNA molecule.

  6. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  7. Efficient double fragmentation ChIP-seq provides nucleotide resolution protein-DNA binding profiles

    NARCIS (Netherlands)

    Mokry, M.; Hatzis, P.; de Bruijn, E.; Koster, J.; Versteeg, R.; Schuijers, J.; van de Wetering, M.L.; Guryev, V.; Clevers, H.; Cuppen, E.

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  8. Characterization of a three bacteria mixed culture in a chemostat: evaluation and application of a quantitative terminal-restriction fragment length polymorphism (T-RFLP) analysis for absolute and species specific cell enumeration.

    Science.gov (United States)

    Schmidt, Julia K; König, Brigitte; Reichl, Udo

    2007-03-01

    Growth dynamics of Pseudomonas aeruginosa, Burkholderia cepacia, and Staphylococcus aureus in a batch and chemostat, were investigated as a laboratory model system for persistent infections in cystic fibrosis. Most species-specific enumeration methods for mixed cultures are laborious or only qualitative, and therefore impede generation of quantitative data required for validation of mathematical models. Here, a quantitative T-RFLP method was evaluated and applied for specific and absolute cell number enumerations. The method was tested to be unbiased by quantitative sample composition and allowed reproducible enumerations of mixed cultures. For assay validation, samples of defined concentration containing one, two or three species were quantified. Logarithmically transformed absolute cell numbers of single-species dilutions were linear within a lower working range of 10(4)-10(6) cfu/mL (species-dependent) and an upper working range of 10(10) cfu/mL. Quantifications of single species (10(6)-10(10) cfu/mL) spiked with one or two other species agreed well with single species controls. Differences between slopes of first order linear regression of spiked and pure dilution series were insignificant. Coefficient of variation of defined mixed replicates was maximum 4.39%, of a three-species chemostat it was maximum 1.76%. T-RFLP monitoring of pure cultures in parallel shake flasks and of a three-species mixed chemostat gave very consistent results. Coexistence of at least two species after a time period equivalent to more than 33 volume exchanges was found. This result was not predicted from pure cultures clearly indicating the need for quantitative mixed culture experiments to better understand microbial growth dynamics and for mathematical model validation.

  9. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  10. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  11. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  12. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  13. The Restriction Fragment Map of Rat-Liver Mitochondrial DNA : A Reconsideration

    NARCIS (Netherlands)

    Pepe, G.; Bakker, H.; Holtrop, M.; Bollen, J.E.; Bruggen, E.F.J. van; Cantatore, P.; Terpstra, P.; Saccone, C.

    1977-01-01

    1. Rat-liver mitochondrial DNA (mtDNA) contains at least 8 cleavage sites for the restriction endonuclease Eco RI, 6 for the restriction endonuclease Hind III, 2 for the restriction endonuclease Bam HI and 11 for the restriction endonuclease Hap II. 2. The physical map of the restriction fragments

  14. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona Berger Håkonsen; Fedder, J

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR...

  15. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium meliloti 042B].

    Science.gov (United States)

    Ge, S; Fan, Z; Chen, X; Yang, S

    2001-02-01

    A 4 kb ClaI DNA fragment related to salt tolerance from S. meliloti 042B was digested by HindIII down 2.4 kb fragment, and a 1.6 kb ClaII-HindIII fragment was retained on plasmid pML122. Then, the 2.4 kb DNA fragment was ligated with plasmid pBBR1-MCS2, and the recombinant plasmid was transformed to E. coli DH5 alpha, and transformant GS2 was obtained. Three-parental mating experiments were carried out with transformant GS2 as donor, salt sensitive strains GZ17 as recipient and pRK2013 as helper plasmid, then the transconjugant GG2 was selected on FY plates containing kanamycin and 0.4 mol/L NaCl. The remaining DNA fragment was self ligated with pML122 and then transformed into E. coli S17-1 and transformat GS0 was obtained. Two-parental mating experiment was carried out with transformant GS0 as donor and salt sensitive strain GZ17 as recipient, but no transconjugant was obtained on the FY plates. Then, the 2.4 kb HindIII DNA fragment was ligated into sequencing vector pGEM-7Zf(+) for sequencing. The result of sequencing and analysis showed that the 2.4 kb DNA fragment contained three ORFs. According to the result of sequencing, further subcloning was conducted and 1.9 kb HindIII-Sac II DNA fragment related to salt tolerance was obtained.

  16. Analysis of parental strain DNA fragments existing in GEMs-Fhhh.

    Science.gov (United States)

    Hao, Chun-Bo; Yan, Jun; Qu, Meng-Meng; Wang, Dong; Cheng, Shu-Pei; Gu, Ji-Dong; Qiu, Wan-Fei; Wang, Yin-Yin

    2003-09-01

    There were 6 target DNA fragments of the three parental strains existing in the cell of GEMs (genetically engineered microorganism strain) Fhhh measured in this research by PCR(polymerase chain reaction). The determination showed that GEMs Fhhh contained all the 6 target DNA fragments, mnp1, mnp2, lip1, lip2, FLO1 and 16S rDNA, and had the molecular genetic stability. Meanwhile the PCR production of each parental strain could only had its target DNA fragments and was different from each other. It may illustrate that the technique of the inter-kingdom protoplast fusion for the construction of GEMs Fhhh through the process of intercellular gene recombination could be used as a reliable bioengineering technique to create the specific functional stain for the pollution control.

  17. Hyperbolic SOM-based clustering of DNA fragment features for taxonomic visualization and classification.

    Science.gov (United States)

    Martin, Christian; Diaz, Naryttza N; Ontrup, Jörg; Nattkemper, Tim W

    2008-07-15

    Modern high-throughput sequencing technologies enable the simultaneous analysis of organisms in an environment. The analysis of species diversity and the binning of DNA fragments of non-sequenced species for assembly are two major challenges in sequence analysis. To achieve reasonable binnings and classifications, DNA fragment structure has to be represented appropriately, so it can be processed by machine learning algorithms. Hierarchically growing hyperbolic Self-Organizing maps (H(2)SOMs) are trained to cluster small variable-length DNA fragments (0.2-50 kb) of 350 prokaryotic organisms at six taxonomic ranks Superkingdom, Phylum, Class, Order, Genus and Species in the Tree of Life. DNA fragments are mapped to three different types of feature vectors based on the genomic signature: basic features, features considering the importance of oligonucleotide patterns as well as contrast enhanced features. The H (2)SOM classifier achieves high classification rates while at the same time its visualization allows further insights into the projected data and has the potential to support binning of short sequence reads, because DNA fragments can be grouped into phylogenetic groups. An implementation of the H(2)HSOM classifier in Matlab is provided at www.techfak.uni-bielefeld.de/ags/ani/projects/HHSOMSeqData.

  18. Effect of different gravity environments on DNA fragmentation and cell death in Kalanchoe leaves.

    Science.gov (United States)

    Pedroso, M C; Durzan, D J

    2000-11-01

    Different gravity environments have been shown to significantly affect leaf-plantlet formation and asexual reproduction in Kalanchoë daigremontiana Ham. and Perr. In the present work, we investigated the effect of gravity at tissue and cell levels. Leaves and leaf-plantlets were cultured for different periods of time (min to 15 d) in different levels of gravity stimulation: simulated hypogravity (1 rpm clinostats; 2 x 10(-4) g), 1 g (control) and hypergravity (centrifugation; 20 and 150 g). Both simulated hypogravity and hypergravity affected cell death (apoptosis) in this species, and variations in the number of cells showing DNA fragmentation directly correlated with nitric oxide (NO) formation. Apoptosis in leaves was more common as gravity increased. Apoptotic cells were localized in the epidermis, mainly guard cells, in leaf parenchyma, and in tracheary elements undergoing terminal differentiation. Exposures to acute hypergravity (up to 60 min) showed that chloroplast DNA fragmentation occurred prior to nuclear DNA fragmentation, marginalization of chromatin, nuclear condensation, and nuclear blebbing. Addition of sodium nitroprusside (NO donor) mimicked centrifugation. NO and DNA fragmentation decreased with N(G)-monomethyl-L-arginine (NO-synthase inhibitor). The variations in NO levels, nucleoid DNA fragmentation, and cell death show how chloroplasts, cells and leaves may respond (and adapt) to gravity changes. c 2000 Annals of Botany Company.

  19. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  20. Simulating Molecular Interactions of Carbon Nanoparticles with a Double-Stranded DNA Fragment

    Directory of Open Access Journals (Sweden)

    Zhuang Wang

    2015-01-01

    Full Text Available Molecular interactions between carbon nanoparticles (CNPs and a double-stranded deoxyribonucleic acid (dsDNA fragment were investigated using molecular dynamics (MD simulations. Six types of CNPs including fullerenes (C60 and C70, (8,0 single-walled carbon nanotube (SWNT, (8,0 double-walled carbon nanotube (DWNT, graphene quantum dot (GQD, and graphene oxide quantum dot (GOQD were studied. Analysis of the best geometry indicates that the dsDNA fragment can bind to CNPs through pi-stacking and T-shape. Moreover, C60, DWNT, and GOQD bind to the dsDNA molecules at the minor groove of the nucleotide, and C70, SWNT, and GQD bind to the dsDNA molecules at the hydrophobic ends. Estimated interaction energy implies that van der Waals force may mainly contribute to the mechanisms for the dsDNA-C60, dsDNA-C70, and dsDNA-SWNT interactions and electrostatic force may contribute considerably to the dsDNA-DWNT, dsDNA-GQD, and dsDNA-GOQD interactions. On the basis of the results from large-scale MD simulations, it was found that the presence of the dsDNA enhances the dispersion of C60, C70, and SWNT in water and has a slight impact on DWNT, GQD, and GOQD.

  1. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... interest by PCR using proof reading DNA polymerase, such as Pfu, KOD and Primerstar, is preferred since the. PCR products with a higher degree of fidelity are required in many investigations. However, traditional blunt-end cloning method for direct cloning of blunt-end PCR products is not efficient since ...

  2. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  3. The Flp double cross system a simple efficient procedure for cloning DNA fragments

    Directory of Open Access Journals (Sweden)

    Sadowski Paul D

    2003-07-01

    Full Text Available Abstract Background While conventional cloning methods using restriction enzymes and polynucleotide ligase are adequate for most DNAs, fragments made by the polymerase chain reaction are difficult to clone because the amplifying DNA polymerase tends to add untemplated nucleotides to the 3'-termini of the amplified strands. Conservative site-specific recombinases offer an efficient alternative to conventional cloning methods. Results In this paper I describe the use of the Flp site-specific recombinase for cloning PCR-amplified fragments. A DNA fragment is amplified with primers that contain at their ends inverted target sequences for Flp. Flp readily recombines these fragments in vitro into a vector that also contains two inverted Flp target sequences surrounding the α-complementing region of the lacZ gene of E. coli. The recombinants are conveniently detected as white colonies by the familiar blue/white screening test for lacZ activity. A useful feature of the system is that both orientations of the inserted DNA are usually obtained. If the recipient vector is cut between the two inverted Flp targets, Flp "heals" the double-strand break by inserting a linear fragment flanked by Flp targets. Conclusion This system ("The Flp Double Cross System" should be useful for cloning multiple PCR fragments into many sites in several vectors. It has certain advantages over other available recombinase-based cloning procedures.

  4. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  5. Sperm DNA fragmentation: An early and reliable marker of air pollution.

    Science.gov (United States)

    Bosco, Liana; Notari, Tiziana; Ruvolo, Giovanni; Roccheri, Maria C; Martino, Chiara; Chiappetta, Rosanna; Carone, Domenico; Lo Bosco, Giosuè; Carrillo, Laura; Raimondo, Salvatore; Guglielmino, Antonino; Montano, Luigi

    2018-03-01

    Environmental factors could have a key role in the continuous and remarkable decline of sperm quality observed in the last decades. This study compared the seminal parameters and sperm DFI in men living in areas with different levels of air pollution. Results demonstrate that both steel plants workers and patients living in a high polluted area show a mean percentage of sperm DNA fragmentation above 30%, highlighting a clear sperm damage. In this work, two different techniques were used to measure sperm DNA damage in patients' groups, finding in both cases a high sperm DFI in patients living in polluted areas. We candidate sperm DNA fragmentation as a valuable early marker of the presence and harmful effects of pollution. We suggest that sperm DNA evaluation could be both an indicator of individual health and reproductive capacity, and a suitable datum to connect the surrounding environment with its effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  7. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  8. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    International Nuclear Information System (INIS)

    Santiso, Rebeca; Tamayo, María; Gosálvez, Jaime; Johnston, Steve; Mariño, Alfonso; Fernández, Carlos; Losada, Carlos; Fernández, José Luis

    2012-01-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 °C and 45 °C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 °C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan–Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  9. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  10. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  11. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  12. FragMatch--a program for the analysis of DNA fragment data.

    Science.gov (United States)

    Saari, T A; Saari, S K; Campbell, C D; Alexander, I J; Anderson, I C

    2007-03-01

    FragMatch is a user-friendly Java-supported program that automates the identification of taxa present in mixed samples by comparing community DNA fragment data against a database of reference patterns for known species. The program has a user-friendly Windows interface and was primarily designed for the analysis of fragment data derived from terminal restriction fragment length polymorphism analysis of ectomycorrhizal fungal communities, but may be adapted for other applications such as microsatellite analyses. The program uses a simple algorithm to check for the presence of reference fragments within sample files that can be directly imported, and the results appear in a clear summary table that also details the parameters that were used for the analysis. This program is significantly more flexible than earlier programs designed for matching RFLP patterns as it allows default or user-defined parameters to be used in the analysis and has an unlimited database size in terms of both the number of reference species/individuals and the number of diagnostic fragments per database entry. Although the program has been developed with mycorrhizal fungi in mind, it can be used to analyse any DNA fragment data regardless of biological origin. FragMatch, along with a full description and users guide, is freely available to download from the Aberdeen Mycorrhiza Group web page (http://www.aberdeenmycorrhizas.com).

  13. A general method to modify BACs to generate large recombinant DNA fragments.

    Science.gov (United States)

    Shen, Wei; Huang, Yue; Tang, Yi; Liu, De-Pei; Liang, Chih-Chuan

    2005-11-01

    Bacterial artificial chromosome (BAC) has the capacity to clone DNA fragments in excess of 300 kb. It also has the considerable advantages of stable propagation and ease of purification. These features make BAC suitable in genetic research, such as library construction, transgenic mice production, and gene targeting constructs. Homologous recombination in Escherichia coli, a process named recombineering, has made the modification of BACs easy and reliable. We report here a modified recombineering method that can efficiently mediate the fusion of large DNA fragments from two or more different BACs. With the introduction of kanamycin-resistant gene and proposed rare-cutting restriction endonuclease (RCRE) sites into two BACs, a 82.6-kb DNA fragment containing the inverted human alpha-globin genes (theta, alpha1, alpha2, and zeta) from BAC191K2 and the locus control region (LCR) of human beta-globin gene locus (from the BAC186D7) was reconstructed. This approach for combining different BAC DNA fragments should facilitate many kinds of genomic experiments.

  14. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  15. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  16. Digital analysis of cDNA abundance; expression profiling by means of restriction fragment fingerprinting

    Directory of Open Access Journals (Sweden)

    Regenbogen Johannes

    2002-03-01

    Full Text Available Abstract Background Gene expression profiling among different tissues is of paramount interest in various areas of biomedical research. We have developed a novel method (DADA, Digital Analysis of cDNA Abundance, that calculates the relative abundance of genes in cDNA libraries. Results DADA is based upon multiple restriction fragment length analysis of pools of clones from cDNA libraries and the identification of gene-specific restriction fingerprints in the resulting complex fragment mixtures. A specific cDNA cloning vector had to be constructed that governed missing or incomplete cDNA inserts which would generate misleading fingerprints in standard cloning vectors. Double stranded cDNA was synthesized using an anchored oligo dT primer, uni-directionally inserted into the DADA vector and cDNA libraries were constructed in E. coli. The cDNA fingerprints were generated in a PCR-free procedure that allows for parallel plasmid preparation, labeling, restriction digest and fragment separation of pools of 96 colonies each. This multiplexing significantly enhanced the throughput in comparison to sequence-based methods (e.g. EST approach. The data of the fragment mixtures were integrated into a relational database system and queried with fingerprints experimentally produced by analyzing single colonies. Due to limited predictability of the position of DNA fragments on the polyacrylamid gels of a given size, fingerprints derived solely from cDNA sequences were not accurate enough to be used for the analysis. We applied DADA to the analysis of gene expression profiles in a model for impaired wound healing (treatment of mice with dexamethasone. Conclusions The method proved to be capable of identifying pharmacologically relevant target genes that had not been identified by other standard methods routinely used to find differentially expressed genes. Due to the above mentioned limited predictability of the fingerprints, the method was yet tested only with

  17. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  18. Generation of longer 3' cDNA fragments from massively parallel signature sequencing tags.

    Science.gov (United States)

    Silva, Ana Paula M; Chen, Jianjun; Carraro, Dirce M; Wang, San Ming; Camargo, Anamaria A

    2004-07-06

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3'end of transcripts. A single MPSS experiment can generate over 10(7) tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (approximately 1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3' cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts.

  19. Generation of longer 3′ cDNA fragments from massively parallel signature sequencing tags

    Science.gov (United States)

    Silva, Ana Paula M.; Chen, Jianjun; Carraro, Dirce M.; Wang, San Ming; Camargo, Anamaria A.

    2004-01-01

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3′end of transcripts. A single MPSS experiment can generate over 107 tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (∼1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3′ cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts. PMID:15247327

  20. Combination of native and denaturing PAGE for the detection of protein binding regions in long fragments of genomic DNA

    Directory of Open Access Journals (Sweden)

    Metsis Madis

    2008-06-01

    Full Text Available Abstract Background In a traditional electrophoresis mobility shift assay (EMSA a 32P-labeled double-stranded DNA oligonucleotide or a restriction fragment bound to a protein is separated from the unbound DNA by polyacrylamide gel electrophoresis (PAGE in nondenaturing conditions. An extension of this method uses the large population of fragments derived from long genomic regions (approximately 600 kb for the identification of fragments containing protein binding regions. With this method, genomic DNA is fragmented by restriction enzymes, fragments are amplified by PCR, radiolabeled, incubated with nuclear proteins and the resulting DNA-protein complexes are separated by two-dimensional PAGE. Shifted DNA fragments containing protein binding sites are identified by using additional procedures, i. e. gel elution, PCR amplification, cloning and sequencing. Although the method allows simultaneous analysis of a large population of fragments, it is relatively laborious and can be used to detect only high affinity protein binding sites. Here we propose an alternative and straightforward strategy which is based on a combination of native and denaturing PAGE. This strategy allows the identification of DNA fragments containing low as well as high affinity protein binding regions, derived from genomic DNA ( Results We have combined an EMSA-based selection step with subsequent denaturing PAGE for the localization of protein binding regions in long (up to10 kb fragments of genomic DNA. Our strategy consists of the following steps: digestion of genomic DNA with a 4-cutter restriction enzyme (AluI, BsuRI, TruI, etc, separation of low and high molecular weight fractions of resultant DNA fragments, 32P-labeling with Klenow polymerase, traditional EMSA, gel elution and identification of the shifted bands (or smear by denaturing PAGE. The identification of DNA fragments containing protein binding sites is carried out by running the gel-eluted fragments alongside

  1. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  2. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  3. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  4. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  5. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  6. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  7. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  8. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  9. Species-specific PCR for the identification of goat cashmere and sheep wool.

    Science.gov (United States)

    Geng, Rong-Qing

    2015-02-01

    In order to establish rapid and species-specific method of goat cashmere and sheep wool identification, a polymerase chain reaction using specific primer pairs targeting mitochondrial D-loop was developed. The goat specific primers yielded a 294 bp PCR fragment and the sheep specific primers yielded three PCR fragments of which only the 404 bp fragment was found highly diagnostic. The specificity and reliability of the developed species-specific PCR assay was validated by considering as many as 500 cashmere and wool samples. The developed species-specific PCR was found effective in detecting mixed samples of cashmere and wool precisely with the relative content over 9.09%. The species-specific PCR method proved to be low cost, fast, easy and reliable alternative to determine the addition of sheep wool in goat cashmere. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Cell-free DNA fragmentation patterns in amniotic fluid identify genetic abnormalities and changes due to storage.

    Science.gov (United States)

    Peter, Inga; Tighiouart, Hocine; Lapaire, Olav; Johnson, Kirby L; Bianchi, Diana W; Terrin, Norma

    2008-09-01

    Circulating cell-free DNA (cfDNA) has become a promising biomarker in prenatal diagnosis. However, despite extensive studies in different body fluids, cfDNA predictive value is uncertain owing to the confounding factors that can affect its levels, such as gestational age, maternal weight, smoking status, and medications. Residual fresh and archived amniotic fluid (AF) supernatants were obtained from gravid women (mean gestational age 17 wk) carrying euploid (N=36) and aneuploid (N=29) fetuses, to characterize cfDNA-fragmentation patterns with regard to aneuploidy and storage time (-80 degrees C). AF cfDNA was characterized by the real-time quantitative polymerase chain reaction amplification of glyceraldehyde-3-phosphate dehydrogenase, gel electrophoresis, and pattern recognition of the DNA fragmentation. The distributions of cfDNA fragment lengths were compared using 6 measures that defined the locations and slopes for the first and last peaks, after elimination of the confounding variables. This method allowed for the unique classification of euploid and aneuploid cfDNA samples in AF, which had been matched for storage time. In addition, we showed that archived euploid AF samples gradually lose long cfDNA fragments: this loss accurately distinguishes them from the fresh samples. We present preliminary data using cfDNA-fragmentation patterns, to uniquely distinguish between AF samples of pregnant women with regard to aneuploidy and storage time, independent of gestational age and initial DNA amount. In addition to potential applications in prenatal diagnosis, these data suggest that archived AF samples consist of large amounts of short cfDNA fragments, which are undetectable using standard real-time polymerase chain reaction amplification.

  11. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  12. Dimerization of the Klenow fragment of Escherichia coli DNA polymerase I is linked to its mode of DNA binding.

    Science.gov (United States)

    Bailey, Michael F; Van der Schans, Edwin J C; Millar, David P

    2007-07-10

    Upon associating with a proofreading polymerase, the nascent 3' end of a DNA primer/template has two possible fates. Depending upon its suitability as a substrate for template-directed extension or postsynthetic repair, it will bind either to the 5'-3' polymerase active site, yielding a polymerizing complex, or to the 3'-5' exonuclease site, yielding an editing complex. In this investigation, we use a combination of biochemical and biophysical techniques to probe the stoichiometry, thermodynamic, and kinetic stability of the polymerizing and editing complexes. We use the Klenow fragment of Escherichia coli DNA polymerase I (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA substrates. Polymerizing complexes are produced by mixing KF with correctly base paired (matched) primer/templates, whereas editing complexes are produced by mixing KF with multiply mismatched primer/templates. Electrophoretic mobility shift titrations carried out with matched and multiply mismatched primer/templates give rise to markedly different electrophoretic patterns. In the case of the matched primer/template, the KF.DNA complex is represented by a slow moving band. However, in the case of the multiply mismatched primer/template, the complex is predominantly represented by a fast moving band. Analytical ultracentrifugation measurements indicate that the fast and slow moving bands correspond to 1:1 and 2:1 KF.DNA complexes, respectively. Fluorescence anisotropy titrations reveal that KF binds with a higher degree of cooperativity to the matched primer/template. Taken together, these results indicate that KF is able to dimerize on a DNA primer/template and that dimerization is favored when the first molecule is bound in the polymerizing mode, but disfavored when it is bound in the editing mode. We suggest that self-association of the polymerase may play an important and as yet unexplored role in coordinating high-fidelity DNA replication.

  13. Fragmentation of bacteriophage S13 replicative from DNA by restriction endonucleases from Hemophilus influenzae and Hemophilus aegyptius.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); K.M. Ojamaa; J.H. Spencer

    1976-01-01

    textabstractThe restriction enzymes Hind from Hemophilus influenzae and HaeIII from Hemophilus aegyptius cleave bacteriophage S13 replicative form (RF) DNA into 13 and 10 specific fragments, respectively. The sizes of these fragments were estimated by gel electrophoresis, electron microscopy, and

  14. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  15. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  16. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  17. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  18. Halal authenticity of gelatin using species-specific PCR.

    Science.gov (United States)

    Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

    2015-10-01

    Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  20. Melting profiles may affect detection of residual HPV L1 gene DNA fragments in Gardasil®.

    Science.gov (United States)

    Lee, Sin Hang

    2014-03-01

    Gardasil® is a quadrivalent human papillomavirus (HPV) protein-based vaccine containing genotype-specific L1 capsid proteins of HPV-16, HPV-18, HPV-6 and HPV-11 in the form of virus-like-particles (VLPs) as the active ingredient. The VLPs are produced by a DNA recombinant technology. It is uncertain if the residual HPV L1 gene DNA fragments in the vaccine products are considered contaminants or excipients of the Gardasil® vaccine. Because naked viral DNA fragments, if present in the vaccine, may bind to the insoluble amorphous aluminum hydroxyphosphate sulfate (AAHS) adjuvant which may help deliver the foreign DNA into macrophages, causing unintended pathophysiologic effects, experiments were undertaken to develop tests for HPV L1 gene DNA fragments in the final products of Gardasil® by polymerase chain reaction (PCR) and direct DNA sequencing. The results showed that while the HPV-11 and HPV-18 L1 gene DNA fragments in Gardasil® were readily amplified by the common GP6/MY11 degenerate consensus primers, the HPV-16 L1 gene DNA may need specially designed non-degenerate PCR primers for amplification at different regions of the L1 gene and different stringency conditions for detection. These variable melting profiles of HPV DNA in the insoluble fraction of the Gardasil® vaccine suggest that the HPV DNA fragments are firmly bound to the aluminum AAHS adjuvant. All methods developed for detecting residual HPV DNA in the vaccine Gardasil® for quality assurance must take into consideration the variable melting profiles of the DNA to avoid false negative results.

  1. Analysis of DNA from post-blast pipe bomb fragments for identification and determination of ancestry.

    Science.gov (United States)

    Tasker, Esiri; LaRue, Bobby; Beherec, Charity; Gangitano, David; Hughes-Stamm, Sheree

    2017-05-01

    Improvised explosive devices (IEDs) such as pipe bombs are weapons used to detrimentally affect people and communities. A readily accessible brand of exploding targets called Tannerite® has been identified as a potential material for abuse as an explosive in pipe bombs. The ability to recover and genotype DNA from such weapons may be vital in the effort to identify suspects associated with these devices. While it is possible to recover DNA from post-blast fragments using short tandem repeat markers (STRs), genotyping success can be negatively affected by low quantities of DNA, degradation, and/or PCR inhibitors. Alternative markers such as insertion/null (INNULs) and single nucleotide polymorphisms (SNPs) are bi-allelic genetic markers that are shorter genomic targets than STRs for amplification, which are more likely to resist degradation. In this study, we constructed pipe bombs that were spiked with known amounts of biological material to: 1) recover "touch" DNA from the surface of the device, and 2) recover traces of blood from the ends of wires (simulated finger prick). The bombs were detonated with the binary explosive Tannerite® using double-base smokeless powder to initiate the reaction. DNA extracted from the post-blast fragments was quantified with the Quantifiler® Trio DNA Quantification Kit. STR analysis was conducted using the GlobalFiler® Amplification Kit, INNULs were amplified using an early-access version of the InnoTyper™ 21 Kit, and SNP analysis via massively parallel sequencing (MPS) was performed using the HID-Ion Ampliseq™ Identity and Ancestry panels using the Ion Chef and Ion PGM sequencing system. The results of this study showed that INNUL markers resulted in the most complete genetic profiles when compared to STR and SNP profiles. The random match probabilities calculated for samples using INNULs were lower than with STRs when less than 14 STR alleles were reported. These results suggest that INNUL analysis may be well suited for

  2. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  3. Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.

    Science.gov (United States)

    Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

    2014-11-01

    Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 μg/μL and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  5. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. In vivo assembly of DNA-fragments in the moss, Physcomitrella patens

    DEFF Research Database (Denmark)

    King, Brian Christopher; Vavitsas, Konstantinos; Ikram, Nur Kusaira Binti Khairul

    2016-01-01

    enabled the complete replacement of eukaryotic chromosomes with heterologous DNA. The moss Physcomitrella patens, a non-vascular and spore producing land plant (Bryophyte), has a well-established capacity for homologous recombination. Here, we demonstrate the in vivo assembly of multiple DNA fragments...

  7. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  8. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...

  9. Nested PCRs and sequencing of nuclear ITS-rDNA fragments detect three Leishmania species of gerbils in sandflies from Iranian foci of zoonotic cutaneous leishmaniasis.

    Science.gov (United States)

    Parvizi, P; Ready, P D

    2008-09-01

    To identify and understand the natural transmission cycles of Leishmania in Iranian sandflies. Nested PCR protocols were developed to amplify two regions of the ribosomal RNA amplicon of Leishmania (ITS1-5.8S rRNA gene, and a microsatellite DNA region of ITS2), which were species-specific by DNA sequence or fragment size. The PCR assays detected in Iranian sandflies not only Leishmania major but also for the first time L. turanica and L. gerbilli sensu lato, two other parasites of the great gerbil. All three parasites were found in the northeast and centre of Iran, in two foci of rural Zoonotic Cutaneous Leishmaniasis (ZCL) caused by L. major. Fifty infections were detected in common sandfly species: at least six geographically differentiated haplotypes of L. major in four to five sandfly species; one strain of L. gerbilli s.l. in five to six sandfly species and one strain of L. turanica in one sandfly species. Past conclusions about the transmission cycles of L. major in Iran should be treated with caution. Careful molecular eco-epidemiological investigations are essential for modelling the roles of different sandfly species in maintaining and spreading ZCL foci. Even if non-pathogenic to humans, frequent inoculations of L. turanica by sandflies might alter the efficacy of vaccines against L. major. Phlebotomus papatasi is probably the key vector in many ZCL foci because of its abundance and high infection rates with both L. major and L. turanica.

  10. Species-specific beaked whale echolocation signals.

    Science.gov (United States)

    Baumann-Pickering, Simone; McDonald, Mark A; Simonis, Anne E; Solsona Berga, Alba; Merkens, Karlina P B; Oleson, Erin M; Roch, Marie A; Wiggins, Sean M; Rankin, Shannon; Yack, Tina M; Hildebrand, John A

    2013-09-01

    Beaked whale echolocation signals are mostly frequency-modulated (FM) upsweep pulses and appear to be species specific. Evolutionary processes of niche separation may have driven differentiation of beaked whale signals used for spatial orientation and foraging. FM pulses of eight species of beaked whales were identified, as well as five distinct pulse types of unknown species, but presumed to be from beaked whales. Current evidence suggests these five distinct but unidentified FM pulse types are also species-specific and are each produced by a separate species. There may be a relationship between adult body length and center frequency with smaller whales producing higher frequency signals. This could be due to anatomical and physiological restraints or it could be an evolutionary adaption for detection of smaller prey for smaller whales with higher resolution using higher frequencies. The disadvantage of higher frequencies is a shorter detection range. Whales echolocating with the highest frequencies, or broadband, likely lower source level signals also use a higher repetition rate, which might compensate for the shorter detection range. Habitat modeling with acoustic detections should give further insights into how niches and prey may have shaped species-specific FM pulse types.

  11. Sperm DNA fragmentation and mitochondrial membrane potential combined are better for predicting natural conception than standard sperm parameters.

    Science.gov (United States)

    Malić Vončina, Slađana; Golob, Barbara; Ihan, Alojz; Kopitar, Andreja Nataša; Kolbezen, Mojca; Zorn, Branko

    2016-03-01

    To evaluate whether DNA fragmentation and/or mitochondrial membrane potential (MMP) predict natural conception better than standard sperm parameters. Prospective cross-sectional study. University medical center. Eighty-five infertile and 51 fertile men. Assessment of sperm DNA fragmentation, MMP, and standard semen parameters over a 6- to 12-month observation period. Comparison between the results of DNA fragmentation, MMP, and standard sperm parameters alone or combined and achievement of natural conception. Twenty-six of the 85 (31%) men from infertile couples conceived naturally. The median values of DNA fragmentation and MMP in the men who conceived within the observation period were similar to those in the fertile controls. Optimal threshold values of DNA fragmentation and MMP were 25% as determined by receiver operating characteristic analysis (area under the curve [AUC], 0.70; 95% confidence interval (CI) 0.58-0.82) and 62.5% (AUC, 0.68, 95% CI 0.56-0.80), respectively. The men in the infertile group with values of DNA fragmentation ≤25% and with MMP values ≥62.5% had significantly higher odds for conception (odds ratio [OR], 5.22; 95% CI 1.82-14.93] and OR, 4.67; 95% CI 1.74-12.5, respectively). Normal semen analysis alone had no predictive value for natural conception (OR, 1.84; 95% CI 0.67-5.07]). Both sperm function tests combined had significant odds for natural conception (OR, 8.24; 95% CI 2.91-23.33]), with a probability of 0.607 (60.7%) for both normal values and 0.158 (15.8%) for abnormal values. Sperm DNA fragmentation and MMP combined may be superior to standard semen parameters for the prediction of natural conception. Copyright © 2016. Published by Elsevier Inc.

  12. Sex determination in highly fragmented human DNA by high-resolution melting (HRM analysis.

    Directory of Open Access Journals (Sweden)

    Brenda A Álvarez-Sandoval

    Full Text Available Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM. HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  13. Sex determination in highly fragmented human DNA by high-resolution melting (HRM) analysis.

    Science.gov (United States)

    Álvarez-Sandoval, Brenda A; Manzanilla, Linda R; Montiel, Rafael

    2014-01-01

    Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp) of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM). HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  14. Correlation between sperm DNA fragmentation index and CMA3 positive spermatozoa in globozoospermic patients.

    Science.gov (United States)

    Hosseinifar, H; Yazdanikhah, S; Modarresi, T; Totonchi, M; Sadighi Gilani, M A; Sabbaghian, M

    2015-05-01

    The absence of the acrosome causes the situation which is called globozoospermia. There are a few studies, mostly as case reports, about correlation between levels of sperm DNA damage in patients with total round-headed spermatozoa. We investigated this correlation as well as CMA3 positive spermatozoa in 20 globozoospermic men (with more than 90% round-headed spermatozoa) attending to Royan Institute. Semen samples divided into three parts to semen analysis, to measure DNA fragmentation index (DFI) using sperm chromatin structure assay (SCSA) and to detect CMA3(+) sperm cells by chromomycin A3 staining and fluorescent microscopy. Our results showed that there were significant differences in sperm concentration, total sperm motility, and normal morphology between patients and controls group (p spermatozoa in patients group significantly increases compared with control group (p spermatozoa with round head sperm cells in total globozoospermic men. It seems that the increase in DNA damage may be because of defective sperm DNA compaction, as we detected CMA3 positive sperm cells in these patients. © 2015 American Society of Andrology and European Academy of Andrology.

  15. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  16. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  17. Single-cell pulsed-field gel electrophoresis to detect the early stage of DNA fragmentation in human sperm nuclei.

    Directory of Open Access Journals (Sweden)

    Satoru Kaneko

    Full Text Available Single-cell pulsed-field gel electrophoresis (SCPFGE with dual electrode pairs was developed to detect the early stage of DNA fragmentation in human sperm. The motile sperm were purified by the commonly used density-gradient centrifugation technique and subsequent swim-up. The sperm were embedded in a thin film of agarose containing bovine trypsin (20 µg/mL and were then lysed. Prior to SCPFGE, proteolysis of DNA-binding components, such as protamine and the nuclear matrix was essential to separate the long chain fibers from the fibrous and granular fragments derived from a single nucleus. The overall electrophoretic profiles elucidated the course of DNA fragmentation. A few large fibrous fragments were observed at the beginning of the process, however, as the fragmentation advanced, the long chain fibers decreased and shortened, and, conversely, the granular fragments increased until finally almost all the DNA was shredded. Although the ejaculate contained sperm with heterogeneous stages, the purified motile sperm exhibited several dozens of uniformly elongated fibers arising from the tangled DNA at the origin, whereas a part of these fibers gave rise to fibrous fragments beyond the tip of the elongated fibers, and their numbers and sizes varied among the sperm. Conventional intra-cytoplasmic sperm injection (ICSI usually depends on intra-operative light microscopic observation to select a sperm for injection. The present results revealed that sperm motility could not give full assurance of DNA integrity. SCPFGE is likely to serve an important role in the preoperative differential diagnosis to determine the competence of the sperm population provided for injection.

  18. Phenotypic changes in Cyprinus carpiovar var. Jian introduced by sperm-mediated transgenesis of rearranged homologous DNA fragments.

    Science.gov (United States)

    Cao, Zheming; Ding, Weidong; Ren, Hongtao

    2013-09-01

    Common carp, specifically the Jian variety (Cyprinus carpiovar var. Jian), is an important Chinese and global aquatic stock for commercial foodstuff. Homologous recombination of carp gene sequences has been widely used in population genetics to broadly screen for beneficial phenotypical variations, thus optimizing artificially engineered carp stocks with Jian variety and native stock varieties. Random rearrangement of homologous DNA fragments from parent specimens of C. carpiovar var. Jian were attained by digestion of genomic DNA with MspI followed by religation and redigestion with EcoR I to specifically rearrange homologous DNA fragments of myostatin and microsatellite genes. Based on known characteristics of myostatin gene function, growth pattern changes in resultant carp mutant varieties was expected. DNA fragments were introduced into metaphase-II oocytes, resulting in one to several dozen insertions of homologous fragments into the host genome by sperm-mediated transgenesis. Introduction of rearranged homologous DNA fragments often resulted in phenotypic changes in C. carpiovar var. Jian, including significant phenotypic changes linked to growth rate at 4 months.

  19. Illumina sequencing of bacterial 16S rDNA and 16S rRNA reveals seasonal and species-specific variation in bacterial communities in four moss species.

    Science.gov (United States)

    Ma, Jing; Tang, Jing Yan; Wang, Su; Chen, Zhi Ling; Li, Xue Dong; Li, Yan Hong

    2017-09-01

    In order to better understand the factors that influence bacterial diversity and community composition in moss-associated bacteria, a study of bacterial communities in four moss species collected in three seasons was carried out via high-throughput sequencing of 16S rDNA and 16S rRNA. Moss species included Cratoneuron filicinum, Pylaisiella polyantha, Campyliadelphus polygamum, and Grimmia pilifera, with samples collected in May, July, and October 2015 from rocks at Beijing Songshan National Nature Reserve. In total, the bacterial richness and diversity were high regardless of moss species, sampling season, or data source (DNA vs. RNA). Bacterial sequences were assigned to a total of 558 OTUs and 279 genera in 16 phyla. Proteobacteria and Actinobacteria were the two most abundant phyla, and Cellvibrio, Lapillicoccus, Jatrophihabitans, Friedmanniella, Oligoflexus, and Bosea the most common genera in the samples. A clustering algorithm and principal coordinate analysis revealed that C. filicinum and C. polygamum had similar bacterial communities, as did P. polyantha and G. pilifera. Metabolically active bacteria showed the same pattern in addition to seasonal variation: bacterial communities were most similar in summer and autumn, looking at each moss species separately. In contrast, DNA profiles lacked obvious seasonal dynamics. A partial least squares discriminant analysis identified three groups of samples that correlated with differences in moss species resources. Although bacterial community composition did vary with the sampling season and data source, these were not the most important factors influencing bacterial communities. Previous reports exhibited that mosses have been widely used in biomonitoring of air pollution by enriching some substances or elements in the moss-tag technique and the abundant moss associated bacteria might also be important components involved in the related biological processes. Thus, this survey not only enhanced our understanding

  20. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  1. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  2. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  3. Colloidal centrifugation of stallion semen results in a reduced rate of sperm DNA fragmentation.

    Science.gov (United States)

    Crespo, F; Gosalvez, J; Gutiérrez-Cepeda, L; Serres, C; Johnston, S D

    2013-04-01

    Stallion spermatozoa recovered and examined immediately after colloidal centrifugation resulted in a higher straight-line velocity (VSL) than sperm processed using direct conventional centrifugation (p = 0.000), but there was no differences in the progressive motility or sperm DNA fragmentation (SDF) as determined by the sperm chromatin dispersion assay. However, when centrifuged spermatozoa were incubated at 37 °C for 24 h to determine the rate of SDF (r-SDF), a lower r-SDF (p = 0.0011) was observed in those sperm recovered after colloidal separation (0.5 ± 0.1%/h) compared to direct (1.2 ± 0.4%/h) or no centrifugation (r-SDF = 1.2 ± 0.3%/h). These results confirm that colloidal separation of stallion spermatozoa results in prolonged sperm DNA longevity, but these differences were only apparent following a period of incubation and dynamic assessment. Consequently, we strongly recommend the use of the dynamic form of the SDF assay for evaluating centrifugation and/or other ex vivo procedures, as a single basal assessment of SDF may inadvertently result in a false-positive evaluation of DNA quality. © 2012 Blackwell Verlag GmbH.

  4. Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

    Science.gov (United States)

    Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

    2014-01-01

    Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

  5. Fluorescent SSCP of overlapping fragments (FSSCP-OF): a highly sensitive method for the screening of mitochondrial DNA variation

    DEFF Research Database (Denmark)

    Salas, A; Rasmussen, Erik Michael; Lareu, M V

    2001-01-01

    The mtDNA analysis (mtDNA) is increasingly being demanded for forensic purposes due to the fact that many times the use of standard nuclear marker fails to analyze degraded samples (such as bones) and specially for the analysis of hair shafts (a common sample in the crime scene). However, analysis...... conformation polymorphism (SSCP) of overlapping fragments (FSSCP-OF). FSSCP-OF is based on the basic theory of SSCP analysis and combines two complementary strategies: the use of PCR amplified overlapping fragments and fluorescent detection technology. The overlap region contains a high percentage (50...... fragments. The use of multicolor fluorescent technology allows also the multiplex amplification of overlapping fragment and its subsequent analysis in an automatic sequencer. We have analyzed 50 samples of unrelated individuals through the FSSCP-OF technique and we have found that using this methodology...

  6. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  7. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  8. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  9. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  10. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2017-06-01

    Full Text Available Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata that are processed into one of the most valued traditional Chinese medicines (TCM. The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  11. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  12. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  13. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  14. The Society for Translational Medicine: clinical practice guidelines for sperm DNA fragmentation testing in male infertility

    Science.gov (United States)

    Cho, Chak-Lam; Majzoub, Ahmad; Esteves, Sandro C.

    2017-01-01

    Sperm DNA fragmentation (SDF) testing has been emerging as a valuable tool for male fertility evaluation. While the essential role of sperm DNA integrity in human reproduction was extensively studied, the clinical indication of SDF testing is less clear. This clinical practice guideline provides recommendations of clinical utility of the test supported by evidence. It is intended to serve as a reference for fertility specialists in identifying the circumstances in which SDF testing should be of greatest clinical value. SDF testing is recommended in patients with clinical varicocele and borderline to normal semen parameters as it can better select varicocelectomy candidates. Outcomes of natural pregnancy and assisted reproductive techniques (ART) can be predicted by result of SDF tests. High SDF is also linked with recurrent pregnancy loss (RPL) and failure of ART. Result of SDF testing may change the management decision by selecting the most appropriate ART with the highest success rate for infertile couples. Several studies have demonstrated the benefit in using testicular instead of ejaculated sperm in men with high SDF, oligozoospermia or recurrent in vitro fertilization (IVF) failure. Infertile men with modifiable lifestyle factor may benefit from SDF testing by reinforcing risk factor modification and monitoring patient’s progress to intervention. PMID:29082206

  15. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  17. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  18. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  19. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Autophagic degradation of dBruce controls DNA fragmentation in nurse cells during late Drosophila melanogaster oogenesis

    Science.gov (United States)

    Shravage, Bhupendra V.; Sagona, Antonia P.; Lamark, Trond; Bjørkøy, Geir; Johansen, Terje; Rusten, Tor Erik; Brech, Andreas; Baehrecke, Eric H.

    2010-01-01

    Autophagy is an evolutionarily conserved pathway responsible for degradation of cytoplasmic material via the lysosome. Although autophagy has been reported to contribute to cell death, the underlying mechanisms remain largely unknown. In this study, we show that autophagy controls DNA fragmentation during late oogenesis in Drosophila melanogaster. Inhibition of autophagy by genetically removing the function of the autophagy genes atg1, atg13, and vps34 resulted in late stage egg chambers that contained persisting nurse cell nuclei without fragmented DNA and attenuation of caspase-3 cleavage. The Drosophila inhibitor of apoptosis (IAP) dBruce was found to colocalize with the autophagic marker GFP-Atg8a and accumulated in autophagy mutants. Nurse cells lacking Atg1 or Vps34 in addition to dBruce contained persisting nurse cell nuclei with fragmented DNA. This indicates that autophagic degradation of dBruce controls DNA fragmentation in nurse cells. Our results reveal autophagic degradation of an IAP as a novel mechanism of triggering cell death and thereby provide a mechanistic link between autophagy and cell death. PMID:20713604

  2. Optimized quantification of fragmented, free circulating DNA in human blood plasma using a calibrated duplex real-time PCR.

    Directory of Open Access Journals (Sweden)

    Martin Horlitz

    Full Text Available BACKGROUND: Duplex real-time PCR assays have been widely used to determine amounts and concentrations of free circulating DNA in human blood plasma samples. Circulatory plasma DNA is highly fragmented and hence a PCR-based determination of DNA concentration may be affected by the limited availability of full-length targets in the DNA sample. This leads to inaccuracies when counting PCR target copy numbers as whole genome equivalents. METHODOLOGY/PRINCIPAL FINDINGS: A model system was designed allowing for assessment of bias in a duplex real-time PCR research assay. We collected blood plasma samples from male donors in pools of 6 to 8 individuals. Circulatory plasma DNA was extracted and separated by agarose gel electrophoresis. Separated DNA was recovered from the gel in discrete size fractions and analyzed with different duplex real-time PCR Taqman assays detecting a Y chromosome-specific target and an autosomal target. The real-time PCR research assays used differed significantly in their ability to determine the correct copy number ratio of 0.5 between Y chromosome and autosome targets in DNA of male origin. Longer PCR targets did not amplify quantitatively in circulatory DNA, due to limited presence of full-length target sequence in the sample. CONCLUSIONS: PCR targets of the same small size are preferred over longer targets when comparing fractional circulatory DNA concentrations by real-time PCR. As an example, a DYS14/18S duplex real-time PCR research assay is presented that correctly measures the fractional concentration of male DNA in a male/female mixture of circulatory, fragmented DNA.

  3. Mitochondrial DNA diversity and population structure of a forest-dependent rodent, Praomys taitae (Rodentia: Muridae) Heller 1911, in the fragmented forest patches of Taita Hills, Kenya

    DEFF Research Database (Denmark)

    Nyakaana, S.; Tumusiime, C.; Oguge, N.

    2008-01-01

    The population genetic structure of the forest-dependent rodent, Praomys taitae, sampled from nine indigenous forest fragments sampled from nine indigenous forest fragments distributed over three ranges of the Taita Hills in Kenya, was determined using mitochondrial DNA (mtDNA) control region seq...

  4. RADOM, an efficient in vivo method for assembling designed DNA fragments up to 10 kb long in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lin, Qiuhui; Jia, Bin; Mitchell, Leslie A; Luo, Jingchuan; Yang, Kun; Zeller, Karen I; Zhang, Wenqian; Xu, Zhuwei; Stracquadanio, Giovanni; Bader, Joel S; Boeke, Jef D; Yuan, Ying-Jin

    2015-03-20

    We describe rapid assembly of DNA overlapping multifragments (RADOM), an improved assembly method via homologous recombination in Saccharomyces cerevisiae, which combines assembly in yeasto with blue/white screening in Escherichia coli. We show that RADOM can successfully assemble ∼3 and ∼10 kb DNA fragments that are highly similar to the yeast genome rapidly and accurately. This method was tested in the Build-A-Genome course by undergraduate students, where 125 ∼3 kb "minichunks" from the synthetic yeast genome project Sc2.0 were assembled. Here, 122 out of 125 minichunks achieved insertions with correct sizes, and 102 minichunks were sequenced verified. As this method reduces the time-consuming and labor-intensive efforts of yeast assembly by improving the screening efficiency for correct assemblies, it may find routine applications in the construction of DNA fragments, especially in hierarchical assembly projects.

  5. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  6. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  7. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  8. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  9. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  10. Genotyping the hepatitis B virus with a fragment of the HBV DNA polymerase gene in Shenyang, China

    Directory of Open Access Journals (Sweden)

    Juan Feng

    2011-06-01

    Full Text Available Abstract The hepatitis B virus (HBV has been classified into eight genotypes (A-H based on intergenotypic divergence of at least 8% in the complete nucleotide sequence or more than 4% in the S gene. To facilitate the investigation of the relationship between the efficacy of drug treatment and the mutation with specific genotype of HBV, we have established a new genotyping strategy based on a fragment of the HBV DNA polymerase gene. Pairwise sequence and phylogenetic analyses were performed using CLUSTAL V (DNASTAR on the eight (A-H standard full-length nucleotide sequences of HBV DNA from GenBank (NCBI and the corresponding semi-nested PCR products from the HBV DNA polymerase gene. The differences in the semi-nested PCR fragments of the polymerase genes among genotypes A through F were greater than 4%, which is consistent with the intergenotypic divergence of at least 4% in HBV DNA S gene sequences. Genotyping using the semi-nested PCR products of the DNA polymerase genes revealed that only genotypes B, C, and D were present in the 50 cases, from Shenyang, China, with a distribution of 11 cases (22%, 25 cases (50%, and 14 cases (28% respectively. These results demonstrate that our new genotyping method utilizing a fragment of the HBV DNA polymerase gene is valid and can be employed as a general genotyping strategy in areas with prevalent HBV genotypes A through F. In Shenyang, China, genotypes C, B, and D were identified with this new genotyping method, and genotype C was demonstrated to be the dominant genotype.

  11. ABNORMAL CHROMATIN CONDENSATION IN SPERMATOZOA AND DNA FRAGMENTATION IN SPERMATOZOA: IS THERE A CORRELATION?

    Directory of Open Access Journals (Sweden)

    E. E. Bragina

    2017-01-01

    Full Text Available Introduction. In the last decade, an understanding of the two-fold nature of genetic apparatus damage in spermatozoa has emerged: abnormal chromatin condensation (“immature” chromatin, ICH related to defective protaminization and leading to altered epigenetic regulation of the early embryogenesis, and disruption of DNA integrity, i. e. DNA fragmentation (DFS.Objective. Study of the correlation between abnormal chromatin condensation in spermatozoa and DFS.Materials and methods. The study included spermatozoa of 54 fertile males (1st group, control, 46 patients with primary infertility (2nd group, and 111 patients whose wives had a history of pregnancy abnormalities or failures of the assisted reproductive technology (ART, i. e. arrested embryonic development (3rd group. Presence of ICH was identified by quantitative electron microscopy, presence of DFS by TUNEL. Study of ICH and DFS in the same spermatozoon was conducted using correlation microscopy (TUNEL with subsequent ultrastructural analysis of the labeled cells.Results. The number of ICH spermatozoa significantly differed in the 3rd group from the control group (29.26 ± 13.49 vs. 22.43 ± 9.54; p = 0.006. The number of ICH spermatozoa in the 2nd group was higher than in the control group, but the difference wasn’t statistically significant (p = 0.061. A significant difference in the number of spermatozoa with residual cytoplasm on the head was observed between the fertile group and 2nd and 3rd groups (p = 0.0001 and p = 0.0006, respectively and on the neck (p = 0.0002 and p = 0.0003, respectively. Number of DFS spermatozoa in the second group significantly differed from the control (21.40 ± 11.88 vs. 13.70 ± 7.00, p = 0.03, but this difference wasn’t observed for the 3rd group. A very weak correlation between the number of DFS and ICH spermatozoa was observed in all three groups (r = 0.18, r = 0.33, and r = 0.01, respectively. Forty-six (46 spermatozoa were studied using

  12. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  13. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  14. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  15. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  16. Effects of chronic buproprion and nicotine administration on cell genesis and DNA fragmentation in adult rat dentate gyrus

    OpenAIRE

    Scerri, Charles;

    2006-01-01

    Previous experiments have shown that chronic subcutaneous administration of nicotine dose-dependently inhibits the acquisition and retention of a spatial task in the Morris water maze and reduces cell genesis in the dentate gyrus (DG) of adult rats.1 In the present study, the effects of nicotine and buproprion, an atypical antidepressant used in smoking cessation, on dentate gyrus cell genesis and DNA fragmentation were investigated. The results show that nicotine, chronically infused for 21 ...

  17. Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus.

    Science.gov (United States)

    Passinho-Soares, Helna; Felix, Durvalina; Kaplan, Maria Auxiliadora; Margis-Pinheiro, Marcia; Margis, Rogério

    2006-08-01

    In Brazil, Plectranthus species are known as "boldo" and have been used in popular medicine for analgesic and dyspeptic purposes. Plectranthus need to be well identified in order to be used as commercially genuine medicinal plants. Here we describe AFLP DNA patterns able to distinguish among different Pectranthus species. The genetic variability of P. grandis Cramer, P. barbatus Andr. and P. ornatus Codd was analyzed with two sets of AFLP primers allowing detection of 241 loci. A total of 22 monomorphic loci were identified in P. barbatus, 15 in P. grandis and 30 in P. ornatus. Among these, 5 loci were informative and species-specific to P. barbatus, 3 to P. grandis and 2 loci were unique to P. ornatus. The AFLP pattern analyzed by different clustering methods assembled individuals according to their species. So far, AFLP represents a genuine and strong method to certify medicinal plant materials.

  18. Use of laptop computers connected to internet through Wi-Fi decreases human sperm motility and increases sperm DNA fragmentation.

    Science.gov (United States)

    Avendaño, Conrado; Mata, Ariela; Sanchez Sarmiento, César A; Doncel, Gustavo F

    2012-01-01

    To evaluate the effects of laptop computers connected to local area networks wirelessly (Wi-Fi) on human spermatozoa. Prospective in vitro study. Center for reproductive medicine. Semen samples from 29 healthy donors. Motile sperm were selected by swim up. Each sperm suspension was divided into two aliquots. One sperm aliquot (experimental) from each patient was exposed to an internet-connected laptop by Wi-Fi for 4 hours, whereas the second aliquot (unexposed) was used as control, incubated under identical conditions without being exposed to the laptop. Evaluation of sperm motility, viability, and DNA fragmentation. Donor sperm samples, mostly normozoospermic, exposed ex vivo during 4 hours to a wireless internet-connected laptop showed a significant decrease in progressive sperm motility and an increase in sperm DNA fragmentation. Levels of dead sperm showed no significant differences between the two groups. To our knowledge, this is the first study to evaluate the direct impact of laptop use on human spermatozoa. Ex vivo exposure of human spermatozoa to a wireless internet-connected laptop decreased motility and induced DNA fragmentation by a nonthermal effect. We speculate that keeping a laptop connected wirelessly to the internet on the lap near the testes may result in decreased male fertility. Further in vitro and in vivo studies are needed to prove this contention. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  19. In Vitro Effect of Cell Phone Radiation on Motility, DNA Fragmentation and Clusterin Gene Expression in Human Sperm

    Directory of Open Access Journals (Sweden)

    Adel Zalata

    2015-04-01

    Full Text Available Background: Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU gene expression. Materials and Methods: In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26, ii. asthenozoospermia (A, n=32, iii. asthenoteratozoospermia (AT, n=31 and iv. oligoasthenoteratozoospermia (OAT, n=35. The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where pAT>A>N groups, respectively (p<0.05. Conclusion: Cell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  20. In vitro effect of cell phone radiation on motility, DNA fragmentation and clusterin gene expression in human sperm.

    Science.gov (United States)

    Zalata, Adel; El-Samanoudy, Ayman Z; Shaalan, Dalia; El-Baiomy, Youssef; Mostafa, Taymour

    2015-01-01

    Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF) has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU) gene expression. In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26), ii. asthenozoospermia (A, n=32), iii. asthenoteratozoospermia (AT, n=31) and iv. oligoasthenoteratozoospermia (OAT, n=35). The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where pAT>A>N groups, respectively (pCell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  1. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  2. Rapid diagnosis of the economically important fruit fly, Bactrocera correcta (Diptera: Tephritidae) based on a species-specific barcoding cytochrome oxidase I marker.

    Science.gov (United States)

    Jiang, F; Li, Z H; Deng, Y L; Wu, J J; Liu, R S; Buahom, N

    2013-06-01

    The guava fruit fly, Bactrocera correcta (Bezzi) (Diptera: Tephritidae), is an invasive pest of fruit and vegetable crops that primarily inhabits Southeast Asia and which has the potential to become a major threat within both the Oriental and Australian oceanic regions as well as California and Florida. In light of the threat posed, it is important to develop a rapid, accurate and reliable method to identify B. correcta in quarantine work in order to provide an early warning to prevent its widespread invasion. In the present study, we describe a species-specific polymerase chain reaction assay for the diagnosis of B. correcta using mitochondrial DNA cytochrome oxidase I (mtDNA COI) barcoding genes. A B. correcta-specific primer pair was designed according to variations in the mtDNA COI barcode sequences among 14 fruit fly species. The specificity and sensitivity of the B. correcta-specific primer pair was tested based on the presence or absence of a band in the gel profile. A pair of species-specific B. correcta primers was successfully designed and named BCOR-F/BCOR-R. An ∼280 bp fragment was amplified from specimens belonging to 17 geographical populations and four life stages of B. correcta, while no such diagnostic bands were present in any of the 14 other related fruit fly species examined. Sensitivity test results demonstrated that successful amplification can be obtained with as little as 1 ng μl⁻¹ of template DNA. The species-specific PCR analysis was able to successfully diagnose B. correcta, even in immature life stages, and from adult body parts. This method proved to be a robust single-step molecular technique for the diagnosis of B. correcta with respect to potential plant quarantine.

  3. Influence of thickness of alkyl-silane coupling agent coating on separation of small DNA fragments in capillary gel electrophoresis

    Science.gov (United States)

    Nakazumi, T.; Hara, Y.

    2017-09-01

    To simplify the process of coating capillaries with fused silica, we herein set out to develop a one-step procedure for coating capillaries to prevent electro-osmotic flow (EOF) during the separation of small DNA fragments. We selected a short capillary (total length = 15 cm; effective length = 7.5 cm) for use in a compact capillary gel electrophoresis (CGE) system. To develop a one-step coating procedure, we employed alkyltrimethoxysilane agents because they are cheap and can be easily acquired, in contrast to polyethylene glycol (PEG) silane coupling agents. We examined a 100-bp DNA Ladder sample using fused silica capillaries, which were coated with alkyltrimethoxysilane agents of five different molecular lengths (C4, C6, C8, C12, and C16). We found that a fused-silica capillary with C8 alkyltrimethoxysilane is optimal for separating small DNA samples.

  4. Phosphorylation regulates proteasomal-mediated degradation and solubility of TAR DNA binding protein-43 C-terminal fragments

    Directory of Open Access Journals (Sweden)

    Zhang Yong-Jie

    2010-08-01

    Full Text Available Abstract Background Inclusions of TAR DNA binding protein-43 (TDP-43 are the defining histopathological feature of several neurodegenerative diseases collectively referred to as TDP-43 proteinopathies. These diseases are characterized by the presence of cellular aggregates composed of abnormally phosphorylated, N-terminally truncated and ubiquitinated TDP-43 in the spinal cord and/or brain. Recent studies indicate that C-terminal fragments of TDP-43 are aggregation-prone and induce cytotoxicity. However, little is known regarding the pathways responsible for the degradation of these fragments and how their phosphorylation contributes to the pathogenesis of disease. Results Herein, we established a human neuroblastoma cell line (M17D3 that conditionally expresses an enhanced green fluorescent protein (GFP-tagged caspase-cleaved C-terminal TDP-43 fragment (GFP-TDP220-414. We report that expression of this fragment within cells leads to a time-dependent formation of inclusions that are immunoreactive for both ubiquitin and phosphorylated TDP-43, thus recapitulating pathological hallmarks of TDP-43 proteinopathies. Phosphorylation of GFP-TDP220-414 renders it resistant to degradation and enhances its accumulation into insoluble aggregates. Nonetheless, GFP-TDP220-414 inclusions are reversible and can be cleared through the ubiquitin proteasome system. Moreover, both Hsp70 and Hsp90 bind to GFP-TDP220-414 and regulate its degradation. Conclusions Our data indicates that inclusions formed from TDP-43 C-terminal fragments are reversible. Given that TDP-43 inclusions have been shown to confer toxicity, our findings have important therapeutic implications and suggest that modulating the phosphorylation state of TDP-43 C-terminal fragments may be a promising therapeutic strategy to clear TDP-43 inclusions.

  5. Assessment of sperm DNA fragmentation in stallion (Equus caballus) and donkey (Equus asinus) using the sperm chromatin dispersion test.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Crespo, F; Serres-Dalmau, C; Gutiérrez de las Rozas, A L; Dávila-Rodríguez, M I; López-Fernández, C; Gósalvez, J

    2009-10-01

    Sperm DNA fragmentation (sDF) is an important parameter to assessing sperm quality. Information about sperm quality is not available for donkeys, especially in some breeds at risk of extinction. The objectives of this research were to test the four commercial variants of sperm chromatin dispersion test (SCD; sperm Halomax test), originally developed to assess sDF in boars, bulls, rams and stallions, in order to scrutinize their applicability in the study of sDF in a donkey breed at risk of extinction (Zamorano-Leonesa), for which there is no specific test available to analyze sperm at present. Only the SCD test, originally developed for stallions, produced stable and consistent results, and was deemed suitable to assess DNA fragmentation in sperm samples from donkeys. Image analysis was used to compare differences between the SCD methodology applied to stallion and donkey semen samples processed under the same experimental conditions. The extent of SCD in the SCD test was approximately 20% lower in donkey sperm than in stallion sperm. Yet, the ratio of chromatin sperm dispersion achieved in fragmented and unfragmented nuclei did not differ significantly between species. These data suggest that a similar protein depletion treatment can cause differences in protein removal in equivalent cells from different species and that sperm chromatin may be organized differently in stallions and donkeys.

  6. [Large-scale fragmentation of dna and the death of tumor cells by the action of the binary system ascorbic acid-metallocomplexes of cobalt in vitro].

    Science.gov (United States)

    Medvedev, A I; Leshchenko, V V

    2012-01-01

    High-molecular-weight DNA fragments are the markers of the early stage of apoptosis induced in eukaryotic cells by cytotoxins of different nature. The dynamics of the development of large-scale DNA fragmentation in K-562 leukemia cells by the action of the antitumor drug, the binary system ascorbic acid--cobalt phthalocyanine within 48 h of incubation, which correspond to two periods of the doubling of cell number in growing control cultures, have been studied. It was shown that, within the first hours of incubation, hydrogen peroxide generated by the system induces the formation of DNA fragments from 2200 to 50 kbp long. Later on the cell death accompanied by a decrease in the content of fragmented DNA is observed. Within 24 h of incubation, part of fragmented DNA remains unrepaired; after 48 h of incubation, a delay or a slowed down proliferation of K-562 cells, which differ from control cells also by a high level of death and a higher content of high-molecular-weight DNA fragments, is observed.

  7. Solid Lipid Curcumin Particles Induce More DNA Fragmentation and Cell Death in Cultured Human Glioblastoma Cells than Does Natural Curcumin

    Directory of Open Access Journals (Sweden)

    Panchanan Maiti

    2017-01-01

    Full Text Available Despite recent advancements in cancer therapies, glioblastoma multiforme (GBM remains largely incurable. Curcumin (Cur, a natural polyphenol, has potent anticancer effects against several malignancies, including metastatic brain tumors. However, its limited bioavailability reduces its efficiency for treating GBM. Recently, we have shown that solid lipid Cur particles (SLCPs have greater bioavailability and brain tissue penetration. The present study compares the efficiency of cell death by Cur and/or SLCPs in cultured GBM cells derived from human (U-87MG and mouse (GL261 tissues. Several cell viability and cell death assays and marker proteins (MTT assay, annexin-V staining, TUNEL staining, comet assay, DNA gel electrophoresis, and Western blot were investigated following the treatment of Cur and/or SLCP (25 μM for 24–72 h. Relative to Cur, the use of SLCP increased cell death and DNA fragmentation, produced longer DNA tails, and induced more fragmented nuclear lobes. In addition, cultured GBM cells had increased levels of caspase-3, Bax, and p53, with decreases in Bcl2, c-Myc, and both total Akt, as well as phosphorylated Akt, when SLCP, rather Cur, was used. Our in vitro work suggests that the use of SLCP may be a promising strategy for reversing or preventing GBM growth, as compared to using Cur.

  8. DNA fragmentation in frozen sperm of Equus asinus: Zamorano-Leonés, a breed at risk of extinction.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Crespo, F; Gosálvez, A; Dávila-Rodríguez, M I; López-Fernández, C; Gósalvez, J

    2008-05-01

    The dynamics of sperm DNA fragmentation (sDF) and sperm viability were analyzed in frozen-thawed sperm samples of Equus asinus (Zamorano-Leonés), a breed at risk of extinction. Sperm DNA fragmentation was assessed using an adaptation of the sperm chromatin dispersion test developed for stallions in five different frozen samples. Sperm were thawed and incubated at different temperatures (37 degrees C, 25 degrees C, and 4 degrees C) and sDF was assessed at different times and compared. The mean sDF after thawing at the beginning of the experiment was 18.20+/-14.77% and did not differ significantly from the results of a neutral comet assay (22.0+/-19.34%). The tendency in the sDF of all donkeys indicated that sperm DNA is more sensitive to breakage when incubated at 37 degrees C than when incubated at 25 degrees C or 4 degrees C. Interestingly, the tendency was not the same when different animals were compared, and differences in sDF dynamics were established among individuals. sDF correlated negatively with sperm viability in some individuals but not in others. From a conservation perspective, sDF analysis may offer a new way to assess sperm quality in endangered breeds in order to identify and select the best semen samples for artificial reproduction purposes. In particular, we recommend for artificial insemination the use of semen samples with a slow increase in sDF with time after thawing.

  9. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval. PMID:28440264

  10. Effect of Incubation Time and Vitamin E Supplementation on Sperm Motility, Viability and DNA Fragmentation in Asthenoteratozoospermic Samples

    Directory of Open Access Journals (Sweden)

    Ali Asghar Ghafarizadeh

    2017-09-01

    Full Text Available Abstract Background: In Asthenoteratozoospermic‎ men, low motility, defected DNA and highly oxidative stress in ‎sperm ‎‎cause ‎poor‎ assisted reproductive techniques (ART outcomes. The aim of this study was to determine the effect of Vitamin E (Vit E, as a potent antioxidant, on sperm motility, viability and DNA integrity at different times of in vitro incubation (after 2, 4 and 6-h to improve asthenoteratozoospermic semen samples for ART. Materials and Methods: Asthenoteratozoospermic semen samples of 50 volunteers were collected and examined. Each sample was divided into two groups of control and vitamin E (2mM and kept in the 37 °C and 6 % CO2 for 2, 4 and 6 hours. After this incubation, sperm motility, viability and sperm DNA fragmentation (SCD were evaluated in each group. Data were analyzed using repeated measurement of ANOVA and T-test. The means were considered significantly different at p<0.05. Results:Significant decrease in total and progressive motility and viability as well as significant increase in sperm DNA damage (after 6h of incubation were found in control group vs. the control group before incubation (p<0.05. The sperm motility and viability was significantly higher in vitamin E group compared to untreated control group (p<0.05. Our results also showed that DNA fragmentation significantly was lower after 6h of vitamin E treatment (p<0.05. Conclusion: In vitro supplementation of vitamin E in asthenoteratozoospermia semen samples may protect spermatozoa from maltreatment effect of ROS during sperm sampling via keeping enzymatic and antioxidant process in optimum condition.

  11. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  12. Direct Visualization of RNA-DNA Primer Removal from Okazaki Fragments Provides Support for Flap Cleavage and Exonucleolytic Pathways in Eukaryotic Cells.

    Science.gov (United States)

    Liu, Bochao; Hu, Jiazhi; Wang, Jingna; Kong, Daochun

    2017-03-24

    During DNA replication in eukaryotic cells, short single-stranded DNA segments known as Okazaki fragments are first synthesized on the lagging strand. The Okazaki fragments originate from ∼35-nucleotide-long RNA-DNA primers. After Okazaki fragment synthesis, these primers must be removed to allow fragment joining into a continuous lagging strand. To date, the models of enzymatic machinery that removes the RNA-DNA primers have come almost exclusively from biochemical reconstitution studies and some genetic interaction assays, and there is little direct evidence to confirm these models. One obstacle to elucidating Okazaki fragment processing has been the lack of methods that can directly examine primer removal in vivo In this study, we developed an electron microscopy assay that can visualize nucleotide flap structures on DNA replication forks in fission yeast ( Schizosaccharomyces pombe ). With this assay, we first demonstrated the generation of flap structures during Okazaki fragment processing in vivo The mean and median lengths of the flaps in wild-type cells were ∼51 and ∼41 nucleotides, respectively. We also used yeast mutants to investigate the impact of deleting key DNA replication nucleases on these flap structures. Our results provided direct in vivo evidence for a previously proposed flap cleavage pathway and the critical function of Dna2 and Fen1 in cleaving these flaps. In addition, we found evidence for another previously proposed exonucleolytic pathway involving RNA-DNA primer digestion by exonucleases RNase H2 and Exo1. Taken together, our observations suggest a dual mechanism for Okazaki fragment maturation in lagging strand synthesis and establish a new strategy for interrogation of this fascinating process. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  14. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  15. Restarting and recentering genetic algorithm variations for DNA fragment assembly: The necessity of a multi-strategy approach.

    Science.gov (United States)

    Hughes, James Alexander; Houghten, Sheridan; Ashlock, Daniel

    2016-12-01

    DNA Fragment assembly - an NP-Hard problem - is one of the major steps in of DNA sequencing. Multiple strategies have been used for this problem, including greedy graph-based algorithms, deBruijn graphs, and the overlap-layout-consensus approach. This study focuses on the overlap-layout-consensus approach. Heuristics and computational intelligence methods are combined to exploit their respective benefits. These algorithm combinations were able to produce high quality results surpassing the best results obtained by a number of competitive algorithms specially designed and tuned for this problem on thirteen of sixteen popular benchmarks. This work also reinforces the necessity of using multiple search strategies as it is clearly observed that algorithm performance is dependent on problem instance; without a deeper look into many searches, top solutions could be missed entirely. Copyright © 2016. Published by Elsevier Ireland Ltd.

  16. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    Forensic Science Research and Training Center (FSRTC), Quantico, and at the Institut für Rechtsmedizin, Münster, Germany. Concordant HUMTH01 types were found in 39 out of 40 individuals. The allele which led to discrepant typing results was assigned type 9.3 in two laboratories and type 10 in one......DNA from the short tandem repeat (STR) system HUMTH01 was amplified by the polymerase chain reaction (PCR) and analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 100 unrelated Danes, 147 unrelated Greenland Eskimos, and 89 Danish mother....../child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  17. [Subcloning and sequencing of promoter active DNA fragment from Streptomyces lividans].

    Science.gov (United States)

    Jiang, H; Dong, K; Huan, L

    1994-12-01

    Random subfragments with strong promoter activities were isolated from 2. 1 kb fragment of pMG50-25 using a promoter-probe vector pIJ4083. One of the promoter-active region was narrowed down to a 220bp sequence. Putative promoter regions, SD sequence and start codons were found.

  18. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  19. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  20. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  1. Fragmentation and plasmid strand breaks in pure and gold-doped DNA irradiated by beams of fast hydrogen atoms

    Energy Technology Data Exchange (ETDEWEB)

    Wyer, J A; Latimer, C J; Shah, M B; Currell, F J [Centre for Plasma Physics, IRCEP, Queen' s University Belfast, BT7 1NN (United Kingdom); Butterworth, K T; Hirst, D G [Experimental Therapeutics Research Group, School of Pharmacy, Queen' s University Belfast, BT9 7BL (United Kingdom); Montenegro, E C [Instituto de Fisica, Universidade Federal do Rio de Janeiro, Cx. Postal 68528, Rio de Janeiro, RJ 21941-972 (Brazil)], E-mail: jeanwyer@phys.au.dk

    2009-08-07

    The results of an investigation into the damage caused to dry plasmid DNA after irradiation by fast (keV) hydrogen atoms are presented. Agarose gel electrophoresis was used to assess single and double strand break yields as a function of dose in dry DNA samples deposited on a mica substrate. Damage levels were observed to increase with beam energy. Strand break yields demonstrated a considerable dependence on sample structure and the method of sample preparation. Additionally, the effect of high-Z nanoparticles on damage levels was investigated by irradiating DNA samples containing controlled amounts of gold nanoparticles. In contrast to previous (photonic) studies, no enhancement of strand break yields was observed with the particles showing a slight radioprotective effect. A model of DNA damage as a function of dose has been constructed in terms of the probability for the creation of single and double strand breaks, per unit ion flux. This model provides quantitative conclusions about the effects of both gold nanoparticles and the different buffers used in performing the assays and, in addition, infers the proportion of multiply damaged fragments.

  2. The Effects of Melatonin on Oxidative Stress Parameters and DNA Fragmentation in Testicular Tissue of Rats Exposed to Microwave Radiation.

    Science.gov (United States)

    Sokolovic, Dusan; Djordjevic, Branka; Kocic, Gordana; Stoimenov, Tatjana J; Stanojkovic, Zoran; Sokolovic, Danka M; Veljkovic, Andrej; Ristic, Goran; Despotovic, Milena; Milisavljevic, Dusan; Jankovic, Radmilo; Binic, Ivana

    2015-01-01

    Microwaves from mobile phones are one of the environmental toxicants that are capable of compromising male fertility by inducing oxidative stress and apoptosis in the testes. Melatonin is a lipophilic tryptophan indole amine and a potent antioxidant. The aim of the study was to evaluate the effect of melatonin treatment on oxidative stress parameters and DNA fragmentation in the testicular tissue of rats exposed to microwave radiation (4 h/day). Adult Wistar rats were divided in 4 groups: I--treated with saline; II--treated with melatonin; III--exposed to microwaves; IV--exposed to microwaves and treated with melatonin. The melatonin (2 mg/kg ip) was administered daily. The animals were sacrificed after 20, 40 and 60 days. Melatonin treatment prevented previously registered increases in malondialdehyde after only 20 days. Furthermore, it reversed the effects of microwave exposure on xanthine oxidase (after 40 days) and acid-DNase activity (after 20 days). However, neither protein carbonyl content nor catalase and alkaline Dnase activity were changed due to melatonin treatment. Melatonin exerts potent antioxidant effects in the testes of rats exposed to microwaves by decreasing the intensity of oxidative stress; it also reduces DNA fragmentation.

  3. Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods.

    Science.gov (United States)

    Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc

    2004-03-01

    Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.

  4. Unusual Structures Are Present in DNA Fragments Containing Super-Long Huntingtin CAG Repeats

    Science.gov (United States)

    Duzdevich, Daniel; Li, Jinliang; Whang, Jhoon; Takahashi, Hirohide; Takeyasu, Kunio; Dryden, David T. F.; Morton, A. Jennifer; Edwardson, J. Michael

    2011-01-01

    Background In the R6/2 mouse model of Huntington's disease (HD), expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene. Methodology/Principal Findings We analysed the structure of polymerase chain reaction (PCR)-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM). As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I. Conclusions/Significance “Super-long” CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD. PMID:21347256

  5. A baculovirus alkaline nuclease knockout construct produces fragmented DNA and aberrant capsids

    International Nuclear Information System (INIS)

    Okano, Kazuhiro; Vanarsdall, Adam L.; Rohrmann, George F.

    2007-01-01

    DNA replication of bacmid-derived constructs of the Autographa californica multiple nucleocapsid nucleopolyhedrovirus (AcMNPV) was analyzed by field inversion gel electrophoresis (FIGE) in combination with digestion at a unique Eco81I restriction enzyme site. Three constructs were characterized: a parental bacmid, a bacmid deleted for the alkaline nuclease gene, and a bacmid from which the gp64 gene had been deleted. The latter was employed as a control for comparison with the alkaline nuclease knockout because neither yields infectious virus and their replication is limited to the initially transfected cells. The major difference between DNA replicated by the different constructs was the presence in the alkaline nuclease knockout of high concentrations of relatively small, subgenome length DNA in preparations not treated with Eco81I. Furthermore, upon Eco81I digestion, the alkaline nuclease knockout bacmid also yielded substantially more subgenome size DNA than the other constructs. Electron microscopic examination of cells transfected with the alkaline nuclease knockout indicated that, in addition to a limited number of normal-appearing electron-dense nucleocapsids, numerous aberrant capsid-like structures were observed indicating a defect in nucleocapsid maturation or in a DNA processing step that is necessary for encapsidation. Because of the documented role of the baculovirus alkaline nuclease and its homologs from other viruses in homologous recombination, these data suggest that DNA recombination may play a major role in the production of baculovirus genomes

  6. Pulsed field gel electrophoresis techniques for separating 1- to 50-kilobase DNA fragments.

    Science.gov (United States)

    Birren, B W; Lai, E; Hood, L; Simon, M I

    1989-03-01

    Conventional agarose gel electrophoresis separates DNA using a static electric field. The maximum size limit for separation of DNA by this method is about 20 kilobase pairs (kb). A number of new electrophoretic techniques which employ periodic reorientation of electric fields permit separation of DNA well beyond this size limit. We sought to determine whether the use of very fast (millisecond) field switching could improve separation of DNA in the size range of 1 to 50 kb. Additionally, we have compared the resolution obtained with each of the different field switching regimens for DNA in this size range. Switching intervals of from 0.2 to 900 ms were used with unidirectional pulsing of a single electric field, with pulsed field gels, and with field inversion gel electrophoresis. Plotting the mobility of DNA as a function of size demonstrates that under the conditions used, each of these techniques offers comparable resolution. We also have examined the separation obtained when field inversion gels are run with forward and reverse fields of equal voltage and different durations, versus using fields of equal duration and different voltages. Field inversion which uses forward and reverse fields of different voltages yields resolution which is superior to the other methods examined.

  7. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  8. Linker-mediated recombinational subcloning of large DNA fragments using yeast.

    Science.gov (United States)

    Raymond, Christopher K; Sims, Elizabeth H; Olson, Maynard V

    2002-01-01

    The homologous recombination pathway in yeast is an ideal tool for the sequence-specific assembly of plasmids. Complementary 80-nucleotide oligonucleotides that overlap a vector and a target fragment were found to serve as efficient recombination linkers for fragment subcloning. Using electroporation, single-stranded 80-mers were adequate for routine plasmid construction. A cycloheximide-based counterselection was introduced to increase the specificity of cloning by homologous recombination relative to nonspecific vector background. Reconstruction experiments suggest this counterselection increased cloning specificity by 100-fold. Cycloheximide counterselection was used in conjunction with 80-bp linkers to subclone targeted regions from bacterial artificial chromosomes. This technology may find broad application in the final stages of completing the Human Genome Sequencing Project and in applications of BAC clones to the functional analysis of complex genomes.

  9. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  10. The effect of two pre-cryopreservation single layer colloidal centrifugation protocols in combination with different freezing extenders on the fragmentation dynamics of thawed equine sperm DNA.

    Science.gov (United States)

    Gutiérrez-Cepeda, Luna; Fernández, Alvaro; Crespo, Francisco; Ramírez, Miguel Ángel; Gosálvez, Jaime; Serres, Consuelo

    2012-12-05

    Variability among stallions in terms of semen cryopreservation quality renders it difficult to arrive at a standardized cryopreservation method. Different extenders and processing techniques (such us colloidal centrifugation) are used in order to optimize post-thaw sperm quality. Sperm chromatin integrity analysis is an effective tool for assessing such quality. The aim of the present study was to compare the effect of two single layer colloidal centrifugation protocols (prior to cryopreservation) in combination with three commercial freezing extenders on the post-thaw chromatin integrity of equine sperm samples at different post-thaw incubation (37°C) times (i.e., their DNA fragmentation dynamics). Post-thaw DNA fragmentation levels in semen samples subjected to either of the colloidal centrifugation protocols were significantly lower (pcentrifugation. The use of InraFreeze® extender was associated with significantly less DNA fragmentation than the use of Botu-Crio® extender at 6 h of incubation, and than the use of either Botu-Crio® or Gent® extender at 24 h of incubation (pcentrifugation performed with extended or raw semen prior to cryopreservation reduces DNA fragmentation during the first four hours after thawing. Further studies are needed to determine the influence of freezing extenders on equine sperm DNA fragmentation dynamics.

  11. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied...... by plant health services and researchers for online phytoplasma identification....

  12. Isolation of rye-specific DNA fragment and genetic diversity analysis ...

    Indian Academy of Sciences (India)

    PCR-based markers are useful and convenient tools for de- tecting alien chromosome segments incorporated into wheat genomes. Some rye-specific PCR-based markers have been successfully developed by random amplified polymorphic. DNA (RAPD) analysis (Iqbal and Rayburn 1995; Katto et al. 2004; Liu et al. 2008 ...

  13. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  14. An investigation of the potential effect of sperm nuclear vacuoles in human spermatozoa on DNA fragmentation using a neutral and alkaline Comet assay.

    Science.gov (United States)

    Pastuszek, E; Kiewisz, J; Skowronska, P; Liss, J; Lukaszuk, M; Bruszczynska, A; Jakiel, G; Lukaszuk, K

    2017-03-01

    Presence of vacuoles and degree of sperm DNA damage are considered to be the basic factors used for the assessment of sperm fertilization capacity. We aimed to investigate the link between these two parameters. According to our knowledge, this is the first study where the Comet assay was used to assess the degree of DNA fragmentation of sperm categorized by Motile Sperm Organelle Morphology Examination (MSOME) Grades. Semen samples from 10 patients were assessed. Spermatozoa were graded into four MSOME groups according to the Vanderzwalmen's criteria. A total of 3930 motile spermatozoa were selected one-by-one using an inverted microscope and transferred onto two different slides. The degree of DNA fragmentation was analyzed by alkaline and neutral Comet assay. Results of the neutral Comet assay showed that Grade I spermatozoa (absence of vacuoles) presented significantly lower dsDNA fragmentation level (mean: 3.13 ± 1.17%) than Grade II (maximum of two small vacuoles; mean: 10.34 ± 2.65%), Grade III (more than two small vacuoles or at least one large vacuole; mean: 23.88 ± 8.37%), and Grade IV (large vacuoles associated with abnormal head shapes or other abnormalities; mean: 36.94 ± 7.78%; p  0.05). Probably, the vacuoles may be responsible for double strand DNA breaks rather than single strand DNA breaks (only 2.39% spermatozoa in MSOME Grade II, 1.76% in III, and 3.16% in IV has single strand breaks). The results demonstrate that lower MSOME grading correlates with lower sperm DNA fragmentation. Therefore, the observation of sperm nuclear vacuoles using real-time optical microscopy without precise DNA fragmentation examination is not sufficient for optimal sperm selection for intracytoplasmic sperm injection. © 2017 American Society of Andrology and European Academy of Andrology.

  15. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  16. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  17. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  18. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    the Eskimo and Danish populations. Significant differences were observed between the distribution of fragments ('alleles') in Greenland Eskimos and in Danes. The allele MBP-A7 was considerably more frequent in Eskimos (0.2214) than in Danes (0.0775) and also the allele MBP-B9 was considerably more frequent......DNA from the double short tandem repeat (STR) system MBP (locus 18q23-pter) was amplified by the polymerase chain reaction (PCR) and the two polymorphic repeat systems were separated by cutting with the restriction enzyme NlaIII. The lengths of the DNA fragments of the two MBP STR systems MBP...

  20. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  1. Historic cycles of fragmentation and expansion in Parnassius smintheus (papilionidae) inferred using mitochondrial DNA.

    Science.gov (United States)

    DeChaine, Eric G; Martini, Andrew P

    2004-01-01

    Climate oscillations of the Quaternary drove the repeated expansion and contraction of ecosystems. Alpine organisms were probably isolated in sky island refugia during warm interglacials, such as now, and expanded their range by migrating down-slope during glacial periods. We used population genetic and phylogenetic approaches to infer how paleoclimatic events influenced the distribution of genetic variation in the predominantly alpine butterfly Parnassius smintheus. We sequenced a 789 bp region of cytochrome oxidase I for 385 individuals from 20 locations throughout the Rocky Mountains, ranging from southern Colorado to northern Montana. Analyses revealed at lease two centers of diversity in the northern and southern Rocky Mountains and strong population structure. Nested clade analysis suggested that the species experienced repeated cycles of population expansion and fragmentation. The estimated ages of these events, assuming a molecular clock, corresponded with paleoclimatic data on habitat expansion and contraction over the past 400,000 years. We propose that alpine butterflies persisted in an archipelago of isolated sky islands during interglacials and that populations expanded and became more connected during cold glacial periods. An archipelago model implies that the effects of genetic drift and selection varied among populations, depending on their latitude, area, and local environment. Alpine organisms are sensitive indicators of climate change and their history can be used to predict how high-elevation ecosystems might respond to further climate warming.

  2. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  3. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  4. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  5. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  6. Species specificity in major urinary proteins by parallel evolution.

    Directory of Open Access Journals (Sweden)

    Darren W Logan

    Full Text Available Species-specific chemosignals, pheromones, regulate social behaviors such as aggression, mating, pup-suckling, territory establishment, and dominance. The identity of these cues remains mostly undetermined and few mammalian pheromones have been identified. Genetically-encoded pheromones are expected to exhibit several different mechanisms for coding 1 diversity, to enable the signaling of multiple behaviors, 2 dynamic regulation, to indicate age and dominance, and 3 species-specificity. Recently, the major urinary proteins (Mups have been shown to function themselves as genetically-encoded pheromones to regulate species-specific behavior. Mups are multiple highly related proteins expressed in combinatorial patterns that differ between individuals, gender, and age; which are sufficient to fulfill the first two criteria. We have now characterized and fully annotated the mouse Mup gene content in detail. This has enabled us to further analyze the extent of Mup coding diversity and determine their potential to encode species-specific cues.Our results show that the mouse Mup gene cluster is composed of two subgroups: an older, more divergent class of genes and pseudogenes, and a second class with high sequence identity formed by recent sequential duplications of a single gene/pseudogene pair. Previous work suggests that truncated Mup pseudogenes may encode a family of functional hexapeptides with the potential for pheromone activity. Sequence comparison, however, reveals that they have limited coding potential. Similar analyses of nine other completed genomes find Mup gene expansions in divergent lineages, including those of rat, horse and grey mouse lemur, occurring independently from a single ancestral Mup present in other placental mammals. Our findings illustrate that increasing genomic complexity of the Mup gene family is not evolutionarily isolated, but is instead a recurring mechanism of generating coding diversity consistent with a species-specific

  7. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  8. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Science.gov (United States)

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  9. Species-Specific Responses of Carnivores to Human-Induced Landscape Changes in Central Argentina.

    Directory of Open Access Journals (Sweden)

    Nicolás Caruso

    Full Text Available The role that mammalian carnivores play in ecosystems can be deeply altered by human-driven habitat disturbance. While most carnivore species are negatively affected, the impact of habitat changes is expected to depend on their ecological flexibility. We aimed to identify key factors affecting the habitat use by four sympatric carnivore species in landscapes of central Argentina. Camera trapping surveys were carried out at 49 sites from 2011 to 2013. Each site was characterized by 12 habitat attributes, including human disturbance and fragmentation. Four landscape gradients were created from Principal Component Analysis and their influence on species-specific habitat use was studied using Generalized Linear Models. We recorded 74 events of Conepatus chinga, 546 of Pseudalopex gymnocercus, 193 of Leopardus geoffroyi and 45 of Puma concolor. We found that the gradient describing sites away from urban settlements and with low levels of disturbance had the strongest influence. L. geoffroyi was the only species responding significantly to the four gradients and showing a positive response to modified habitats, which could be favored by the low level of persecution by humans. P. concolor made stronger use of most preserved sites with low proportion of cropland, even though the species also used sites with an intermediate level of fragmentation. A more flexible use of space was found for C. chinga and P. gymnocercus. Our results demonstrate that the impact of human activities spans across this guild of carnivores and that species-specific responses appear to be mediated by ecological and behavioral attributes.

  10. Species-Specific Responses of Carnivores to Human-Induced Landscape Changes in Central Argentina

    Science.gov (United States)

    Caruso, Nicolás; Lucherini, Mauro; Fortin, Daniel; Casanave, Emma B.

    2016-01-01

    The role that mammalian carnivores play in ecosystems can be deeply altered by human-driven habitat disturbance. While most carnivore species are negatively affected, the impact of habitat changes is expected to depend on their ecological flexibility. We aimed to identify key factors affecting the habitat use by four sympatric carnivore species in landscapes of central Argentina. Camera trapping surveys were carried out at 49 sites from 2011 to 2013. Each site was characterized by 12 habitat attributes, including human disturbance and fragmentation. Four landscape gradients were created from Principal Component Analysis and their influence on species-specific habitat use was studied using Generalized Linear Models. We recorded 74 events of Conepatus chinga, 546 of Pseudalopex gymnocercus, 193 of Leopardus geoffroyi and 45 of Puma concolor. We found that the gradient describing sites away from urban settlements and with low levels of disturbance had the strongest influence. L. geoffroyi was the only species responding significantly to the four gradients and showing a positive response to modified habitats, which could be favored by the low level of persecution by humans. P. concolor made stronger use of most preserved sites with low proportion of cropland, even though the species also used sites with an intermediate level of fragmentation. A more flexible use of space was found for C. chinga and P. gymnocercus. Our results demonstrate that the impact of human activities spans across this guild of carnivores and that species-specific responses appear to be mediated by ecological and behavioral attributes. PMID:26950300

  11. Intervention improves assisted conception intracytoplasmic sperm injection outcomes for patients with high levels of sperm DNA fragmentation: a retrospective analysis.

    Science.gov (United States)

    Bradley, C K; McArthur, S J; Gee, A J; Weiss, K A; Schmidt, U; Toogood, L

    2016-09-01

    Sperm DNA fragmentation (SDF) is used in assisted reproductive technology (ART) programs as an indicator for sperm quality, although there is still a lack of consensus as to its clinical utility. In this retrospective study, we examined intracytoplasmic sperm injection (ICSI) outcomes of 1924 infertile patients who underwent SDF analysis using the sperm chromatin integrity test. ART patients were classified as having low [DNA fragmentation index (DFI) <29%] or high SDF (DFI ≥29%) and by whether or not an intervention [physiological intracytoplasmic sperm injection (PICSI), intracytoplasmic morphologically selected sperm injection (IMSI), testicular sperm extraction (TESE)/testicular sperm aspiration (TESA), frequent ejaculation] was performed. High SDF patients who did not have an intervention had a lower fertilization rate and poorer clinical outcomes from blastocyst transfers as compared with low SDF patients; the fertilization rate was 66.0% vs. 70.2% (p = 0.042), single embryo transfer (SET) fetal heart pregnancy rate was 28.5% vs. 45.2% (p = 0.042), and SET live birth rate was 24.9% vs. 40.6% (p = 0.060), respectively. Furthermore, high SDF patients who had an intervention had significantly improved blastocyst transfer outcomes, similar to those of low SDF patients; the SET live birth rate for high SDF intervention patients was 43.8% as compared with 24.9% for high SDF no intervention patients (p = 0.037) and 40.6% for low SDF patients (p = 0.446). Analysis of the three main intervention subgroups for high SDF patients revealed that TESE/TESA patients had the highest SET live birth rate; in comparison with 24.2% for high SDF patients who did not have an intervention, PICSI patients had 38.3% (p = 0.151), IMSI patients had 28.7% (p = 0.680), and TESE/TESA patients had 49.8% (p = 0.020). Our data suggest that SDF results indicate ICSI outcomes and that patients who have high SDF benefit from an intervention. © 2016 American Society of

  12. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  13. Species-Specific Cuticular Hydrocarbon Stability within European Myrmica Ants.

    Science.gov (United States)

    Guillem, Rhian M; Drijfhout, Falko P; Martin, Stephen J

    2016-10-01

    Recognition is a fundamental process on which all subsequent behaviors are based at every organizational level, from the gene up to the super-organism. At the whole organism level, visual recognition is the best understood. However, chemical communication is far more widespread than visual communication, but despite its importance is much less understood. Ants provide an excellent model system for chemical ecology studies as it is well established that compounds known as cuticular hydrocarbons (CHCs) are used as recognition cues in ants. Therefore, stable species-specific odors should exist, irrespective of geographic locality. We tested this hypothesis by comparing the CHC profiles of workers of twelve species of Myrmica ants from four countries across Europe, from Iberia to the Balkans and from the Mediterranean to Fennoscandia. CHCs remained qualitatively stable within each species, right down to the isomer level. Despite the morphological similarity that occurs within the genus Myrmica, their CHCs were highly diverse but remarkably species-specific and stable across wide geographical areas. This indicates a genetic mechanism under strong selection that produces these species-specific chemical profiles, despite each species encountering different environmental conditions across its range.

  14. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1.

    Science.gov (United States)

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-07

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1.

  15. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning

    OpenAIRE

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the ta...

  16. The mutT defect does not elevate chromosomal fragmentation in Escherichia coli because of the surprisingly low levels of MutM/MutY-recognized DNA modifications.

    Science.gov (United States)

    Rotman, Ella; Kuzminov, Andrei

    2007-10-01

    Nucleotide pool sanitizing enzymes Dut (dUTPase), RdgB (dITPase), and MutT (8-oxo-dGTPase) of Escherichia coli hydrolyze noncanonical DNA precursors to prevent incorporation of base analogs into DNA. Previous studies reported dramatic AT-->CG mutagenesis in mutT mutants, suggesting a considerable density of 8-oxo-G in DNA that should cause frequent excision and chromosomal fragmentation, irreparable in the absence of RecBCD-catalyzed repair and similar to the lethality of dut recBC and rdgB recBC double mutants. In contrast, we found mutT recBC double mutants viable with no signs of chromosomal fragmentation. Overproduction of the MutM and MutY DNA glycosylases, both acting on DNA containing 8-oxo-G, still yields no lethality in mutT recBC double mutants. Plasmid DNA, extracted from mutT mutM double mutant cells and treated with MutM in vitro, shows no increased relaxation, indicating no additional 8-oxo-G modifications. Our DeltamutT allele elevates the AT-->CG transversion rate 27,000-fold, consistent with published reports. However, the rate of AT-->CG transversions in our mutT(+) progenitor strain is some two orders of magnitude lower than in previous studies, which lowers the absolute rate of mutagenesis in DeltamutT derivatives, translating into less than four 8-oxo-G modifications per genome equivalent, which is too low to cause the expected effects. Introduction of various additional mutations in the DeltamutT strain or treatment with oxidative agents failed to increase the mutagenesis even twofold. We conclude that, in contrast to the previous studies, there is not enough 8-oxo-G in the DNA of mutT mutants to cause elevated excision repair that would trigger chromosomal fragmentation.

  17. The mutT Defect Does Not Elevate Chromosomal Fragmentation in Escherichia coli Because of the Surprisingly Low Levels of MutM/MutY-Recognized DNA Modifications▿

    Science.gov (United States)

    Rotman, Ella; Kuzminov, Andrei

    2007-01-01

    Nucleotide pool sanitizing enzymes Dut (dUTPase), RdgB (dITPase), and MutT (8-oxo-dGTPase) of Escherichia coli hydrolyze noncanonical DNA precursors to prevent incorporation of base analogs into DNA. Previous studies reported dramatic AT→CG mutagenesis in mutT mutants, suggesting a considerable density of 8-oxo-G in DNA that should cause frequent excision and chromosomal fragmentation, irreparable in the absence of RecBCD-catalyzed repair and similar to the lethality of dut recBC and rdgB recBC double mutants. In contrast, we found mutT recBC double mutants viable with no signs of chromosomal fragmentation. Overproduction of the MutM and MutY DNA glycosylases, both acting on DNA containing 8-oxo-G, still yields no lethality in mutT recBC double mutants. Plasmid DNA, extracted from mutT mutM double mutant cells and treated with MutM in vitro, shows no increased relaxation, indicating no additional 8-oxo-G modifications. Our ΔmutT allele elevates the AT→CG transversion rate 27,000-fold, consistent with published reports. However, the rate of AT→CG transversions in our mutT+ progenitor strain is some two orders of magnitude lower than in previous studies, which lowers the absolute rate of mutagenesis in ΔmutT derivatives, translating into less than four 8-oxo-G modifications per genome equivalent, which is too low to cause the expected effects. Introduction of various additional mutations in the ΔmutT strain or treatment with oxidative agents failed to increase the mutagenesis even twofold. We conclude that, in contrast to the previous studies, there is not enough 8-oxo-G in the DNA of mutT mutants to cause elevated excision repair that would trigger chromosomal fragmentation. PMID:17616589

  18. cDNA-amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese-like medium.

    Science.gov (United States)

    Bove, C G; Lazzi, C; Bernini, V; Bottari, B; Neviani, E; Gatti, M

    2011-10-01

    Lactobacillus rhamnosus is a dominant species during Parmigiano Reggiano cheese ripening and exhibits a great adaptability to unfavourable growth conditions. Gene expression of a Lact. rhamnosus, isolated from Parmigiano Reggiano cheese, grown in a rich medium (MRS) and in a cheese-like medium (CB) has been compared by a novel cDNA-amplified fragment length polymorphism (cDNA-AFLP) protocol. Two techniques, capillary and gel electrophoresis cDNA-AFLP, were applied to generate unique transcript tags from reverse-transcribed messenger RNA using the immobilization of biotinylated 3'-terminal cDNA fragments on streptavidin-coated Dynabeads. The use of three pairs of primers allowed detecting 64 genes expressed in MRS and 96 in CB. Different transcripts were observed when Lact. rhamnosus was cultured on CB and MRS. The cDNA-AFLP approach proved to be able to show that Lact. rhamnosus modifies the expression of a large part of genes when cultivated in CB compared with growth under optimal conditions (MRS). In particular, the profiles of the strain grown in CB were more complex probably because the cells activate different metabolic pathways to generate energy and to respond to the environmental changes. This is the first research on Lact. rhamnosus isolated from cheese and represents one of the few concerning bacterial transcriptomic analysis towards cDNA-AFLP approaches. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  19. Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

    International Nuclear Information System (INIS)

    Peltomaa, Riikka; Vaghini, Silvia; Patiño, Belén; Benito-Peña, Elena; Moreno-Bondi, María C.

    2016-01-01

    Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

  20. Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

    Energy Technology Data Exchange (ETDEWEB)

    Peltomaa, Riikka; Vaghini, Silvia [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Patiño, Belén [Department of Microbiology III, Faculty of Biology, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Benito-Peña, Elena, E-mail: elenabp@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Moreno-Bondi, María C., E-mail: mcmbondi@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain)

    2016-09-07

    Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

  1. Can Hyperspectral Remote Sensing Detect Species Specific Biochemicals ?

    Science.gov (United States)

    Vanderbilt, V. C.; Daughtry, C. S.

    2011-12-01

    Discrimination of a few plants scattered among many plants is a goal common to detection of agricultural weeds, invasive plant species and illegal Cannabis clandestinely grown outdoors, the subject of this research. Remote sensing technology provides an automated, computer based, land cover classification capability that holds promise for improving upon the existing approaches to Cannabis detection. In this research, we investigated whether hyperspectral reflectance of recently harvested, fully turgid Cannabis leaves and buds depends upon the concentration of the psychoactive ingredient Tetrahydrocannabinol (THC) that, if present at sufficient concentration, presumably would allow species-specific identification of Cannabis.

  2. Species-Specific Associations Between Bacterioplankton and Photosynthetic Picoeukaryotes

    Science.gov (United States)

    Farnelid, H.; Turk-Kubo, K.; Zehr, J. P.

    2016-02-01

    Photosynthetic picoeukaryotes are significant contributors to marine primary productivity. Interactions between marine bacterioplankton and picoeukaryotes frequently occur and can have large biogeochemical impacts. Currently, partly due to methodological difficulties for studying microbial associations in situ, these ecological interactions are poorly characterized. Here we use flow cytometry sorting to identify novel bacterial phylotypes found in physical association with photosynthetic picoeukaryotes. Samples were collected on eight occasions at the Santa Cruz wharf on Monterey Bay during summer and fall, 2014. The phylogeny of associated microbes was assessed through clone libraries and Illumina MiSeq sequencing of amplicons of the 16S rRNA gene. In addition, 16 bacterial isolates comprised of 14 taxa were obtained from sorted photosynthetic picoeukaryote cells. The most frequently detected bacterioplankton phyla were Alphaproteobacteria, Bacteriodetes, and Gammaproteobacteria. The sequences from the sorted populations were a community distinct from the unsorted seawater samples suggesting species-specific functional associations. These species-specific patterns were further supported by re-occurring patterns between replicates and sampling dates. The finding of sequences from the free-living genera Synechococcus and Pelagibacter also suggest that photosynthetic picoeukaryotes can be bacterivores, possibly feeding on some of the most numerically abundant bacteria. The results show that specific bacterial phylotypes are found in association with photosynthetic picoeukaryotes. Taxonomic identification of these associations is a prerequisite for further characterizing the interactions, their metabolic pathways and ecological functions.

  3. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  5. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  6. Molecular characterization of a DNA fragment harboring the replicon of pBMB165 from Bacillus thuringiensis subsp. tenebrionis

    Directory of Open Access Journals (Sweden)

    Yu Ziniu

    2006-10-01

    Full Text Available Abstract Background Bacillus thuringiensis belongs to the Bacillus cereus sensu lato group of Gram-positive and spore-forming bacteria. Most isolates of B. thuringiensis can bear many endogenous plasmids, and the number and size of these plasmids can vary widely among strains or subspecies. As far as we know, the replicon of the plasmid pBMB165 is the first instance of a plasmid replicon being isolated from subsp. tenebrionis and characterized. Results A 20 kb DNA fragment containing a plasmid replicon was isolated from B. thuringiensis subsp. tenebrionis YBT-1765 and characterized. By Southern blot analysis, this replicon region was determined to be located on pBMB165, the largest detected plasmid (about 82 kb of strain YBT-1765. Deletion analysis revealed that a replication initiation protein (Rep165, an origin of replication (ori165 and an iteron region were required for replication. In addition, two overlapping ORFs (orf6 and orf10 were found to be involved in stability control of plasmid. Sequence comparison showed that the replicon of pBMB165 was homologous to the pAMβ1 family replicons, indicating that the pBMB165 replicon belongs to this family. The presence of five transposable elements or remnants thereof in close proximity to and within the replicon control region led us to speculate that genetic exchange and recombination are potentially responsible for the divergence among the replicons of this plasmid family. Conclusion The replication and stability features of the pBMB165 from B. thuringiensis subsp. tenebrionis YBT-1765 were identified. Of particular interest is the homology and divergence shared between the pBMB165 replicon and other pAMβ1 family replicons.

  7. Assessment of sperm function parameters and DNA fragmentation in ejaculated alpaca sperm (Lama pacos) by flow cytometry.

    Science.gov (United States)

    Cheuquemán, C; Merino, O; Giojalas, L; Von Baer, A; Sánchez, R; Risopatrón, J

    2013-06-01

    Flow cytometry has been shown to be an accurate and highly reproducible tool for the analysis of sperm function. The main objective of this study was to assess sperm function parameters in ejaculated alpaca sperm by flow cytometry. Semen samples were collected from six alpaca males and processed for flow cytometric analysis of sperm viability and plasma membrane integrity using SYBR-14⁄PI staining; acrosomal membrane integrity using FITC-conjugated Pisum Sativum Agglutinin⁄PI labelling; mitochondrial membrane potential (Δψm) by staining with JC-1 and DNA Fragmentation Index (DFI) by TUNEL. The results indicate that the mean value for sperm viability was 57 ± 8 %. Spermatozoa with intact acrosome membrane was 87.9 ± 5%, and viable sperm with intact acrosomal membrane was 46.8 ± 9%, high mitochondrial membrane potential (Δψm) was detected in 66.32 ± 9.51% of spermatozoa and mean DFI value was 0.91 ± 0.9%. The DFI was inversely correlated with high Δψm (p = 0.04; r = -0.41) and with plasma membrane integrity (p = 0.01; r = -0.47). To our knowledge, this is the first report of the assessment on the same sample of several parameters of sperm function in ejaculated alpaca sperm by flow cytometry. © 2012 Blackwell Verlag GmbH.

  8. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  9. Differences in Electrostatic Potential Around DNA Fragments Containing Adenine and 8-oxo-Adenine. An Analysis Based on Regular Cylindrical Projection

    Energy Technology Data Exchange (ETDEWEB)

    Haranczyk, Maciej; Miller, John H; Gutowski, Maciej S

    2007-07-01

    Changes of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained adenine in the middle layer, while the “damaged” fragment had the adenine replaced with 8-oxo-adenine. The electrostatic potential around these DNA fragments was projected on a cylindrical surface around the double helix. The two-dimensional maps of EP of the intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-adenine (8oA). It was found that distortions of a phosphate group neighboring 8oA and displacements of the accompanying countercation are clearly reflected in the EP maps. Helpful discussions Michel Dupuis are gratefully acknowledged. Authors wish to thank Marcel Swart for directing us to a compilation of van der Waals radii. This work was supported by the: (i) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G. and M.H.), (ii) the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG03-02ER63470 (JHM), (iii) Polish State Committee for Scientific Research (KBN) Grant DS/8221-4-0140-6 (MG), (iv) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic Computer Center in Gdansk (TASK) and at the Molecular Science Computing Facility (MSCF) in the William R. Wiley Environmental Molecular Sciences Laboratory, a national

  10. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  11. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652 ......, but not in the highly exposed Inuit men. Additional issues (genetic background, lifestyle habits and characterization of total xeno-hormonal activities) need to be investigated in order to fully assess the population variations observed........ Sperm DNA fragmentation was measured by using the TUNEL assay, whereas immunofluorescence methods were utilized for detecting pro-apoptotic (Fas) and anti-apoptotic (Bcl-xL) markers. Both TUNEL assay and apoptotic markers were statistically differed across the four populations. No correlation between...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  12. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  13. Construction and characterization of three yeast-Escherichia coli shuttle vectors designed for rapid subcloning of yeast genes on small DNA fragments.

    Science.gov (United States)

    Ferguson, J; Groppe, J C; Reed, S I

    1981-12-01

    We have constructed three new subcloning plasmid vectors, pRC1, pRC2, and pRC3, derived from pKC7, which allow the rapid, single-step subcloning of yeast genes. Subcloning with these vectors utilizes a partial digestion with Sau3A to generate a quasi-random set of DNA fragments from the original plasmid. All three vectors contain a kanamycin resistance gene. Therefore, if the original cloned yeast DNA fragment is present in a vector that does not specify kanamycin resistance, the subclone pool can be propagated in Escherichia coli in the presence of kanamycin to select against parent plasmids that escaped restriction by Sau3A. Selection by complementation in yeast yields a collection of plasmids with smaller yeast DNA inserts containing the gene of interest. In the vectors pRC2 and pRC3, constructed from pRC1, the unique BamHI site is located within an intact tetracycline resistance gene, thus making it possible to screen bacterial transformants for those containing recombinant plasmid molecules. Vectors pRC2 and pRC3 also contain the yeast 2 micrometers DNA replication origin, and thus are more stable than plasmids carrying only the TRP1-associated replicator (ars1).

  14. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  16. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  17. Construction of Lambda Libraries from Large PFGE Fragments.

    Science.gov (United States)

    Pritchard, C; Burmeister, M

    1992-01-01

    Pulsed-field gel electrophoresis (PFGE) has the capacity to fractionate large fragments of DNA up to thousands of kilobases in size. This aspect of the technique has been exploited for constructing long-range restriction maps of chromosomes from many different species including humans (see Chapters 14 , 15 , and 18 ). Besides its use for analytical purposes, PFGE has also been used as a preparative tool. Intact DNA obtained from preparative PFGE gels has been used for cloning into yeast artificial chromosome (MC) vectors (see Chapter 16 ) and for constructing jumping libraries (1). In addition, DNAeluted from PFGE gels has been used for generating libraries with a smaller insert size (2-7). In this latter procedure, DNA from a somatic cell hybrid is digested with a rare-cutting restriction enzyme, separated by PFGE, and the DNA from a particular PFGE fragment is eluted, digested, and cloned into a plasmid or phage vector. The resulting library is then screened with a species-specific probe to identify DNA segments from the donor chromosome of the hybrid. This use of preparative PFGE has had widespread application in the cloning of DNA close to several important disease genes, namely cystic fibrosis (4,6), Duchenne muscular dystrophy (2), choroideremia (7), polycystic kidney disease (3), and Huntington disease (5).

  18. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning.

    Science.gov (United States)

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the target vector. We test its universality in our script programmed in Python. Our data shows that, among the entire human and mouse CDS, at least 70% of long CDS cloning will benefit from this strategy.

  19. Biooxidation of Ciguatoxins Leads to Species-Specific Toxin Profiles.

    Science.gov (United States)

    Ikehara, Tsuyoshi; Kuniyoshi, Kyoko; Oshiro, Naomasa; Yasumoto, Takeshi

    2017-06-29

    Ciguatoxins (CTXs) contaminate fish worldwide and cause the foodborne illness ciguatera. In the Pacific, these toxins are produced by the dinoflagellate Gambierdiscus toxicus , which accumulates in fish through the food chain and undergoes oxidative modification, giving rise to numerous analogs. In this study, we examined the oxidation of CTXs in vitro with liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis using reference toxins, and found that CTX4A, CTX4B, and CTX3C, which are produced by the alga, are oxidized to the analogs found in fish, namely CTX1B, 52- epi -54-deoxyCTX1B, 54-deoxyCTX1B, 2-hydroxyCTX3C, and 2,3-dihydroxyCTX3C. This oxidation was catalyzed by human CYP3A4, fish liver S9 fractions, and microsomal fractions prepared from representative ciguateric fishes ( Lutjanus bohar , L. monostigumus , and Oplegnathus punctatus ). In addition, fish liver S9 fractions prepared from non-ciguateric fishes ( L. gibbus and L. fulviflamma ) in Okinawa also converted CTX4A and CTX4B to CTX1B, 54-deoxyCTX1B, and 52- epi -54-deoxyCTX1B in vitro. This is the first study to demonstrate the enzymatic oxidation of these toxins, and provides insight into the mechanism underlying the development of species-specific toxin profiles and the fate of these toxins in humans and fish.

  20. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  2. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  3. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis

    Directory of Open Access Journals (Sweden)

    Songelwayo L. Chisi

    2017-09-01

    Full Text Available Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100% diagnostic sensitivity and specificity. Polymerase chain reaction (PCR has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  4. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

    Science.gov (United States)

    Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

    2017-09-27

    Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  5. Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment.

    Science.gov (United States)

    Stengel, Gudrun; Purse, Byron W; Wilhelmsson, L Marcus; Urban, Milan; Kuchta, Robert D

    2009-08-11

    We studied the incorporation of the fluorescent cytidine analogues 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) by human DNA polymerase alpha and Klenow fragment of DNA polymerase I (Escherichia coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly expanded in size toward the major groove. Despite the size alteration, both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only approximately 4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs and can incorporate at least four consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. Klenow fragment inserts dGTP with a 4-9-fold higher probability than dATP, while polymerase alpha favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as a templating base and as an incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o).

  6. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  7. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  8. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  9. Species-specific variation in nesting and postfledging resource selection for two forest breeding migrant songbirds.

    Directory of Open Access Journals (Sweden)

    Julianna M A Jenkins

    Full Text Available Habitat selection is a fundamental component of community ecology, population ecology, and evolutionary biology and can be especially important to species with complex annual habitat requirements, such as migratory birds. Resource preferences on the breeding grounds may change during the postfledging period for migrant songbirds, however, the degree to which selection changes, timing of change, and whether all or only a few species alter their resource use is unclear. We compared resource selection for nest sites and resource selection by postfledging juvenile ovenbirds (Seiurus aurocapilla and Acadian flycatchers (Empidonax virescens followed with radio telemetry in Missouri mature forest fragments from 2012-2015. We used Bayesian discrete choice modeling to evaluate support for local vegetation characteristics on the probability of selection for nest sites and locations utilized by different ages of postfledging juveniles. Patterns of resource selection variation were species-specific. Resource selection models indicated that Acadian flycatcher habitat selection criteria were similar for nesting and dependent postfledging juveniles and selection criteria diverged when juveniles became independent from adults. After independence, flycatcher resource selection was more associated with understory foliage density. Ovenbirds differed in selection criteria between the nesting and postfledging periods. Fledgling ovenbirds selected areas with higher densities of understory structure compared to nest sites, and the effect of foliage density on selection increased as juveniles aged and gained independence. The differences observed between two sympatric forest nesting species, in both the timing and degree of change in resource selection criteria over the course of the breeding season, illustrates the importance of considering species-specific traits and postfledging requirements when developing conservation efforts, especially when foraging guilds or

  10. Profiles of fragments after pulsed-field gel electrophoresis of cleaved genomic DNA from strains of Taylorella equigenitalis isolated from horses in Norway.

    Science.gov (United States)

    Matsuda, M; Miyazawa, T; Ishida, Y; Moore, J E

    1997-07-01

    The genomic DNA of eight strains of Taylorella equigenitalis, isolated from seven Norwegian Trotters and a Norwegian pony with contagious equine metritis in Norway, was examined by pulsed-field gel electrophoresis after separate digestions with two restriction enzymes, namely, ApaI and NotI. The respective electrophoretic profiles of the fragments were essentially identical but differed from those of T. equigenitalis NCTC11184T and Kentucky 188. They also exhibited slight differences from profiles obtained from Japanese isolates. These results may possibly suggest a common genotype and a common source of infection for all these eight isolates in Norway.

  11. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...... potential for the differentiation of M. hyosynoviae isolates. Concordant results obtained with the two whole-genome fingerprinting techniques evidence the considerable intraspecies genetic heterogeneity of M. hyosynoviae . Sixteen field strains of M. hyosynoviae and the type strain S16(T) were further...

  12. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  13. Fluorescent SSCP of overlapping fragments (FSSCP-OF): a highly sensitive method for the screening of mitochondrial DNA variation

    DEFF Research Database (Denmark)

    Salas, A; Rasmussen, Erik Michael; Lareu, M V

    2001-01-01

    The mtDNA analysis (mtDNA) is increasingly being demanded for forensic purposes due to the fact that many times the use of standard nuclear marker fails to analyze degraded samples (such as bones) and specially for the analysis of hair shafts (a common sample in the crime scene). However, analysi...

  14. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  15. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  16. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  17. Mitochondrial DNA Fragmentation as a Molecular Tool to Monitor Thermal Processing of Plant-Derived, Low-Acid Foods, and Biomaterials.

    Science.gov (United States)

    Caldwell, Jane M; Pérez-Díaz, Ilenys M; Sandeep, K P; Simunovic, Josip; Harris, Keith; Osborne, Jason A; Hassan, Hosni M

    2015-08-01

    Cycle threshold (Ct) increase, quantifying plant-derived DNA fragmentation, was evaluated for its utility as a time-temperature integrator. This novel approach to monitoring thermal processing of fresh, plant-based foods represents a paradigm shift. Instead of using quantitative polymerase chain reaction (qPCR) to detect pathogens, identify adulterants, or authenticate ingredients, this rapid technique was used to quantify the fragmentation of an intrinsic plant mitochondrial DNA (mtDNA) gene over time-temperature treatments. Universal primers were developed which amplified a mitochondrial gene common to plants (atp1). These consensus primers produced a robust qPCR signal in 10 vegetables, 6 fruits, 3 types of nuts, and a biofuel precursor. Using sweet potato (Ipomoea batatas) puree as a model low-acid product and simple linear regression, Ct value was highly correlated to time-temperature treatment (R(2) = 0.87); the logarithmic reduction (log CFU/mL) of the spore-forming Clostridium botulinum surrogate, Geobacillus stearothermophilus (R(2) = 0.87); and cumulative F-value (min) in a canned retort process (R(2) = 0.88), all comparisons conducted at 121 °C. D121 and z-values were determined for G. stearothermophilus ATCC 7953 and were 2.71 min and 11.0 °C, respectively. D121 and z-values for a 174-bp universal plant amplicon were 11.3 min and 9.17 °C, respectively, for mtDNA from sweet potato puree. We present these data as proof-of-concept for a molecular tool that can be used as a rapid, presumptive method for monitoring thermal processing in low-acid plant products. © 2015 Institute of Food Technologists®

  18. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  19. Nuclear status and DNA fragmentation of oocytes from porcine, bovine and feline ovaries stored at 4 degrees C for 5 days.

    Science.gov (United States)

    Luu, Vien Viet; Namula, Zhao; Do, Lanh Thi Kim; Sato, Yoko; Taniguchi, Masayasu; Karja, Ni Wayan Kurniani; Otoi, Takeshige

    2014-01-01

    The cooling of mammalian oocytes to sub-physiological temperatures is widely known to affect their viability through the induction of various abnormalities at all stages of meiosis. This study was to compare the kinetics of nuclear status and oocyte damage in porcine, bovine and feline ovaries stored at 4 degrees C for 5 days. The nuclear status and oocyte quality during storage were evaluated before and after maturation culture. The cold storage of ovaries decreased the proportions of porcine and bovine oocytes that remained at the germinal vesicle stage before maturation culture. The maturation rates of oocytes decreased with increasing storage time, independent of species. None of the porcine oocytes reached metaphase II (MII) after 1 day of storage. In contrast, bovine and feline oocytes from ovaries that were stored for 2 days and 3 days reached MII. DNA fragmentation in porcine oocytes from ovaries stored for 1 day was significantly higher than that in bovine and feline oocytes. The maturation competency of oocytes after the cold storage of ovaries could be related to the meiotic resumption of oocytes during storage and the occurrence of DNA fragmentation in oocytes during maturation culture.

  20. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  1. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  2. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  3. Species-specific deletion of the viral attachment glycoprotein of avian metapneumovirus.

    Science.gov (United States)

    Kong, Byung-Whi; Foster, Linda K; Foster, Douglas N

    2008-03-01

    The avian metapneumovirus (AMPV) genome encodes the fusion (F), small hydrophobic (SH), and attachment glycoprotein (G) as envelope glycoproteins. The F and G proteins mainly function to allow viral entry into host cells during the early steps of the virus life cycle. The highly variable AMPV G protein is a major determinant for distinguishing virus subtypes. Sequence analysis was used to determine if any differences between avian or mammalian cell propagated subtype C AMPV could be detected for the 1.8kb G gene. As a result, the complete 1.8kb G gene was found to be present when AMPV was propagated in our immortal turkey turbinate (TT-1) cell line regardless of passage number. Surprisingly, AMPV propagated for 15 or more passages in mammalian Vero cells revealed an essentially deleted G gene in the viral genome, resulting in no G gene mRNA expression. Although the Vero cell propagated AMPV genome contained a small 122 nucleotide fragment of the G gene, no other mRNA variants were detected from either mammalian or avian propagated AMPV. The G gene truncation might be caused by cellular molecular mechanisms that are species-specific. The lack of viral gene deletions suggests that avian cell propagated AMPV will provide a better alternative host for live recombinant vaccine development based on a reverse genetics system.

  4. Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase α and Klenow Fragment #

    Science.gov (United States)

    Stengel, Gudrun; Purse, Byron W.; Wilhelmsson, L. Marcus; Urban, Milan; Kuchta, Robert D.

    2009-01-01

    We studied the incorporation of the fluorescent cytidine analogues 1, 3-diaza-2-oxo-phenothiazine (tC) and 1, 3-diaza-2-oxo-phenoxazine (tCo) by human DNA polymerase α and Klenow fragment of DNA polymerase I (E. coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly size expanded toward the major groove. Despite the size alteration both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only ∼4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs, and can incorporate at least 4 consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. KF inserts dGTP with a 4- to 9-fold higher probability than dATP, while pol α favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as templating base and as incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o). PMID:19580325

  5. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  6. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  7. Quality, oxidative markers and DNA damage (DNA) fragmentation of red deer thawed spermatozoa after incubation at 37 °C in presence of several antioxidants.

    Science.gov (United States)

    Mata-Campuzano, M; Alvarez-Rodríguez, M; del Olmo, E; Fernández-Santos, M R; Garde, J J; Martínez-Pastor, F

    2012-09-15

    Antioxidants may be useful for supplementing sperm extenders. We have tested dehydroascorbic acid (DHA), TEMPOL, N-acetyl-cysteine (NAC) and rutin on epididymal spermatozoa from red deer, during incubation at 37 °C. Cryopreserved spermatozoa were thawed, washed and incubated with 1 mM or 0.1 mM of each antioxidant, including oxidative stress (Fe(2+)/ascorbate). Motility (CASA and clustering of subpopulations), viability, mitochondrial membrane potential, and acrosomal status were assessed at 2 and 4 h. Lipoperoxidation, intracellular reactive oxygen species (ROS) and DNA damage (DNA) status (TUNEL) were checked at 4 h. Oxidative stress increased ROS, lipoperoxidation and DNA damage. Overall, antioxidants negatively affected motility and physiological parameters. Only DHA 1 mm protected motility, increasing the fast and progressive subpopulation. However, it had a detrimental effect on acrosomal and DNA status, in absence of oxidative stress. Tempol and rutin efficiently reduced lipoperoxidation, ROS, and DNA damage in presence of oxidative stress. NAC was not as efficient as TEMPOL or rutin reducing lipoperoxidation or protecting DNA, and did not reduce ROS, but its negative effects were lower than the other antioxidants when used at 1 mm, increasing the subpopulation of hyperactivated-like spermatozoa at 2 h. Our results show that these antioxidants have mixed effects when spermatozoa are incubated at physiological temperatures. DHA may not be suitable because of prooxidant effects, but TEMPOL, NAC and rutin may be considered for cryopreservation trials. In general, exposure of red deer spermatozoa to these antioxidants should be limited to low temperatures, when only protective effects may develop. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  9. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Science.gov (United States)

    Després, V. R.; Nowoisky, J. F.; Klose, M.; Conrad, R.; Andreae, M. O.; Pöschl, U.

    2007-12-01

    This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA) particles in the atmosphere. Samples of fine particulate matter (PM2.5) and total suspended particulates (TSP) have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze). From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP) were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses. Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m-3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively). Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42) and some from Actinobacteria (10) and Firmicutes (1). The fungal sequences were characteristic for Ascomycota (3) and Basidiomycota (1), which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2) and moss spores (2), while animal DNA was found only for one unicellular eukaryote (protist). Over 80% of the 53 bacterial sequences could be matched to one of the 19 T-RF peaks found in the PM2.5 samples, but only 40% of the T-RF peaks

  10. Species-specific detection and identification of fusarium species complex, the causal agent of sugarcane pokkah boeng in China.

    Directory of Open Access Journals (Sweden)

    Zhenyue Lin

    Full Text Available BACKGROUND: Pokkah boeng disease caused by the Fusarium species complex results in significant yield losses in sugarcane. Thus, the rapid and accurate detection and identification of the pathogen is urgently required to manage and prevent the spreading of sugarcane pokkah boeng. METHODS: A total of 101 isolates were recovered from the pokkah boeng samples collected from five major sugarcane production areas in China throughout 2012 and 2013. The causal pathogen was identified by morphological observation, pathogenicity test, and phylogenetic analysis based on the fungus-conserved rDNA-ITS. Species-specific TaqMan real-time PCR and conventional PCR methods were developed for rapid and accurate detection of the causal agent of sugarcane pokkah boeng. The specificity and sensitivity of PCR assay were also evaluated on a total of 84 isolates of Fusarium from China and several isolates from other fungal pathogens of Sporisorium scitamineum and Phoma sp. and sugarcane endophyte of Acremonium sp. RESULT: Two Fusarium species (F. verticillioides and F. proliferatum that caused sugarcane pokahh boeng were identified by morphological observation, pathogenicity test, and phylogenetic analysis. Species-specific TaqMan PCR and conventional PCR were designed and optimized to target their rDNA-ITS regions. The sensitivity of the TaqMan PCR was approximately 10 pg of fungal DNA input, which was 1,000-fold over conventional PCR, and successfully detected pokkah boeng in the field-grown sugarcane. CONCLUSIONS/SIGNIFICANCE: This study was the first to identify two species, F. verticillioides and F. proliferatum, that were causal pathogens of sugarcane pokkah boeng in China. It also described the development of a species-specific PCR assay to detect and confirm these pathogens in sugarcane plants from mainland China. This method will be very useful for a broad range of research endeavors as well as the regulatory response and management of sugarcane pokkah boeng.

  11. Nesting behaviour influences species-specific gas exchange across avian eggshells.

    Science.gov (United States)

    Portugal, Steven J; Maurer, Golo; Thomas, Gavin H; Hauber, Mark E; Grim, Tomáš; Cassey, Phillip

    2014-09-15

    Carefully controlled gas exchange across the eggshell is essential for the development of the avian embryo. Water vapour conductance (G(H2O)) across the shell, typically measured as mass loss during incubation, has been demonstrated to optimally ensure the healthy development of the embryo while avoiding desiccation. Accordingly, eggs exposed to sub-optimal gas exchange have reduced hatching success. We tested the association between eggshell G(H2O) and putative life-history correlates of adult birds, ecological nest parameters and physical characteristics of the egg itself to investigate how variation in G(H2O) has evolved to maintain optimal water loss across a diverse set of nest environments. We measured gas exchange through eggshell fragments in 151 British breeding bird species and fitted phylogenetically controlled, general linear models to test the relationship between G(H2O) and potential predictor parameters of each species. Of our 17 life-history traits, only two were retained in the final model: wet-incubating parent and nest type. Eggs of species where the parent habitually returned to the nest with wet plumage had significantly higher G(H2O) than those of parents that returned to the nest with dry plumage. Eggs of species nesting in ground burrows, cliffs and arboreal cups had significantly higher G(H2O) than those of species nesting on the ground in open nests or cups, in tree cavities and in shallow arboreal nests. Phylogenetic signal (measured as Pagel's λ) was intermediate in magnitude, suggesting that differences observed in the G(H2O) are dependent upon a combination of shared ancestry and species-specific life history and ecological traits. Although these data are correlational by nature, they are consistent with the hypothesis that parents constrained to return to the nest with wet plumage will increase the humidity of the nest environment, and the eggs of these species have evolved a higher G(H2O) to overcome this constraint and still

  12. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Czech Academy of Sciences Publication Activity Database

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  13. Guanine quadruplex formation by RNA/DNA hybrid analogs of Oxytricha telomere G4T4G4 fragment

    Czech Academy of Sciences Publication Activity Database

    Vondrušková, Jitka; Kypr, Jaroslav; Kejnovská, Iva; Fialová, Markéta; Vorlíčková, Michaela

    2008-01-01

    Roč. 89, č. 10 (2008), s. 797-806 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA/DNA hybrids * guanine quadruplex * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 2.823, year: 2008

  14. Identification of campylobacteria isolated from Danish broilers by phenotypic tests and species-specific PCR assays

    DEFF Research Database (Denmark)

    Wainø, M; Bang, Dan; Lund, Marianne

    2003-01-01

    To validate a phenotypic Campylobacter species identification method employed to identify campylobacters in broilers by comparison with campylobacterial species identification using various species-specific PCR analyses....

  15. Identity of victims from fragmented and decomposed remnants by DNA profiling in a case of serial killings.

    Science.gov (United States)

    Raina, Anupuma; Dogra, T D; Leenaars, Antoon A; Yadav, Bhuvnesh; Bhera, C; Lalwani, Sanjeev; Leenaars, Lindsey

    2010-10-01

    A 28-year-old man, Surinder Koli, from a Nithari village adjoining Delhi, India committed serial murder. This case was of paramount importance in medico-legal investigations, as it was a landmark case of a serial killer reported from India. The skeletal remains (627 pieces) including skull/skull portions (19) were recovered from the nearby sewer drain, sump and the backyard of the house in which this man was residing. In addition, soft tissues (51) were also recovered from the same sewer drain. The victims were killed over a two-year period. The establishment of identity of the victims was crucial to prove the case in the court of law as well as for the claimants. Nineteen sets were prepared by radiology/anatomical examination from the exhibits recovered. DNA profiling confirmed the correctness of these sets and also short tandem repeat typing of nuclear DNA successfully identified eight individuals. Both DNA profiling and radiography/anatomical examination played an important role in solving this complicated case.

  16. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  17. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  18. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  19. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  20. [Values of the sperm deformity index, acrosome abnormity rate, and sperm DNA fragmentation index of optimized sperm in predicting IVF fertilization failure].

    Science.gov (United States)

    Jiang, Wei-jie; Jin, Fan; Zhou, Li-ming

    2016-02-01

    To investigate the values of the sperm deformity index (SDI), acrosome abnormity rate (AAR), and DNA fragmentation index (DFI) of optimized sperm in the prediction of fertilization failure (fertilization rate fertilization (IVF). We selected 695 cycles of conventional IVF for pure oviductal infertility in this study, including 603 cycles of normal fertilization and 92 cycles of fertilization failure. On the day of oocyte retrieval, we examined sperm morphology, acrosome morphology, and DNA fragmentation using the Diff-Quik, PSA-FITC and SCD methods. We established the joint predictor (JP) by logistic equation and analyzed the values of different parameters in predicting fertilization failure with the receiver operating characteristic (ROC) curve. The fertilization rate was negatively correlated with SDI (r = - 0.07; P = 0.03), AAR (r = -0.49; P fertilization group were 1.24 ± 0.20, (7.75 ± 2.28)%, and (7.87 ± 3.15)%, and those in the fertilization failure group were 1.42 ± 0.15, (12.02 ± 3.06)%, and (13.32 ± 4.13)%, respectively, all with statistically significant differences between the two groups (P fertilization failure ( OR = 2.68, 14.11, and 3.85; P = 0.01, fertilization failure were approximately 1.45, 10%, and 12%. The SDI, AAR and DFI of optimized sperm are closely associated with the fertilization rate, and all have the value for predicting fertilization failure in IVF. The AAR is more valuable than the other single predictors, but JP is more effective than the AAR.

  1. Species-specific evolution of class I MHC genes in iguanas (order: Squamata; subfamily: Iguaninae).

    Science.gov (United States)

    Glaberman, Scott; Caccone, Adalgisa

    2008-07-01

    Over the last few decades, the major histocompatibility complex (MHC) has emerged as a model for understanding the influence of natural selection on genetic diversity in populations as well as for investigating the genetic basis of host resistance to pathogens. However, many vertebrate taxa remain underrepresented in the field of MHC research, preventing its application to studies of disease, evolution, and conservation genetics in these groups. This is particularly true for squamates, which are by far the most diversified order of non-avian reptiles but have not been the subject of any recent MHC studies. In this paper, we present MHC class I complementary DNA data from three squamate species in the subfamily Iguaninae (iguanas): the Galápagos marine iguana (Amblyrhynchus cristatus), the Galápagos land iguana (Conolophus subcristatus), and the green iguana (Iguana iguana). All sequences obtained are related to the few published class I genes from other squamates. There is evidence for multiple loci in each species, and the conserved alpha-3 domain appears to be evolving in a species-specific manner. Conversely, there is some indication of shared polymorphism between species in the peptide-binding alpha-1 and alpha-2 domains, suggesting that these two regions have different phylogenetic histories. The great similarity between alpha-3 sequences in marine iguanas in particular suggests that concerted evolution is acting to homogenize class I loci within species. However, while less likely, the data are also compatible with a birth and death model of evolution.

  2. The virome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals the first report of DNA fragments corresponding to replicating non-retroviral RNA viruses in fungi.

    Science.gov (United States)

    Turina, Massimo; Ghignone, Stefano; Astolfi, Nausicaa; Silvestri, Alessandro; Bonfante, Paola; Lanfranco, Luisa

    2018-02-02

    Arbuscular Mycorrhizal Fungi (AMF) are key components of the plant microbiota. AMF genetic complexity is increased by the presence of endobacteria, which live inside many species. A further component of such complexity is the virome associated to AMF, whose knowledge is still very limited. Here, by exploiting transcriptomic data we describe the virome of Gigaspora margarita. A BLAST search for viral RNA-dependent RNA polymerases sequences allowed the identification of four mitoviruses, one Ourmia-like narnavirus, one Giardia-like virus, and two sequences related to Fusarium graminearum mycoviruses. Northern blot and RT-PCR confirmed the authenticity of all the sequences with the exception of the F. graminearum-related ones. All the mitoviruses are replicative and functional since both positive strand and negative strand RNA are present. The abundance of the viral RNA molecules is not regulated by the presence or absence of Candidatus Glomeribacter gigasporarum, the endobacterium hosted by G. margarita, with the exception of the Ourmia-like sequence which is absent in bacteria-cured spores. In addition, we report, for the first time, DNA fragments corresponding to mitovirus sequences associated to the presence of viral RNA. These sequences are not integrated in the mitochondrial DNA and preliminary evidence seems to exclude integration in the nuclear genome. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. QTL for the species-specific male and female genital morphologies in Ohomopterus ground beetles.

    Science.gov (United States)

    Sasabe, Masataka; Takami, Yasuoki; Sota, Teiji

    2010-12-01

    Animals with internal fertilization often exhibit marked diversification in genital morphology among closely related species. However, our knowledge of the genetic architecture underlying genital evolution is still limited. We constructed genetic linkage maps and analysed quantitative trait loci (QTL) for F(2) hybrids of two closely related species of the carabid beetles Carabus (Ohomopterus) iwawakianus and C. (O.) maiyasanus, which show matching male and female genital shapes within species, but marked differences in genital morphologies between species. The linkage maps comprised both amplified fragment length polymorphism and microsatellite markers. Composite interval mapping to detect QTL for three traits of male copulatory piece (length, width, weight) and two traits for female vaginal appendix (length, width) resulted in the detection of one to five significant QTL for each trait. The QTL explained large proportions of phenotypic variance. Thus, the interspecific difference in the genital morphologies appeared to be determined by relatively small numbers of genes with large genetic effects. QTL of different traits for the same or different sexes co-occurred on five of eight linkage groups with significant QTL; in particular, three QTL for different male and female genital traits occurred almost at the same position. Each of the male genital traits showed uniform signs of additive genetic effects, suggesting that directional selection has led to species-specific morphologies. However, the signs of additive genetic effects in each female genital trait were not uniform, suggesting that coevolution between sexes is not necessarily concerted. This result requires further assessment because the sample size of F(2) females was small. © 2010 Blackwell Publishing Ltd.

  5. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  6. Link-N: The missing link towards intervertebral disc repair is species-specific.

    Directory of Open Access Journals (Sweden)

    Frances C Bach

    Full Text Available Degeneration of the intervertebral disc (IVD is a frequent cause for back pain in humans and dogs. Link-N stabilizes proteoglycan aggregates in cartilaginous tissues and exerts growth factor-like effects. The human variant of Link-N facilitates IVD regeneration in several species in vitro by inducing Smad1 signaling, but it is not clear whether this is species specific. Dogs with IVD disease could possibly benefit from Link-N treatment, but Link-N has not been tested on canine IVD cells. If Link-N appears to be effective in canines, this would facilitate translation of Link-N into the clinic using the dog as an in vivo large animal model for human IVD degeneration.This study's objective was to determine the effect of the human and canine variant of Link-N and short (s Link-N on canine chondrocyte-like cells (CLCs and compare this to those on already studied species, i.e. human and bovine CLCs. Extracellular matrix (ECM production was determined by measuring glycosaminoglycan (GAG content and histological evaluation. Additionally, the micro-aggregates' DNA content was measured. Phosphorylated (p Smad1 and -2 levels were determined using ELISA.Human (sLink-N induced GAG deposition in human and bovine CLCs, as expected. In contrast, canine (sLink-N did not affect ECM production in human CLCs, while it mainly induced collagen type I and II deposition in bovine CLCs. In canine CLCs, both canine and human (sLink-N induced negligible GAG deposition. Surprisingly, human and canine (sLink-N did not induce Smad signaling in human and bovine CLCs. Human and canine (sLink-N only mildly increased pSmad1 and Smad2 levels in canine CLCs.Human and canine (sLink-N exerted species-specific effects on CLCs from early degenerated IVDs. Both variants, however, lacked the potency as canine IVD regeneration agent. While these studies demonstrate the challenges of translational studies in large animal models, (sLink-N still holds a regenerative potential for humans.

  7. Can DNA fragmentation of neat or swim-up spermatozoa be used to predict pregnancy following ICSI of fertile oocyte donors?

    Science.gov (United States)

    Gosálvez, Jaime; Caballero, Pedro; López-Fernández, Carmen; Ortega, Leonor; Guijarro, José Andrés; Fernández, José Luís; Johnston, Stephen D; Nuñez-Calonge, Rocío

    2013-11-01

    This study compared the potential of assessing sperm DNA fragmentation (SDF) from neat semen and the subsequent swim-up (SU) procedure to predict pregnancy when conducting ICSI of fertile donor oocytes. Infertile females (n=81) were transferred embryos resulting from intracytoplasmic sperm injection (ICSI) of their partner's spermatozoa and proven donor oocytes. This model normalized the impact of female factor in putative sperm DNA repair. Semen was blindly assessed for SDF using Halosperm immediately following ejaculation (NS) and after swim-up at the time of ICSI fertilisation. There was a decrease in SDF values of the ejaculated semen sample following the swim-up protocol (P=0.000). Interestingly, pregnancy could be equally predicted from SDF values derived from either neat or swim-up semen samples. Receiver operator curves and the derived Youden's indices determined SDF cutoff values for NS and SU of 24.8% and 17.5%, respectively. Prediction of pregnancy from NS SDF had a sensitivity of 75% and a specificity of 69%, whereas for SU SDF was 78% and 73%, respectively. While increased levels of SDF negatively impact reproductive outcome, we have shown that a reduction in SDF following sperm selection using ICSI with proven donor oocytes is not mandatory for achieving pregnancy. This suggests that a certain level of DNA damage that is not detectable using current technologies could be impacting on the relative success of assisted reproductive technology (ART) procedures. Consequently, we propose a modification of the so called 'iceberg model' as a possible rationale for understanding the role of SDF in reproductive outcome.

  8. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Directory of Open Access Journals (Sweden)

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  9. Forebrain Ischemia-Reperfusion Simulating Cardiac Arrest in Mice Induces Edema and DNA Fragmentation in the Brain

    Directory of Open Access Journals (Sweden)

    Christina H. Liu

    2007-05-01

    Full Text Available Brain injury affects one-third of persons who survive after heart attack, even with restoration of spontaneous circulation by cardiopulmonary resuscitation. We studied brain injury resulting from transient bilateral carotid artery occlusion (BCAO and reperfusion by simulating heart attack and restoration of circulation, respectively, in live C57Black6 mice. This model is known to induce neuronal death in the hippocampus, striatum, and cortex. We report the appearance of edema after transient BCAO of 60 minutes and 1 day of reperfusion. Hyperintensity in diffusion-weighted magnetic resonance imaging (MRI was detectable in the striatum, thalamus, and cortex but not in the hippocampus. To determine whether damage to the hippocampus can be detected in live animals, we infused a T2 susceptibility magnetic resonance contrast agent (superparamagnetic iron oxide nanoparticles [SPIONs] that was linked to single-stranded deoxyribonucleic acid (DNA complementary in sequence to c-fos messenger ribonucleic acid (SPION-cfos; we acquired in vivo T2*-weighted MRI 3 days later. SPION retention was measured as T2* (milliseconds signal reduction or R2* value (s−1 elevation. We found that animals treated with 60-minute BCAO and 7-day reperfusion exhibited significantly less SPION retention in the hippocampus and cortex than sham-operated animals. These findings suggest that brain injury induced by cardiac arrest can be detected in live animals.

  10. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  11. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Science.gov (United States)

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  12. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    Directory of Open Access Journals (Sweden)

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  13. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios

    Science.gov (United States)

    Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-01-01

    Background Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. Methods A search of papers published in response to the CPG entitled “Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios” was performed within the Translational Andrology and Urology (TAU) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as “supportive without reservation”, “supportive with reservation”, “not supportive” or “neutral”. We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the ‘Strengths-Weaknesses-Opportunities-Threats’ (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Results Fifty-eight fertility experts from six

  14. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Science.gov (United States)

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  15. Scrambled eggs: A highly sensitive molecular diagnostic workflow for Fasciola species specific detection from faecal samples

    Science.gov (United States)

    Calvani, Nichola Eliza Davies; Windsor, Peter Andrew; Bush, Russell David

    2017-01-01

    transport of samples from endemic to non-endemic countries without the requirement of a complete cold chain. The commercially-available ELISA displayed poorer sensitivity, even after adjustment of the positive threshold (65–88%), compared to the sensitivity (91–100%) of the new molecular diagnostic workflow. Conclusions/Significance Species-specific assays for sensitive detection of Fasciola spp. enable ante-mortem diagnosis in both human and animal settings. This includes Southeast Asia where there are potentially many undocumented human cases and where post-mortem examination of production animals can be difficult. The new molecular workflow provides a sensitive and quantitative diagnostic approach for the rapid testing of medium to large sample sizes, potentially superseding the traditional sedimentation and FEC technique and enabling surveillance programs in locations where animal and human health funding is limited. PMID:28915255

  16. Scrambled eggs: A highly sensitive molecular diagnostic workflow for Fasciola species specific detection from faecal samples.

    Science.gov (United States)

    Calvani, Nichola Eliza Davies; Windsor, Peter Andrew; Bush, Russell David; Šlapeta, Jan

    2017-09-01

    -endemic countries without the requirement of a complete cold chain. The commercially-available ELISA displayed poorer sensitivity, even after adjustment of the positive threshold (65-88%), compared to the sensitivity (91-100%) of the new molecular diagnostic workflow. Species-specific assays for sensitive detection of Fasciola spp. enable ante-mortem diagnosis in both human and animal settings. This includes Southeast Asia where there are potentially many undocumented human cases and where post-mortem examination of production animals can be difficult. The new molecular workflow provides a sensitive and quantitative diagnostic approach for the rapid testing of medium to large sample sizes, potentially superseding the traditional sedimentation and FEC technique and enabling surveillance programs in locations where animal and human health funding is limited.

  17. Scrambled eggs: A highly sensitive molecular diagnostic workflow for Fasciola species specific detection from faecal samples.

    Directory of Open Access Journals (Sweden)

    Nichola Eliza Davies Calvani

    2017-09-01

    to non-endemic countries without the requirement of a complete cold chain. The commercially-available ELISA displayed poorer sensitivity, even after adjustment of the positive threshold (65-88%, compared to the sensitivity (91-100% of the new molecular diagnostic workflow.Species-specific assays for sensitive detection of Fasciola spp. enable ante-mortem diagnosis in both human and animal settings. This includes Southeast Asia where there are potentially many undocumented human cases and where post-mortem examination of production animals can be difficult. The new molecular workflow provides a sensitive and quantitative diagnostic approach for the rapid testing of medium to large sample sizes, potentially superseding the traditional sedimentation and FEC technique and enabling surveillance programs in locations where animal and human health funding is limited.

  18. A Luminex-based single DNA fragment amplification assay as a practical tool for detecting and serotyping dengue virus.

    Science.gov (United States)

    Cabral-Castro, Mauro Jorge; Peralta, Regina Helena Saramago; Cavalcanti, Marta Guimarães; Puccioni-Sohler, Marzia; Carvalho, Valéria Lima; da Costa Vasconcelos, Pedro Fernando; Peralta, José Mauro

    2016-10-01

    Dengue is a mosquito-borne viral infection that can evolve from subclinical to severe forms of disease. Early recognition during initial primary and secondary infections correlates with a reduced case-fatality rate in susceptible groups. The aim of this study was to standardize a DNA hybridization assay based on the Luminex technology for detecting and serotyping dengue virus (DENV). Reference DENVs representing the four different serotypes were used as controls to standardize the test. For validation, 16 DENV isolates obtained from a reference laboratory were analyzed in a double-blind manner to validate the test. Sixty blood samples from patients suspected of having dengue fever were used to evaluate the methodology after the validation step, and the results were compared with the reference semi-nested RT-PCR. Additionally, five human samples of each Zika and Chikungunya confirmed patients were used for specificity analysis. The Luminex-based assay correctly identified all 16 DENV isolates. In the evaluation step, the results of the RT-PCR/Luminex assay showed a concordance of 86.7% with those of the semi-nested RT-PCR. None of other virus infection samples was amplified. This is the first description of a hybridization assay that can discriminate the four DENV serotypes using probes against a single DENV sequence. The results indicated that the RT-PCR/Luminex DENV assay designed and evaluated in this study is a valuable additional tool for the early and rapid detection and serotyping of DENV, which could, in the future, be applied to new targets such as the Zika and Chikungunya viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. A novel gene family controls species-specific morphological traits in Hydra.

    Directory of Open Access Journals (Sweden)

    Konstantin Khalturin

    2008-11-01

    Full Text Available Understanding the molecular events that underlie the evolution of morphological diversity is a major challenge in biology. Here, to identify genes whose expression correlates with species-specific morphologies, we compared transcriptomes of two closely related Hydra species. We find that species-specific differences in tentacle formation correlate with expression of a taxonomically restricted gene encoding a small secreted protein. We show that gain of function induces changes in morphology that mirror the phenotypic differences observed between species. These results suggest that "novel" genes may be involved in the generation of species-specific morphological traits.

  20. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  1. Species-specific genes under selection characterize the co-evolution of slavemaker and host lifestyles.

    Science.gov (United States)

    Feldmeyer, B; Elsner, D; Alleman, A; Foitzik, S

    2017-12-04

    selection in each species. These results point to species-specific adaptations rather than convergent trajectories during the evolution of the slavemaker and host lifestyles suggesting that the evolution of parasitism, even in closely related species, may be achieved in diverse ways.

  2. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  3. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  4. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Polymer fragmentation in extensional flow

    International Nuclear Information System (INIS)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-01-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments

  6. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  7. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  8. A species-specific method for detecting pathogenic Streptomyces species from soil and potato tubers in Argentina

    Directory of Open Access Journals (Sweden)

    Viviana A. Barrera

    Full Text Available Potato common scab is caused by several soil-inhabiting pathogenic Streptomyces species. In the present study, a species-specific PCR method was used to detect Streptomyces species in potato tuber lesions and soils. Total genomic DNA from soil samples from six locations and tuber samples from four potato cultivars (Spunta, Shepody, Innovator and Russet Burbank were assessed. Streptomyces scabies, Streptomyces acidiscabies, and Streptomyces turgidiscabies were detected in soybean, tobacco and potato soils and in all potato varieties except Russet Burbank. The phylogenetic analysis of the sequences obtained confirmed the identification. The method proposed proved to be time-saving and cost effective for the rapid detection of Streptomyces species. This is the first report of the detection of S. acidiscabies and S. turgidiscabies in soils and potato tubers from Argentina.

  9. The impact of coexisting sperm DNA fragmentation and seminal oxidative stress on the outcome of varicocelectomy in infertile patients: A prospective controlled study.

    Science.gov (United States)

    Abdelbaki, Shabieb A; Sabry, Jehan H; Al-Adl, Ahmed M; Sabry, Hanan H

    2017-06-01

    To study the relationship between sperm DNA fragmentation (SDF) and reactive oxygen species (ROS) levels in infertile patients with varicocele, and to examine the beneficial effect of varicocelectomy and elucidate predictors of improvement after repair. We prospectively studied 60 patients with varicocele and abnormal semen variables who attended the outpatient clinic complaining of infertility for ≥12 months. In all, 25 patients (41.7%) had bilateral varicoceles and 35 (58.3%) had left varicoceles. The DNA fragmentation index (DFI%, percentage of sperm with denatured nuclei), ROS and total non-enzymatic antioxidant capacity (TAC) were measured. Inguinal varicocelectomy was performed in all patients. At 3-6 months postoperatively, all measurements were repeated. A control group, comprised of 20 normozoospermic fertile men, was included. Regression analysis was used to examine predictors of improvement. The mean (SD) DFI% in the 60 infertile patients with varicocele was 29.9 (8.3) and 7.56 (2.84)% in the controls; ROS levels were 4.49 (0.9) in patients and 2.62 (0.8) photons/min in controls; and the TAC was 0.97 (0.4) in patients and 1.5 (0.5) mM in controls; with highly significant differences between the patients and controls. The DFI% showed a positive correlation with ROS levels, whilst the total motile sperm count (TMSC) had a significant negative correlation with DFI%, ROS levels and grade of varicocele, whilst there was significant positive correlation with TAC. The grade of varicocele and duration of infertility were related to the presence of higher levels of ROS and increased of DFI%. Postoperatively, improvement (measured as a >50% increase in TMSC) occurred in 40 of 55 (73%) patients available at follow-up, with a significant reduction in the mean (SD) DFI% from 29.49 (8.58) to 18.78 (7.23)%, ROS levels from 4.49 (0.88) to 3.27 (1.3) photons/min (both P  < 0.001), and a significant increase in the mean (SD) TAC from 1.01 (0.44) to 2.05 (0.51)

  10. Species-specific detection of Lobaria pulmonaria (lichenized ascomycete) diaspores in litter samples trapped in snow cover.

    Science.gov (United States)

    Walser, J C; Zoller, S; Büchler, U; Scheidegger, C

    2001-09-01

    The foliose lichen Lobaria pulmonaria has suffered a substantial decline in central and northern Europe during the twentieth century and is now considered to be critically endangered in many European lowland regions. Based on demographic studies, it has been proposed that under the present environmental conditions and forest management regimes, dispersal of diaspores and subsequent establishment of new thalli are insufficient to maintain the remnant small lowland populations. Chances of long-term survival may therefore be reduced. The data and analytical power of these demographic studies are limited. Since lichen diaspores show very few species-specific morphological characteristics, and are therefore almost indistinguishable, the accurate assessment of diaspore flux would be a fundamental first step in better understanding the life cycle of L. pulmonaria. Here we present a new molecular approach to investigate the dispersal of L. pulmonaria diaspores in its natural environment by specifically identifying small amounts of DNA in snow litter samples at varying distances from known sources. We used a species-specific polymerase chain reaction (PCR) primer pair to amplify the ribosomal internal transcribed spacer region (ITS rDNA) and a sensitive automated PCR product detection system using fluorescent labelled primers. We detected considerable amounts of naturally dispersed diaspores, deposited as far as 50 m away from the closest potential source. Diaspores were only found in the direction of the prevailing wind. Diaspore deposition varied from 1.2 diaspores per m(2) per day at 50 m distance from the source to 15 diaspores per m(2) per day at 1 m distance. The method described in this paper opens up perspectives for studies of population dynamics and dispersal ecology mainly in lichenized ascomycetes but also in other organisms with small, wind-dispersed diaspores.

  11. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  12. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  13. Identification of human papillomavirus type 156, the prototype of a new human gammapapillomavirus species, by a generic and highly sensitive PCR strategy for long DNA fragments.

    Science.gov (United States)

    Chouhy, Diego; Bolatti, Elisa M; Piccirilli, Gustavo; Sánchez, Adriana; Fernandez Bussy, Ramón; Giri, Adriana A

    2013-03-01

    This study developed a hanging-droplet long PCR, a generic and highly sensitive strategy to facilitate the identification of new human papillomavirus (HPV) genomes. This novel procedure used for the first time the hanging-droplet PCR technique for the amplification of long DNA fragments with generic primers targeting the L1 and E1 regions. It was first applied to the amplification of types belonging to the highly divergent genus Gammapapillovirus (γ-PV). The hanging-droplet long PCR was 100-fold more sensitive than a simple long PCR procedure, detecting as few as ten copies of HPV-4. Nineteen skin samples, potentially containing putative HPV types from the γ-PV genus, were also screened. The method identified four γ-PV genomic halves from new and previously described putative types, and made the full characterization of HPV-156 possible. This novel virus meets the criteria for a new species within the γ-PV genus, with nucleotide identities in the L1 ORF ranging from 58.3 to 67.3 % compared with representative types of the current γ-PV species. HPV-156 showed the highest identity to HPV-60 (67.3 %) from species γ-4, and was consistently closely related to it in both late- and early-gene-derived phylogenies. In conclusion, this report provides a versatile and highly sensitive approach that allowed identification of the prototype of a new species within the γ-PV genus. Its application with primers targeting the different genera in which both human and non-human PVs are distributed may facilitate characterization of the missing members of the family Papillomaviridae.

  14. Simulation study of natural UV-B radiation on Catla catla and its impact on physiology, oxidative stress, Hsp 70 and DNA fragmentation.

    Science.gov (United States)

    Singh, Moirangthem Kameshwor; Sharma, Jai Gopal; Chakrabarti, Rina

    2015-08-01

    UV-B radiation is a potential stressor to the aquacultural species. Catla catla, catla larvae (1.08±0.065g) were exposed to different doses of UV-B radiation, 0 (control), 504, 1008, 1512 and 2016mJ/cm(2) at a mean radiant energy of 80μW/cm(2) for 21days. The dose of UV-B radiation was selected on the basis of the field study conducted in Lake Naini, Delhi, India (Latitude: 28°41'26″N and Longitude: 77°12″37″E). Significantly (PUV-B irradiated larvae compared to the control one. Food conversion ratio was 1.5-4-fold higher in UV-B treated larvae compared to the control one. The carbonyl protein (CP), thiobarbituric acid reactive substances (TBARS), superoxide dismutase (SOD) levels were significantly (P UV-B irradiated larvae compared to the control group. Among the treated larvae, CP and SOD were significantly (P UV-B. A correlation was found between the CP and SOD (R(2)=0.834). Highest TBARS level was found in 2016mJ/cm(2) UV-B exposed catla. Nitric oxide synthase level was significantly (P UV-B exposed larvae compared to the control one. A 3-fold increased Hsp 70 level was recorded in UV-B irradiated catla compared to the control larvae. Comet assay analysis indicated that UV-B irradiation enhanced DNA fragmentation. Tail extent moment and the olive tail moment were significantly (P UV-B exposed catla compared to others. The tail length was significantly (P UV-B exposed larvae compared to the other doses. The present study suggests that the catla is a useful species for the biomonitoring of stress in the aquatic environment. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Science.gov (United States)

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  17. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  18. A generalized method of subcloning DNA fragments by restriction site reconstruction: application to sequencing the amino-terminal coding region of the transforming gene of Gazdar murine sarcoma virus.

    Science.gov (United States)

    Donoghue, D J; Hunter, T

    1982-01-01

    The technique of restriction site reconstruction was generalized so as to allow the subcloning of any DNA fragment and its subsequent reexcision with EcoRI, XbaI, XhoI or HindIII. After excision, the 3' terminus of each strand will be derived from the starting nucleic acid, permitting the use of such fragments as primers for nucleotide sequencing by primer extension methods. The technique was used to subclone a 56 base pair BstNI-DdeI fragment of Moloney murine sarcoma virus (Mo-MSV) as a unique HindIII-HindIII fragment. This fragment then served as a primer to sequence a portion of the RNA genome of Gazdar murine sarcoma virus (Gz-MSV). The nucleotide sequence which was obtained indicated that the transforming gene of Gz-MSV arose by at least two recombination events involving murine leukemia virus (MLV) and the cellular homologue c-mos. This analysis suggests that a virus indistinguishable from Mo-MSV was an intermediate in the formation of Gz-MSV. Images PMID:6281735

  19. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species

    Directory of Open Access Journals (Sweden)

    P Das

    2017-01-01

    Full Text Available Purpose: Standardization of Aspergillus polymerase chain reaction (PCR poses two technical challenges (a standardization of DNA extraction, (b optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Materials and Methods: Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR, the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, gene and calmodulin gene (for Aspergillus niger. Results: Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. Conclusion: The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

  20. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

    Science.gov (United States)

    Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

    2017-01-01

    Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

  1. Complementary seed dispersal by three avian frugivores in a fragmented Afromontane forest

    NARCIS (Netherlands)

    Lehouck, V.; Spanhove, T.; Demeter, S.; Groot, N.E.; Lens, L.

    2009-01-01

    Questions To what extent does species-specific variation in gut passage time (GPT), habitat use and mobility of three key avian frugivores synergistically affect the distribution of Xymalos monospora seeds within and among isolated forest fragments? Location Three fragments of a severely fragmented

  2. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  3. A rapid assessment of species-specific bird strike risk at the Kotoka ...

    African Journals Online (AJOL)

    A rapid assessment of species-specific bird strike risk at the Kotoka International Airport in Accra, Ghana. ... We conclude that wildlife management to avert the risk of bird strikes could be successfully achieved by adopting both proactive and reactive measures to reduce the presence of problem species at the aerodrome.

  4. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  5. Nonstructural Protein L* Species Specificity Supports a Mouse Origin for Vilyuisk Human Encephalitis Virus.

    Science.gov (United States)

    Drappier, Melissa; Opperdoes, Fred R; Michiels, Thomas

    2017-07-15

    Vilyuisk human encephalitis virus (VHEV) is a picornavirus related to Theiler's murine encephalomyelitis virus (TMEV). VHEV was isolated from human material passaged in mice. Whether this VHEV is of human or mouse origin is therefore unclear. We took advantage of the species-specific activity of the nonstructural L* protein of theiloviruses to track the origin of TMEV isolates. TMEV L* inhibits RNase L, the effector enzyme of the interferon pathway. By using coimmunoprecipitation and functional RNase L assays, the species specificity of RNase L antagonism was tested for L* from mouse (DA) and rat (RTV-1) TMEV strains as well as for VHEV. Coimmunoprecipitation and functional assay data confirmed the species specificity of L* activity and showed that L* from rat strain RTV-1 inhibited rat but not mouse or human RNase L. Next, we showed that the VHEV L* protein was phylogenetically related to L* of mouse viruses and that it failed to inhibit human RNase L but readily antagonized mouse RNase L, unambiguously showing the mouse origin of VHEV. IMPORTANCE Defining the natural host of a virus can be a thorny issue, especially when the virus was isolated only once or when the isolation story is complex. The species Theilovirus includes Theiler's murine encephalomyelitis virus (TMEV), infecting mice and rats, and Saffold virus (SAFV), infecting humans. One TMEV strain, Vilyuisk human encephalitis virus (VHEV), however, was isolated from mice that were inoculated with cerebrospinal fluid of a patient presenting with chronic encephalitis. It is therefore unclear whether VHEV was derived from the human sample or from the inoculated mouse. The L* protein encoded by TMEV inhibits RNase L, a cellular enzyme involved in innate immunity, in a species-specific manner. Using binding and functional assays, we show that this species specificity even allows discrimination between TMEV strains of mouse and of rat origins. The VHEV L* protein clearly inhibited mouse but not human RNase L

  6. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  7. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  8. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  9. Is Drosophila-microbe association species-specific or region specific? A study undertaken involving six Indian Drosophila species.

    Science.gov (United States)

    Singhal, Kopal; Khanna, Radhika; Mohanty, Sujata

    2017-06-01

    The present work aims to identify the microbial diversity associated with six Indian Drosophila species using next generation sequencing (NGS) technology and to discover the nature of their distribution across species and eco-geographic regions. Whole fly gDNA of six Drosophila species were used to generate sequences in an Illumina platform using NGS technology. De novo based assembled raw reads were blasted against the NR database of NCBI using BLASTn for identification of their bacterial loads. We have tried to include Drosophila species from different taxonomical groups and subgroups and from three different eco-climatic regions India; four species belong to Central India, while the rest two, D. melanogaster and D. ananassae, belong to West and South India to determine both their species-wise and region-wide distribution. We detected the presence of 33 bacterial genera across all six study species, predominated by the class Proteobacteria. Amongst all, D. melanogaster was found to be the most diverse by carrying around 85% of the bacterial diversity. Our findings infer both species-specific and environment-specific nature of the bacterial species inhabiting the Drosophila host. Though the present results are consistent with most of the earlier studies, they also remain incoherent with some. The present study outcome on the host-bacteria association and their species specific adaptation may provide some insight to understand the host-microbial interactions and the phenotypic implications of microbes on the host physiology. The knowledge gained may be importantly applied into the recent insect and pest population control strategy going to implement through gut microflora in India and abroad.

  10. Bacterial communities of two ubiquitous Great Barrier Reef corals reveals both site- and species-specificity of common bacterial associates.

    Directory of Open Access Journals (Sweden)

    E Charlotte E Kvennefors

    Full Text Available BACKGROUND: Coral-associated bacteria are increasingly considered to be important in coral health, and altered bacterial community structures have been linked to both coral disease and bleaching. Despite this, assessments of bacterial communities on corals rarely apply sufficient replication to adequately describe the natural variability. Replicated data such as these are crucial in determining potential roles of bacteria on coral. METHODOLOGY/PRINCIPAL FINDINGS: Denaturing Gradient Gel Electrophoresis (DGGE of the V3 region of the 16S ribosomal DNA was used in a highly replicated approach to analyse bacterial communities on both healthy and diseased corals. Although site-specific variations in the bacterial communities of healthy corals were present, host species-specific bacterial associates within a distinct cluster of gamma-proteobacteria could be identified, which are potentially linked to coral health. Corals affected by "White Syndrome" (WS underwent pronounced changes in their bacterial communities in comparison to healthy colonies. However, the community structure and bacterial ribotypes identified in diseased corals did not support the previously suggested theory of a bacterial pathogen as the causative agent of the syndrome. CONCLUSIONS/SIGNIFICANCE: This is the first study to employ large numbers of replicated samples to assess the bacterial communities of healthy and diseased corals, and the first culture-independent assessment of bacterial communities on WS affected Acroporid corals on the GBR. Results indicate that a minimum of 6 replicate samples are required in order to draw inferences on species, spatial or health-related changes in community composition, as a set of clearly distinct bacterial community profiles exist in healthy corals. Coral bacterial communities may be both site and species specific. Furthermore, a cluster of gamma-proteobacterial ribotypes may represent a group of specific common coral and marine

  11. Bacterial communities of two ubiquitous Great Barrier Reef corals reveals both site- and species-specificity of common bacterial associates.

    Science.gov (United States)

    Kvennefors, E Charlotte E; Sampayo, Eugenia; Ridgway, Tyrone; Barnes, Andrew C; Hoegh-Guldberg, Ove

    2010-04-29

    Coral-associated bacteria are increasingly considered to be important in coral health, and altered bacterial community structures have been linked to both coral disease and bleaching. Despite this, assessments of bacterial communities on corals rarely apply sufficient replication to adequately describe the natural variability. Replicated data such as these are crucial in determining potential roles of bacteria on coral. Denaturing Gradient Gel Electrophoresis (DGGE) of the V3 region of the 16S ribosomal DNA was used in a highly replicated approach to analyse bacterial communities on both healthy and diseased corals. Although site-specific variations in the bacterial communities of healthy corals were present, host species-specific bacterial associates within a distinct cluster of gamma-proteobacteria could be identified, which are potentially linked to coral health. Corals affected by "White Syndrome" (WS) underwent pronounced changes in their bacterial communities in comparison to healthy colonies. However, the community structure and bacterial ribotypes identified in diseased corals did not support the previously suggested theory of a bacterial pathogen as the causative agent of the syndrome. This is the first study to employ large numbers of replicated samples to assess the bacterial communities of healthy and diseased corals, and the first culture-independent assessment of bacterial communities on WS affected Acroporid corals on the GBR. Results indicate that a minimum of 6 replicate samples are required in order to draw inferences on species, spatial or health-related changes in community composition, as a set of clearly distinct bacterial community profiles exist in healthy corals. Coral bacterial communities may be both site and species specific. Furthermore, a cluster of gamma-proteobacterial ribotypes may represent a group of specific common coral and marine invertebrate associates. Finally, the results did not support the contention that a single

  12. Analysis of Bacterial Communities in the Rhizosphere of Chrysanthemum via Denaturing Gradient Gel Electrophoresis of PCR-Amplified 16S rRNA as Well as DNA Fragments Coding for 16S rRNA†

    Science.gov (United States)

    Duineveld, Bernadette M.; Kowalchuk, George A.; Keijzer, Anneke; van Elsas, Jan Dirk; van Veen, Johannes A.

    2001-01-01

    The effect of developing chrysanthemum roots on the presence and activity of bacterial populations in the rhizosphere was examined by using culture-independent methods. Nucleic acids were extracted from rhizosphere soil samples associated with the bases of roots or root tips of plants harvested at different stages of development. PCR and reverse transcriptase (RT) PCR were used to amplify 16S ribosomal DNA (rDNA) and 16S rRNA, respectively, and the products were subjected to denaturing gradient gel electrophoresis (DGGE). Prominent DGGE bands were excised and sequenced to gain insight into the identities of predominantly present (PCR) and predominantly active (RT-PCR) bacterial populations. The majority of DGGE band sequences were related to bacterial genera previously associated with the rhizosphere, such as Pseudomonas, Comamonas, Variovorax, and Acetobacter, or typical of root-free soil environments, such as Bacillus and Arthrobacter. The PCR-DGGE patterns observed for bulk soil were somewhat more complex than those obtained from rhizosphere samples, and the latter contained a subset of the bands present in bulk soil. DGGE analysis of RT-PCR products detected a subset of bands visible in the rDNA-based analysis, indicating that some dominantly detected bacterial populations did not have high levels of metabolic activity. The sequences detected by the RT-PCR approach were, however, derived from a wide taxonomic range, suggesting that activity in the rhizosphere was not determined at broad taxonomic levels but rather was a strain- or species-specific phenomenon. Comparative analysis of DGGE profiles grouped all DNA-derived root tip samples together in a cluster, and within this cluster the root tip samples from young plants formed a separate subcluster. Comparison of rRNA-derived bacterial profiles showed no grouping of root tip samples versus root base samples. Rather, all profiles derived from 2-week-old plant rhizosphere soils grouped together regardless of

  13. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  14. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    ‘Engaging Through Architecture’ in 2015 by Aarhus School of Architecture as a part of the Ventura Lambrate Milan Design Week, where it was exhibited under the name Concrete. The fundamental pool of techniques and knowledge that set the agenda for the fragment was established before the intentions...

  15. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    to create architectural meaning and give character to an architecture of fragmentation. Layers are both seen as conceptual as well as material frames which define certain strong properties or meanings in the architectural work. Defining layers is a way of separating and organizing; it both defines...

  16. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  17. Extracellular self-DNA as a damage-associated molecular pattern (DAMP) that triggers self-specific immunity induction in plants.

    Science.gov (United States)

    Duran-Flores, Dalia; Heil, Martin

    2017-10-16

    Mammals sense self or non-self extracellular or extranuclear DNA fragments (hereinafter collectively termed eDNA) as indicators of injury or infection and respond with immunity. We hypothesised that eDNA acts as a damage-associated molecular pattern (DAMP) also in plants and that it contributes to self versus non-self discrimination. Treating plants and suspension-cultured cells of common bean (Phaseolus vulgaris) with fragmented self eDNA (obtained from other plants of the same species) induced early, immunity-related signalling responses such as H 2 O 2 generation and MAPK activation, decreased the infection by a bacterial pathogen (Pseudomonas syringae) and increased an indirect defence to herbivores (extrafloral nectar secretion). By contrast, non-self DNA (obtained from lima bean, Phaseolus lunatus, and Acacia farnesiana) had significantly lower or no detectable effects. Only fragments below a size of 700 bp were active, and treating the eDNA preparation DNAse abolished its inducing effects, whereas treatment with RNAse or proteinase had no detectable effect. These findings indicate that DNA fragments, rather than small RNAs, single nucleotides or proteins, accounted for the observed effects. We suggest that eDNA functions a DAMP in plants and that plants discriminate self from non-self at a species-specific level. The immune systems of plants and mammals share multiple central elements, but further work will be required to understand the mechanisms and the selective benefits of an immunity response that is triggered by eDNA in a species-specific manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Genetic investigations in immigration cases and frequencies of DNA fragments of the VNTR systems D2S44, D5S43, D7S21, D7S22, and D12S11 in Turks

    DEFF Research Database (Denmark)

    Hansen, Hanna Elsebeth; Morling, N

    1993-01-01

    We have included investigations of the DNA polymorphism of variable numbers of tandem repeat (VNTR) regions with restriction fragment length polymorphism (RFLP) in the genetic evaluations in immigrant cases. HinfI-digested DNA was separated by electrophoresis in agarose gels and hybridized...... with radiolabelled probes detecting the VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). We used the matching criterion for paternity testing for the parent/child comparisons, i.e. non-match if the intra gel difference exceeded 1.25 mm. A total of 43 immigration cases involving...... putative father/child pairs. In a putative father/child combination with non-exclusion in 18 genetic systems, a single genetic inconsistency ('exclusion') in D7S21 (MS31) was observed. The frequency distributions of HinfI digested DNA fragments of the five VNTR systems in 105 Turks are presented....

  19. Adaptive Evolution as a Predictor of Species-Specific Innate Immune Response.

    Science.gov (United States)

    Webb, Andrew E; Gerek, Z Nevin; Morgan, Claire C; Walsh, Thomas A; Loscher, Christine E; Edwards, Scott V; O'Connell, Mary J

    2015-07-01

    It has been proposed that positive selection may be associated with protein functional change. For example, human and macaque have different outcomes to HIV infection and it has been shown that residues under positive selection in the macaque TRIM5α receptor locate to the region known to influence species-specific response to HIV. In general, however, the relationship between sequence and function has proven difficult to fully elucidate, and it is the role of large-scale studies to help bridge this gap in our understanding by revealing major patterns in the data that correlate genotype with function or phenotype. In this study, we investigate the level of species-specific positive selection in innate immune genes from human and mouse. In total, we analyzed 456 innate immune genes using codon-based models of evolution, comparing human, mouse, and 19 other vertebrate species to identify putative species-specific positive selection. Then we used population genomic data from the recently completed Neanderthal genome project, the 1000 human genomes project, and the 17 laboratory mouse genomes project to determine whether the residues that were putatively positively selected are fixed or variable in these populations. We find evidence of species-specific positive selection on both the human and the mouse branches and we show that the classes of genes under positive selection cluster by function and by interaction. Data from this study provide us with targets to test the relationship between positive selection and protein function and ultimately to test the relationship between positive selection and discordant phenotypes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Programmed death in a unicellular organism has species-specific fitness effects.

    Science.gov (United States)

    Durand, Pierre M; Choudhury, Rajdeep; Rashidi, Armin; Michod, Richard E

    2014-02-01

    Programmed cell death (PCD) is an ancient phenomenon and its origin and maintenance in unicellular life is unclear. We report that programmed death provides differential fitness effects that are species specific in the model organism Chlamydomonas reinhardtii. Remarkably, PCD in this organism not only benefits others of the same species, but also has an inhibitory effect on the growth of other species. These data reveal that the fitness effects of PCD can depend upon genetic relatedness.

  1. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    or from a position as business leader to a position in the state apparatus or in the Party and vice versa. To conceptualize the coexistence of the contradicting forces for further enterprise autonomy and continued central control that characterizes the evolving relationship between business groups...... and the Party-state, I suggest the notion of integrated fragmentation....

  2. Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.

    2004-01-01

    Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)

  3. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...... the development of lupus nephritis at an early stage....

  4. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  5. Non-destructive sampling of ancient insect DNA.

    Directory of Open Access Journals (Sweden)

    Philip Francis Thomsen

    Full Text Available BACKGROUND: A major challenge for ancient DNA (aDNA studies on insect remains is that sampling procedures involve at least partial destruction of the specimens. A recent extraction protocol reveals the possibility of obtaining DNA from past insect remains without causing visual morphological damage. We test the applicability of this protocol on historic museum beetle specimens dating back to AD 1820 and on ancient beetle chitin remains from permafrost (permanently frozen soil dating back more than 47,000 years. Finally, we test the possibility of obtaining ancient insect DNA directly from non-frozen sediments deposited 3280-1800 years ago -- an alternative approach that also does not involve destruction of valuable material. METHODOLOGY/PRINCIPAL FINDINGS: The success of the methodological approaches are tested by PCR and sequencing of COI and 16S mitochondrial DNA (mtDNA fragments of 77-204 base pairs (-bp in size using species-specific and general insect primers. CONCLUSION/SIGNIFICANCE: The applied non-destructive DNA extraction method shows promising potential on insect museum specimens of historical age as far back as AD 1820, but less so on the ancient permafrost-preserved insect fossil remains tested, where DNA was obtained from samples up to ca. 26,000 years old. The non-frozen sediment DNA approach appears to have great potential for recording the former presence of insect taxa not normally preserved as macrofossils and opens new frontiers in research on ancient biodiversity.

  6. Non-destructive sampling of ancient insect DNA.

    Science.gov (United States)

    Thomsen, Philip Francis; Elias, Scott; Gilbert, M Thomas P; Haile, James; Munch, Kasper; Kuzmina, Svetlana; Froese, Duane G; Sher, Andrei; Holdaway, Richard N; Willerslev, Eske

    2009-01-01

    A major challenge for ancient DNA (aDNA) studies on insect remains is that sampling procedures involve at least partial destruction of the specimens. A recent extraction protocol reveals the possibility of obtaining DNA from past insect remains without causing visual morphological damage. We test the applicability of this protocol on historic museum beetle specimens dating back to AD 1820 and on ancient beetle chitin remains from permafrost (permanently frozen soil) dating back more than 47,000 years. Finally, we test the possibility of obtaining ancient insect DNA directly from non-frozen sediments deposited 3280-1800 years ago -- an alternative approach that also does not involve destruction of valuable material. The success of the methodological approaches are tested by PCR and sequencing of COI and 16S mitochondrial DNA (mtDNA) fragments of 77-204 base pairs (-bp) in size using species-specific and general insect primers. The applied non-destructive DNA extraction method shows promising potential on insect museum specimens of historical age as far back as AD 1820, but less so on the ancient permafrost-preserved insect fossil remains tested, where DNA was obtained from samples up to ca. 26,000 years old. The non-frozen sediment DNA approach appears to have great potential for recording the former presence of insect taxa not normally preserved as macrofossils and opens new frontiers in research on ancient biodiversity.

  7. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  8. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    the photographs as a starting point for a series of paintings. This way of creating representations of something that already exists is for me to see a way forward in the "decoding" of my own models into other depictions. The models are analyzed through a series of representations in different types of drawings....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...

  9. Detection of all Chlamydophila and Chlamydia spp. of veterinary interest using species-specific real-time PCR assays.

    Science.gov (United States)

    Pantchev, Alexandra; Sting, Reinhard; Bauerfeind, Rolf; Tyczka, Judith; Sachse, Konrad

    2010-12-01

    The aim of the present study was to analyse the occurrence of chlamydiae in several mammalian host species. Clinical samples that previously tested positive in a Chlamydiaceae-specific real-time PCR were retested using six species-specific real-time PCR assays to identify the chlamydial species involved. Chlamydophila (Cp.) abortus was the agent most frequently found in cattle, sheep, horses, goats, and pigs. Detection in cattle of Cp. psittaci (11% of samples) and Chlamydia (C.) suis (9%), as well as Cp. psittaci in a goat sample was somewhat unexpected. DNA of two different chlamydiae was identified in 56 (12.7%) of 440 samples tested. Cp. felis was the predominant species found in cats, while in guinea pigs and rabbits only Cp. caviae was detected. Interestingly, the latter two pathogens were also identified in samples from dogs. The data show that mixed chlamydial infections are not rare and suggest an extended host range of individual species. Copyright © 2009 Elsevier Ltd. All rights reserved.

  10. Species-specific ant brain manipulation by a specialized fungal parasite.

    Science.gov (United States)

    de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P

    2014-08-29

    A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation

  11. [Enrichment of extracellular DNA from the cultivation medium of human peripheral blood mononuclears with genomic CpG rich fragments results in increased cell production of IL-6 and TNF-a via activation of the NF-kB signaling pathway].

    Science.gov (United States)

    Speranskii, A I; Kostyuk, S V; Kalashnikova, E A; Veiko, N N

    2016-03-01

    Previously, it was found that blood plasma extracellular DNA (ecDNA) of patients with rheumatoid arthritis (RA) is enriched with CpG-rich genomic DNA fragments, which contain TLR9 ligands (Veiko et al., 2006). In this study we have demonstrated that ecDNA of a RA patient and model fragments added to a cultivation medium of peripheral blood mononuclear cells (PBMC) of healthy donors stimulate expression of genes for the TLR9-MyD88-NF-kB signaling pathway; this leads to a significant increase in concentrations of the proinflammatory cytokines IL-6 and TNF-a in the cultivation medium. Human genomic DNA non-enriched with the CpG sequences did not stimulate IL-6 and TNF-a synthesis in PBMC. A scheme explaining the potential role ecDNA in the induction and maintenance of increased levels of the proinflammatory cytokines under conditions damaging the human cells has been proposed.

  12. Species-specific associations between soil-transmitted helminths and micronutrients in Vietnamese schoolchildren

    DEFF Research Database (Denmark)

    de Gier, Brechje; Nga, Tran Thuy; Winichagoon, Pattanee

    2016-01-01

    with vitamin A. Trichuris and hookworm infections were associated with lower hemoglobin concentration, but not with plasma ferritin. Trichuris-infected children had zinc deficiency less often than uninfected children. In conclusion, our study shows species-specific associations between STH infections...... and micronutrient status in children. The different life cycles of STH species might have specific effects on the absorption or loss of specific micronutrients. Tailor-made combinations of deworming and nutritional interventions may be needed to improve child health and nutrition....

  13. Assessment of nucleic acid modification induced by amotosalen and ultraviolet A light treatment of platelets and plasma using real-time polymerase chain reaction amplification of variable length fragments of mitochondrial DNA.

    Science.gov (United States)

    Bakkour, Sonia; Chafets, Daniel M; Wen, Li; Dupuis, Kent; Castro, Grace; Green, Jennifer M; Stassinopoulos, Adonis; Busch, Michael P; Lee, Tzong-Hae

    2016-02-01

    Pathogen inactivation methods are increasingly used to reduce the risk of infections after transfusion of blood products. Photochemical treatment (PCT) of platelets (PLTs) and plasma with amotosalen and ultraviolet A (UVA) light inactivates pathogens and white blood cells through formation of adducts between amotosalen and nucleic acid that block replication, transcription, and translation. The same adducts block the amplification of nucleic acids using polymerase chain reaction (PCR) in a manner that correlates with the number of adducts formed, providing a direct quality control (QC). Current QC measures for PCT rely on indirect methods that measure the delivered UVA dose or percent residual amotosalen after illumination, rather than directly measuring nucleic acid modification. Endogenous mitochondrial DNA (mtDNA), which is detectable in PLT and plasma units, was chosen as a target for the quantification of photochemically induced modifications. DNA was extracted from untreated or amotosalen and UVA-treated PLTs or plasma, and mtDNA fragments of variable lengths were quantified using a real-time PCR inhibition assay. PCT induced increasing real-time PCR inhibition of mtDNA amplification for larger amplicon sizes. Amplification was unaffected by treatment with amotosalen or UVA alone, whereas up to 3 log inhibition was observed after PCT. Blinded PCR testing of a panel of 110 samples each, from PLT or plasma components prepared for routine use within a blood center, allowed 100% discrimination between untreated and treated units. Our initial findings indicate that an adequately sensitive, quantitative real-time PCR inhibition assay targeting mtDNA could provide a valuable tool to confirm and monitor PCT. © 2015 The Authors. Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  14. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  16. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  17. Differentiation of Meat Samples from Domestic Horses (Equus caballus) and Asiatic Wild Asses (Equus hemionus) Using a Species-Specific Restriction Site in the Mitochondrial Cytochrome b Region

    Science.gov (United States)

    Kuehn, Ralph; Kaczensky, Petra; Lkhagvasuren, Davaa; Pietsch, Stephanie; Walzer, Chris

    2011-01-01

    Recent studies suggest that Asiatic wild asses (Equus hemionus) are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse (Equus caballus) and wild ass meat, we developed a restriction fragment length polymorphism (RFLP) assay based on the polymerase chain reaction (PCR). We amplified and sequenced a cytochrome b fragment (335 bp) and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey (Equus asinus) and the Przewalski’s horse (Equus ferus przewalskii). We detected a species-specific restriction site (AatII) for the Asiatic wild ass, resulting in a specific restriction fragment length polymorphism (RFLP) band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season. PMID:22059088

  18. Species-specificity of sperm motility activation and chemotaxis: a study on ascidian species.

    Science.gov (United States)

    Yoshida, Manabu; Hiradate, Yuki; Sensui, Noburu; Cosson, Jacky; Morisawa, Masaaki

    2013-08-01

    Egg-derived sperm-activating factors and attractants activate sperm motility and attract the sperm, respectively. These phenomena constitute the first communication signaling between males and females in the process of fertilization in many animals and plants, and in many cases, these are species-specific events. Thus, sperm motility activation and chemotaxis may act as a safety process for the authentication between conspecific egg and sperm, and help to prevent crossbreeding. Here, we examine species-specificity of sperm motility activation and chemotaxis in the ascidians belonging to the order Phlebobranchiata: Ciona intestinalis, Ciona savignyi, Phallusia mammillata, Phallusia nigra, and Ascidia sydneiensis. Cross-reactivity in both motility activation and chemotaxis of sperm was not observed between C. savignyi and P. mammillata, or between A. sydneiensis and Phallusia spp. However, there is a "one way" (no reciprocity) cross-reaction between P. mammillata and P. nigra in sperm activation, and between C. savignyi and A. sydneiensis in sperm chemotaxis. Furthermore, the level of activity is different, even when cross-reaction is observed. Thus, sperm motility activation and chemotaxis are neither "species-" nor "genus-" specific phenomena among the ascidian species. Moreover, the interaction between the sperm-activating and sperm-attracting factors (SAAFs) in the ascidian species and the SAAF receptors on the sperm cells are not all-or-none responses.

  19. Species-Specific Seed Dispersal in an Obligate Ant-Plant Mutualism

    Science.gov (United States)

    Youngsteadt, Elsa; Baca, Jeniffer Alvarez; Osborne, Jason; Schal, Coby

    2009-01-01

    Throughout lowland Amazonia, arboreal ants collect seeds of specific plants and cultivate them in nutrient-rich nests, forming diverse yet obligate and species-specific symbioses called Neotropical ant-gardens (AGs). The ants depend on their symbiotic plants for nest stability, and the plants depend on AGs for substrate and nutrients. Although the AGs are limited to specific participants, it is unknown at what stage specificity arises, and seed fate pathways in AG epiphytes are undocumented. Here we examine the specificity of the ant-seed interaction by comparing the ant community observed at general food baits to ants attracted to and removing seeds of the AG plant Peperomia macrostachya. We also compare seed removal rates under treatments that excluded vertebrates, arthropods, or both. In the bait study, only three of 70 ant species collected P. macrostachya seeds, and 84% of observed seed removal by ants was attributed to the AG ant Camponotus femoratus. In the exclusion experiment, arthropod exclusion significantly reduced seed removal rates, but vertebrate exclusion did not. We provide the most extensive empirical evidence of species specificity in the AG mutualism and begin to quantify factors that affect seed fate in order to understand conditions that favor its departure from the typical diffuse model of plant-animal mutualism. PMID:19194502

  20. Endogenous retroviruses function as species-specific enhancer elements in the placenta.

    Science.gov (United States)

    Chuong, Edward B; Rumi, M A Karim; Soares, Michael J; Baker, Julie C

    2013-03-01

    The mammalian placenta is remarkably distinct between species, suggesting a history of rapid evolutionary diversification. To gain insight into the molecular drivers of placental evolution, we compared biochemically predicted enhancers in mouse and rat trophoblast stem cells (TSCs) and found that species-specific enhancers are highly enriched for endogenous retroviruses (ERVs) on a genome-wide level. One of these ERV families, RLTR13D5, contributes hundreds of mouse-specific histone H3 lysine 4 monomethylation (H3K4me1)- and histone H3 lysine 27 acetylation (H3K27ac)-defined enhancers that functionally bind Cdx2, Eomes and Elf5-core factors that define the TSC regulatory network. Furthermore, we show that RLTR13D5 is capable of driving gene expression in rat placental cells. Analysis in other tissues shows that species-specific ERV enhancer activity is generally restricted to hypomethylated tissues, suggesting that tissues permissive for ERV activity gain access to an otherwise silenced source of regulatory variation. Overall, our results implicate ERV enhancer co-option as a mechanism underlying the extensive evolutionary diversification of placental development.

  1. Fine-scale genetic analysis of species-specific female preference in Drosophila simulans.

    Science.gov (United States)

    Laturney, M; Moehring, A J

    2012-09-01

    Behavioural differences are thought to be the first components to contribute to species isolation, yet the precise genetic basis of behavioural isolation remains poorly understood. Here, we used a combination of behaviour assays and genetic mapping to provide the first refined map locating candidate genes for interspecific female preference isolating Drosophila simulans from D. melanogaster. First, we tested whether two genes identified as affecting D. melanogaster female intraspecific mate choice also affect interspecific mate choice; neither of these genes was found to contribute to species-specific female preference. Next, we used deficiency mapping to locate genes on the right arm of the third chromosome for species-specific female preference and identified five small significant regions that contain candidate genes contributing to behavioural isolation. All five regions were located in areas that would have low interspecific recombination, which mirrors the results of other behavioural isolation studies that used quantitative trait locus (QTL) mapping, but without the potential concern of bias towards regions of low recombination that QTL mapping may have. As this model system may be refined to the individual gene level using the same methodology, this initial map we provide may potentially serve as a ready template for the identification and characterization of the first behavioural isolation genes. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  2. Development of a multiplex assay for genus- and species-specific detection of Phytophthora based on differences in mitochondrial gene order.

    Science.gov (United States)

    Bilodeau, Guillaume J; Martin, Frank N; Coffey, Michael D; Blomquist, Cheryl L

    2014-07-01

    A molecular diagnostic assay for Phytophthora spp. that is specific, sensitive, has both genus- and species-specific detection capabilities multiplexed, and can be used to systematically develop markers for detection of a wide range of species would facilitate research and regulatory efforts. To address this need, a marker system was developed based on the high copy sequences of the mitochondrial DNA utilizing gene orders that were highly conserved in the genus Phytophthora but different in the related genus Pythium and plants to reduce the importance of highly controlled annealing temperatures for specificity. An amplification primer pair designed from conserved regions of the atp9 and nad9 genes produced an amplicon of ≈340 bp specific for the Phytophthora spp. tested. The TaqMan probe for the genus-specific Phytophthora test was designed from a conserved portion of the atp9 gene whereas variable intergenic spacer sequences were used for designing the species-specific TaqMan probes. Specific probes were developed for 13 species and the P. citricola species complex. In silico analysis suggests that species-specific probes could be developed for at least 70 additional described and provisional species; the use of locked nucleic acids in TaqMan probes should expand this list. A second locus spanning three tRNAs (trnM-trnP-trnM) was also evaluated for genus-specific detection capabilities. At 206 bp, it was not as useful for systematic development of a broad range of species-specific probes as the larger 340-bp amplicon. All markers were validated against a test panel that included 87 Phytophthora spp., 14 provisional Phytophthora spp., 29 Pythium spp., 1 Phytopythium sp., and 39 plant species. Species-specific probes were validated further against a range of geographically diverse isolates to ensure uniformity of detection at an intraspecific level, as well as with other species having high levels of sequence similarity to ensure specificity. Both diagnostic

  3. Effect of prenatal species-specific and music stimulation on the postnatal auditory preference of domestic chick.

    Science.gov (United States)

    Jain, Suman; Sharma, Ratna; Wadhwa, Shashi

    2004-04-01

    Perinatal sensory experience plays an important role in the development of perceptual preferences. In the present study prenatal enrichment with sound stimulus was given to see its effect on the development of postnatal auditory preference. Auditory stimulation with either species-specific (chicken maternal and hatching calls) or music (slow and fast sitar music) sounds was provided to two separate sets of fertilized eggs from the day 10 of incubation. The postnatal auditory preference of the chicks to either species-specific or music sounds was then tested at different time periods after hatching. All the chicks, irrespective of the type of prenatal exposure, showed preference for species-specific maternal calls. Notably, the music stimulated chicks did not show preference for either slow or fast music. In both the experimental groups, the number of chicks responding to the species-specific maternal calls was significantly (Pmusic stimulated group, for auditory preference to the maternal calls, did not show any significant difference. Further, in the species-specific sound stimulated groups, there was a significant (Ppreference of the chicks, in both the experimental groups. The results indicate that prenatal auditory experience with either species-specific or non-specific music enhances the postnatal auditory preference of chicks for the species-specific sounds.

  4. Species-Specific Chromosome Engineering Greatly Improves Fully Human Polyclonal Antibody Production Profile in Cattle.

    Science.gov (United States)

    Matsushita, Hiroaki; Sano, Akiko; Wu, Hua; Wang, Zhongde; Jiao, Jin-An; Kasinathan, Poothappillai; Sullivan, Eddie J; Kuroiwa, Yoshimi

    2015-01-01

    Large-scale production of fully human IgG (hIgG) or human polyclonal antibodies (hpAbs) by transgenic animals could be useful for human therapy. However, production level of hpAbs in transgenic animals is generally very low, probably due to the fact that evolutionarily unique interspecies-incompatible genomic sequences between human and non-human host species may impede high production of fully hIgG in the non-human environment. To address this issue, we performed species-specific human artificial chromosome (HAC) engineering and tested these engineered HAC in cattle. Our previous study has demonstrated that site-specific genomic chimerization of pre-B cell receptor/B cell receptor (pre-BCR/BCR) components on HAC vectors significantly improves human IgG expression in cattle where the endogenous bovine immunoglobulin genes were knocked out. In this report, hIgG1 class switch regulatory elements were subjected to site-specific genomic chimerization on HAC vectors to further enhance hIgG expression and improve hIgG subclass distribution in cattle. These species-specific modifications in a chromosome scale resulted in much higher production levels of fully hIgG of up to 15 g/L in sera or plasma, the highest ever reported for a transgenic animal system. Transchromosomic (Tc) cattle containing engineered HAC vectors generated hpAbs with high titers against human-origin antigens following immunization. This study clearly demonstrates that species-specific sequence differences in pre-BCR/BCR components and IgG1 class switch regulatory elements between human and bovine are indeed functionally distinct across the two species, and therefore, are responsible for low production of fully hIgG in our early versions of Tc cattle. The high production levels of fully hIgG with hIgG1 subclass dominancy in a large farm animal species achieved here is an important milestone towards broad therapeutic applications of hpAbs.

  5. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    proved their influence by obstructing the creation of new ministries and regulatory commissions that would limit their powers. The heads of these business groups often outrank their counterparts in state administrative organs and bureaus that are supposed to regulate their activities. The increased role...... of these business leaders prompts the question of whether we are seeing the development of distinct interest groups that could challenge Party and state authority and create a fragmented polity. However, through the nomenklatura system the Party has an important instrument of control to wield over business groups....... Through this system the Party controls the appointment and promotion of the heads of the most important state-owned enterprises. The nomenklatura system also enables the Party to rotate leaders in big business from a position as CEO in one company to a similar position in another state-owned company...

  6. The potential of platinum-DNA adduct determination in ex vivo treated tumor fragments for the prediction of sensitivity to cisplatin chemotherapy

    NARCIS (Netherlands)

    Welters, M.J.P.; Braakhuis, B.J.M.; Jacobs-Bergmans, A.J.; Kegel, A.; Baan, R.A.; Vijgh, W.J.F. van der; Fichtinger-Schepman, A.M.J.

    1999-01-01

    Background: Response to cisplatin-therapy is assumed to be related to the formation of platinum (Pt)-DNA adducts. Measurement of these adducts prior to therapy could be of value to improve cisplatin based cancer therapy. Materials and methods: We determined Pt-GG and Pt-AG adduct levels by use of

  7. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  8. Analysis of endophytic bacterial communities of potato by plating and denaturing gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments

    NARCIS (Netherlands)

    Garbeva, P.; Overbeek, van L.S.; Vuurde, van J.W.L.; Elsas, van J.D.

    2001-01-01

    The diversity of endophytic bacterial populations of potato (Solanum tuberosum cv Desiree) was assessed using a combination of dilution plating of plant macerates followed by isolation and characterization of isolates, and direct PCR-DGGE on the basis of DNA extracted from plants. The culturable

  9. Method to Assemble Genomic DNA Fragments or Genes on Human Artificial Chromosome with Regulated Kinetochore Using a Multi-Integrase System.

    Science.gov (United States)

    Lee, Nicholas C O; Kim, Jung-Hyun; Petrov, Nikolai S; Lee, Hee-Sheung; Masumoto, Hiroshi; Earnshaw, William C; Larionov, Vladimir; Kouprina, Natalay

    2018-01-19

    The production of cells capable of carrying multiple transgenes to Mb-size genomic loci has multiple applications in biomedicine and biotechnology. In order to achieve this goal, three key steps are required: (i) cloning of large genomic segments; (ii) insertion of multiple DNA blocks at a precise location and (iii) the capability to eliminate the assembled region from cells. In this study, we designed the iterative integration system (IIS) that utilizes recombinases Cre, ΦC31 and ΦBT1, and combined it with a human artificial chromosome (HAC) possessing a regulated kinetochore (alphoid tetO -HAC). We have demonstrated that the IIS-alphoid tetO -HAC system is a valuable genetic tool by reassembling a functional gene from multiple segments on the HAC. IIS-alphoid tetO -HAC has several notable advantages over other artificial chromosome-based systems. This includes the potential to assemble an unlimited number of genomic DNA segments; a DNA assembly process that leaves only a small insertion (system that also changes cell color, and counter-selection markers at each DNA insertion step, simplifying selection of correct clones; and presence of an error proofing mechanism to remove cells with misincorporated DNA segments, which improves the integrity of assembly. In addition, the IIS-alphoid tetO -HAC carrying a locus of interest is removable, offering the unique possibility to revert the cell line to its pretransformed state and compare the phenotypes of human cells with and without a functional copy of a gene(s). Thus, IIS-alphoid tetO -HAC allows investigation of complex biomedical pathways, gene(s) regulation, and has the potential to engineer synthetic chromosomes with a predetermined set of genes.

  10. Development of PCR primers based on a fragment from randomly amplified polymorphic DNA for the detection of Escherichia coli O157:H7/NM.

    Science.gov (United States)

    Lin, Chien-Ku; Lin, Jia-Chi

    2007-06-01

    Serotype O157:H7 of EHEC is by far the most prevalent serotype associated with haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS). Although PCR methods aimed on the detection of genes associated with the pathogenicity of Escherichia coli O157:H7 have been reported, tests allowing the direct identification of this serotype are rare. In this study, we used RAPD-PCR tests to analyze strains of E. coli O157:H7 serotype, strains of non-pathogenic E. coli, and strains of other pathotypes, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), and enteroaggregation E. coli (EAggEC). One RAPD fragment co-shared by serotype O157:H7 strains was observed when 10-mer primer termed as OPQ3 was used. After sequencing this fragment, three primers were designed and combined to form two PCR primer pairs. These two primer pairs were highly specific to the strains belonging to E. coli O157:H7/NM (non-motile).

  11. In vivo synthesized 34S enriched amino acid standards for species specific isotope dilution of proteins

    DEFF Research Database (Denmark)

    Hermann, Gerrit; Moller, Laura Hyrup; Gammelgaard, Bente

    2016-01-01

    with the concept of species specific isotope dilution analysis (IDA). The method relies on the determination of the two sulfur containing amino acids, cysteine and methionine by sulfur speciation analysis and is hence applicable to any protein containing sulfur. In vivo synthesis using 34S as sulfur source...... (ICP-MS) combined to anion exchange showed that very high concentrated spike material could be produced with [small mu ]mol amounts of proteinogenic sulfur containing amino acids per g cell dry weight. An enrichment of 34S to 96.3 +/- 0.4% (n = 3) and 98.5 +/- 0.4% (n = 3) for cysteic acid......A generic quantification approach was introduced addressing the characterization of protein standards while fulfilling the principles of metrology. Traceable absolute quantification was achieved combining a proven biochemical method, i.e. protein hydrolysis followed by amino acid quantification...

  12. Temporal Lobe Lesions and Perception of Species-Specific Vocalizations by Macaques

    Science.gov (United States)

    Heffner, Henry E.; Heffner, Rickye S.

    1984-10-01

    Japanese macaques were trained to discriminate two forms of their coo vocalization before and after unilateral and bilateral ablation of the temporal cortex. Unilateral ablation of the left superior temporal gyrus, including auditory cortex, resulted in an initial impairment in the discrimination, but similar unilateral ablation of the right superior temporal gyrus had no effect. Bilateral temporal lesions including auditory cortex completely abolished the ability of the animals to discriminate their coos. Neither unilateral nor bilateral ablation of cortex dorsal to and sparing the auditory cortex had any effect on the discrimination. The perception of species-specific vocalizations by Japanese macaques seems to be mediated by the temporal cortex, with the left hemisphere playing a predominant role.

  13. Species-specific Posture of Human Foetus in Late First Trimester.

    Science.gov (United States)

    Ohmura, Yoshiyuki; Morokuma, Seiichi; Kato, Kiyoko; Kuniyoshi, Yasuo

    2018-01-08

    The ontogeny associated with the arm-hanging posture, which is considered ape-specific, remains unknown. To examine its ontogeny, we measured foetal movements of 62 human foetuses aged 10-20 gestation weeks using four-dimensional sonography. We observed that the first-trimester foetuses show this particular species-specific posture. After 11 weeks of gestation, all foetuses showed the arm-hanging posture, and the posture was most frequently observed at 14-16 weeks of gestation. Moreover, this posture often involved extension of both arms and both legs, indicating that it is not myogenic but neurogenic. Furthermore, early ontogeny suggests that it originates because of subcortical activity. Such posture extension bias and persistence indicates that vestibulospinal tract maturation involves the ontogeny of arm-hanging posture during 14-16 weeks of gestation.

  14. Coexistence and environmental filtering of species-specific biomass in an African savanna.

    Science.gov (United States)

    Colgan, Matthew S; Asner, Gregory P

    2014-06-01

    Biomass density is a key metric of vegetation abundance, but understanding how community assembly processes, such as environmental filtering and competitive exclusion, affect biomass distributions of coexisting species has proven logistically challenging. Here we apply airborne remote sensing to study the ecosystem-scale distribution of species-specific, woody plant biomass and its relation to topographic and hydrologic gradients in a South African savanna. We also spatially analyzed variation in biomass among species to understand patterns of coexistence, mapping the species and biomass over one million trees across 10500 ha. We found the biomass of dominant woody species to be weakly but significantly related to environmental filters, where a combination of 10 topographic and edaphic variables accounted for community assembly processes in natural ecosystems. Characterizing the species composition of biomass is an important advance in understanding the balance of community assembly processes and its control over current species assemblages.

  15. Ants Learn Aphid Species as Mutualistic Partners: Is the Learning Behavior Species-Specific?

    Science.gov (United States)

    Hayashi, Masayuki; Nakamuta, Kiyoshi; Nomura, Masashi

    2015-12-01

    In ant-aphid associations, many aphid species provide ants with honeydew and are tended by ants, whereas others are never tended and are frequently preyed upon by ants. In these relationships, ants must have the ability to discriminate among aphid species, with mutualistic aphids being accepted as partners rather than prey. Although ants reportedly use cuticular hydrocarbons (CHCs) of aphids to differentiate between mutualistic and non-mutualistic species, it is unclear whether the ability to recognize mutualistic aphid species as partners is innate or involves learning. Therefore, we tested whether aphid recognition by ants depends on learning, and whether the learning behavior is species-specific. When workers of the ant Tetramorium tsushimae had previously tended the cowpea aphid, Aphis craccivora, they were less aggressive toward this species. In addition, ants also reduced their aggressiveness toward another mutualistic aphid species, Aphis fabae, after tending A. craccivora, whereas ants remained aggressive toward the non-mutualistic aphid, Acyrthosiphon pisum, regardless of whether or not they had previous experience in tending A. craccivora. When ants were offered glass dummies treated with CHCs of these aphid species, ants that had tended A. craccivora displayed reduced aggression toward CHCs of A. craccivora and A. fabae. Chemical analyses showed the similarity of the CHC profiles between A. craccivora and A. fabae but not with A. pisum. These results suggest that aphid recognition of ants involves learning, and that the learning behavior may not be species-specific because of the similarity of CHCs between different aphid species with which they form mutualisms.

  16. Species-specific trajectories of nitrogen isotopes in Indiana hardwood forests, USA

    Directory of Open Access Journals (Sweden)

    K. K. McLauchlan

    2012-02-01

    Full Text Available Humans have drastically altered the global nitrogen (N cycle, and these alterations have begun to affect a variety of ecosystems. In North America, N deposition rates are highest in the central US, yet there are few studies that examine whether N availability has been increasing to different tree species in the forests of the region. To determine the species-specific trajectories of N availability in secondary temperate forests experiencing high N deposition, we measured the N concentrations and composition of stable N isotopes in wood of four tree species from six hardwood forest remnants in northern Indiana, USA. Annual nitrogen deposition rates averaged 5.8 kg ha−1 from 2000 to 2008 in this region. On average, wood δ15N values in Quercus alba have been increasing steadily over the past 100 years. In contrast, wood δ15N values have been declining in three other hardwood species – Acer saccharum, Carya ovata, and Fagus grandifolia – over the same time period. The species-specific trends suggest a change in the partitioning of ammonium and nitrate among species, due to an increase in nitrification rates over time. With no apparent net change in wood δ15N over the past century at the stand level, there is currently little evidence for consistent trends in stand-level N availability over time in the Indiana forests.

  17. Species-specific regulation of innate immunity by vitamin D signaling.

    Science.gov (United States)

    Dimitrov, Vassil; White, John H

    2016-11-01

    While many global mechanisms of innate immune responses to pathogen threat are conserved over a vast range of species, the details of those responses and their regulation appear to be highly species-specific. An array of studies over recent years has revealed that hormonal vitamin D is an important regulator of innate immunity. In humans, the hormone-bound VDR directly induces the transcription of genes encoding antimicrobial peptides (AMPs), pattern recognition receptors and key cytokines implicated in innate immune responses. We find that the vitamin D response elements (VDREs) in a number of these human genes are highly conserved in a range of primates, but not present in rodent genes. Consistent with this, VDR target genes encoding AMPs human beta-defensin 2 (HBD2) and cathelicidin (CAMP) and the pattern recognition receptor NOD2 are induced by 1,25(OH) 2 D in human cells of epithelial or myeloid origin but not similarly regulated in mouse cells. In addition, while conditioned media from human epithelial cells treated with 1,25(OH) 2 D produced antimicrobial activity against E. coli and the lung pathogen Pseudomonas aeruginosa, no such activity was detected in conditioned media from comparable 1,25(OH) 2 D-treated mouse epithelial cells. Given that other work has provided evidence that 1,25(OH) 2 D does control innate immune responses in mouse models of disease, we discuss the species-specific similarities and differences in 1,25(OH) 2 D-regulated innate immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Species-specific variation in the phosphorus nutritional sources by microphytoplankton in a Mediterranean estuary

    Directory of Open Access Journals (Sweden)

    MARLY CAROLINA MARTINEZ SOTO

    2015-08-01

    Full Text Available We investigated the species-specific phosphorus (P nutrition sources in the microphytoplankton community in the Mahon estuary (Minorca, Western Mediterranean in 2011, under two contrasting hydrographic scenarios. Estuarine flow, nutrient concentrations, phytoplankton community composition and enzyme-labeled fluorescence (ELF were measured in June and October, corresponding to the beginning and the end of summer. Dissolved inorganic nitrogen (DIN and inorganic phosphate (Pi exhibited enhanced concentrations in the inner estuary where N:P molar ratios suggested P-limitation in both surveys. Pi was low and variable (0.09±0.02 μmol•l-1 in June and 0.06±0.02 μmol•l-1 in October, whereas organic phosphorus remained a more reliable P source. Even though ambient Pi concentrations were slightly higher on June, when the microphytoplankton assemblage was dominated by dinoflagellates, the percentage of cells expressing ELF labeling was notably higher (65% of total cells than in October (12%, when the presence of diatoms characterized the microphytoplankton community. ELF was mainly expressed by dinoflagellate taxa, whereas diatoms only expressed significant AP in the inner estuary during the June survey. A P-addition bioassay in which response of AP to Pi enrichment was evaluated showed remarkable reduction in AP with increasing Pi. However, some dinoflagellate species maintained AP even when Pi was supplied in excess. We suggest that in the case of some dinoflagellate species AP is not as tightly controlled by ambient Pi as previously believed. AP activity in these species could indicate selective use of organic phosphorus, or slow metabolic response to changes in P forms, rather than physiological stress to low Pi availability. We emphasize the importance of identifying the links between the different P sources and the species-specific requirements, in order to understand the ecological response to anthropogenic biogeochemical perturbations.

  19. Teat apex colonization with coagulase-negative Staphylococcus species before parturition: Distribution and species-specific risk factors.

    Science.gov (United States)

    De Visscher, A; Piepers, S; Haesebrouck, F; De Vliegher, S

    2016-02-01

    Coagulase-negative staphylococci (CNS) are the main cause of bovine intramammary infections and are also abundantly present in extramammary habitats such as teat apices. Teat apex colonization (TAC) with CNS has already been explored in lactating dairy cows at the species level, whereas this is not true for dry cows and end-term heifers. Therefore, the aim of this observational study was to describe CNS TAC in nonlactating dairy cows and end-term heifers in Flemish dairy herds and to identify associated risk factors at the herd, cow, and quarter level. All CNS were molecularly identified to the species level using transfer RNA intergenic spacer PCR (tDNA-PCR) and sequencing of the 16S rRNA gene, allowing for species-specific statistical analyses using multivariable, multilevel logistic regression. Staphylococcus devriesei, Staphylococcus chromogenes, Staphylococcus haemolyticus, and Staphylococcus equorum were the most frequently isolated species. Staphylococcus chromogenes was the sole species colonizing teat apices of cows and heifers in all herds, whereas large between-herd differences were observed for the other species. Teat apices of red and white Holstein Friesians, of quarters dried off without an internal teat sealer, and swabbed in months with lower precipitation and higher ambient temperature were significantly more likely to be colonized by S. devriesei. Slightly dirty teat apices and teat apices swabbed in months with lower precipitation had higher odds of being colonized by S. chromogenes, whereas teat apices sampled in months with lower precipitation and higher ambient temperature were more likely to be colonized by S. haemolyticus. Dirty teat apices and teat apices swabbed in months with lower ambient temperature in combination with low precipitation had higher odds of being colonized by S. equorum. Diverse factors explaining CNS TAC, yet mostly related to humidity, ambient temperature, and hygiene, substantiate differences in epidemiological

  20. Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.

    Science.gov (United States)

    Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

    1993-02-01

    Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM.

  1. A mouse variable gene fragment binds to DNA independently of the BCR context: a possible role for immature B-cell repertoire establishment.

    Directory of Open Access Journals (Sweden)

    Andrea Queiroz Maranhão

    Full Text Available B-cell maturation occurs in several steps and requires constant stimulus for its continuing development. From the emergence of the pre-B-cell receptor, signal transduction stimulates and supports B-cell development. Current viewpoints indicate that both positive selection pressure for autoantigens and tonic signaling constitutively stimulate B-cell maturation. In this work, we tested for the presence of a putative DNA binding site in a variable gene segment in a germline configuration, independently of VDJ recombination. After a survey of the public antibody databases, we chose a single mouse heavy variable gene segment that is highly represented in anti-nucleic acid antibodies and tested it for ssDNA binding. A phage display approach was used to search for intrinsic binding to oligo deoxythymidine. The results revealed that binding to an antigen can be influenced by the use of a specific DNA binding V[Formula: see text] gene segment. Our data support the idea that some variable genes have intrinsic reactivity towards specific types of endogenous autoantigens, and this property may contribute to the establishment of the immature B-cell repertoire.

  2. An Intrabody Drug (rAAV6-INT41 Reduces the Binding of N-Terminal Huntingtin Fragment(s to DNA to Basal Levels in PC12 Cells and Delays Cognitive Loss in the R6/2 Animal Model

    Directory of Open Access Journals (Sweden)

    I. Alexandra Amaro

    2016-01-01

    Full Text Available Huntington’s disease (HD is a fatal progressive disease linked to expansion of glutamine repeats in the huntingtin protein and characterized by the progressive loss of cognitive and motor function. We show that expression of a mutant human huntingtin exon-1-GFP fusion construct results in nonspecific gene dysregulation that is significantly reduced by 50% due to coexpression of INT41, an intrabody specific for the proline-rich region of the huntingtin protein. Using stable PC12 cell lines expressing either inducible human mutant huntingtin (mHtt, Q73 or normal huntingtin (nHtt, Q23, we investigated the effect of rAAV6-INT41, an adeno-associated virus vector with the INT41 coding sequence, on the subcellular distribution of Htt. Compartmental fractionation 8 days after induction of Htt showed a 6-fold increased association of a dominate N-terminal mHtt fragment with DNA compared to N-terminal nHtt. Transduction with rAAV6-INT41 reduced DNA binding of N-terminal mHtt 6.5-fold in the nucleus and reduced nuclear translocation of the detected fragments. Subsequently, when rAAV6-INT41 is delivered to the striatum in the R6/2 mouse model, treated female mice exhibited executive function statistically indistinguishable from wild type, accompanied by reductions in Htt aggregates in the striatum, suggesting that rAAV6-INT41 is promising as a gene therapy for Huntington’s disease.

  3. Binary and ternary binding affinities between exonuclease-deficient Klenow fragment (Kf-exo(-)) and various arylamine DNA lesions characterized by surface plasmon resonance.

    Science.gov (United States)

    Vaidyanathan, V G; Xu, Lifang; Cho, Bongsup P

    2012-08-20

    We used surface plasmon resonance (SPR) to characterize the binding interactions between the exonulease-free Klenow fragment (Kf-exo(-)) and unmodified and modified dG adducts derived from arylamine carcinogens: fluorinated 2-aminofluorene (FAF), 2-acetylaminofluorene (FAAF), and 4-aminobiphenyl (FABP). Tight polymerase binding was detected with unmodified dG and the correct dCTP. The discrimination of correct versus incorrect nucleotides was pronounced with K(D) values in the order of dCTP ≪ dTTP Kf-exo(-) binding tighter to the FAAF (k(off): 0.02 s(-1)) and FABP (k(off): 0.01 s(-1)) lesions than to FAF (k(off): 0.04 s(-1)).

  4. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  5. Unlocking the "Black box": internal female genitalia in Sepsidae (Diptera) evolve fast and are species-specific

    OpenAIRE

    Puniamoorthy, Nalini; Kotrba, Marion; Meier, Rudolf

    2010-01-01

    Abstract Background The species-specificity of male genitalia has been well documented in many insect groups and sexual selection has been proposed as the evolutionary force driving the often rapid, morphological divergence. The internal female genitalia, in sharp contrast, remain poorly studied. Here, we present the first comparative study of the internal reproductive system of Sepsidae. We test the species-specificity of the female genitalia by comparing recently diverged sister taxa. We al...

  6. Species Specificity of the Putative Male Antennal Aphrodisiac Pheromone in Leptopilina heterotoma, Leptopilina boulardi, and Leptopilina victoriae

    OpenAIRE

    Ingmar Weiss; Joachim Ruther; Johannes Stökl

    2015-01-01

    Male antennal aphrodisiac pheromones have been suggested to elicit female receptiveness in several parasitic Hymenoptera, including Leptopilina boulardi. None of the proposed pheromones, however, has been fully identified to date. It is also unknown whether these antennal pheromones are species specific, because the species specificity of mate recognition and courtship elicitation in Leptopilina prevented such experiments. In this study we present an experimental design that allows the invest...

  7. Species-specific intrinsic water use efficiency and its mediation of carbon assimilation during the drought

    Science.gov (United States)

    Yi, K.; Wenzel, M. K.; Maxwell, J. T.; Novick, K. A.; Gray, A.; Roman, D. T.

    2015-12-01

    Drought is expected to occur more frequently and intensely in the future, and many studies have suggested frequent and intense droughts can significantly alter carbon and water cycling in forest ecosystems, consequently decreasing the ability of forests to assimilate carbon. Predicting the impact of drought on forest ecosystem processes requires an understanding of species-specific responses to drought, especially in eastern US where species composition is highly dynamic. An emerging approach for describing species-specific drought response is to classify the plant water use strategy into isohydric and anisohydric behaviors. Trees utilizing isohydric behavior regulate water potential by closing stomata to reduce water loss during drought conditions, while anisohydric trees allow water potential to drop by sustaining stomatal conductance, but with the risk of hydraulic failure caused by cavitation of xylem tissues. Since catastrophic cavitation occurs infrequently in the relatively wet eastern U.S., we hypothesize that 1) tree growth of isohydric trees will be more limited during the drought than the anisohydric trees due to decreased stomatal conductance, but 2) variation in intrinsic water use efficient (iWUE) during drought in isohydric trees will mediate the effects of drought on carbon assimilation. We will test these hypotheses by 1) analyzing tree-ring chronologies and dendrometer data on productivity, and 2) estimating intrinsic water use efficiency (iWUE) at multiple scales by analyzing gas exchange data for the leaf-level, inter-annual variability of d13C in tree stem cores for the tree-level, and eddy covariance technique for the stand-level. Our study site is the Morgan-Monroe State Forest (Indiana, USA). A 46 m flux tower has been continuously recording the carbon, water and energy fluxes, and tree diameter has been measured every 2 weeks using dendrometers, since 1998. Additional research, including gas exchange measurements performed during the

  8. Toxicological and chemical investigation of untreated municipal wastewater: Fraction- and species-specific toxicity.

    Science.gov (United States)

    Hrubik, Jelena; Glisic, Branka; Tubic, Aleksandra; Ivancev-Tumbas, Ivana; Kovacevic, Radmila; Samardzija, Dragana; Andric, Nebojsa; Kaisarevic, Sonja

    2016-05-01

    Absence of a municipal wastewater (WW) treatment plant results in the untreated WW discharge into the recipient. The present study investigated toxic effects and chemical composition of water extracts and fractions from untreated WW and recipient Danube River (DR). Samples were prepared by solid-phase extraction and silica gel fractionation and screened for EROD activity and cytotoxicity using aquatic models, comprising of fish liver cells (PLHC-1) and a model of the early development of zebrafish embryos, while rat (H4IIE) and human (HepG2) hepatoma cells served as mammalian models. Polar fraction caused cytotoxicity and increased the EROD activity in PLHC-1 cells, and increased mortality and developmental abnormalities in developing zebrafish embryos. In H4IIE, polar fraction induced inhibition of cell growth and increased EROD activity, whereas HepG2 exerted low or no response to the exposure. Non-polar and medium-polar fractions were ineffective. Tentative identification by GC/MS showed that WW is characterized by the hydrocarbons, alkylphenols, plasticizers, and a certain number of benzene derivatives and organic acids. In DR, smaller number of organic compounds was identified and toxicity was less pronounced than in WW treatments. The present study revealed the potent toxic effect of polar fraction of untreated WW, with biological responses varying in sensitivity across organisms. Obtained results confirmed that fraction- and species-specific toxicity should be considered when assessing health risk of environmental pollution. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Molecular evolution and species-specific expansion of the NAP members in plants.

    Science.gov (United States)

    Fan, Kai; Shen, Hao; Bibi, Noreen; Li, Feng; Yuan, Shuna; Wang, Ming; Wang, Xuede

    2015-08-01

    The NAP (NAC-Like, Activated by AP3 /PI) subfamily is one of the important plant-specific transcription factors, and controls many vital biological processes in plants. In the current study, 197 NAP proteins were identified from 31 vascular plants, but no NAP members were found in eight non-vascular plants. All NAP proteins were phylogenetically classified into two groups (NAP I and NAP II), and the origin time of the NAP I group might be relatively later than that of the NAP II group. Furthermore, species-specific gene duplications, caused by segmental duplication events, resulted in the expansion of the NAP subfamily after species-divergence. Different groups have different expansion rates, and the NAP group preference was found during the expansion in plants. Moreover, the expansion of NAP proteins may be related to the gain and loss of introns. Besides, functional divergence was limited after the gene duplication. Abscisic acid (ABA) might play an important role in leaf senescence, which is regulated by NAP subfamily. These results could lay an important foundation for expansion and evolutionary analysis of NAP subfamily in plants. © 2015 Institute of Botany, Chinese Academy of Sciences.

  10. Diversity of the skin microbiota of fishes: evidence for host species specificity.

    Science.gov (United States)

    Larsen, Andrea; Tao, Zhen; Bullard, Stephen A; Arias, Covadonga R

    2013-09-01

    Skin microbiota of Gulf of Mexico fishes were investigated by ribosomal internal spacer analysis (RISA) and 16S rRNA gene sequencing. A total of 102 fish specimens representing six species (Mugil cephalus, Lutjanus campechanus, Cynoscion nebulosus, Cynoscion arenarius, Micropogonias undulatus, and Lagodon rhomboides) were sampled at regular intervals throughout a year. The skin microbiota from each individual fish was analyzed by RISA and produced complex profiles with 23 bands on average. Similarities between RISA profiles ranged from 97.5% to 4.0%. At 70% similarity, 11 clusters were defined, each grouping individuals from the same fish species. Multidimensional scaling and analysis of similarity correlated the RISA-defined clusters with geographic locality, date, and fish species. Global R values indicated that fish species was the most indicative variable for group separation. Analysis of 16S rRNA gene sequences (from pooled samples of 10 individual fish for each fish species) showed that the Proteobacteria was the predominant phylum in skin microbiota, followed by the Firmicutes and the Actinobacteria. The distribution and abundance of bacterial sequences were different among all species analyzed. Aeribacillus was found in all fish species representing 19% of all clones sequenced, while some genera were fish species-specific (Neorickettsia in M. cephalus and Microbacterium in L. campechanus). Our data provide evidence for the existence of specific skin microbiota associated with particular fish species. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  11. Quantifying the human vaginal community state types (CSTs with the species specificity index

    Directory of Open Access Journals (Sweden)

    Zhanshan (Sam Ma

    2017-06-01

    Full Text Available The five community state types (CSTs first identified by Ravel et al. (2011 offered a powerful scheme to classify the states of human vaginal microbial communities (HVMC. The classification is a significant advance because it devised an effective handle to deal with the enormous inter-subject heterogeneity and/or intra-subject temporal variability, the quantification of which is extremely difficult but of critical importance such as the understanding of BV (bacterial vaginosis etiology. Indeed, arguably the most plausible ecological hypothesis for interpreting the BV etiology heavily depends on the CST classification (Gajer et al., 2012; Ma, Forney & Ravel, 2012; Ravel et al., 2011. Nevertheless, the current form of CSTs is still qualitative and lacks a quantitative criterion to determine the CSTs. In this article, we develop a quantitative tool that can reliably distinguish the CSTs by applying the species specificity of Mariadassou, Pichon & Ebert (2015 and the specificity aggregation index (SAI we propose in this study. The new tool accurately characterized the classifications of the five CSTs with both 400-crosssectional cohort (Ravel et al., 2011 and 32-longitudinal cohort (Gajer et al., 2012 studies originally utilized to develop the CST scheme. Furthermore, it offers a mechanistic interpretation of the original CST scheme by invoking the paradigm of specificity continuum for species adaptation and distribution. The advances we made may not only facilitate the accurate applications of the CST scheme, but also offer hints towards an effective tool for microbiome typing such as classifying gut enterotypes.

  12. Anti-infective strategies of the future: is there room for species-specific antibacterial agents?

    Science.gov (United States)

    Then, Rudolf L; Sahl, Hans-Georg

    2010-01-01

    Broad-spectrum antibiotics, directed against conserved bacterial targets, are the mainstay of antibacterial therapy. Increasing resistance, however, demands new strategies. Over time a number of therapeutic concepts have evolved, starting out with the use of polyclonal antisera, which were rapidly replaced by the easier to use antibiotics. Other concepts, such as immunotherapy, radioimmunotherapy, anti-virulence agents, phage therapy and others are under evaluation and often limited in application. In the discovery process of new antibiotics in the pharmaceutical industry quite a number of new agents have emerged, which exhibit a surprisingly high degree of species-specificity. None of them has been considered for development so far. Some examples from the literature which show selectivity for Helicobacter pylori, Pseudomonas aeruginosa, Haemophilus influenzae, Staphylococcus aureus, anaerobes, and others, will be discussed here. It is postulated that there is a room for such agents in future antibacterial therapy, e.g. in difficult to treat infections caused by nonfermenters such as multiresistant P. aerugoinosa, Acinetobacter, Enterobacteriaceae, and S.aureus, including MRSA. Their application would include monotherapy as well as combination therapy with other antibiotics, anti-virulence agents or immunotherapy and these possibilities would greatly expand the current anti-infective armamentarium.

  13. Fear conditioned discrimination of frequency modulated sweeps within species-specific calls of mustached bats.

    Directory of Open Access Journals (Sweden)

    Jie Ma

    2010-05-01

    Full Text Available Social and echolocation vocalizations of bats contain different patterns of frequency modulations. An adult bat's ability to discriminate between various FM parameters, however, is not well established. Using changes in heart rate (HR as a quantitative measure of associative learning, we demonstrate that mustached bats (Pteronotus parnellii can be fear conditioned to linear frequency modulated (FM sweeps typically centered at their acoustic fovea (approximately 60 kHz. We also show that HR is sensitive to a change in the direction of the conditional frequency modulation keeping all other parameters constant. In addition, a change in either depth or duration co-varied with FM rate is reflected in the change in HR. Finally, HR increases linearly with FM rate incremented by 0.1 kHz/ms from a pure tone to a target rate of 1.0 kHz/ms of the conditional stimulus. Learning is relatively rapid, occurring after a single training session. We also observed that fear conditioning enhances local field potential activity within the basolateral amygdala. Neural response enhancement coinciding with rapid learning and a fine scale cortical representation of FM sweeps shown earlier make FMs prime candidates for discriminating between different call types and possibly communicating socially relevant information within species-specific sounds.

  14. Biomarkers for Tuberculosis Based on Secreted, Species-Specific, Bacterial Small Molecules.

    Science.gov (United States)

    Pan, Shih-Jung; Tapley, Asa; Adamson, John; Little, Tessa; Urbanowski, Michael; Cohen, Keira; Pym, Alexander; Almeida, Deepak; Dorasamy, Afton; Layre, Emilie; Young, David C; Singh, Ravesh; Patel, Vinod B; Wallengren, Kristina; Ndung'u, Thumbi; Wilson, Douglas; Moody, D Branch; Bishai, William

    2015-12-01

    Improved biomarkers are needed for tuberculosis. To develop tests based on products secreted by tubercle bacilli that are strictly associated with viability, we evaluated 3 bacterial-derived, species-specific, small molecules as biomarkers: 2 mycobactin siderophores and tuberculosinyladenosine. Using liquid chromatography-tandem mass spectrometry, we demonstrated the presence of 1 or both mycobactins and/or tuberculosinyladenosine in serum and whole lung tissues from infected mice and sputum, cerebrospinal fluid (CSF), or lymph nodes from infected patients but not uninfected controls. Detection of the target molecules distinguished host infection status in 100% of mice with both serum and lung as the target sample. In human subjects, we evaluated detection of the bacterial small molecules (BSMs) in multiple body compartments in 3 patient cohorts corresponding to different forms of tuberculosis. We detected at least 1 of the 3 molecules in 90%, 71%, and 40% of tuberculosis patients' sputum, CSF, and lymph node samples, respectively. In paucibacillary forms of human tuberculosis, which are difficult to diagnose even with culture, detection of 1 or more BSM was rapid and compared favorably to polymerase chain reaction-based detection. Secreted BSMs, detectable in serum, warrant further investigation as a means for diagnosis and therapeutic monitoring in patients with tuberculosis. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Pyrosequencing reveals highly diverse and species-specific microbial communities in sponges from the Red Sea.

    Science.gov (United States)

    Lee, On On; Wang, Yong; Yang, Jiangke; Lafi, Feras F; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

    2011-04-01

    Marine sponges are associated with a remarkable array of microorganisms. Using a tag pyrosequencing technology, this study was the first to investigate in depth the microbial communities associated with three Red Sea sponges, Hyrtios erectus, Stylissa carteri and Xestospongia testudinaria. We revealed highly diverse sponge-associated bacterial communities with up to 1000 microbial operational taxonomic units (OTUs) and richness estimates of up to 2000 species. Altogether, 26 bacterial phyla were detected from the Red Sea sponges, 11 of which were absent from the surrounding sea water and 4 were recorded in sponges for the first time. Up to 100 OTUs with richness estimates of up to 300 archaeal species were revealed from a single sponge species. This is by far the highest archaeal diversity ever recorded for sponges. A non-negligible proportion of unclassified reads was observed in sponges. Our results demonstrated that the sponge-associated microbial communities remained highly consistent in the same sponge species from different locations, although they varied at different degrees among different sponge species. A significant proportion of the tag sequences from the sponges could be assigned to one of the sponge-specific clusters previously defined. In addition, the sponge-associated microbial communities were consistently divergent from those present in the surrounding sea water. Our results suggest that the Red Sea sponges possess highly sponge-specific or even sponge-species-specific microbial communities that are resistant to environmental disturbance, and much of their microbial diversity remains to be explored.

  16. Diastereoisomer- and species-specific distribution of hexabromocyclododecane (HBCD) in fish and marine invertebrates.

    Science.gov (United States)

    Son, Min-Hui; Kim, Jongchul; Shin, Eun-Su; Seo, Sung-hee; Chang, Yoon-Seok

    2015-12-30

    The levels and distributional characteristics of hexabromocyclododecane (HBCD) diastereoisomers have been largely reported for various fish and select shellfish. In this study, we reclassified a number and variety of marine invertebrates, including shellfish, to further contribute to the comprehensive understanding of the effects and assessment of human exposure to HBCD. Overall, 30 marine invertebrate species (n=188) were investigated and the following order of ∑2HBCD (α- and γ-HBCD) was observed: fish>chordata>cephalopoda>echinodermata>bivalve>crustacea. The marine invertebrates that were reclassified into nektonic and benthic organisms showed similar concentration of ∑2HBCD. The feeding habits and modes of the marine organisms were considered to compare the degree of bioaccumulation and diastereoisomer-specific distribution of HBCD due to the effects of the environment in and around pollution sources, as well as the organisms' metabolic capacities. To the best of our knowledge, this is the first study to examine the species-specific distribution patterns of HBCD for both fish and marine invertebrates. We expect to significantly expand the understanding of the environmental fate of HBCD for marine organisms. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. The GHKL ATPase MORC1 Modulates Species-Specific Plant Immunity in Solanaceae.

    Science.gov (United States)

    Manosalva, Patricia; Manohar, Murli; Kogel, Karl-Heinz; Kang, Hong-Gu; Klessig, Daniel F

    2015-08-01

    The microrchidia (MORC) proteins, a subset of the GHKL ATPase superfamily, were recently described as components involved in transcriptional gene silencing and plant immunity in Arabidopsis. To assess the role of MORC1 during resistance to Phytophthora infestans in solanaceous species, we altered the expression of the corresponding MORC1 homologs in potato, tomato, and Nicotiana benthamiana. Basal resistance to P. infestans was compromised in StMORC1-silenced potato and enhanced in overexpressing lines, indicating that StMORC1 positively affects immunity. By contrast, silencing SlMORC1 expression in tomato or NbMORC1 expression in N. benthamiana enhanced basal resistance to this oomycete pathogen. In addition, silencing SlMORC1 further enhanced resistance conferred by two resistance genes in tomato. Transient expression of StMORC1 in N. benthamiana accelerated cell death induced by infestin1 (INF1), whereas SlMORC1 or NbMORC1 suppressed it. Domain-swapping and mutational analyses indicated that the C-terminal region dictates the species-specific effects of the solanaceous MORC1 proteins on INF1-induced cell death. This C-terminal region also was required for homodimerization and phosphorylation of recombinant StMORC1 and SlMORC1, and its transient expression induced spontaneous cell death in N. benthamiana. Thus, this C-terminal region likely plays important roles in both determining and modulating the biological activity of MORC1 proteins.

  18. Species-specific immunity induced by infection with Entamoeba histolytica and Entamoeba moshkovskii in mice.

    Directory of Open Access Journals (Sweden)

    Chikako Shimokawa

    Full Text Available Entamoeba histolytica, the parasitic amoeba responsible for amoebiasis, causes approximately 100,000 deaths every year. There is currently no vaccine against this parasite. We have previously shown that intracecal inoculation of E. histolytica trophozoites leads to chronic and non-healing cecitis in mice. Entamoeba moshkovskii, a closely related amoeba, also causes diarrhea and other intestinal disorders in this model. Here, we investigated the effect of infection followed by drug-cure of these species on the induction of immunity against homologous or heterologous species challenge. Mice were infected with E. histolytica or E. moshkovskii and treated with metronidazole 14 days later. Re-challenge with E. histolytica or E. moshkovskii was conducted seven or 28 days following confirmation of the clearance of amoebae, and the degree of protection compared to non-exposed control mice was evaluated. We show that primary infection with these amoebae induces a species-specific immune response which protects against challenge with the homologous, but not a heterologous species. These findings pave the way, therefore, for the identification of novel amoebae antigens that may become the targets of vaccines and provide a useful platform to investigate host protective immunity to Entamoeba infections.

  19. Species-specific immunity induced by infection with Entamoeba histolytica and Entamoeba moshkovskii in mice.

    Science.gov (United States)

    Shimokawa, Chikako; Culleton, Richard; Imai, Takashi; Suzue, Kazutomo; Hirai, Makoto; Taniguchi, Tomoyo; Kobayashi, Seiki; Hisaeda, Hajime; Hamano, Shinjiro

    2013-01-01

    Entamoeba histolytica, the parasitic amoeba responsible for amoebiasis, causes approximately 100,000 deaths every year. There is currently no vaccine against this parasite. We have previously shown that intracecal inoculation of E. histolytica trophozoites leads to chronic and non-healing cecitis in mice. Entamoeba moshkovskii, a closely related amoeba, also causes diarrhea and other intestinal disorders in this model. Here, we investigated the effect of infection followed by drug-cure of these species on the induction of immunity against homologous or heterologous species challenge. Mice were infected with E. histolytica or E. moshkovskii and treated with metronidazole 14 days later. Re-challenge with E. histolytica or E. moshkovskii was conducted seven or 28 days following confirmation of the clearance of amoebae, and the degree of protection compared to non-exposed control mice was evaluated. We show that primary infection with these amoebae induces a species-specific immune response which protects against challenge with the homologous, but not a heterologous species. These findings pave the way, therefore, for the identification of novel amoebae antigens that may become the targets of vaccines and provide a useful platform to investigate host protective immunity to Entamoeba infections.

  20. Hologenome theory supported by cooccurrence networks of species-specific bacterial communities in siphonous algae (Caulerpa).

    Science.gov (United States)

    Aires, Tania; Moalic, Yann; Serrao, Ester A; Arnaud-Haond, Sophie

    2015-07-01

    The siphonous algae of the Caulerpa genus harbor internal microbial communities hypothesized to play important roles in development, defense and metabolic activities of the host. Here, we characterize the endophytic bacterial community of four Caulerpa taxa in the Mediterranean Sea, through 16S rRNA amplicon sequencing. Results reveal a striking alpha diversity of the bacterial communities, similar to levels found in sponges and coral holobionts. These comprise (1) a very small core community shared across all hosts (70%) species-specific fraction of the community, forming very specific clusters revealed by modularity in networks of cooccurrence, even in areas where distinct Caulerpa taxa occurred in sympatry. Indirect inferences based on sequence homology suggest that these communities may play an important role in the metabolism of their host, in particular on their ability to grow on anoxic sediment. These findings support the hologenome theory and the need for a holistic framework in ecological and evolutionary studies of these holobionts that frequently become invasive. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Species Specific Antiviral Activity of Porcine Interferon-α8 (IFNα8).

    Science.gov (United States)

    Kim, Eunhye; Jhun, Hyunjhung; Kim, Joohee; Park, Unjoo; Jo, Seunghyun; Kwak, Areum; Kim, Sinae; Nguyen, Tam T; Kang, Yongsun; Choi, Insoo; Lee, Joongbok; Kim, Heijun; Kim, Younghyun; Lee, Siyoung; Kim, Soohyun

    2017-12-01

    Interferons (IFNs) have been known as antiviral genes and they are classified by type 1, type 2, and type 3 IFN. The type 1 IFN consists of IFNα, IFNβ, IFNτ, and IFNω whereas the type 2 IFN consists of only IFNγ, which is a key cytokine driving T helper cell type 1 immunity. IFNλ belongs to the type 3 IFN, which is also known as IL-28 and IL-29 possessing antiviral activities. Type 1 IFN is produced by viral infection whereas type 2 IFN is induced by mitogenic or antigenic T-cell stimuli. The IFNτ of bovine was first discovered in an ungulate ruminant recognition hormone. IFNτ belongs to the type 1 IFN with the common feature of type 1 IFN such as antiviral activity. IFNs have been mostly studied for basic research and clinical usages therefore there was no effort to investigate IFNs in industrial animals. Here we cloned porcine IFNα8 from peripheral blood mononuclear cells of Korean domestic pig ( Sus scrofa domestica ). The newly cloned IFNα8 amino acid sequence from Korean domestic pig shares 98.4% identity with the known porcine IFNα8 in databank. The recombinant porcine IFNα8 showed potent antiviral activity and protected bovine Madin-Darby bovine kidney epithelial (MDBK) cells from the cytopathic effect of vesicular stomatitis virus, but it failed to protect human Wistar Institute Susan Hayflick (WISH) cells and canine Madin-Darby canine kidney epithelial-like (MDCK) cells. The present study demonstrates species specific antiviral activity of porcine IFNα8.

  2. Behavioral Relevance of Species-Specific Vasotocin Anatomy in Gregarious Finches

    Directory of Open Access Journals (Sweden)

    Aubrey M Kelly

    2013-12-01

    Full Text Available Despite substantial species differences in the vasotocin/vasopressin (VT/VP circuitry of the medial bed nucleus of the stria terminalis (BSTm and lateral septum (LS; a primary projection target of BSTm VT/VP cells, functional consequences of this variation are poorly known. Previous experiments in the highly gregarious zebra finch (Estrildidae: Taeniopygia guttata demonstrate that BSTm VT neurons promote gregariousness in a male-specific manner and reduce anxiety in both sexes. However, in contrast to the zebra finch, the less gregarious Angolan blue waxbill (Estrildidae: Uraeginthus angolensis exhibits fewer VT-immunoreactive cells in the BSTm as well as differences in receptor distribution across the LS subnuclei, suggesting that knockdown of VT production in the BSTm would produce behavioral effects in Angolan blue waxbills that are distinct from zebra finches. Thus, we here quantified social contact, gregariousness (i.e. preference for the larger of two groups, and anxiety-like behavior following bilateral antisense knockdown of VT production in the BSTm of male and female Angolan blue waxbills. We find that BSTm VT neurons promote social contact, but not gregariousness (as in male zebra finches, and that antisense effects on social contact are significantly stronger in male waxbills than in females. Knockdown of BSTm VT production has no effect on anxiety-like behavior. These data provide novel evidence that species differences in the VT/VP circuitry arising in the BSTm are accompanied by species-specific effects on affiliation behaviors.

  3. Hepatitis B Virus and Hepatitis D Virus Entry, Species Specificity, and Tissue Tropism.

    Science.gov (United States)

    Watashi, Koichi; Wakita, Takaji

    2015-08-03

    Entry of hepatitis B (HBV) and hepatitis D viruses (HDV) into a host cell represents the initial step of infection. This process requires multiple steps, including the low-affinity attachment of the virus to the cell surface, followed by high-affinity attachment to specific receptor(s), and subsequent endocytosis-mediated internalization. Within the viral envelope, the preS1 region is involved in receptor binding. Recently, sodium taurocholate cotransporting polypeptide (NTCP) has been identified as an entry receptor of HBV and HDV by affinity purification using a preS1 peptide. NTCP is mainly or exclusively expressed in the liver, and this membrane protein is at least one of the factors determining the narrow species specificity and hepatotropism of HBV and HDV. However, there are likely other factors that mediate the species and tissue tropism of HBV. This review summarizes the current understanding of the mechanisms of HBV/HDV entry. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  4. Rapid species specific identification and subtyping of Yersinia enterocolitica by MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Stephan, Roger; Cernela, Nicole; Ziegler, Dominik; Pflüger, Valentin; Tonolla, Mauro; Ravasi, Damiana; Fredriksson-Ahomaa, Maria; Hächler, Herbert

    2011-11-01

    Yersinia enterocolitica are Gram-negative pathogens and known as important causes of foodborne infections. Rapid and reliable identification of strains of the species Y. enterocolitica within the genus Yersinia and the differentiation of the pathogenic from the non-pathogenic biotypes has become increasingly important. We evaluated here the application of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid species identification and subtyping of Y. enterocolitica. To this end, we developed a reference MS database library including 19 Y. enterocolitica (non-pathogenic biotype 1A and pathogenic biotypes 2 and 4) as well as 24 non-Y. enterocolitica strains, belonging to eleven different other Yersinia spp. The strains provided reproducible and unique mass spectra profiles covering a wide molecular mass range (2000 to 30,000 Da). Species-specific and biotype-specific biomarker protein mass patterns were determined for Y. enterocolitica. The defined biomarker mass patterns (SARAMIS SuperSpectrum™) were validated using 117 strains from various Y. enterocolitica bioserotypes in a blind-test. All strains were correctly identified and for all strains the mass spectrometry-based identification scheme yielded identical results compared to a characterization by a combination of biotyping and serotyping. Our study demonstrates that MALDI-TOF-MS is a reliable and powerful tool for the rapid identification of Y. enterocolitica strains to the species level and allows subtyping of strains to the biotype level. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. RAPD Profiling, DNA Fragmentation, and Histomorphometric Examination in Brains of Wistar Rats Exposed to Indoor 2.5 Ghz Wi-Fi Devices Radiation.

    Science.gov (United States)

    Ibitayo, A O; Afolabi, O B; Akinyemi, A J; Ojiezeh, T I; Adekoya, K O; Ojewunmi, O O

    2017-01-01

    The advent of Wi-Fi connected high technology devices in executing day-to-day activities is fast evolving especially in developing countries of the world and hence the need to assess its safety among others. The present study was conducted to investigate the injurious effect of radiofrequency emissions from installed Wi-Fi devices in brains of young male rats. Animals were divided into four equal groups; group 1 served as control while groups 2, 3, and 4 were exposed to 2.5 Ghz at intervals of 30, 45, and 60 consecutive days with free access to food and water ad libitum. Alterations in harvested brain tissues were confirmed by histopathological analyses which showed vascular congestion and DNA damage in the brain was assayed using agarose gel electrophoresis. Histomorphometry analyses of their brain tissues showed perivascular congestion and tissue damage as well.

  6. Evolutionary re-wiring of p63 and the epigenomic regulatory landscape in keratinocytes and its potential implications on species-specific gene expression and phenotypes

    Science.gov (United States)

    Sethi, Isha; Gluck, Christian; Zhou, Huiqing

    2017-01-01

    Abstract Although epidermal keratinocyte development and differentiation proceeds in similar fashion between humans and mice, evolutionary pressures have also wrought significant species-specific physiological differences. These differences between species could arise in part, by the rewiring of regulatory network due to changes in the global targets of lineage-specific transcriptional master regulators such as p63. Here we have performed a systematic and comparative analysis of the p63 target gene network within the integrated framework of the transcriptomic and epigenomic landscape of mouse and human keratinocytes. We determined that there exists a core set of ∼1600 genomic regions distributed among enhancers and super-enhancers, which are conserved and occupied by p63 in keratinocytes from both species. Notably, these DNA segments are typified by consensus p63 binding motifs under purifying selection and are associated with genes involved in key keratinocyte and skin-centric biological processes. However, the majority of the p63-bound mouse target regions consist of either murine-specific DNA elements that are not alignable to the human genome or exhibit no p63 binding in the orthologous syntenic regions, typifying an occupancy lost subset. Our results suggest that these evolutionarily divergent regions have undergone significant turnover of p63 binding sites and are associated with an underlying inactive and inaccessible chromatin state, indicative of their selective functional activity in the transcriptional regulatory network in mouse but not human. Furthermore, we demonstrate that this selective targeting of genes by p63 correlates with subtle, but measurable transcriptional differences in mouse and human keratinocytes that converges on major metabolic processes, which often exhibit species-specific trends. Collectively our study offers possible molecular explanation for the observable phenotypic differences between the mouse and human skin and broadly

  7. Species-specific markers provide molecular genetic evidence for natural introgression of bullhead catfishes in Hungary

    Science.gov (United States)

    Béres, Beatrix; Kánainé Sipos, Dóra; Müller, Tamás; Staszny, Ádám; Farkas, Milán; Bakos, Katalin; Urbányi, Béla

    2017-01-01

    Since three bullhead catfish species were introduced to Europe in the late 19th century, they have spread to most European countries. In Hungary, the brown bullhead (Ameiurus nebulosus) was more widespread in the 1970s–1980s, but the black bullhead (Ameiurus melas) has gradually supplanted since their second introduction in 1980. The introgressive hybridization of the two species has been presumed based on morphological examinations, but it has not previously been supported by genetic evidence. In this study, 11 different Hungarian habitats were screened with a new species-specific nuclear genetic, duplex PCR based, marker system to distinguish the introduced catfish species, Ameiurus nebulosus, Ameiurus melas, and Ameiurus natalis, as well as the hybrids of the first two. More than 460 specimens were analyzed using the above markers and additional mitochondrial sequence analyses were also conducted on >25% of the individuals from each habitat sampled. The results showed that only 7.9% of the specimens from two habitats belonged to Ameiurus nebulosus, and 92.1% were classified as Ameiurus melas of all habitats, whereas the presence of Ameiurus natalis was not detected. Two specimens (>0.4%) showed the presence of both nuclear genomes and they were identified as hybrids of Ameiurus melas and Ameiurus nebulosus. An additional two individuals showed contradicting results from the nuclear and mitochondrial assays as a sign of a possible footprint of introgressive hybridization that might have happened two or more generations before. Surprisingly, the level of hybridization was much smaller than expected based on the analyses of the North American continent’s indigenous stock from the hybrid zones. This phenomenon has been observed in several invasive fish species and it is regarded as an added level of complexity in the management of their rapid adaptation. PMID:28265489

  8. Characterization of the fecal microbiome from non-human wild primates reveals species specific microbial communities.

    Directory of Open Access Journals (Sweden)

    Suleyman Yildirim

    Full Text Available BACKGROUND: Host-associated microbes comprise an integral part of animal digestive systems and these interactions have a long evolutionary history. It has been hypothesized that the gastrointestinal microbiome of humans and other non-human primates may have played significant roles in host evolution by facilitating a range of dietary adaptations. We have undertaken a comparative sequencing survey of the gastrointestinal microbiomes of several non-human primate species, with the goal of better understanding how these microbiomes relate to the evolution of non-human primate diversity. Here we present a comparative analysis of gastrointestinal microbial communities from three different species of Old World wild monkeys. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed fecal samples from three different wild non-human primate species (black-and-white colobus [Colubus guereza], red colobus [Piliocolobus tephrosceles], and red-tailed guenon [Cercopithecus ascanius]. Three samples from each species were subjected to small subunit rRNA tag pyrosequencing. Firmicutes comprised the vast majority of the phyla in each sample. Other phyla represented were Bacterioidetes, Proteobacteria, Spirochaetes, Actinobacteria, Verrucomicrobia, Lentisphaerae, Tenericutes, Planctomycetes, Fibrobacateres, and TM7. Bray-Curtis similarity analysis of these microbiomes indicated that microbial community composition within the same primate species are more similar to each other than to those of different primate species. Comparison of fecal microbiota from non-human primates with microbiota of human stool samples obtained in previous studies revealed that the gut microbiota of these primates are distinct and reflect host phylogeny. CONCLUSION/SIGNIFICANCE: Our analysis provides evidence that the fecal microbiomes of wild primates co-vary with their hosts, and that this is manifested in higher intraspecies similarity among wild primate species, perhaps reflecting species

  9. Assessment of Anopheles salivary antigens as individual exposure biomarkers to species-specific malaria vector bites

    Directory of Open Access Journals (Sweden)

    Ali Zakia M I

    2012-12-01

    Full Text Available Abstract Background Malaria transmission occurs during the blood feeding of infected anopheline mosquitoes concomitant with a saliva injection into the vertebrate host. In sub-Saharan Africa, most malaria transmission is due to Anopheles funestus s.s and to Anopheles gambiae s.l. (mainly Anopheles gambiae s.s. and Anopheles arabiensis. Several studies have demonstrated that the immune response against salivary antigens could be used to evaluate individual exposure to mosquito bites. The aim of this study was to assess the use of secreted salivary proteins as specific biomarkers of exposure to An. gambiae and/or An. funestus bites. Methods For this purpose, salivary gland proteins 6 (SG6 and 5′nucleotidases (5′nuc from An. gambiae (gSG6 and g-5′nuc and An. funestus (fSG6 and f-5′nuc were selected and produced in recombinant form. The specificity of the IgG response against these salivary proteins was tested using an ELISA with sera from individuals living in three Senegalese villages (NDiop, n = 50; Dielmo, n = 38; and Diama, n = 46 that had been exposed to distinct densities and proportions of the Anopheles species. Individuals who had not been exposed to these tropical mosquitoes were used as controls (Marseille, n = 45. Results The IgG responses against SG6 recombinant proteins from these two Anopheles species and against g-5′nucleotidase from An. gambiae, were significantly higher in Senegalese individuals compared with controls who were not exposed to specific Anopheles species. Conversely, an association was observed between the level of An. funestus exposure and the serological immune response levels against the f-5′nucleotidase protein. Conclusion This study revealed an Anopheles salivary antigenic protein that could be considered to be a promising antigenic marker to distinguish malaria vector exposure at the species level. The epidemiological interest of such species-specific antigenic markers is discussed.

  10. Species-specific effects of woody litter on seedling emergence and growth of herbaceous plants.

    Directory of Open Access Journals (Sweden)

    Kadri Koorem

    Full Text Available The effect of litter on seedling establishment can influence species richness in plant communities. The effect of litter depends on amount, and also on litter type, but relatively little is known about the species-specific effects of litter. We conducted a factorial greenhouse experiment to examine the effect of litter type, using two woody species that commonly co-occur in boreonemoral forest--evergreen spruce (Picea abies, deciduous hazel (Corylus avellana, and a mixture of the two species--and litter amount--shallow (4 mm, deep (12 mm and leachate--on seedling emergence and biomass of three understorey species. The effect of litter amount on seedling emergence was highly dependent on litter type; while spruce needle litter had a significant negative effect that increased with depth, seedling emergence in the presence of hazel broadleaf litter did not differ from control pots containing no litter. Mixed litter of both species also had a negative effect on seedling emergence that was intermediate compared to the single-species treatments. Spruce litter had a marginally positive (shallow or neutral effect (deep on seedling biomass, while hazel and mixed litter treatments had significant positive effects on biomass that increased with depth. We found non-additive effects of litter mixtures on seedling biomass indicating that high quality hazel litter can reduce the negative effects of spruce. Hazel litter does not inhibit seedling emergence; it increases seedling growth, and creates better conditions for seedling growth in mixtures by reducing the suppressive effect of spruce litter, having a positive effect on understorey species richness.

  11. Evidence of species-specific detoxification processes for trace elements in shorebirds.

    Science.gov (United States)

    Lucia, Magali; Bocher, Pierrick; Cosson, Richard P; Churlaud, Carine; Bustamante, Paco

    2012-11-01

    This study investigated sub-lethal effects and detoxification processes activated in free-ranging Red Knots (RKs) (Calidris canutus) from the Pertuis Charentais on the Atlantic coast of France, and compared the results with previous data obtained on another shorebird species, the Black-tailed Godwit (Limosa limosa). The concentrations of 13 trace elements (Ag, As, Cd, Co, Cr, Cu, Fe, Hg, Mn, Ni, Pb, Se, Zn) were assessed in the liver, kidneys, muscle and feathers. Stable isotope analyses of carbon and nitrogen were carried out to determine whether differences in diet explained variations in elemental uptake. The mRNA expression of relevant genes (cytochrome c oxidase 1, acetyl-CoA carboxylase, Cu/Zn and Mn superoxide dismutase, catalase, metallothionein, malic enzyme), antioxidant enzyme activities (catalase, glutathione peroxidase (GPx), superoxide dismutase), and metallothionein (MT) levels were investigated to shed light on trace element detoxification and toxic effects. Although Red Knots were characterized by elevated As and Se concentrations which were potentially toxic, most elements were usually below toxicity threshold levels. The results strongly suggested a dietary specialization of Red Knots, with individuals feeding on higher trophic status prey experiencing higher As, Hg and Se burdens. Red Knots and Godwits also showed discrepancies in elemental accumulation and detoxification processes. Higher As and Se concentrations in Red Knots enhanced catalase gene expression and enzyme activity, while Godwits had higher Ag, Cu, Fe and Zn levels and showed higher MT production and GPx activity. The results strongly suggest that detoxification pathways are essentially trace element- and species-specific.

  12. Mercury speciation analysis in seafood by species-specific isotope dilution: method validation and occurrence data

    Energy Technology Data Exchange (ETDEWEB)

    Clemens, Stephanie; Guerin, Thierry [Agence Nationale de Securite Sanitaire de l' Alimentation, Laboratoire de Securite des Aliments de Maisons-Alfort, Unite des Contaminants Inorganiques et Mineraux de l' Environnement, ANSES, Maisons-Alfort (France); Monperrus, Mathilde; Donard, Olivier F.X.; Amouroux, David [IPREM UMR 5254 CNRS - Universite de Pau et des Pays de l' Adour, Laboratoire de Chimie Analytique Bio-Inorganique et Environnement, Institut des Sciences Analytiques et de Physico-chimie pour l' Environnement et les Materiaux, Pau Cedex (France)

    2011-11-15

    Methylmercury (MeHg) and total mercury (THg) in seafood were determined using species-specific isotope dilution analysis and gas chromatography combined with inductively coupled plasma mass spectrometry. Sample preparation methods (extraction and derivation step) were evaluated on certified reference materials using isotopically enriched Hg species. Solid-liquid extraction, derivation by propylation and automated agitation gave excellent accuracy and precision results. Satisfactory figures of merit for the selected method were obtained in terms of limit of quantification (1.2 {mu}g Hg kg{sup -1} for MeHg and 1.4 {mu}g Hg kg{sup -1} for THg), repeatability (1.3-1.7%), intermediate precision reproducibility (1.5% for MeHg and 2.2% for THg) and trueness (bias error less than 7%). By means of a recent strategy based on accuracy profiles ({beta}-expectation tolerance intervals), the selected method was successfully validated in the range of approximately 0.15-5.1 mg kg{sup -1} for MeHg and 0.27-5.2 mg kg{sup -1} for THg. Probability {beta} was set to 95% and the acceptability limits to {+-}15%. The method was then applied to 62 seafood samples representative of consumption in the French population. The MeHg concentrations were generally low (1.9-588 {mu}g kg{sup -1}), and the percentage of MeHg varied from 28% to 98% in shellfish and from 84% to 97% in fish. For all real samples tested, methylation and demethylation reactions were not significant, except in one oyster sample. The method presented here could be used for monitoring food contamination by MeHg and inorganic Hg in the future to more accurately assess human exposure. (orig.)

  13. Positive selection underlies the species-specific binding of Plasmodium falciparum RH5 to human basigin.

    Science.gov (United States)

    Forni, Diego; Pontremoli, Chiara; Cagliani, Rachele; Pozzoli, Uberto; Clerici, Mario; Sironi, Manuela

    2015-09-01

    Plasmodium falciparum, the causative agent of the deadliest form of malaria, is a member of the Laverania subgenus, which includes ape-infecting parasites. P. falciparum is thought to have originated in gorillas, although infection is now restricted to humans. Laverania parasites display remarkable host-specificity, which is partially mediated by the interaction between parasite ligands and host receptors. We analyse the evolution of BSG (basigin) and GYPA (glycophorin A) in primates/hominins, as well as of their Plasmodium-encoded ligands, PfRH5 and PfEBA175. We show that, in primates, positive selection targeted two sites in BSG (F27 and H102), both involved in PfRH5 binding. A population genetics-phylogenetics approach detected the strongest selection for the gorilla lineage: one of the positively selected sites (K191) is a major determinant of PfRH5 binding affinity. Analysis of RH5 genes indicated episodic selection on the P. falciparum branch; the positively selected W447 site is known to stabilize the interaction with human basigin. Conversely, we detect no selection in the receptor-binding region of EBA175 in the P. falciparum lineage. Its host receptor, GYPA, shows evidence of positive selection in all hominid lineages; selected codons include glycosylation sites that modulate PfEBA175 binding affinity. Data herein provide an evolutionary explanation for species-specific binding of the PfRH5-BSG ligand-receptor pair and support the hypothesis that positive selection at these genes drove the host shift leading to the emergence of P. falciparum as a human pathogen. © 2015 John Wiley & Sons Ltd.

  14. Species-specific diversity of a fixed motor pattern: the electric organ discharge of Gymnotus.

    Directory of Open Access Journals (Sweden)

    Alejo Rodríguez-Cattaneo

    Full Text Available Understanding fixed motor pattern diversity across related species provides a window for exploring the evolution of their underlying neural mechanisms. The electric organ discharges of weakly electric fishes offer several advantages as paradigmatic models for investigating how a neural decision is transformed into a spatiotemporal pattern of action. Here, we compared the far fields, the near fields and the electromotive force patterns generated by three species of the pulse generating New World gymnotiform genus Gymnotus. We found a common pattern in electromotive force, with the far field and near field diversity determined by variations in amplitude, duration, and the degree of synchronization of the different components of the electric organ discharges. While the rostral regions of the three species generate similar profiles of electromotive force and local fields, most of the species-specific differences are generated in the main body and tail regions of the fish. This causes that the waveform of the field is highly site dependant in all the studied species. These findings support a hypothesis of the relative separation of the electrolocation and communication carriers. The presence of early head negative waves in the rostral region, a species-dependent early positive wave at the caudal region, and the different relationship between the late negative peak and the main positive peak suggest three points of lability in the evolution of the electrogenic system: a the variously timed neuronal inputs to different groups of electrocytes; b the appearance of both rostrally and caudally innervated electrocytes, and c changes in the responsiveness of the electrocyte membrane.

  15. Pyrosequencing reveals highly diverse and species-specific microbial communities in sponges from the Red Sea

    KAUST Repository

    Lee, Onon

    2010-11-18

    Marine sponges are associated with a remarkable array of microorganisms. Using a tag pyrosequencing technology, this study was the first to investigate in depth the microbial communities associated with three Red Sea sponges, Hyrtios erectus, Stylissa carteri and Xestospongia testudinaria. We revealed highly diverse sponge-associated bacterial communities with up to 1000 microbial operational taxonomic units (OTUs) and richness estimates of up to 2000 species. Altogether, 26 bacterial phyla were detected from the Red Sea sponges, 11 of which were absent from the surrounding sea water and 4 were recorded in sponges for the first time. Up to 100 OTUs with richness estimates of up to 300 archaeal species were revealed from a single sponge species. This is by far the highest archaeal diversity ever recorded for sponges. A non-negligible proportion of unclassified reads was observed in sponges. Our results demonstrated that the sponge-associated microbial communities remained highly consistent in the same sponge species from different locations, although they varied at different degrees among different sponge species. A significant proportion of the tag sequences from the sponges could be assigned to one of the sponge-specific clusters previously defined. In addition, the sponge-associated microbial communities were consistently divergent from those present in the surrounding sea water. Our results suggest that the Red Sea sponges possess highly sponge-specific or even sponge-species-specific microbial communities that are resistant to environmental disturbance, and much of their microbial diversity remains to be explored. © 2011 International Society for Microbial Ecology All rights reserved.

  16. Theoretical performance of non-invasive prenatal testing for chromosome imbalances using counting of cell-free DNA fragments in maternal plasma.

    Science.gov (United States)

    Benn, Peter; Cuckle, Howard

    2014-08-01

    The aim of this study was to calculate the theoretical performance of non-invasive prenatal testing based on counting methods. The calculations were based on Gaussian distributions of the percent cell-free DNA from selected chromosome regions in affected and normal pregnancies. The means were derived from the relative genomic size of the chromosome region and the fetal fraction. The standard deviations were derived from the bivariate distributions of proportional counts. Depth of sequencing was varied from 50,000,000 to 100,000 and fetal fraction from 20% to 3%. Detection rate was estimated for a fixed 0.13% false-positive rate. When either depth or fetal fraction is high, expected Down syndrome screening detection rates are high. However, when fetal fraction is low, deeper sequencing is required to obtain high detection rates. For microdeletion and microduplication screening, deeper sequencing is routinely required to consistently achieve high detection rates. There are small differences in the ability to detect a microdeletion compared with a duplication of the same size. While the theoretical calculations do not necessarily reflect the performance of currently available non-invasive prenatal testing tests, it confirms that fetal fraction is a key factor. Efficacy can be substantially altered depending on the abnormality under investigation and the depth of sequencing. © 2014 John Wiley & Sons, Ltd.

  17. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

    Science.gov (United States)

    Li, Lin-Feng; Häkkinen, Markku; Yuan, Yong-Ming; Hao, Gang; Ge, Xue-Jun

    2010-10-01

    Musaceae is a small paleotropical family. Three genera have been recognised within this family although the generic delimitations remain controversial. Most species of the family (around 65 species) have been placed under the genus Musa and its infrageneric classification has long been disputed. In this study, we obtained nuclear ribosomal ITS and chloroplast (atpB-rbcL, rps16, and trnL-F) DNA sequences of 36 species (42 accessions of ingroups representing three genera) together with 10 accessions of ingroups retrieved from GenBank database and 4 accessions of outgroups, to construct the phylogeny of the family, with a special reference to the infrageneric classification of the genus Musa. Our phylogenetic analyses elaborated previous results in supporting the monophyly of the family and suggested that Musella and Ensete may be congeneric or at least closely related, but refuted the previous infrageneric classification of Musa. None of the five sections of Musa previously defined based on morphology was recovered as monophyletic group in the molecular phylogeny. Two infrageneric clades were identified, which corresponded well to the basic chromosome numbers of x=11 and 10/9/7, respectively: the former clade comprises species from the sections Musa and Rhodochlamys while the latter contains sections of Callimusa, Australimusa, and Ingentimusa. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Need for species-specific detection for the diagnosis of amoebiasis in a non-endemic setting

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Høgh, Silje V; Chen, Ming

    2013-01-01

    The diagnosis of amoebiasis caused by Entamoeba histolytica is traditionally based on microscopy. However, the specificity of this method may be questioned, especially in areas where infections by E. histolytica are rare. In the present study, a species-specific real-time PCR was used for the ide......The diagnosis of amoebiasis caused by Entamoeba histolytica is traditionally based on microscopy. However, the specificity of this method may be questioned, especially in areas where infections by E. histolytica are rare. In the present study, a species-specific real-time PCR was used....... On specific suspicion of amoebiasis, such as the suspicion of amoebic liver abscesses, species-specific tests can be applied even after storage....

  19. Species-Specific Monoclonal Antibodies to Escherichia coli-Expressed p36 Cytosolic Protein of Mycoplasma hyopneumoniae

    Science.gov (United States)

    Caron, J.; Sawyer, N.; Moumen, B. Ben Abdel; Bouh, K. Cheikh Saad; Dea, S.

    2000-01-01

    The p36 protein of Mycoplasma hyopneumoniae is a cytosolic protein carrying species-specific antigenic determinants. Based on the genomic sequence of the reference strain ATCC 25934, primers were designed for PCR amplification of the p36-encoding gene (948 bp). These primers were shown to be specific to M. hyopneumoniae since no DNA amplicons could be obtained with other mycoplasma species and pathogenic bacteria that commonly colonize the porcine respiratory tract. The amplified p36 gene was subcloned into the pGEX-4T-1 vector to be expressed in Escherichia coli as a fusion protein with glutathione S-transferase (GST). The GST-p36 recombinant fusion protein was purified by affinity chromatography and cut by thrombin, and the enriched p36 protein was used to immunize female BALB/c mice for the production of anti-p36 monoclonal antibodies (MAbs). The polypeptide specificity of the nine MAbs obtained was confirmed by Western immunoblotting with cell lysates prepared from the homologous strain. Cross-reactivity studies of the anti-p36 MAbs towards two other M. hyopneumoniae reference strains (ATCC 25095 and J strains) and Quebec field strains that had been isolated in culture suggested that these anti-p36 MAbs were directed against a highly conserved epitope, or closely located epitopes, of the p36 protein. No reactivity was demonstrated against other mycoplasma species tested. Clinical signs and lesions suggestive of enzootic pneumonia were reproduced in specific-pathogen-free pigs infected experimentally with a virulent Quebec field strain (IAF-DM9827) of M. hyopneumoniae. The bacteria could be recovered from lung homogenates of pigs that were killed after the 3-week observation period by both PCR and cultivation procedures. Furthermore, the anti-p36 MAbs permitted effective detection by indirect immunofluorescence of M. hyopneumoniae in frozen lung sections from experimentally infected pigs. However, attempts to use the recombinant p36 protein as an antigen in an

  20. Diphtheria toxin- and Pseudomonas A toxin-mediated apoptosis. ADP ribosylation of elongation factor-2 is required for DNA fragmentation and cell lysis and synergy with tumor necrosis factor-alpha.

    Science.gov (United States)

    Morimoto, H; Bonavida, B

    1992-09-15

    We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings

  1. Species-specific photosynthetic responses of four coniferous seedlings to open-field experimental warming

    Science.gov (United States)

    Han, S.; Yoon, S. J.; Yoon, T. K.; Han, S. H.; Lee, J.; Lee, D.; Kim, S.; Hwang, J.; Cho, M.; Son, Y.

    2014-12-01

    in chlorophyll contents resulted from heat stress were observed for PD and PK. We found the species-specific responses of Pn related to the change in photosynthetic parameters following experimental warming of four 1-year-old coniferous seedlings.

  2. Organ- and species-specific accumulation of metals in two land snail species (Gastropoda, Pulmonata)

    International Nuclear Information System (INIS)

    Boshoff, Magdalena; Jordaens, Kurt; Backeljau, Thierry; Lettens, Suzanna; Tack, Filip; Vandecasteele, Bart; De Jonge, Maarten; Bervoets, Lieven

    2013-01-01

    In order to evaluate the usefulness of terrestrial gastropods as bioindicators there is a need for studies that simultaneously compare (1) concentrations of metals in reference and polluted plots, (2) species within the same polluted habitat, (3) metal accumulation patterns in different organs and (4) metal accumulation patterns in relation to soil physicochemical properties. This study aims to assess metal accumulation patterns in two land snail species. Instead of analyzing an organism as a whole, investigating the partitioning of metals in different organs can provide information on the actual toxicological relevant fractions. Therefore, concentrations of Ag, Cd, Cr, Cu, Ni and Zn were examined in five different organs of Cepaea nemoralis, as well as in the foot and the body of Succinea putris. Snails were sampled at four polluted dredged sediment disposal localities and three adjacent less polluted reference plots situated along waterways in Flanders, Belgium. Due to the small size and problematic dissection of S. putris only the concentrations in the foot of both species could be compared. For this reason only, C. nemoralis can be described as a better bioindicator species that allows a far more detailed analysis of organ metal accumulation. This study showed that organs other than the digestive gland may be involved in the immobilization and detoxification of metals. Furthermore, pH, soil fractionation (clay %, silt %, sand %) and organic matter, correlate with metal accumulation in organs. However, most often the soil metal concentrations did not correlate with the concentrations found in snail organs. Metal concentrations in organs of both species (1) differed among polluted plots but rarely between polluted and reference plots within a locality, (2) were organ-specific (digestive gland > foot > albumen gland = spermoviduct = ovotestis), (3) were species-specific and (4) depended on the metal type (high Cd and Cu concentrations were observed in the

  3. Organ- and species-specific accumulation of metals in two land snail species (Gastropoda, Pulmonata)

    Energy Technology Data Exchange (ETDEWEB)

    Boshoff, Magdalena, E-mail: magdalena.boshoff@ua.ac.be [University of Antwerp, Systemic Physiological and Ecotoxicological Research, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Jordaens, Kurt [Royal Museum for Central Africa (JEMU), Leuvensesteenweg 13, B-3080 Tervuren (Belgium); University of Antwerp, Evolutionary Ecology Group, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Backeljau, Thierry [University of Antwerp, Evolutionary Ecology Group, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Royal Belgian Institute of Natural Sciences (JEMU), Vautierstraat 29, B-1000 Brussels (Belgium); Lettens, Suzanna [Research Institute for Nature and Forest (INBO), Kliniekstraat 25, B-1070 Brussels (Belgium); Tack, Filip [Ghent University, Laboratory of Analytical Chemistry and Applied Ecochemistry, Coupure Links 265, B-9000 Ghent (Belgium); Vandecasteele, Bart [Institute for Agricultural and Fisheries Research (ILVO), Burg van Gansberghelaan 109, B-9820 Merelbeke (Belgium); De Jonge, Maarten; Bervoets, Lieven [University of Antwerp, Systemic Physiological and Ecotoxicological Research, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

    2013-04-01

    In order to evaluate the usefulness of terrestrial gastropods as bioindicators there is a need for studies that simultaneously compare (1) concentrations of metals in reference and polluted plots, (2) species within the same polluted habitat, (3) metal accumulation patterns in different organs and (4) metal accumulation patterns in relation to soil physicochemical properties. This study aims to assess metal accumulation patterns in two land snail species. Instead of analyzing an organism as a whole, investigating the partitioning of metals in different organs can provide information on the actual toxicological relevant fractions. Therefore, concentrations of Ag, Cd, Cr, Cu, Ni and Zn were examined in five different organs of Cepaea nemoralis, as well as in the foot and the body of Succinea putris. Snails were sampled at four polluted dredged sediment disposal localities and three adjacent less polluted reference plots situated along waterways in Flanders, Belgium. Due to the small size and problematic dissection of S. putris only the concentrations in the foot of both species could be compared. For this reason only, C. nemoralis can be described as a better bioindicator species that allows a far more detailed analysis of organ metal accumulation. This study showed that organs other than the digestive gland may be involved in the immobilization and detoxification of metals. Furthermore, pH, soil fractionation (clay %, silt %, sand %) and organic matter, correlate with metal accumulation in organs. However, most often the soil metal concentrations did not correlate with the concentrations found in snail organs. Metal concentrations in organs of both species (1) differed among polluted plots but rarely between polluted and reference plots within a locality, (2) were organ-specific (digestive gland > foot > albumen gland = spermoviduct = ovotestis), (3) were species-specific and (4) depended on the metal type (high Cd and Cu concentrations were observed in the

  4. Examining the species-specificity of rhesus macaque cytomegalovirus (RhCMV in cynomolgus macaques.

    Directory of Open Access Journals (Sweden)

    Angie K Marsh

    Full Text Available Cytomegalovirus (CMV is a highly species-specific virus that has co-evolved with its host over millions of years and thus restricting cross-species infection. To examine the extent to which host restriction may prevent cross-species research between closely related non-human primates, we evaluated experimental infection of cynomolgus macaques with a recombinant rhesus macaque-derived CMV (RhCMV-eGFP. Twelve cynomolgus macaques were randomly allocated to three groups: one experimental group (RhCMV-eGFP and two control groups (UV-inactivated RhCMV-eGFP or media alone. The animals were given two subcutaneous inoculations at week 0 and week 8, and a subset of animals received an intravenous inoculation at week 23. No overt clinical or haematological changes were observed and PBMCs isolated from RhCMV-eGFP inoculated animals had comparable eGFP- and IE-1-specific cellular responses to the control animals. Following inoculation with RhCMV-eGFP, we were unable to detect evidence of infection in any blood or tissue samples up to 4 years post-inoculation, using sensitive viral co-culture, qPCR, and Western blot assays. Co-culture of urine and saliva samples demonstrated the presence of endogenous cynomolgus CMV (CyCMV cytopathic effect, however no concomitant eGFP expression was observed. The absence of detectable RhCMV-eGFP suggests that the CyCMV-seropositive cynomolgus macaques were not productively infected with RhCMV-eGFP under these inoculation conditions. In a continued effort to develop CMV as a viral vector for an HIV/SIV vaccine, these studies demonstrate that CMV is highly restricted to its host species and can be highly affected by laboratory cell culture. Consideration of the differences between lab-adapted and primary viruses with respect to species range and cell tropism should be a priority in evaluating CMV as vaccine vector for HIV or other pathogens at the preclinical development stage.

  5. Elucidating Microbial Species-Specific Effects on Organic Matter Transformation in Marine Sediments

    Science.gov (United States)

    Mahmoudi, N.; Enke, T. N.; Beaupre, S. R.; Teske, A.; Cordero, O. X.; Pearson, A.

    2017-12-01

    Microbial transformation and decomposition of organic matter in sediments constitutes one of the largest fluxes of carbon in marine environments. Mineralization of sedimentary organic matter by microorganisms results in selective degradation such that bioavailable or accessible compounds are rapidly metabolized while more recalcitrant, complex compounds are preserved and buried in sediment. Recent studies have found that the ability to use different carbon sources appears to vary among microorganisms, suggesting that the availability of certain pools of carbon can be specific to the taxa that utilize the pool. This implies that organic matter mineralization in marine environments may depend on the metabolic potential of the microbial populations that are present and active. The goal of our study was to investigate the extent to which organic matter availability and transformation may be species-specific using sediment from Guaymas Basin (Gulf of California). We carried out time-series incubations using bacterial isolates and sterilized sediment in the IsoCaRB system which allowed us to measure the production rates and natural isotopic signatures (δ13C and Δ14C) of microbially-respired CO2. Separate incubations using two different marine bacterial isolates (Vibrio sp. and Pseudoalteromonas sp.) and sterilized Guaymas Basin sediment under oxic conditions showed that the rate and total quantity of organic matter metabolized by these two species differs. Approximately twice as much CO2 was collected during the Vibrio sp. incubation compared to the Pseudoalteromonas sp. incubation. Moreover, the rate at which organic matter was metabolized by the Vibrio sp. was much higher than the Pseudoalteromonas sp. indicating the intrinsic availability of organic matter in sediments may depend on the species that is present and active. Isotopic analyses of microbially respired CO2 will be used to constrain the type and age of organic matter that is accessible to each species

  6. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  7. Species-specific inflammatory responses as a primary component for the development of glomerular lesions in mice and monkeys following chronic administration of a second-generation antisense oligonucleotide.

    Science.gov (United States)

    Frazier, Kendall S; Sobry, Cécile; Derr, Victoria; Adams, Mike J; Besten, Cathaline Den; De Kimpe, Sjef; Francis, Ian; Gales, Tracy L; Haworth, Richard; Maguire, Shaun R; Mirabile, Rosanna C; Mullins, David; Palate, Bernard; Doorten, Yolanda Ponstein-Simarro; Ridings, James E; Scicchitano, Marshall S; Silvano, Jérémy; Woodfine, Jennie

    2014-07-01

    Chronic administration of drisapersen, a 2'-OMe phosphorothioate antisense oligonucleotide (AON) to mice and monkeys resulted in renal tubular accumulation, with secondary tubular degeneration. Glomerulopathy occurred in both species with species-specific characteristics. Glomerular lesions in mice were characterized by progressive hyaline matrix accumulation, accompanied by the presence of renal amyloid and with subsequent papillary necrosis. Early changes involved glomerular endothelial hypertrophy and degeneration, but the chronic glomerular amyloid and hyaline alterations in mice appeared to be species specific. An immune-mediated mechanism for the glomerular lesions in mice was supported by early inflammatory changes including increased expression of inflammatory cytokines and other immunomodulatory genes within the renal cortex, increased stimulation of CD68 protein, and systemic elevation of monocyte chemotactic protein 1. In contrast, kidneys from monkeys given drisapersen chronically showed less severe glomerular changes characterized by increased mesangial and inflammatory cells, endothelial cell hypertrophy, and subepithelial and membranous electron-dense deposits, with ultrastructural and immunohistochemical characteristics of complement and complement-related fragments. Lesions in monkeys resembled typical features of C3 glomerulopathy, a condition described in man and experimental animals to be linked to dysregulation of the alternative complement pathway. Thus, inflammatory/immune mechanisms appear critical to glomerular injury with species-specific sensitivities for mouse and monkey. The lower observed proinflammatory activity in humans as compared to mice and monkeys may reflect a lower risk of glomerular injury in patients receiving AON therapy. © 2014 by The Author(s).

  8. Species Specificity of the Putative Male Antennal Aphrodisiac Pheromone in Leptopilina heterotoma, Leptopilina boulardi, and Leptopilina victoriae

    Directory of Open Access Journals (Sweden)

    Ingmar Weiss

    2015-01-01

    Full Text Available Male antennal aphrodisiac pheromones have been suggested to elicit female receptiveness in several parasitic Hymenoptera, including Leptopilina boulardi. None of the proposed pheromones, however, has been fully identified to date. It is also unknown whether these antennal pheromones are species specific, because the species specificity of mate recognition and courtship elicitation in Leptopilina prevented such experiments. In this study we present an experimental design that allows the investigation of the species specificity of the putative male aphrodisiac pheromone of L. heterotoma, L. boulardi, and L. victoriae. This is achieved by chemical manipulation of the odour profile of heterospecific females, so that males perceive them as conspecifics and show antennal courtship behaviour. Males courted the manipulated heterospecific females and antennal contact between the male and the female was observed. However, males elicited receptiveness only in conspecific females, never in the manipulated heterospecific females. Chemical analysis showed the presence of species specific unsaturated hydrocarbons on the antennae of males. Only trace amounts of these hydrocarbons are found on the antennae of females. Our results are an important step towards the understanding and identification of antennal pheromones of parasitic wasps.

  9. Species Specificity of the Putative Male Antennal Aphrodisiac Pheromone in Leptopilina heterotoma, Leptopilina boulardi, and Leptopilina victoriae.

    Science.gov (United States)

    Weiss, Ingmar; Ruther, Joachim; Stökl, Johannes

    2015-01-01

    Male antennal aphrodisiac pheromones have been suggested to elicit female receptiveness in several parasitic Hymenoptera, including Leptopilina boulardi. None of the proposed pheromones, however, has been fully identified to date. It is also unknown whether these antennal pheromones are species specific, because the species specificity of mate recognition and courtship elicitation in Leptopilina prevented such experiments. In this study we present an experimental design that allows the investigation of the species specificity of the putative male aphrodisiac pheromone of L. heterotoma, L. boulardi, and L. victoriae. This is achieved by chemical manipulation of the odour profile of heterospecific females, so that males perceive them as conspecifics and show antennal courtship behaviour. Males courted the manipulated heterospecific females and antennal contact between the male and the female was observed. However, males elicited receptiveness only in conspecific females, never in the manipulated heterospecific females. Chemical analysis showed the presence of species specific unsaturated hydrocarbons on the antennae of males. Only trace amounts of these hydrocarbons are found on the antennae of females. Our results are an important step towards the understanding and identification of antennal pheromones of parasitic wasps.

  10. Systematic development of Phytophthora species-specific mitochondrial diagnostic markers for economically important members of the genus

    Science.gov (United States)

    The genus Phytophthora contains many invasive species to the USA that have the potential to cause significant damage to agriculture and native ecosystems. A genus and species-specific diagnostic assay was previously reported based on mitochondrial gene order differences that allowed for the systemat...

  11. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  12. Distribution of two DNA restriction fragment length polymorphisms (RFLPs) corresponding to Ag(c/g) and Ag(al/d) of the apo B gene in the Orang Asli (aborigines) of West Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Candlish, J.K.; Gajra, B; Saha, N. [National Univ. of Singapore, Kuala Lumpur (Malaysia)] [and others

    1994-09-01

    One hundred and ninety five subjects of the Semai group of Orang Asli in peninsular Malaysia were examined for the distribution of Ag(c/g) and Ag(al/d) RFLPs of the apoB gene. Regions of apoB gene corresponding to nt 421 and 1981 representing these two Ags were amplified by polymerase chain reaction using primers of published sequences. Thr{sub 71} to Ile (Ag c/g) was detected as an ApaL I RFLP and Val{sub 591} to Ala (Ag al/d) by Alu I RFLP. DNA fragments were separated by 4% agarose gel electrophoresis and photographed over a UV transilluminator. The frequencies of Ag(d) (absence of ApaL I site) and Ag(d) (presence of Alu I site) were found to be 0.13 and 0.14, respectively, in the Orang Asli compared to frequencies of 0.30 and 0.45 in the Caucasian population. Distribution of the genotypes of these two polymorphisms was at Hardy-Weinberg equiilibrium.

  13. Habitat specialization predicts genetic response to fragmentation in tropical birds.

    Science.gov (United States)

    Khimoun, Aurélie; Eraud, Cyril; Ollivier, Anthony; Arnoux, Emilie; Rocheteau, Vincent; Bely, Marine; Lefol, Emilie; Delpuech, Martin; Carpentier, Marie-Laure; Leblond, Gilles; Levesque, Anthony; Charbonnel, Anaïs; Faivre, Bruno; Garnier, Stéphane

    2016-08-01

    Habitat fragmentation is one of the most severe threats to biodiversity as it may lead to changes in population genetic structure, with ultimate modifications of species evolutionary potential and local extinctions. Nonetheless, fragmentation does not equally affect all species and identifying which ecological traits are related to species sensitivity to habitat fragmentation could help prioritization of conservation efforts. Despite the theoretical link between species ecology and extinction proneness, comparative studies explicitly testing the hypothesis that particular ecological traits underlies species-specific population structure are rare. Here, we used a comparative approach on eight bird species, co-occurring across the same fragmented landscape. For each species, we quantified relative levels of forest specialization and genetic differentiation among populations. To test the link between forest specialization and susceptibility to forest fragmentation, we assessed species responses to fragmentation by comparing levels of genetic differentiation between continuous and fragmented forest landscapes. Our results revealed a significant and substantial population structure at a very small spatial scale for mobile organisms such as birds. More importantly, we found that specialist species are more affected by forest fragmentation than generalist ones. Finally, our results suggest that even a simple habitat specialization index can be a satisfying predictor of genetic and demographic consequences of habitat fragmentation, providing a reliable practical and quantitative tool for conservation biology. © 2016 John Wiley & Sons Ltd.

  14. Species-specific polymerase chain reactions for the detection of Mycoplasma buteonis, Mycoplasma falconis, Mycoplasma gypis, and Mycoplasma corogypsi in captive birds of prey.

    Science.gov (United States)

    Lierz, Michael; Hagen, Nils; Lueschow, Doerte; Hafez, Hafez M

    2008-03-01

    Mycoplasmas are pathogens of different avian species, but the role of Mycoplasma in raptors is not yet completely determined. As Mycoplasma isolation and identification present several difficulties, species-specific polymerase chain reactions (PCRs) for the detection of mycoplasmas found in birds of prey (Mycoplasma buteonis, Mycoplasma corogypsi, Mycoplasma falconis, and Mycoplasma gypis) were established. The specificity of the PCR methods were investigated using known avian Mycoplasma reference strains and isolates as well as related bacteria and was found to be specific. Amplificons obtained with these PCRs from field samples showed no false-positive results in restriction enzyme analysis and sequencing. The sensitivities of the different PCR assays varied between 50 fg and 1 pg DNA. Twenty-five tracheal swabs from healthy captive birds of prey were investigated by culture and immunobinding assay as comparison to the PCRs. Mycoplasmal DNA was detected in 88% of the samples, with negative results only from vultures. Mycoplasma falconis and M. buteonis were regularly found in falcons, and M. gypis was found in a common buzzard. Mycoplasma corogypsi was not demonstrated. Several isolates could not be differentiated using an immunobinding assay as well as the described PCR methods.

  15. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  16. Species-specific responses of Late Quaternary megafauna to climate and humans

    DEFF Research Database (Denmark)

    Lorenzen, Eline D; Nogués-Bravo, David; Orlando, Ludovic

    2011-01-01

    Despite decades of research, the roles of climate and humans in driving the dramatic extinctions of large-bodied mammals during the Late Quaternary period remain contentious. Here we use ancient DNA, species distribution models and the human fossil record to elucidate how climate and humans shaped...... the demographic history of woolly rhinoceros, woolly mammoth, wild horse, reindeer, bison and musk ox. We show that climate has been a major driver of population change over the past 50,000 years. However, each species responds differently to the effects of climatic shifts, habitat redistribution and human...... encroachment. Although climate change alone can explain the extinction of some species, such as Eurasian musk ox and woolly rhinoceros, a combination of climatic and anthropogenic effects appears to be responsible for the extinction of others, including Eurasian steppe bison and wild horse. We find no genetic...

  17. Development of an improved species specific PCR test for detection of Haemophilus parasuis

    DEFF Research Database (Denmark)

    Angen, Øystein; Oliveira, Simone; Ahrens, Peter

    2007-01-01

    lower when tested on pure cultures of H. parasuis (5 CFU and 0.5 CFU/PCR reaction, respectively). Addition of 1.4 x 10(5) Escherichia coli to each PCR tube did not alter the sensitivity of the tests. No difference in sensitivity of the tests was observed when tested on purified DNA. On the other hand...... by Oliveira et al. [Oliveira, S., Galina, L., Pijoan, C., 2001. Development of a PCR test to diagnose Haemophilus parasuis infections. J. Vet. Diagn. Invest. 13, 495-501]. The sensitivity of the present PCR test was found to be slightly lower when applied on clinical samples from diseased pigs and 10-fold...... of H. parasuis in clinical samples, regardless of the presence of affiliated species and contaminating flora. As the two PCR tests differ in sensitivity and specificity, the use of both PCR tests for different purposes is a possibility....

  18. Malazy, a degenerate, species-specific transposable element in Cercospora zeae-maydis.

    Science.gov (United States)

    Shim, Won-Bo; Dunkle, Larry D

    2005-01-01

    Two fungal pathogens, Cercospora zeae-maydis Groups I and II, cause gray leaf spot of maize. During the sequencing of a cosmid library from C. zeae-maydis Group I, we discovered a sequence with high similarity to Maggy, a transposable element from Magnaporthe grisea. The element from C. zeae-maydis, named Malazy, contained 194-base-pair terminal repeats and sequences with high similarity to reverse transcriptase and integrase, components of the POL gene in the gypsy-like retrotransposons in fungi. Sequences with similarity to other POL gene components, protease and ribonuclease, were not detected in Malazy. A single copy of the element was detected by PCR and Southern analyses in all six North American isolates of C. zeae-maydis Group I but was not detected in the four isolates of C. zeae-maydis Group II from three continents or in phylogenetically related species. Fragments of the core domains of reverse transcriptase and integrase contained a high frequency of stop codons that were conserved in all six isolates of Group I. Additional C:G to T:A transitions in occasional isolates usually were silent mutations, while two resulted in isolate-specific stop codons. The absence of Malazy from related species suggests that it was acquired after the divergence of C. zeae-maydis Groups I and II. The high frequency of stop codons and the presence of a single copy of the element suggest that it was inactivated soon after it was acquired. Because the element is inactive and because reading frames for other genes were not found in sequences flanking the element, Malazy does not appear to be the cause of differences leading to speciation or genetic diversity between C. zeae-maydis Groups I and II.

  19. Bidirectional promoters as important drivers for the emergence of species-specific transcripts.

    Science.gov (United States)

    Gotea, Valer; Petrykowska, Hanna M; Elnitski, Laura

    2013-01-01

    The diversification of gene functions has been largely attributed to the process of gene duplication. Novel examples of genes originating from previously untranscribed regions have been recently described without regard to a unifying functional mechanism for their emergence. Here we propose a model mechanism that could generate a large number of lineage-specific novel transcripts in vertebrates through the activation of bidirectional transcription from unidirectional promoters. We examined this model in silico using human transcriptomic and genomic data and identified evidence consistent with the emergence of more than 1,000 primate-specific transcripts. These are transcripts with low coding potential and virtually no functional annotation. They initiate at less than 1 kb upstream of an oppositely transcribed conserved protein coding gene, in agreement with the generally accepted definition of bidirectional promoters. We found that the genomic regions upstream of ancestral promoters, where the novel transcripts in our dataset reside, are characterized by preferential accumulation of transposable elements. This enhances the sequence diversity of regions located upstream of ancestral promoters, further highlighting their evolutionary importance for the emergence of transcriptional novelties. By applying a newly developed test for positive selection to transposable element-derived fragments in our set of novel transcripts, we found evidence of adaptive evolution in the human lineage in nearly 3% of the novel transcripts in our dataset. These findings indicate that at least some novel transcripts could become functionally relevant, and thus highlight the evolutionary importance of promoters, through their capacity for bidirectional transcription, for the emergence of novel genes.

  20. Bidirectional promoters as important drivers for the emergence of species-specific transcripts.

    Directory of Open Access Journals (Sweden)

    Valer Gotea

    Full Text Available The diversification of gene functions has been largely attributed to the process of gene duplication. Novel examples of genes originating from previously untranscribed regions have been recently described without regard to a unifying functional mechanism for their emergence. Here we propose a model mechanism that could generate a large number of lineage-specific novel transcripts in vertebrates through the activation of bidirectional transcription from unidirectional promoters. We examined this model in silico using human transcriptomic and genomic data and identified evidence consistent with the emergence of more than 1,000 primate-specific transcripts. These are transcripts with low coding potential and virtually no functional annotation. They initiate at less than 1 kb upstream of an oppositely transcribed conserved protein coding gene, in agreement with the generally accepted definition of bidirectional promoters. We found that the genomic regions upstream of ancestral promoters, where the novel transcripts in our dataset reside, are characterized by preferential accumulation of transposable elements. This enhances the sequence diversity of regions located upstream of ancestral promoters, further highlighting their evolutionary importance for the emergence of transcriptional novelties. By applying a newly developed test for positive selection to transposable element-derived fragments in our set of novel transcripts, we found evidence of adaptive evolution in the human lineage in nearly 3% of the novel transcripts in our dataset. These findings indicate that at least some novel transcripts could become functionally relevant, and thus highlight the evolutionary importance of promoters, through their capacity for bidirectional transcription, for the emergence of novel genes.

  1. The nucleotide sequence of two restriction fragments located in the gene AB region of bacteriophage S13.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); J.H. Spencer

    1977-01-01

    textabstractThe nucleotide sequence of a double stranded DNA fragment from the gene AB region of bacteriophage S13 DNA has been determined. The fragment was isolated as two adjacent shorter fragments by cleavage of S13 replicative form (RF) DNA with restriction endonuclease III from Hemophilus

  2. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  3. Species-specific responses of Late Quaternary megafauna to climate and humans

    Science.gov (United States)

    Lorenzen, Eline D.; Nogués-Bravo, David; Orlando, Ludovic; Weinstock, Jaco; Binladen, Jonas; Marske, Katharine A.; Ugan, Andrew; Borregaard, Michael K.; Gilbert, M. Thomas P.; Nielsen, Rasmus; Ho, Simon Y. W.; Goebel, Ted; Graf, Kelly E.; Byers, David; Stenderup, Jesper T.; Rasmussen, Morten; Campos, Paula F.; Leonard, Jennifer A.; Koepfli, Klaus-Peter; Froese, Duane; Zazula, Grant; Stafford, Thomas W.; Aaris-Sørensen, Kim; Batra, Persaram; Haywood, Alan M.; Singarayer, Joy S.; Valdes, Paul J.; Boeskorov, Gennady; Burns, James A.; Davydov, Sergey P.; Haile, James; Jenkins, Dennis L.; Kosintsev, Pavel; Kuznetsova, Tatyana; Lai, Xulong; Martin, Larry D.; McDonald, H. Gregory; Mol, Dick; Meldgaard, Morten; Munch, Kasper; Stephan, Elisabeth; Sablin, Mikhail; Sommer, Robert S.; Sipko, Taras; Scott, Eric; Suchard, Marc A.; Tikhonov, Alexei; Willerslev, Rane; Wayne, Robert K.; Cooper, Alan; Hofreiter, Michael; Sher, Andrei; Shapiro, Beth; Rahbek, Carsten; Willerslev, Eske

    2014-01-01

    Despite decades of research, the roles of climate and humans in driving the dramatic extinctions of large-bodied mammals during the Late Quaternary remain contentious. We use ancient DNA, species distribution models and the human fossil record to elucidate how climate and humans shaped the demographic history of woolly rhinoceros, woolly mammoth, wild horse, reindeer, bison and musk ox. We show that climate has been a major driver of population change over the past 50,000 years. However, each species responds differently to the effects of climatic shifts, habitat redistribution and human encroachment. Although climate change alone can explain the extinction of some species, such as Eurasian musk ox and woolly rhinoceros, a combination of climatic and anthropogenic effects appears to be responsible for the extinction of others, including Eurasian steppe bison and wild horse. We find no genetic signature or any distinctive range dynamics distinguishing extinct from surviving species, underscoring the challenges associated with predicting future responses of extant mammals to climate and human-mediated habitat change. PMID:22048313

  4. What difference does it make if viruses are strain-, rather than species-specific?

    Directory of Open Access Journals (Sweden)

    Tron Frede Thingstad

    2015-04-01

    Full Text Available Theoretical work has suggested an important role of lytic viruses in controlling the diversity of their prokaryotic hosts. Yet, providing strong experimental or observational support (or refutation for this has proven evasive. Such models have usually assumed host groups to correspond to the species level, typically represented by 16S rDNA data. Recent model developments take into account the resolution of species into strains with differences in their susceptibility to viral attack. With strains as the host groups, the models will have explicit viral control of abundance at strain level, combined with explicit predator or resource control at community level, but the direct viral control at species level then disappears. Abundance of a species therefore emerges as the combination of how many strains, and at what abundance, this species can establish in competition with other species from a seeding community. We here discuss how species diversification and strain diversification may introduce competitors and defenders, respectively, and that the balance between the two may be a factor in the control of species diversity in mature natural communities. These models suggest that the balance between the two may be a factor in the control of species diversity in mature natural communities. These models can also give a dominance of individuals from strains with high cost of resistance; suggesting that the high proportion of dormant cells among pelagic heterotrophic prokaryotes may reflect their need for expensive defense rather than the lack of suitable growth substrates in their environment.

  5. Species-specific responses of Late Quaternary megafauna to climate and humans.

    Science.gov (United States)

    Lorenzen, Eline D; Nogués-Bravo, David; Orlando, Ludovic; Weinstock, Jaco; Binladen, Jonas; Marske, Katharine A; Ugan, Andrew; Borregaard, Michael K; Gilbert, M Thomas P; Nielsen, Rasmus; Ho, Simon Y W; Goebel, Ted; Graf, Kelly E; Byers, David; Stenderup, Jesper T; Rasmussen, Morten; Campos, Paula F; Leonard, Jennifer A; Koepfli, Klaus-Peter; Froese, Duane; Zazula, Grant; Stafford, Thomas W; Aaris-Sørensen, Kim; Batra, Persaram; Haywood, Alan M; Singarayer, Joy S; Valdes, Paul J; Boeskorov, Gennady; Burns, James A; Davydov, Sergey P; Haile, James; Jenkins, Dennis L; Kosintsev, Pavel; Kuznetsova, Tatyana; Lai, Xulong; Martin, Larry D; McDonald, H Gregory; Mol, Dick; Meldgaard, Morten; Munch, Kasper; Stephan, Elisabeth; Sabli