WorldWideScience

Sample records for species-specific dna fragment

  1. Generation of species-specific DNA probes for Leishmania aethiopica

    NARCIS (Netherlands)

    Laskay, T.; Kiessling, R.; Rinke deWit, T. F.; Wirth, D. F.

    1991-01-01

    We report here the cloning of kinetoplast DNA (kDNA) sequences from Leishmania aethiopica in order to develop a specific and sensitive method for the identification of the parasite. Analysis of the cloned kDNA sequences showed different taxonomic specificities demonstrating sequence diversity within

  2. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  3. Lemur species-specific metapopulation responses to habitat loss and fragmentation.

    Directory of Open Access Journals (Sweden)

    Travis S Steffens

    Full Text Available Determining what factors affect species occurrence is vital to the study of primate biogeography. We investigated the metapopulation dynamics of a lemur community consisting of eight species (Avahi occidentalis, Propithecus coquereli, Microcebus murinus, Microcebus ravelobensis, Lepilemur edwardsi, Cheirogaleus medius, Eulemur mongoz, and Eulemur fulvus within fragmented tropical dry deciduous forest habitat in Ankarafantsika National Park, Madagascar. We measured fragment size and isolation of 42 fragments of forest ranging in size from 0.23 to 117.7 ha adjacent to continuous forest. Between June and November 2011, we conducted 1218 surveys and observed six of eight lemur species (M. murinus, M. ravelobensis, C. medius, E. fulvus, P. coquereli, and L. edwardsi in the 42 fragments. We applied among patch incidence function models (IFMs with various measures of dispersal and a mainland-island IFM to lemur species occurrence, with the aim of answering the following questions: 1 Do lemur species in dry deciduous forest fragments form metapopulations? 2 What are the separate effects of area (extinction risk and connectivity/isolation (colonization potential within a lemur metapopulation? 3 Within simulated metapopulations over time, how do area and connectivity/isolation affect occurrence? and 4 What are the conservation implications of our findings? We found that M. murinus formed either a mainland-island or an among patch metapopulation, M. ravelobensis formed a mainland-island metapopulation, C. medius and E. fulvus formed among patch metapopulations, and neither P. coquereli or L. edwardsi formed a metapopulation. Metapopulation dynamics and simulations suggest that area was a more consistent positive factor determining lemur species occurrence than fragment isolation and is crucial to the maintenance of lemur populations within this fragmented landscape. Using a metapopulation approach to lemur biogeography is critical for understanding how

  4. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  5. Species-specific identification from incomplete sampling: applying DNA barcodes to monitoring invasive solanum plants.

    Science.gov (United States)

    Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong

    2013-01-01

    Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.

  6. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  7. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  8. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Using niche-modelling and species-specific cost analyses to determine a multispecies corridor in a fragmented landscape

    Science.gov (United States)

    Zurano, Juan Pablo; Selleski, Nicole; Schneider, Rosio G.

    2017-01-01

    Misiones, Argentina, contains the largest remaining tract of Upper Paraná Atlantic Forest ecoregion; however, ~50% of native forest is unprotected and located in a mosaic of plantations, agriculture, and pastures. Existing protected areas are becoming increasingly isolated due to ongoing habitat modification. These factors, combined with lower than expected regional carnivore densities, emphasize the need to understand the effect of fragmentation on animal movement and connectivity between protected areas. Using detection dogs and genetic analyses of scat, we collected data on jaguars (Panthera onca), pumas (Puma concolor), ocelots (Leopardus pardalis), oncillas (Leopardus tigrinus), and bush dogs (Speothos venaticus) across habitats that varied in vegetation, disturbance, human proximity, and protective status. With MaxEnt we evaluated habitat use, habitat suitability, and potential species richness for the five carnivores across northern-central Misiones, Argentina. Through a multifaceted cost analysis that included unique requirements of each carnivore and varying degrees of overlap among them, we determined the optimal location for primary/secondary corridors that would link the northern-central zones of the Green Corridor in Misiones and identified areas within these corridors needing priority management. A secondary analysis, comparing these multispecies corridors with the jaguar’s unique requirements, demonstrated that this multispecies approach balanced the preferences of all five species and effectively captured areas required by this highly restricted and endangered carnivore. We emphasize the potential importance of expanding beyond a single umbrella or focal species when developing biological corridors that aim to capture the varied ecological requirements of coexisting species and ecological processes across the landscape. Detection dogs and genetic analyses of scat allow data on multiple species to be collected efficiently across multiple habitat

  10. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  11. HDP2: a ribosomal DNA (NTS-ETS) sequence as a target for species-specific molecular diagnosis of intestinal taeniasis in humans.

    Science.gov (United States)

    Flores, María D; Gonzalez, Luis M; Hurtado, Carolina; Motta, Yamileth Monje; Domínguez-Hidalgo, Cristina; Merino, Francisco Jesús; Perteguer, María J; Gárate, Teresa

    2018-02-27

    Taenia solium, T. asiatica and T. saginata tapeworms cause human taeniasis and are the origin of porcine and bovine cysticercosis. Furthermore, T. solium eggs can cause human cysticercosis, with neurocysticercosis being the most serious form of the disease. These helminth infections are neglected tropical diseases and are endemic in several countries in the Americas, Asia and Africa. As a result of globalization, migration in particular, the infections have been extending to non-endemic territories. Species-specific diagnosis of taeniasis is subject to drawbacks that could be resolved using molecular approaches. In the present study, conventional and real-time amplification protocols (cPCR and qPCR) based on the T. saginata HDP2 sequence were applied in the differential diagnosis of taeniasis (T. saginata, T. solium) in both fecal samples and proglottids expelled by patients. The HDP2 homolog in T. solium was cloned and characterized. Semi-nested cPCR and qPCR (Sn-HDP2 cPCR and Sn-HDP2 qPCR) amplified T. saginata and T. solium DNA, with an analytical sensitivity of 40 and 400 fg, respectively, and identically in both protocols. Eighteen taeniasis patients were diagnosed directly with T. saginata or T. solium, either from proglottids or fecal samples with/without eggs (detected using microscopy), based on the optimized Sn-HDP2 qPCR. After cloning, the T. solium HDP2 homolog sequence was confirmed to be a ribosomal sequence. The HDP2 fragment corresponded to a non-transcribed sequence/external transcribed repeat (NTS/ETS) of ribosomal DNA. Compared with the T. saginata HDP2 homolog, the T solium HDP2 sequence lacked the first 900 nt at the 5' end and showed nucleotide substitutions and small deletions. Sn-HDP2 cPCR and Sn-HDP2 qPCR were set up for the diagnosis of human taeniasis, using proglottids and fecal samples from affected patients. The new Sn-HDP2 qPCR protocol was the best option, as it directly differentiated T. saginata from T. solium. The diagnosis of

  12. The human immunodeficiency virus-1 protein Tat and its discrete fragments evoke selective release of acetylcholine from human and rat cerebrocortical terminals through species-specific mechanisms.

    Science.gov (United States)

    Feligioni, Marco; Raiteri, Luca; Pattarini, Roberto; Grilli, Massimo; Bruzzone, Santina; Cavazzani, Paolo; Raiteri, Maurizio; Pittaluga, Anna

    2003-07-30

    The effect of the human immunodeficiency virus-1 protein Tat was investigated on neurotransmitter release from human and rat cortical nerve endings. Tat failed to affect the release of several neurotransmitters, such as glutamate, GABA, norepinephrine, and others, but it evoked the release of [3H]ACh via increase of cytosolic [Ca2+]. In human nerve terminals, the Tat effect partly depends on Ca2+ entry through voltage-sensitive Ca2+ channels, because Cd2+ halved the Tat-evoked release. Activation of group I metabotropic glutamate receptors (mGluR) and mobilization of Ca2+ from IP3-sensitive intraterminal stores are also involved, because the Tat effect was prevented by mGluR antagonists 2-methyl-6-(phenylethynyl)pyridine hydrochloride and 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester and by the IP3 receptor antagonists heparin and xestospongin C. Furthermore, the group I selective mGlu agonist (RS)-3,5-dihydroxyphenylglycine enhanced [3H]ACh release. In rat nerve terminals, the Tat-evoked release neither depends on external Ca2+ ions entry nor on IP3-mediated mechanisms. Tat seems to cause mobilization of Ca2+ from ryanodine-sensitive internal stores because its effect was prevented by both 8-bromo-cyclic adenosine diphosphate-ribose and dantrolene. The Tat-evoked release from human synaptosomes was mimicked by the peptide sequences Tat 32-62, Tat 49-86, and Tat 41-60. In contrast, the Tat 49-86 and Tat 61-80 fragments, but not the Tat 32-62 fragment, were active in rat synaptosomes. In conclusion, Tat elicits Ca2+-dependent [3H]ACh release by species-specific intraterminal mechanisms by binding via discrete amino acid sequences to different receptive sites on human and rat cholinergic terminals.

  13. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  14. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  15. The nuclear higher-order structure defined by the set of topological relationships between DNA and the nuclear matrix is species-specific in hepatocytes.

    Science.gov (United States)

    Silva-Santiago, Evangelina; Pardo, Juan Pablo; Hernández-Muñoz, Rolando; Aranda-Anzaldo, Armando

    2017-01-15

    During the interphase the nuclear DNA of metazoan cells is organized in supercoiled loops anchored to constituents of a nuclear substructure or compartment known as the nuclear matrix. The stable interactions between DNA and the nuclear matrix (NM) correspond to a set of topological relationships that define a nuclear higher-order structure (NHOS). Current evidence suggests that the NHOS is cell-type-specific. Biophysical evidence and theoretical models suggest that thermodynamic and structural constraints drive the actualization of DNA-NM interactions. However, if the topological relationships between DNA and the NM were the subject of any biological constraint with functional significance then they must be adaptive and thus be positively selected by natural selection and they should be reasonably conserved, at least within closely related species. We carried out a coarse-grained, comparative evaluation of the DNA-NM topological relationships in primary hepatocytes from two closely related mammals: rat and mouse, by determining the relative position to the NM of a limited set of target sequences corresponding to highly-conserved genomic regions that also represent a sample of distinct chromosome territories within the interphase nucleus. Our results indicate that the pattern of topological relationships between DNA and the NM is not conserved between the hepatocytes of the two closely related species, suggesting that the NHOS, like the karyotype, is species-specific. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  17. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  18. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  19. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  20. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  1. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  2. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  3. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  4. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  5. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  6. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  7. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  8. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  9. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  10. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  11. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  12. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  14. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  15. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  16. Use of species-specific PCR for the identification of 10 sea cucumber species

    Science.gov (United States)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  17. Complexities of bloom dynamics in the toxic dinoflagellate Alexandrium fundyense revealed through DNA measurements by imaging flow cytometry coupled with species-specific rRNA probes

    Science.gov (United States)

    Brosnahan, Michael L.; Farzan, Shahla; Keafer, Bruce A.; Sosik, Heidi M.; Olson, Robert J.; Anderson, Donald M.

    2014-05-01

    Measurements of the DNA content of different protist populations can shed light on a variety of processes, including cell division, sex, prey ingestion, and parasite invasion. Here, we modified an Imaging FlowCytobot (IFCB), a custom-built flow cytometer that records images of microplankton, to measure the DNA content of large dinoflagellates and other high-DNA content species. The IFCB was also configured to measure fluorescence from Cy3-labeled rRNA probes, aiding the identification of Alexandrium fundyense (syn. A. tamarense Group I), a photosynthetic dinoflagellate that causes paralytic shellfish poisoning (PSP). The modified IFCB was used to analyze samples from the development, peak and termination phases of an inshore A. fundyense bloom (Salt Pond, Eastham, MA, USA), and from a rare A. fundyense ‘red tide’ that occurred in the western Gulf of Maine, offshore of Portsmouth, NH (USA). Diploid or G2 phase (‘2C’) A. fundyense cells were frequently enriched at the near-surface, suggesting an important role for aggregation at the air-sea interface during sexual events. Also, our analysis showed that large proportions of A. fundyense cells in both the Salt Pond and red tide blooms were planozygotes during bloom decline, highlighting the importance of sexual fusion to bloom termination. At Salt Pond, bloom decline also coincided with a dramatic rise in infections by the parasite genus Amoebophrya. The samples that were most heavily infected contained many large cells with higher DNA-associated fluorescence than 2C vegetative cells, but these cells' nuclei were also frequently consumed by Amoebophrya trophonts. Neither large cell size nor increased DNA-associated fluorescence could be replicated by infecting an A. fundyense culture of vegetative cells. Therefore, we attribute these characteristics of the large Salt Pond cells to planozygote maturation rather than Amoebophrya infection, though an interaction between infection and planozygote maturation may

  18. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  19. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  20. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  1. Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

    Science.gov (United States)

    Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

    2005-08-01

    In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

  2. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  3. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  4. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  5. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  6. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  7. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  8. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  10. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  11. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  12. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  13. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  14. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  15. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  16. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  17. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  18. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  19. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  20. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  1. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  2. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  3. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  4. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  5. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

  6. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  7. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  8. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  9. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  10. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  11. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  12. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  13. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  14. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  15. OXA-258 from Achromobacter ruhlandii: a Species Specific Marker

    OpenAIRE

    Papalia, Mariana Andrea; Almuzara, Marisa; Cejas, Daniela; Traglia, German Matias; Ramirez, Maria Soledad; Galanternik, Laura; Vay, Carlos Alberto; Gutkind, Gabriel Osvaldo; Radice, Marcela Alejandra

    2015-01-01

    A new blaOXA-258 gene is described as species specific taxonomic marker for Achromobacter ruhlandii isolates (all recovered from cystic fibrosis patients). Even if the OXA-258 differs from OXA-114 variants, isolates could be misidentified as A. xiloxosidans by the amplification of an inner fragment from the OXA coding gene. A robust Identification of A. ruhlandii can be achieved by sequencing this single OXA gene as well as a more laborious recently proposed MLST scheme Fil: Papalia, Maria...

  16. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  17. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  18. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  19. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  20. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  1. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  2. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  3. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  4. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  5. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  6. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  7. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  8. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  9. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  10. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  11. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  12. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  13. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  14. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  15. Halal authenticity of gelatin using species-specific PCR.

    Science.gov (United States)

    Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

    2015-10-01

    Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  17. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  18. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  19. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  20. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  1. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  2. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  3. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  5. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  6. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  8. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  9. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  10. Species-specific AFLP markers for identification of Zingiber officinale, Z. montanum and Z. zerumbet (Zingiberaceae).

    Science.gov (United States)

    Ghosh, S; Majumder, P B; Sen Mandi, S

    2011-02-08

    The Zingiber genus, which includes the herbs known as gingers, commonly used in cooking, is well known for its medicinal properties, as described in the Indian pharmacopoeia. Different members of this genus, although somewhat similar in morphology, differ widely in their pharmacological and therapeutic properties. The most important species of this genus, with maximal therapeutic properties, is Zingiber officinale (garden ginger), which is often adulterated with other less-potent Zingiber sp. There is an existing demand in the herbal drug industry for an authentication system for the Zingiber sp in order to facilitate their commercial use as genuine phytoceuticals. To this end, we used amplified fragment length polymorphism (AFLP) to produce DNA fingerprints for three Zingiber species. Sixteen collections (six of Z. officinale, five of Z. montanum, and five of Z. zerumbet) were used in the study. Seven selective primer pairs were found to be useful for all the accessions. A total of 837 fragments were produced by these primer pairs. Species-specific markers were identified for all three Zingiber species (91 for Z. officinale, 82 for Z. montanum, and 55 for Z. zerumbet). The dendogram analysis generated from AFLP patterns showed that Z. montanum and Z. zerumbet are phylogenetically closer to each other than to Z. officinale. The AFLP fingerprints of the Zingiber species could be used to authenticate Zingiber sp-derived drugs and to resolve adulteration-related problems faced by the commercial users of these herbs.

  11. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  12. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Science.gov (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  13. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  14. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  15. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  16. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    International Nuclear Information System (INIS)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  17. DNA barcoding of freshwater fishes and the development of a quantitative qPCR assay for the species-specific detection and quantification of fish larvae from plankton samples.

    Science.gov (United States)

    Loh, W K W; Bond, P; Ashton, K J; Roberts, D T; Tibbetts, I R

    2014-08-01

    The barcoding of mitochondrial cytochrome c oxidase subunit 1 (coI) gene was amplified and sequenced from 16 species of freshwater fishes found in Lake Wivenhoe (south-eastern Queensland, Australia) to support monitoring of reservoir fish populations, ecosystem function and water health. In this study, 630-650 bp sequences of the coI barcoding gene from 100 specimens representing 15 genera, 13 families and two subclasses of fishes allowed 14 of the 16 species to be identified and differentiated. The mean ± s.e. Kimura 2 parameter divergence within and between species was 0.52 ± 0.10 and 23.8 ± 2.20% respectively, indicating that barcodes can be used to discriminate most of the fish species accurately. The two terapontids, Amniataba percoides and Leiopotherapon unicolor, however, shared coI DNA sequences and could not be differentiated using this gene. A barcoding database was established and a qPCR assay was developed using coI sequences to identify and quantify proportional abundances of fish species in ichthyoplankton samples from Lake Wivenhoe. These methods provide a viable alternative to the time-consuming process of manually enumerating and identifying ichthyoplankton samples. © 2014 The Fisheries Society of the British Isles.

  18. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  19. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  20. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  1. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  2. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  3. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  4. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  5. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    Science.gov (United States)

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  6. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  7. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  8. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Science.gov (United States)

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  9. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  10. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  11. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  12. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  13. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  15. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  16. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  17. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  18. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  19. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  20. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  1. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  2. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  3. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  4. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  5. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    Science.gov (United States)

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  6. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  7. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  8. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  9. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Science.gov (United States)

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  10. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  11. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  12. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  13. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  14. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  15. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    OpenAIRE

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  16. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  17. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    OpenAIRE

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  18. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  19. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  20. Greek PDO saffron authentication studies using species specific molecular markers.

    Science.gov (United States)

    Bosmali, I; Ordoudi, S A; Tsimidou, M Z; Madesis, P

    2017-10-01

    Saffron, the spice produced from the red stigmas of the flower of Crocus sativus L. is a frequent target of fraud and mislabeling practices that cannot be fully traced using the ISO 3632 trade standard specifications and test methods. A molecular approach is proposed herein as a promising branding strategy for the authentication of highly esteemed saffron brands such as the Greek Protected Designation of Origin (PDO) "Krokos Kozanis". Specific ISSR (inter-simple sequence repeat) markers were used to assess for the first time, the within species variability of several populations of C. sativus L. from the cultivation area of "Krokos Kozanis" as well as the potential differences with the band pattern produced by other Crocus species. Then, species-specific markers were developed taking advantage of an advanced molecular technique such as the HRM analysis coupled with universal DNA barcoding regions (trnL) (Bar-HRM) and applied to saffron admixtures with some of the most common plant adulterants (Calendula officinalis, Carthamus tinctorius, Gardenia jasminoides, Zea mays and Curcuma longa). The sensitivity of the procedure was tested for turmeric as a case study whereas HPLC-fluorescence determination of secondary metabolites was also employed for comparison. The overall results indicated that the Bar-HRM approach is quite effective in terms of specificity and sensitivity. Its effectiveness regarding the detection of turmeric was comparable to that of a conventional HPLC method (0.5% vs 1.0%, w/w). Yet, the proposed DNA-based method is much faster, cost-effective and can be used even by non-geneticists, in any laboratory having access to an HRM-capable real-time PCR instrumentation. It can be, thus, regarded as a strong analytical tool in saffron authentication studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  2. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  3. New Method for Simultaneous Species-Specific Identification of Equine Strongyles (Nematoda, Strongylida) by Reverse Line Blot Hybridization▿

    Science.gov (United States)

    Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.

    2007-01-01

    The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168

  4. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  5. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  6. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  7. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  8. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  9. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  10. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    Energy Technology Data Exchange (ETDEWEB)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr

    2014-02-07

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.

  11. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  12. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  13. IRMA iterative relaxation matrix approach for NMR structure determination application to DNA fragments

    International Nuclear Information System (INIS)

    Koning, M.M.G.

    1990-01-01

    The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs

  14. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  15. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  16. Alkaline DNA fragmentation, DNA disentanglement evaluated viscosimetrically and sister chromatid exchanges, after treatment in vivo with nitrofurantoin.

    Science.gov (United States)

    Parodi, S; Pala, M; Russo, P; Balbi, C; Abelmoschi, M L; Taningher, M; Zunino, A; Ottaggio, L; de Ferrari, M; Carbone, A; Santi, L

    1983-07-01

    Nitrofurantoin was not positive as a carcinogen in long term assays. In vitro it was positive in some short term tests and negative in others. We have examined Nitrofurantoin for its capability of inducing DNA damage in vivo. With the alkaline elution technique, Nitrofurantoin appeared clearly positive in all the tissues examined (liver, kidney, lung, spleen and bone marrow). In the liver we also observed some cross-linking effect. In bone marrow cells Nitrofurantoin was also clearly positive in terms of sister chromatid exchanges (SCEs) induction. DNA damage in vivo was also examined with a viscosimetric method, more sensitive than alkaline elution. With this method the results were essentially negative, suggesting that the two methods detect different types of damage. In view of its positivity in many organs and in two short term tests in vivo, the carcinogenic potential of Nitrofurantoin should be reconsidered.

  17. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  18. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  19. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  20. Solution structure of a short dna fragment studied by neutron scattering

    DEFF Research Database (Denmark)

    Lederer, H.; May, R. P.; Kjems, Jørgen

    1986-01-01

    -DNA. The neutron scattering curve is well fitted by that of a rigid rod with a length of 44 nm and a diameter of 2 nm. The result were confirmed by quasi-elastic light scattering and analytical centrifugation. The neutron measurements in H2O and D2O buffer reveal a cross-sectional in homogeneity not detected by X...

  1. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  2. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  3. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  4. Species specificity in major urinary proteins by parallel evolution.

    Directory of Open Access Journals (Sweden)

    Darren W Logan

    Full Text Available Species-specific chemosignals, pheromones, regulate social behaviors such as aggression, mating, pup-suckling, territory establishment, and dominance. The identity of these cues remains mostly undetermined and few mammalian pheromones have been identified. Genetically-encoded pheromones are expected to exhibit several different mechanisms for coding 1 diversity, to enable the signaling of multiple behaviors, 2 dynamic regulation, to indicate age and dominance, and 3 species-specificity. Recently, the major urinary proteins (Mups have been shown to function themselves as genetically-encoded pheromones to regulate species-specific behavior. Mups are multiple highly related proteins expressed in combinatorial patterns that differ between individuals, gender, and age; which are sufficient to fulfill the first two criteria. We have now characterized and fully annotated the mouse Mup gene content in detail. This has enabled us to further analyze the extent of Mup coding diversity and determine their potential to encode species-specific cues.Our results show that the mouse Mup gene cluster is composed of two subgroups: an older, more divergent class of genes and pseudogenes, and a second class with high sequence identity formed by recent sequential duplications of a single gene/pseudogene pair. Previous work suggests that truncated Mup pseudogenes may encode a family of functional hexapeptides with the potential for pheromone activity. Sequence comparison, however, reveals that they have limited coding potential. Similar analyses of nine other completed genomes find Mup gene expansions in divergent lineages, including those of rat, horse and grey mouse lemur, occurring independently from a single ancestral Mup present in other placental mammals. Our findings illustrate that increasing genomic complexity of the Mup gene family is not evolutionarily isolated, but is instead a recurring mechanism of generating coding diversity consistent with a species-specific

  5. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  6. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  8. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  9. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Science.gov (United States)

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  10. Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

    Science.gov (United States)

    Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

    2013-12-01

    Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  12. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  13. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  14. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  15. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  16. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  17. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  18. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  19. Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

    International Nuclear Information System (INIS)

    Peltomaa, Riikka; Vaghini, Silvia; Patiño, Belén; Benito-Peña, Elena; Moreno-Bondi, María C.

    2016-01-01

    Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

  20. Species-specific optical genosensors for the detection of mycotoxigenic Fusarium fungi in food samples

    Energy Technology Data Exchange (ETDEWEB)

    Peltomaa, Riikka; Vaghini, Silvia [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Patiño, Belén [Department of Microbiology III, Faculty of Biology, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Benito-Peña, Elena, E-mail: elenabp@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain); Moreno-Bondi, María C., E-mail: mcmbondi@ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, Complutense University, Ciudad Universitaria s/n, Madrid 28040 (Spain)

    2016-09-07

    Plant-pathogenic Fusarium species, Fusarium verticillioides and Fusarium proliferatum, are the major producers of fumonisins which are one of the most common mycotoxins found in maize. Herein, we report the development of specific and sensitive genosensors for detecting these two closely related Fusarium species in food samples. The sensors are based on species-specific capture and detection probes, which bind to the intergenic spacer region of rDNA (IGS). Oligonucleotide functionalized magnetic microbeads are used to capture the target DNA which is then detected using biotinylated detection probes and a streptavidin-coupled label. The developed genosensors had detection limits of 1.8 pM and 3.0 pM for F. proliferatum and F. verticillioides, respectively, using synthetic DNA targets. Furthermore, the biosensors were used to analyze natural fungal contamination of commercial maize samples. After amplification of the genomic DNA the sensors detected the presence of the fungi, in accordance with previous results obtained with PCR. No cross-reactivity between F. verticillioides and F. proliferatum, or other fungi species tested, was observed. The developed biosensors can provide a valuable tool to evaluate the potential for mycotoxin contamination in conditions where detection of mycotoxins directly is challenging. - Highlights: • Optical genosensors detect fumonisin producing Fusarium species in maize samples. • Oligonucleotide probes designed on the intergenic spacer region of rDNA can distinguish between closely related species. • Sandwich hybridization assay with magnetic microbeads allows species-specific detection of Fusarium spp. directly from PCR.

  1. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

    Science.gov (United States)

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2014-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

  2. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  3. Are temperate canopy spiders tree-species specific?

    Science.gov (United States)

    Mupepele, Anne-Christine; Müller, Tobias; Dittrich, Marcus; Floren, Andreas

    2014-01-01

    Arboreal spiders in deciduous and coniferous trees were investigated on their distribution and diversity. Insecticidal knock-down was used to comprehensively sample spiders from 175 trees from 2001 to 2003 in the Białowieża forest and three remote forests in Poland. We identified 140 species from 9273 adult spiders. Spider communities were distinguished between deciduous and coniferous trees. The richest fauna was collected from Quercus where beta diversity was also highest. A tree-species-specific pattern was clearly observed for Alnus, Carpinus, Picea and Pinus trees and also for those tree species that were fogged in only four or three replicates, namely Betula and Populus. This hitherto unrecognised association was mainly due to the community composition of common species identified in a Dufrene-Legendre indicator species analysis. It was not caused by spatial or temporal autocorrelation. Explaining tree-species specificity for generalist predators like spiders is difficult and has to involve physical and ecological tree parameters like linkage with the abundance of prey species. However, neither did we find a consistent correlation of prey group abundances with spiders nor could differences in spider guild composition explain the observed pattern. Our results hint towards the importance of deterministic mechanisms structuring communities of generalist canopy spiders although the casual relationship is not yet understood.

  4. A species-specific nucleosomal signature defines a periodic distribution of amino acids in proteins.

    Science.gov (United States)

    Quintales, Luis; Soriano, Ignacio; Vázquez, Enrique; Segurado, Mónica; Antequera, Francisco

    2015-04-01

    Nucleosomes are the basic structural units of chromatin. Most of the yeast genome is organized in a pattern of positioned nucleosomes that is stably maintained under a wide range of physiological conditions. In this work, we have searched for sequence determinants associated with positioned nucleosomes in four species of fission and budding yeasts. We show that mononucleosomal DNA follows a highly structured base composition pattern, which differs among species despite the high degree of histone conservation. These nucleosomal signatures are present in transcribed and non-transcribed regions across the genome. In the case of open reading frames, they correctly predict the relative distribution of codons on mononucleosomal DNA, and they also determine a periodicity in the average distribution of amino acids along the proteins. These results establish a direct and species-specific connection between the position of each codon around the histone octamer and protein composition.

  5. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  6. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  7. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  8. Sperm DNA fragmentation induced by cryopreservation: new insights and effect of a natural extract from Opuntia ficus-indica.

    Science.gov (United States)

    Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica

    2012-08-01

    To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  9. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  10. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Science.gov (United States)

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  11. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Directory of Open Access Journals (Sweden)

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  12. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  13. Forest Transpiration: Resolving Species-Specific Root Water Uptake Patterns

    Science.gov (United States)

    Blume, T.; Heidbuechel, I.; Simard, S.; Guntner, A.; Weiler, M.; Stewart, R. D.

    2016-12-01

    Transpiration and its spatio-temporal variability are still not fully understood, despite their importance for the global water cycle. This is in part due to our inability to measure transpiration comprehensively. Transpiration is usually either estimated with empirical equations based on climatic variables and crop factors, by measuring sap velocities, estimating sap wood area and scaling up to the forest stand based on a number of assumptions or by measuring the integral signal across a footprint with eddy flux towers. All these methods are focused on the cumulated loss of water to the atmosphere and do not provide information on where this water is coming from. In this study, spatio-temporal variability of root water uptake was investigated in a forest in the northeastern German lowlands. The soils are sandy and the depth of the unsaturated zone ranges from 1 to 30 m. We estimated root water uptake from different soil depths, from 0.1 m down to 2 m, based on diurnal fluctuations in soil moisture content during rain-free days. The 15 field sites cover different topographic positions and forest stands: 4 pure stands of both mature and young beech and pine and 9 mixed stands. The resulting daily data set of root water uptake shows that the forest stands differ in total amounts as well as in uptake depth distributions. Temporal dynamics of signal strength within the profile suggest a locally shifting spatial distribution of uptake that changes with water availability. The relationship of these depth-resolved uptake rates to overall soil water availability varies considerably between tree species. Using the physically-based soil hydrological model HYDRUS we investigated to what extent the observed patterns in uptake can be related to soil physical relationships alone and where tree species-specific aspects come into play. We furthermore used the model to test assumptions and estimate uncertainties of this soil moisture based estimation of plant water uptake. The

  14. Identification of hare meat by a species-specific marker of mitochondrial origin.

    Science.gov (United States)

    Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel

    2012-03-01

    Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  16. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  18. Species specific anaesthetics for fish anaesthesia and euthanasia.

    Science.gov (United States)

    Readman, Gareth D; Owen, Stewart F; Knowles, Toby G; Murrell, Joanna C

    2017-08-02

    There is a need to ensure that the care and welfare for fish maintained in the laboratory are to the highest standards. This extends to the use of anaesthetics for both scientific study, humane killing and euthanasia at end of life. An anaesthetic should not induce negative behaviours and fish should not seek to avoid the anaesthetic. Surprisingly little information is available to facilitate a humane choice of anaesthetic agent for fish despite over 100 years of use and the millions of fish currently held in thousands of laboratories worldwide. Using a chemotaxic choice chamber we found different species specific behavioural responses among four closely related fish species commonly held in the laboratory, exposed to three widely used anaesthetic agents. As previously found for zebrafish (Danio rerio), the use of MS-222 and benzocaine also appears to induce avoidance behaviours in medaka (Oryzias latipes); but etomidate could provide an alternative choice. Carp (Cyprinus carpio), although closely related to zebrafish showed avoidance behaviours to etomidate, but not benzocaine or MS-222; and rainbow trout (Oncorhynchus mykiss) showed no avoidance to the three agents tested. We were unable to ascertain avoidance responses in fathead minnows (Pimephales promelas) and suggest different test paradigms are required for that species.

  19. Biooxidation of Ciguatoxins Leads to Species-Specific Toxin Profiles.

    Science.gov (United States)

    Ikehara, Tsuyoshi; Kuniyoshi, Kyoko; Oshiro, Naomasa; Yasumoto, Takeshi

    2017-06-29

    Ciguatoxins (CTXs) contaminate fish worldwide and cause the foodborne illness ciguatera. In the Pacific, these toxins are produced by the dinoflagellate Gambierdiscus toxicus , which accumulates in fish through the food chain and undergoes oxidative modification, giving rise to numerous analogs. In this study, we examined the oxidation of CTXs in vitro with liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis using reference toxins, and found that CTX4A, CTX4B, and CTX3C, which are produced by the alga, are oxidized to the analogs found in fish, namely CTX1B, 52- epi -54-deoxyCTX1B, 54-deoxyCTX1B, 2-hydroxyCTX3C, and 2,3-dihydroxyCTX3C. This oxidation was catalyzed by human CYP3A4, fish liver S9 fractions, and microsomal fractions prepared from representative ciguateric fishes ( Lutjanus bohar , L. monostigumus , and Oplegnathus punctatus ). In addition, fish liver S9 fractions prepared from non-ciguateric fishes ( L. gibbus and L. fulviflamma ) in Okinawa also converted CTX4A and CTX4B to CTX1B, 54-deoxyCTX1B, and 52- epi -54-deoxyCTX1B in vitro. This is the first study to demonstrate the enzymatic oxidation of these toxins, and provides insight into the mechanism underlying the development of species-specific toxin profiles and the fate of these toxins in humans and fish.

  20. Influenza virus and endothelial cells: a species specific relationship

    Directory of Open Access Journals (Sweden)

    Kirsty Renfree Short

    2014-12-01

    Full Text Available Influenza A virus infection is an important cause of respiratory disease in humans. The original reservoirs of influenza A virus are wild waterfowl and shorebirds, where virus infection causes limited, if any, disease. Both in humans and in wild waterbirds, epithelial cells are the main target of infection. However, influenza virus can spread from wild bird species to terrestrial poultry. Here, the virus can evolve into highly pathogenic avian influenza (HPAI. Part of this evolution involves increased viral tropism for endothelial cells. HPAI virus infections not only cause severe disease in chickens and other terrestrial poultry species but can also spread to humans and back to wild bird populations. Here, we review the role of the endothelium in the pathogenesis of influenza virus infection in wild birds, terrestrial poultry and humans with a particular focus on HPAI viruses. We demonstrate that whilst the endothelium is an important target of virus infection in terrestrial poultry and some wild bird species, in humans the endothelium is more important in controlling the local inflammatory milieu. Thus, the endothelium plays an important, but species-specific, role in the pathogenesis of influenza virus infection.

  1. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  2. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Science.gov (United States)

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  3. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  4. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  5. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

    Science.gov (United States)

    Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

    2017-09-27

    Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  6. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Science.gov (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  7. Self-DNA inhibitory effects: Underlying mechanisms and ecological implications.

    Science.gov (United States)

    Cartenì, Fabrizio; Bonanomi, Giuliano; Giannino, Francesco; Incerti, Guido; Vincenot, Christian Ernest; Chiusano, Maria Luisa; Mazzoleni, Stefano

    2016-01-01

    DNA is usually known as the molecule that carries the instructions necessary for cell functioning and genetic inheritance. A recent discovery reported a new functional role for extracellular DNA. After fragmentation, either by natural or artificial decomposition, small DNA molecules (between ∼50 and ∼2000 bp) exert a species specific inhibitory effect on individuals of the same species. Evidence shows that such effect occurs for a wide range of organisms, suggesting a general biological process. In this paper we explore the possible molecular mechanisms behind those findings and discuss the ecological implications, specifically those related to plant species coexistence.

  8. Species-specific variation in nesting and postfledging resource selection for two forest breeding migrant songbirds.

    Directory of Open Access Journals (Sweden)

    Julianna M A Jenkins

    Full Text Available Habitat selection is a fundamental component of community ecology, population ecology, and evolutionary biology and can be especially important to species with complex annual habitat requirements, such as migratory birds. Resource preferences on the breeding grounds may change during the postfledging period for migrant songbirds, however, the degree to which selection changes, timing of change, and whether all or only a few species alter their resource use is unclear. We compared resource selection for nest sites and resource selection by postfledging juvenile ovenbirds (Seiurus aurocapilla and Acadian flycatchers (Empidonax virescens followed with radio telemetry in Missouri mature forest fragments from 2012-2015. We used Bayesian discrete choice modeling to evaluate support for local vegetation characteristics on the probability of selection for nest sites and locations utilized by different ages of postfledging juveniles. Patterns of resource selection variation were species-specific. Resource selection models indicated that Acadian flycatcher habitat selection criteria were similar for nesting and dependent postfledging juveniles and selection criteria diverged when juveniles became independent from adults. After independence, flycatcher resource selection was more associated with understory foliage density. Ovenbirds differed in selection criteria between the nesting and postfledging periods. Fledgling ovenbirds selected areas with higher densities of understory structure compared to nest sites, and the effect of foliage density on selection increased as juveniles aged and gained independence. The differences observed between two sympatric forest nesting species, in both the timing and degree of change in resource selection criteria over the course of the breeding season, illustrates the importance of considering species-specific traits and postfledging requirements when developing conservation efforts, especially when foraging guilds or

  9. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  10. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  11. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  12. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  13. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  14. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  15. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  16. Are anti-fouling effects in coralline algae species specific?

    Directory of Open Access Journals (Sweden)

    Alexandre Bigio Villas Bôas

    2004-03-01

    Full Text Available The crustose coralline algae are susceptible to be covered by other algae, which in turn can be affected by anti-fouling effects. In this study the hypothesis tested was that these algae can inhibit the growth of epiphytes in a species specific way. In the laboratory, propagules of Sargassum furcatum and Ulva fasciata were liberated and cultivated on pieces of coralline algae and slide covers (controls and their survival and growth were compared. Spongites and Hydrolithon significantly inhibited the growth of U. fasciata but not Sargassum. In the field, pieces of three species of live and dead coralline algae and their copies in epoxy putty discs were fixed on the rock. After one month epiphytic algae were identified and their dry mass quantified. Lithophyllum did not affect the epiphyte growth. In contrast Spongites and an unidentified coralline significantly inhibited the growth of Enteromorpha spp., Ulva fasciata and Hincksia mitchelliae. Colpomenia sinuosa was absent on all living crusts, but present on controls. Results show that the epiphyte-host relation depends on the species that are interacting. The sloughing of superficial cells of coralline crusts points to the possible action of physical anti-fouling effect, though a chemical one is not rejected.As algas calcárias crostosas são susceptíveis ao recobrimento por outras algas, entretanto, estas podem ser afetadas por efeitos anti-incrustantes. Neste estudo foi testada a hipótese de que estas algas possam inibir o crescimento somente de algumas espécies de epífitas. No laboratório, propágulos de Sargassum furcatum e Ulva fasciata foram liberados e cultivados sobre pedaços de algas calcárias e lamínulas de microscopia (controle e as suas sobrevivência e crescimento comparadas. Spongites e Hydrolithon inibiram significativamente o crescimento de U. fasciata, mas não de Sargassum. No campo, pedaços de três espécies de algas calcárias vivas, mortas e cópias destas em

  17. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  18. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  19. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  20. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    /child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  1. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  2. Species-specific deletion of the viral attachment glycoprotein of avian metapneumovirus.

    Science.gov (United States)

    Kong, Byung-Whi; Foster, Linda K; Foster, Douglas N

    2008-03-01

    The avian metapneumovirus (AMPV) genome encodes the fusion (F), small hydrophobic (SH), and attachment glycoprotein (G) as envelope glycoproteins. The F and G proteins mainly function to allow viral entry into host cells during the early steps of the virus life cycle. The highly variable AMPV G protein is a major determinant for distinguishing virus subtypes. Sequence analysis was used to determine if any differences between avian or mammalian cell propagated subtype C AMPV could be detected for the 1.8kb G gene. As a result, the complete 1.8kb G gene was found to be present when AMPV was propagated in our immortal turkey turbinate (TT-1) cell line regardless of passage number. Surprisingly, AMPV propagated for 15 or more passages in mammalian Vero cells revealed an essentially deleted G gene in the viral genome, resulting in no G gene mRNA expression. Although the Vero cell propagated AMPV genome contained a small 122 nucleotide fragment of the G gene, no other mRNA variants were detected from either mammalian or avian propagated AMPV. The G gene truncation might be caused by cellular molecular mechanisms that are species-specific. The lack of viral gene deletions suggests that avian cell propagated AMPV will provide a better alternative host for live recombinant vaccine development based on a reverse genetics system.

  3. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  4. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  5. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  6. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    Science.gov (United States)

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.

    Science.gov (United States)

    Barkway, Christopher P; Pocock, Rebecca L; Vrba, Vladimir; Blake, Damer P

    2015-02-20

    Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm's anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

  8. Species-specific markers for the differential diagnosis of Trypanosoma cruzi and Trypanosoma rangeli and polymorphisms detection in Trypanosoma rangeli.

    Science.gov (United States)

    Ferreira, Keila Adriana Magalhães; Fajardo, Emanuella Francisco; Baptista, Rodrigo P; Macedo, Andrea Mara; Lages-Silva, Eliane; Ramírez, Luis Eduardo; Pedrosa, André Luiz

    2014-06-01

    Trypanosoma cruzi and Trypanosoma rangeli are kinetoplastid parasites which are able to infect humans in Central and South America. Misdiagnosis between these trypanosomes can be avoided by targeting barcoding sequences or genes of each organism. This work aims to analyze the feasibility of using species-specific markers for identification of intraspecific polymorphisms and as target for diagnostic methods by PCR. Accordingly, primers which are able to specifically detect T. cruzi or T. rangeli genomic DNA were characterized. The use of intergenic regions, generally divergent in the trypanosomatids, and the serine carboxypeptidase gene were successful. Using T. rangeli genomic sequences for the identification of group-specific polymorphisms and a polymorphic AT(n) dinucleotide repeat permitted the classification of the strains into two groups, which are entirely coincident with T. rangeli main lineages, KP1 (+) and KP1 (-), previously determined by kinetoplast DNA (kDNA) characterization. The sequences analyzed totalize 622 bp (382 bp represent a hypothetical protein sequence, and 240 bp represent an anonymous sequence), and of these, 581 (93.3%) are conserved sites and 41 bp (6.7%) are polymorphic, with 9 transitions (21.9%), 2 transversions (4.9%), and 30 (73.2%) insertion/deletion events. Taken together, the species-specific markers analyzed may be useful for the development of new strategies for the accurate diagnosis of infections. Furthermore, the identification of T. rangeli polymorphisms has a direct impact in the understanding of the population structure of this parasite.

  9. Nesting behaviour influences species-specific gas exchange across avian eggshells.

    Science.gov (United States)

    Portugal, Steven J; Maurer, Golo; Thomas, Gavin H; Hauber, Mark E; Grim, Tomáš; Cassey, Phillip

    2014-09-15

    Carefully controlled gas exchange across the eggshell is essential for the development of the avian embryo. Water vapour conductance (G(H2O)) across the shell, typically measured as mass loss during incubation, has been demonstrated to optimally ensure the healthy development of the embryo while avoiding desiccation. Accordingly, eggs exposed to sub-optimal gas exchange have reduced hatching success. We tested the association between eggshell G(H2O) and putative life-history correlates of adult birds, ecological nest parameters and physical characteristics of the egg itself to investigate how variation in G(H2O) has evolved to maintain optimal water loss across a diverse set of nest environments. We measured gas exchange through eggshell fragments in 151 British breeding bird species and fitted phylogenetically controlled, general linear models to test the relationship between G(H2O) and potential predictor parameters of each species. Of our 17 life-history traits, only two were retained in the final model: wet-incubating parent and nest type. Eggs of species where the parent habitually returned to the nest with wet plumage had significantly higher G(H2O) than those of parents that returned to the nest with dry plumage. Eggs of species nesting in ground burrows, cliffs and arboreal cups had significantly higher G(H2O) than those of species nesting on the ground in open nests or cups, in tree cavities and in shallow arboreal nests. Phylogenetic signal (measured as Pagel's λ) was intermediate in magnitude, suggesting that differences observed in the G(H2O) are dependent upon a combination of shared ancestry and species-specific life history and ecological traits. Although these data are correlational by nature, they are consistent with the hypothesis that parents constrained to return to the nest with wet plumage will increase the humidity of the nest environment, and the eggs of these species have evolved a higher G(H2O) to overcome this constraint and still

  10. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  11. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  12. Species-specific evolution of class I MHC genes in iguanas (order: Squamata; subfamily: Iguaninae).

    Science.gov (United States)

    Glaberman, Scott; Caccone, Adalgisa

    2008-07-01

    Over the last few decades, the major histocompatibility complex (MHC) has emerged as a model for understanding the influence of natural selection on genetic diversity in populations as well as for investigating the genetic basis of host resistance to pathogens. However, many vertebrate taxa remain underrepresented in the field of MHC research, preventing its application to studies of disease, evolution, and conservation genetics in these groups. This is particularly true for squamates, which are by far the most diversified order of non-avian reptiles but have not been the subject of any recent MHC studies. In this paper, we present MHC class I complementary DNA data from three squamate species in the subfamily Iguaninae (iguanas): the Galápagos marine iguana (Amblyrhynchus cristatus), the Galápagos land iguana (Conolophus subcristatus), and the green iguana (Iguana iguana). All sequences obtained are related to the few published class I genes from other squamates. There is evidence for multiple loci in each species, and the conserved alpha-3 domain appears to be evolving in a species-specific manner. Conversely, there is some indication of shared polymorphism between species in the peptide-binding alpha-1 and alpha-2 domains, suggesting that these two regions have different phylogenetic histories. The great similarity between alpha-3 sequences in marine iguanas in particular suggests that concerted evolution is acting to homogenize class I loci within species. However, while less likely, the data are also compatible with a birth and death model of evolution.

  13. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  14. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Czech Academy of Sciences Publication Activity Database

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  15. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  16. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  17. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  18. QTL for the species-specific male and female genital morphologies in Ohomopterus ground beetles.

    Science.gov (United States)

    Sasabe, Masataka; Takami, Yasuoki; Sota, Teiji

    2010-12-01

    Animals with internal fertilization often exhibit marked diversification in genital morphology among closely related species. However, our knowledge of the genetic architecture underlying genital evolution is still limited. We constructed genetic linkage maps and analysed quantitative trait loci (QTL) for F(2) hybrids of two closely related species of the carabid beetles Carabus (Ohomopterus) iwawakianus and C. (O.) maiyasanus, which show matching male and female genital shapes within species, but marked differences in genital morphologies between species. The linkage maps comprised both amplified fragment length polymorphism and microsatellite markers. Composite interval mapping to detect QTL for three traits of male copulatory piece (length, width, weight) and two traits for female vaginal appendix (length, width) resulted in the detection of one to five significant QTL for each trait. The QTL explained large proportions of phenotypic variance. Thus, the interspecific difference in the genital morphologies appeared to be determined by relatively small numbers of genes with large genetic effects. QTL of different traits for the same or different sexes co-occurred on five of eight linkage groups with significant QTL; in particular, three QTL for different male and female genital traits occurred almost at the same position. Each of the male genital traits showed uniform signs of additive genetic effects, suggesting that directional selection has led to species-specific morphologies. However, the signs of additive genetic effects in each female genital trait were not uniform, suggesting that coevolution between sexes is not necessarily concerted. This result requires further assessment because the sample size of F(2) females was small. © 2010 Blackwell Publishing Ltd.

  19. Simultaneous discrimination of species and strains in Lactobacillus rhamnosus using species-specific PCR combined with multiplex mini-sequencing technology.

    Science.gov (United States)

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina; Chu, Wen-Shen

    2015-12-01

    This study described the use of species-specific PCR in combination with SNaPshot mini-sequencing to achieve species identification and strain differentiation in Lactobacillus rhamnosus. To develop species-specific PCR and strain subtyping primers, the dnaJ gene was used as a target, and its corresponding sequences were analyzed both in Lb. rhamnosus and in a subset of its phylogenetically closest species. The results indicated that the species-specific primer pair was indeed specific for Lb. rhamnosus, and the mini-sequencing assay was able to unambiguously distinguish Lb. rhamnosus strains into different haplotypes. In conclusion, we have successfully developed a rapid, accurate and cost-effective assay for inter- and intraspecies discrimination of Lb. rhamnosus, which can be applied to achieve efficient quality control of probiotic products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Link-N: The missing link towards intervertebral disc repair is species-specific.

    Directory of Open Access Journals (Sweden)

    Frances C Bach

    Full Text Available Degeneration of the intervertebral disc (IVD is a frequent cause for back pain in humans and dogs. Link-N stabilizes proteoglycan aggregates in cartilaginous tissues and exerts growth factor-like effects. The human variant of Link-N facilitates IVD regeneration in several species in vitro by inducing Smad1 signaling, but it is not clear whether this is species specific. Dogs with IVD disease could possibly benefit from Link-N treatment, but Link-N has not been tested on canine IVD cells. If Link-N appears to be effective in canines, this would facilitate translation of Link-N into the clinic using the dog as an in vivo large animal model for human IVD degeneration.This study's objective was to determine the effect of the human and canine variant of Link-N and short (s Link-N on canine chondrocyte-like cells (CLCs and compare this to those on already studied species, i.e. human and bovine CLCs. Extracellular matrix (ECM production was determined by measuring glycosaminoglycan (GAG content and histological evaluation. Additionally, the micro-aggregates' DNA content was measured. Phosphorylated (p Smad1 and -2 levels were determined using ELISA.Human (sLink-N induced GAG deposition in human and bovine CLCs, as expected. In contrast, canine (sLink-N did not affect ECM production in human CLCs, while it mainly induced collagen type I and II deposition in bovine CLCs. In canine CLCs, both canine and human (sLink-N induced negligible GAG deposition. Surprisingly, human and canine (sLink-N did not induce Smad signaling in human and bovine CLCs. Human and canine (sLink-N only mildly increased pSmad1 and Smad2 levels in canine CLCs.Human and canine (sLink-N exerted species-specific effects on CLCs from early degenerated IVDs. Both variants, however, lacked the potency as canine IVD regeneration agent. While these studies demonstrate the challenges of translational studies in large animal models, (sLink-N still holds a regenerative potential for humans.

  1. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  2. Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

    Directory of Open Access Journals (Sweden)

    Yukio Kurihara

    2014-12-01

    Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

  3. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

    Directory of Open Access Journals (Sweden)

    Gusti Ngurah Permana

    2016-11-01

    The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

  5. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by crocin from kashmiri saffron in a human pancreatic cancer cell line.

    Science.gov (United States)

    Bakshi, Hamid; Sam, Smitha; Rozati, Roya; Sultan, Phalisteen; Islam, Tajamul; Rathore, Babita; Lone, Zahoor; Sharma, Manik; Triphati, Jagrati; Saxena, Ramesh Chand

    2010-01-01

    Apoptosis, a widely important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus in different cancer types. The present study was designed to elucidate apoptosis induction by crocin, a main component of Crocus sativus in a human pancreatic cancer cell line (BxPC-3). Cell viability was measured by MTT assay, Hoechest33258 staining was used to detect the chromatin condensation characteristic of apoptosis, and DNA fragmentation was assessed by gel electrophoresis and cell cycle analysis by flow cytometry. Crocin induced apoptosis and G1-phase cell cycle arrest of BxPC-3 cells, while decreasing cell viability in a dose dependent and time dependent manner. Cells treated with 10μg/L crocin exhibited apoptotic morphology (brightly blue-fluorescent condensed nuclei on Hoechst 33258 staining) and reduction of volume. DNA analysis revealed typical ladders as early as 12 hours after treatment indicative of apoptosis. Our preclinical study demonstrated a pancreatic cancer cell line to be highly sensitive to crocin-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of crocin action are not yet clearly understood, it appears to have potential as a therapeutic agent.

  6. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    Directory of Open Access Journals (Sweden)

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  7. Scrambled eggs: A highly sensitive molecular diagnostic workflow for Fasciola species specific detection from faecal samples

    Science.gov (United States)

    Calvani, Nichola Eliza Davies; Windsor, Peter Andrew; Bush, Russell David

    2017-01-01

    transport of samples from endemic to non-endemic countries without the requirement of a complete cold chain. The commercially-available ELISA displayed poorer sensitivity, even after adjustment of the positive threshold (65–88%), compared to the sensitivity (91–100%) of the new molecular diagnostic workflow. Conclusions/Significance Species-specific assays for sensitive detection of Fasciola spp. enable ante-mortem diagnosis in both human and animal settings. This includes Southeast Asia where there are potentially many undocumented human cases and where post-mortem examination of production animals can be difficult. The new molecular workflow provides a sensitive and quantitative diagnostic approach for the rapid testing of medium to large sample sizes, potentially superseding the traditional sedimentation and FEC technique and enabling surveillance programs in locations where animal and human health funding is limited. PMID:28915255

  8. Scrambled eggs: A highly sensitive molecular diagnostic workflow for Fasciola species specific detection from faecal samples.

    Directory of Open Access Journals (Sweden)

    Nichola Eliza Davies Calvani

    2017-09-01

    to non-endemic countries without the requirement of a complete cold chain. The commercially-available ELISA displayed poorer sensitivity, even after adjustment of the positive threshold (65-88%, compared to the sensitivity (91-100% of the new molecular diagnostic workflow.Species-specific assays for sensitive detection of Fasciola spp. enable ante-mortem diagnosis in both human and animal settings. This includes Southeast Asia where there are potentially many undocumented human cases and where post-mortem examination of production animals can be difficult. The new molecular workflow provides a sensitive and quantitative diagnostic approach for the rapid testing of medium to large sample sizes, potentially superseding the traditional sedimentation and FEC technique and enabling surveillance programs in locations where animal and human health funding is limited.

  9. Scrambled eggs: A highly sensitive molecular diagnostic workflow for Fasciola species specific detection from faecal samples.

    Science.gov (United States)

    Calvani, Nichola Eliza Davies; Windsor, Peter Andrew; Bush, Russell David; Šlapeta, Jan

    2017-09-01

    -endemic countries without the requirement of a complete cold chain. The commercially-available ELISA displayed poorer sensitivity, even after adjustment of the positive threshold (65-88%), compared to the sensitivity (91-100%) of the new molecular diagnostic workflow. Species-specific assays for sensitive detection of Fasciola spp. enable ante-mortem diagnosis in both human and animal settings. This includes Southeast Asia where there are potentially many undocumented human cases and where post-mortem examination of production animals can be difficult. The new molecular workflow provides a sensitive and quantitative diagnostic approach for the rapid testing of medium to large sample sizes, potentially superseding the traditional sedimentation and FEC technique and enabling surveillance programs in locations where animal and human health funding is limited.

  10. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

    1986-01-01

    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  11. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  12. Molecular diagnostic for boll weevil (Coleoptera: Curculionidae) based on amplification of three species-specific microsatellites.

    Science.gov (United States)

    Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W

    2009-04-01

    The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.

  13. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Directory of Open Access Journals (Sweden)

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  14. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  15. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Science.gov (United States)

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  16. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Science.gov (United States)

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  17. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  18. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  19. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  20. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Comprehensive analysis of sperm DNA fragmentation by five different assays: TUNEL assay, SCSA, SCD test and alkaline and neutral Comet assay.

    Science.gov (United States)

    Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J

    2013-09-01

    Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.

  2. The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling.

    Directory of Open Access Journals (Sweden)

    Chad R Sethman

    Full Text Available Sterile alpha and armadillo-motif containing protein (SARM, a highly conserved and structurally unique member of the MyD88 family of Toll-like receptor adaptors, plays an important role in innate immunity signaling and apoptosis. Its exact mechanism of intracellular action remains unclear. Apoptosis is an ancient and ubiquitous process of programmed cell death that results in disruption of the nuclear lamina and, ultimately, dismantling of the nucleus. In addition to supporting the nuclear membrane, lamins serve important roles in chromatin organization, epigenetic regulation, transcription, nuclear transport, and mitosis. Mutations and other damage that destabilize nuclear lamins (laminopathies underlie a number of intractable human diseases. Here, we report that SARM translocates to the nucleus of human embryonic kidney cells by using its amino-terminal Armadillo repeat region. Within the nucleus, SARM forms a previously unreported lattice akin to the nuclear lamina scaffold. Moreover, we show that SARM protects lamins from apoptotic degradation and reduces internucleosomal DNA fragmentation in response to signaling induced by the proinflammatory cytokine Tumor Necrosis Factor alpha. These findings indicate an important link between the innate immunity adaptor SARM and stabilization of nuclear lamins during inflammation-driven apoptosis in human cells.

  3. Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

    Directory of Open Access Journals (Sweden)

    A. Yu. Popova

    2015-01-01

    Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

  4. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  5. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  6. The CRISPR Spacer Space Is Dominated by Sequences from Species-Specific Mobilomes.

    Science.gov (United States)

    Shmakov, Sergey A; Sitnik, Vassilii; Makarova, Kira S; Wolf, Yuri I; Severinov, Konstantin V; Koonin, Eugene V

    2017-09-19

    Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein (CRISPR-Cas) systems store the memory of past encounters with foreign DNA in unique spacers that are inserted between direct repeats in CRISPR arrays. For only a small fraction of the spacers, homologous sequences, called protospacers, are detectable in viral, plasmid, and microbial genomes. The rest of the spacers remain the CRISPR "dark matter." We performed a comprehensive analysis of the spacers from all CRISPR- cas loci identified in bacterial and archaeal genomes, and we found that, depending on the CRISPR-Cas subtype and the prokaryotic phylum, protospacers were detectable for 1% to about 19% of the spacers (~7% global average). Among the detected protospacers, the majority, typically 80 to 90%, originated from viral genomes, including proviruses, and among the rest, the most common source was genes that are integrated into microbial chromosomes but are involved in plasmid conjugation or replication. Thus, almost all spacers with identifiable protospacers target mobile genetic elements (MGE). The GC content, as well as dinucleotide and tetranucleotide compositions, of microbial genomes, their spacer complements, and the cognate viral genomes showed a nearly perfect correlation and were almost identical. Given the near absence of self-targeting spacers, these findings are most compatible with the possibility that the spacers, including the dark matter, are derived almost completely from the species-specific microbial mobilomes. IMPORTANCE The principal function of CRISPR-Cas systems is thought to be protection of bacteria and archaea against viruses and other parasitic genetic elements. The CRISPR defense function is mediated by sequences from parasitic elements, known as spacers, that are inserted into CRISPR arrays and then transcribed and employed as guides to identify and inactivate the cognate parasitic genomes. However, only a small fraction of the CRISPR spacers

  7. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

    Science.gov (United States)

    Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

    2017-01-01

    Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

  8. Development of a Species-specific PCR Assay for Three Xanthomonas Species, Causing Bulb and Flower Diseases, Based on Their Genome Sequences

    Directory of Open Access Journals (Sweden)

    Chang-Gi Back

    2015-09-01

    Full Text Available In this study, we developed a species-specific PCR assay for rapid and accurate detection of three Xanthomonas species, X. axonopodis pv. poinsettiicola (XAP, X. hyacinthi (XH and X. campestris pv. zantedeschiae (XCZ, based on their draft genome sequences. XAP, XH and XCZ genomes consist of single chromosomes that contain 5,221, 4,395 and 7,986 protein coding genes, respectively. Species-specific primers were designed from variable regions of the draft genome sequence data and assessed by a PCR-based detection method. These primers were also tested for specificity against 17 allied Xanthomonas species as well as against the host DNA and the microbial community of the host surface. Three primer sets were found to be very specific and no amplification product was obtained with the host DNA and the microbial community of the host surface. In addition, a detection limit of 1 pg/μl per PCR reaction was detected when these primer sets were used to amplify corresponding bacterial DNAs. Therefore, these primer sets and the developed species-specific PCR assay represent a valuable, sensitive, and rapid diagnostic tool that can be used to detect three specific pathogens at early stages of infection and may help control diseases.

  9. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  10. Relationship of leptin administration with production of reactive oxygen species, sperm DNA fragmentation, sperm parameters and hormone profile in the adult rat.

    Science.gov (United States)

    Abbasihormozi, Shima; Shahverdi, Abdolhossein; Kouhkan, Azam; Cheraghi, Javad; Akhlaghi, Ali Asghar; Kheimeh, Abolfazl

    2013-06-01

    Leptin, an adipose tissue-derived hormone, plays an important role in energy homeostasis and metabolism, and in the neuroendocrine and reproductive systems. The function of leptin in male reproduction is unclear; however, it is known to affect sex hormones, sperm motility and its parameters. Leptin induces mitochondrial superoxide production in aortic endothelia and may increase oxidative stress and abnormal sperm production in leptin-treated rats. This study aims to evaluate whether exogenous leptin affects sperm parameters, hormone profiles, and the production of reactive oxygen species (ROS) in adult rats. A total of 65 Sprague-Dawley rats were divided into three treated groups and a control group. Treated rats received daily intraperitoneal injections of 5, 10 and 30 μg/kg of leptin administered for a duration of 7, 15, and 42 days. Control rats were given 0.1 mL of 0.9 % normal saline for the same period. One day after final drug administration, we evaluated serum specimens for follicle-stimulating hormone (FSH), leutinizing hormone (LH), free testosterone (FT), and total testosterone (TT) levels. Samples from the rat epididymis were also evaluated for sperm parameters and motility characteristics by a Computer-Aided Semen Analysis (CASA) system. Samples were treated with 2',7'-dichlorofluorescein-diacetate (DCFH-DA) and analyzed using flow cytometry and TUNEL to determine the impact of leptin administration on sperm DNA fragmentation. According to CASA, significant differences in all sperm parameters in leptin-treated rats and their age-matched controls were detected, except for TM, ALH and BCF. Serum FSH and LH levels were significantly higher in rats that received 10 and 30 μg/kg of leptin compared to those treated with 5 μg/kg of leptin in the same group and control rats (P control group (P hormone profile modulation.

  11. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  12. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  13. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Science.gov (United States)

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  15. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  16. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  17. Nonstructural Protein L* Species Specificity Supports a Mouse Origin for Vilyuisk Human Encephalitis Virus.

    Science.gov (United States)

    Drappier, Melissa; Opperdoes, Fred R; Michiels, Thomas

    2017-07-15

    Vilyuisk human encephalitis virus (VHEV) is a picornavirus related to Theiler's murine encephalomyelitis virus (TMEV). VHEV was isolated from human material passaged in mice. Whether this VHEV is of human or mouse origin is therefore unclear. We took advantage of the species-specific activity of the nonstructural L* protein of theiloviruses to track the origin of TMEV isolates. TMEV L* inhibits RNase L, the effector enzyme of the interferon pathway. By using coimmunoprecipitation and functional RNase L assays, the species specificity of RNase L antagonism was tested for L* from mouse (DA) and rat (RTV-1) TMEV strains as well as for VHEV. Coimmunoprecipitation and functional assay data confirmed the species specificity of L* activity and showed that L* from rat strain RTV-1 inhibited rat but not mouse or human RNase L. Next, we showed that the VHEV L* protein was phylogenetically related to L* of mouse viruses and that it failed to inhibit human RNase L but readily antagonized mouse RNase L, unambiguously showing the mouse origin of VHEV. IMPORTANCE Defining the natural host of a virus can be a thorny issue, especially when the virus was isolated only once or when the isolation story is complex. The species Theilovirus includes Theiler's murine encephalomyelitis virus (TMEV), infecting mice and rats, and Saffold virus (SAFV), infecting humans. One TMEV strain, Vilyuisk human encephalitis virus (VHEV), however, was isolated from mice that were inoculated with cerebrospinal fluid of a patient presenting with chronic encephalitis. It is therefore unclear whether VHEV was derived from the human sample or from the inoculated mouse. The L* protein encoded by TMEV inhibits RNase L, a cellular enzyme involved in innate immunity, in a species-specific manner. Using binding and functional assays, we show that this species specificity even allows discrimination between TMEV strains of mouse and of rat origins. The VHEV L* protein clearly inhibited mouse but not human RNase L

  18. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    Science.gov (United States)

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  19. Is Drosophila-microbe association species-specific or region specific? A study undertaken involving six Indian Drosophila species.

    Science.gov (United States)

    Singhal, Kopal; Khanna, Radhika; Mohanty, Sujata

    2017-06-01

    The present work aims to identify the microbial diversity associated with six Indian Drosophila species using next generation sequencing (NGS) technology and to discover the nature of their distribution across species and eco-geographic regions. Whole fly gDNA of six Drosophila species were used to generate sequences in an Illumina platform using NGS technology. De novo based assembled raw reads were blasted against the NR database of NCBI using BLASTn for identification of their bacterial loads. We have tried to include Drosophila species from different taxonomical groups and subgroups and from three different eco-climatic regions India; four species belong to Central India, while the rest two, D. melanogaster and D. ananassae, belong to West and South India to determine both their species-wise and region-wide distribution. We detected the presence of 33 bacterial genera across all six study species, predominated by the class Proteobacteria. Amongst all, D. melanogaster was found to be the most diverse by carrying around 85% of the bacterial diversity. Our findings infer both species-specific and environment-specific nature of the bacterial species inhabiting the Drosophila host. Though the present results are consistent with most of the earlier studies, they also remain incoherent with some. The present study outcome on the host-bacteria association and their species specific adaptation may provide some insight to understand the host-microbial interactions and the phenotypic implications of microbes on the host physiology. The knowledge gained may be importantly applied into the recent insect and pest population control strategy going to implement through gut microflora in India and abroad.

  20. Bacterial communities of two ubiquitous Great Barrier Reef corals reveals both site- and species-specificity of common bacterial associates.

    Directory of Open Access Journals (Sweden)

    E Charlotte E Kvennefors

    Full Text Available BACKGROUND: Coral-associated bacteria are increasingly considered to be important in coral health, and altered bacterial community structures have been linked to both coral disease and bleaching. Despite this, assessments of bacterial communities on corals rarely apply sufficient replication to adequately describe the natural variability. Replicated data such as these are crucial in determining potential roles of bacteria on coral. METHODOLOGY/PRINCIPAL FINDINGS: Denaturing Gradient Gel Electrophoresis (DGGE of the V3 region of the 16S ribosomal DNA was used in a highly replicated approach to analyse bacterial communities on both healthy and diseased corals. Although site-specific variations in the bacterial communities of healthy corals were present, host species-specific bacterial associates within a distinct cluster of gamma-proteobacteria could be identified, which are potentially linked to coral health. Corals affected by "White Syndrome" (WS underwent pronounced changes in their bacterial communities in comparison to healthy colonies. However, the community structure and bacterial ribotypes identified in diseased corals did not support the previously suggested theory of a bacterial pathogen as the causative agent of the syndrome. CONCLUSIONS/SIGNIFICANCE: This is the first study to employ large numbers of replicated samples to assess the bacterial communities of healthy and diseased corals, and the first culture-independent assessment of bacterial communities on WS affected Acroporid corals on the GBR. Results indicate that a minimum of 6 replicate samples are required in order to draw inferences on species, spatial or health-related changes in community composition, as a set of clearly distinct bacterial community profiles exist in healthy corals. Coral bacterial communities may be both site and species specific. Furthermore, a cluster of gamma-proteobacterial ribotypes may represent a group of specific common coral and marine

  1. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  2. A putative non-hr origin of DNA replication in the HindIII-K fragment of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus

    NARCIS (Netherlands)

    Kool, M.; Goldbach, R. W.; Vlak, J. M.

    1994-01-01

    In addition to the seven known homologous regions (hrs) of Autographa californica multiple nucleocapsid polyhedrosis virus (AcMNPV) the HindIII-K fragment was also found to carry a putative ori, although this fragment does not contain an hr. Deletion analysis showed that this ori contains several

  3. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  4. Radiation effects on the species-specific cell sorting-out of the cellular slime molds

    International Nuclear Information System (INIS)

    Satow, Takashi

    1976-01-01

    The effects of gamma-rays irradiation on the development and the species-specific cell sorting-out of the cellular slime mold, Dictyostelium discoideum, were investigated. The interphase amoebae of the organism showed extremely resistant to 60 Co gamma-rays. The percentage of non-stained cells estimated by dye staining method was more than 90% at the dose of 270 kR. The amoebae irradiated at 270 kR performed the development similar in the most respects to that of the un-irradiated amoebae except that a little portion of the fruiting bodies were abnormal and that the appearance of aggregates and slugs delayed 3 hrs. The ability of the species-specific cell sorting-out was not affected by gamma-rays irradiation at 270 kR. (auth.)

  5. A systematic identification of species-specific protein succinylation sites using joint element features information

    Directory of Open Access Journals (Sweden)

    Hasan MM

    2017-08-01

    Full Text Available Md Mehedi Hasan,1 Mst Shamima Khatun,2 Md Nurul Haque Mollah,2 Cao Yong,3 Dianjing Guo1 1School of Life Sciences and the State Key Laboratory of Agrobiotechnology, The Chinese University of Hong Kong, Shatin, New Territory, Hong Kong, People’s Republic of China; 2Laboratory of Bioinformatics, Department of Statistics, University of Rajshahi, Rajshahi, Bangladesh; 3Department of Mechanical Engineering and Automation, Harbin Institute of Technology, Shenzhen Graduate School, Shenzhen, People’s Republic of China Abstract: Lysine succinylation, an important type of protein posttranslational modification, plays significant roles in many cellular processes. Accurate identification of succinylation sites can facilitate our understanding about the molecular mechanism and potential roles of lysine succinylation. However, even in well-studied systems, a majority of the succinylation sites remain undetected because the traditional experimental approaches to succinylation site identification are often costly, time-consuming, and laborious. In silico approach, on the other hand, is potentially an alternative strategy to predict succinylation substrates. In this paper, a novel computational predictor SuccinSite2.0 was developed for predicting generic and species-specific protein succinylation sites. This predictor takes the composition of profile-based amino acid and orthogonal binary features, which were used to train a random forest classifier. We demonstrated that the proposed SuccinSite2.0 predictor outperformed other currently existing implementations on a complementarily independent dataset. Furthermore, the important features that make visible contributions to species-specific and cross-species-specific prediction of protein succinylation site were analyzed. The proposed predictor is anticipated to be a useful computational resource for lysine succinylation site prediction. The integrated species-specific online tool of SuccinSite2.0 is publicly

  6. Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.

    2004-01-01

    Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)

  7. Development of a species-specific coproantigen ELISA for human Taenia solium taeniasis.

    Science.gov (United States)

    Guezala, Maria-Claudia; Rodriguez, Silvia; Zamora, Humberto; Garcia, Hector H; Gonzalez, Armando E; Tembo, Alice; Allan, James C; Craig, Philip S

    2009-09-01

    Taenia solium causes human neurocysticercosis and is endemic in underdeveloped countries where backyard pig keeping is common. Microscopic fecal diagnostic methods for human T. solium taeniasis are not very sensitive, and Taenia saginata and Taenia solium eggs are indistinguishable under the light microscope. Coproantigen (CoAg) ELISA methods are very sensitive, but currently only genus (Taenia) specific. This paper describes the development of a highly species-specific coproantigen ELISA test to detect T. solium intestinal taeniasis. Sensitivity was maintained using a capture antibody of rabbit IgG against T. solium adult whole worm somatic extract, whereas species specificity was achieved by utilization of an enzyme-conjugated rabbit IgG against T. solium adult excretory-secretory (ES) antigen. A known panel of positive and negative human fecal samples was tested with this hybrid sandwich ELISA. The ELISA test gave 100% specificity and 96.4% sensitivity for T. solium tapeworm carriers (N = 28), with a J index of 0.96. This simple ELISA incorporating anti-adult somatic and anti-adult ES antibodies provides the first potentially species-specific coproantigen test for human T. solium taeniasis.

  8. COMPARISON OF A GENUS-SPECIFIC CONVENTIONAL PCR AND A SPECIES-SPECIFIC NESTED-PCR FOR MALARIA DIAGNOSIS USING FTA COLLECTED SAMPLES FROM KINGDOM OF SAUDI ARABIA.

    Science.gov (United States)

    Al-Harthi, Saeed A

    2015-12-01

    Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.

  9. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  10. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  11. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    Science.gov (United States)

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage

  12. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  13. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  14. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  15. Detection of all Chlamydophila and Chlamydia spp. of veterinary interest using species-specific real-time PCR assays.

    Science.gov (United States)

    Pantchev, Alexandra; Sting, Reinhard; Bauerfeind, Rolf; Tyczka, Judith; Sachse, Konrad

    2010-12-01

    The aim of the present study was to analyse the occurrence of chlamydiae in several mammalian host species. Clinical samples that previously tested positive in a Chlamydiaceae-specific real-time PCR were retested using six species-specific real-time PCR assays to identify the chlamydial species involved. Chlamydophila (Cp.) abortus was the agent most frequently found in cattle, sheep, horses, goats, and pigs. Detection in cattle of Cp. psittaci (11% of samples) and Chlamydia (C.) suis (9%), as well as Cp. psittaci in a goat sample was somewhat unexpected. DNA of two different chlamydiae was identified in 56 (12.7%) of 440 samples tested. Cp. felis was the predominant species found in cats, while in guinea pigs and rabbits only Cp. caviae was detected. Interestingly, the latter two pathogens were also identified in samples from dogs. The data show that mixed chlamydial infections are not rare and suggest an extended host range of individual species. Copyright © 2009 Elsevier Ltd. All rights reserved.

  16. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  17. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  18. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  19. Species-specific ant brain manipulation by a specialized fungal parasite.

    Science.gov (United States)

    de Bekker, Charissa; Quevillon, Lauren E; Smith, Philip B; Fleming, Kimberly R; Ghosh, Debashis; Patterson, Andrew D; Hughes, David P

    2014-08-29

    A compelling demonstration of adaptation by natural selection is the ability of parasites to manipulate host behavior. One dramatic example involves fungal species from the genus Ophiocordyceps that control their ant hosts by inducing a biting behavior. Intensive sampling across the globe of ants that died after being manipulated by Ophiocordyceps suggests that this phenomenon is highly species-specific. We advance our understanding of this system by reconstructing host manipulation by Ophiocordyceps parasites under controlled laboratory conditions and combining this with field observations of infection rates and a metabolomics survey. We report on a newly discovered species of Ophiocordyceps unilateralis sensu lato from North America that we use to address the species-specificity of Ophiocordyceps-induced manipulation of ant behavior. We show that the fungus can kill all ant species tested, but only manipulates the behavior of those it infects in nature. To investigate if this could be explained at the molecular level, we used ex vivo culturing assays to measure the metabolites that are secreted by the fungus to mediate fungus-ant tissue interactions. We show the fungus reacts heterogeneously to brains of different ant species by secreting a different array of metabolites. By determining which ion peaks are significantly enriched when the fungus is grown alongside brains of its naturally occurring host, we discovered candidate compounds that could be involved in behavioral manipulation by O. unilateralis s.l.. Two of these candidates are known to be involved in neurological diseases and cancer. The integrative work presented here shows that ant brain manipulation by O. unilateralis s.l. is species-specific seemingly because the fungus produces a specific array of compounds as a reaction to the presence of the host brain it has evolved to manipulate. These studies have resulted in the discovery of candidate compounds involved in establishing behavioral manipulation

  20. Species-specific isotopic fractionation of mercury during methylation by bacteria

    International Nuclear Information System (INIS)

    Rodriguez-Gonzalez, P.; Epov, V.N.; Bridou, R.; Tessier, E.; Monperrus, M.; Guyoneaud, R.; Amouroux, D.

    2009-01-01

    Full text: The environmental reactivity of Hg is extremely dependent on its chemical form. In fact, Hg bioaccumulation is due to the greater trophic transfer efficiency of methylmercury which is formed as a result of biotic or abiotic transformations caused by specific redox gradients and bacterial activity. The study of stable isotope biogeochemistry of Hg may provide a powerful tool to track and understand its cycle and pathways in the environment. This work presents the measurement of species-specific Hg isotopic composition by GC-MCICPMS during Hg methylation experiments using cultures of pure bacterial strains incubated with Hg (II) standard NIST 3133. (author)

  1. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    Science.gov (United States)

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  2. Species-specific response-topography of chickens' and pigeons' water-induced autoshaped responding.

    Science.gov (United States)

    Ploog, Bertram O

    2014-07-01

    Four pigeons and eight chickens received autoshaping training where a keylight (conditioned stimulus) signaled response-independent deliveries of water (unconditioned stimulus). Pigeons drink while keeping their beaks submerged in water and moving their beaks to create suction ("mumbling"), whereas chickens drink by trapping a small amount of water in their mouths and then lifting their heads so the water trickles down. This experiment tested whether these and other species-specific differences in drinking and related behaviors of pigeons and chickens would be reflected in the form of conditioned (autoshaped) responding. Touchscreens and videotapes were used for data recording. Results showed that chickens moved their heads more than pigeons when drinking (unconditioned response). The birds also differed in conditioned responding in the presence of the keylight: Pigeons produced more keyswitch closures and mumbled at the keylight more than chickens whereas chickens scratched more than pigeons. In conclusion, with this unique comparative method that employed identical contingencies and comparable deprivation levels, species-specific differences in unconditioned responses and, more importantly, differences in their corresponding conditioned responses were observed. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Endogenous retroviruses function as species-specific enhancer elements in the placenta.

    Science.gov (United States)

    Chuong, Edward B; Rumi, M A Karim; Soares, Michael J; Baker, Julie C

    2013-03-01

    The mammalian placenta is remarkably distinct between species, suggesting a history of rapid evolutionary diversification. To gain insight into the molecular drivers of placental evolution, we compared biochemically predicted enhancers in mouse and rat trophoblast stem cells (TSCs) and found that species-specific enhancers are highly enriched for endogenous retroviruses (ERVs) on a genome-wide level. One of these ERV families, RLTR13D5, contributes hundreds of mouse-specific histone H3 lysine 4 monomethylation (H3K4me1)- and histone H3 lysine 27 acetylation (H3K27ac)-defined enhancers that functionally bind Cdx2, Eomes and Elf5-core factors that define the TSC regulatory network. Furthermore, we show that RLTR13D5 is capable of driving gene expression in rat placental cells. Analysis in other tissues shows that species-specific ERV enhancer activity is generally restricted to hypomethylated tissues, suggesting that tissues permissive for ERV activity gain access to an otherwise silenced source of regulatory variation. Overall, our results implicate ERV enhancer co-option as a mechanism underlying the extensive evolutionary diversification of placental development.

  4. Species-specific separation of lake plankton reveals divergent food assimilation patterns in rotifers.

    Science.gov (United States)

    Burian, Alfred; Kainz, Martin J; Schagerl, Michael; Yasindi, Andrew

    2014-06-01

    1. The analysis of functional groups with a resolution to the individual species level is a basic requirement to better understand complex interactions in aquatic food webs. Species-specific stable isotope analyses are currently applied to analyse the trophic role of large zooplankton or fish species, but technical constraints complicate their application to smaller-sized plankton. 2. We investigated rotifer food assimilation during a short-term microzooplankton bloom in the East African soda lake Nakuru by developing a method for species-specific sampling of rotifers. 3. The two dominant rotifers, Brachionus plicatilis and Brachionus dimidiatus , were separated to single-species samples (purity >95%) and significantly differed in their isotopic values (4.1‰ in δ 13 C and 1.5‰ in δ 15 N). Bayesian mixing models indicated that isotopic differences were caused by different assimilation of filamentous cyanobacteria and particles plicatilis (48%), whereas it was hardly ingested by B. dimidiatus . Overall, A . fusiformis was, relative to its biomass, assimilated to small extents, demonstrating a high grazing resistance of this species. 5. In combination with high population densities, these results demonstrate a strong potential of rotifer blooms to shape phytoplankton communities and are the first in situ demonstration of a quantitatively important direct trophic link between rotifers and filamentous cyanobacteria.

  5. Fine-scale genetic analysis of species-specific female preference in Drosophila simulans.

    Science.gov (United States)

    Laturney, M; Moehring, A J

    2012-09-01

    Behavioural differences are thought to be the first components to contribute to species isolation, yet the precise genetic basis of behavioural isolation remains poorly understood. Here, we used a combination of behaviour assays and genetic mapping to provide the first refined map locating candidate genes for interspecific female preference isolating Drosophila simulans from D. melanogaster. First, we tested whether two genes identified as affecting D. melanogaster female intraspecific mate choice also affect interspecific mate choice; neither of these genes was found to contribute to species-specific female preference. Next, we used deficiency mapping to locate genes on the right arm of the third chromosome for species-specific female preference and identified five small significant regions that contain candidate genes contributing to behavioural isolation. All five regions were located in areas that would have low interspecific recombination, which mirrors the results of other behavioural isolation studies that used quantitative trait locus (QTL) mapping, but without the potential concern of bias towards regions of low recombination that QTL mapping may have. As this model system may be refined to the individual gene level using the same methodology, this initial map we provide may potentially serve as a ready template for the identification and characterization of the first behavioural isolation genes. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  6. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  7. Development of a multiplex assay for genus- and species-specific detection of Phytophthora based on differences in mitochondrial gene order.

    Science.gov (United States)

    Bilodeau, Guillaume J; Martin, Frank N; Coffey, Michael D; Blomquist, Cheryl L

    2014-07-01

    A molecular diagnostic assay for Phytophthora spp. that is specific, sensitive, has both genus- and species-specific detection capabilities multiplexed, and can be used to systematically develop markers for detection of a wide range of species would facilitate research and regulatory efforts. To address this need, a marker system was developed based on the high copy sequences of the mitochondrial DNA utilizing gene orders that were highly conserved in the genus Phytophthora but different in the related genus Pythium and plants to reduce the importance of highly controlled annealing temperatures for specificity. An amplification primer pair designed from conserved regions of the atp9 and nad9 genes produced an amplicon of ≈340 bp specific for the Phytophthora spp. tested. The TaqMan probe for the genus-specific Phytophthora test was designed from a conserved portion of the atp9 gene whereas variable intergenic spacer sequences were used for designing the species-specific TaqMan probes. Specific probes were developed for 13 species and the P. citricola species complex. In silico analysis suggests that species-specific probes could be developed for at least 70 additional described and provisional species; the use of locked nucleic acids in TaqMan probes should expand this list. A second locus spanning three tRNAs (trnM-trnP-trnM) was also evaluated for genus-specific detection capabilities. At 206 bp, it was not as useful for systematic development of a broad range of species-specific probes as the larger 340-bp amplicon. All markers were validated against a test panel that included 87 Phytophthora spp., 14 provisional Phytophthora spp., 29 Pythium spp., 1 Phytopythium sp., and 39 plant species. Species-specific probes were validated further against a range of geographically diverse isolates to ensure uniformity of detection at an intraspecific level, as well as with other species having high levels of sequence similarity to ensure specificity. Both diagnostic

  8. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

    OpenAIRE

    Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

    2015-01-01

    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

  9. Insulin-like growth factor-1 (IGF-1) promotes primordial follicle growth and reduces DNA fragmentation through the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signalling pathway.

    Science.gov (United States)

    Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T

    2018-05-30

    We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.

  10. HIV-1 Vif's Capacity To Manipulate the Cell Cycle Is Species Specific.

    Science.gov (United States)

    Evans, Edward L; Becker, Jordan T; Fricke, Stephanie L; Patel, Kishan; Sherer, Nathan M

    2018-04-01

    Cells derived from mice and other rodents exhibit profound blocks to HIV-1 virion production, reflecting species-specific incompatibilities between viral Tat and Rev proteins and essential host factors cyclin T1 (CCNT1) and exportin-1 (XPO1, also known as CRM1), respectively. To determine if mouse cell blocks other than CCNT1 and XPO1 affect HIV's postintegration stages, we studied HIV-1 NL4-3 gene expression in mouse NIH 3T3 cells modified to constitutively express HIV-1-compatible versions of CCNT1 and XPO1 (3T3.CX cells). 3T3.CX cells supported both Rev-independent and Rev-dependent viral gene expression and produced relatively robust levels of virus particles, confirming that CCNT1 and XPO1 represent the predominant blocks to these stages. Unexpectedly, however, 3T3.CX cells were remarkably resistant to virus-induced cytopathic effects observed in human cell lines, which we mapped to the viral protein Vif and its apparent species-specific capacity to induce G 2 /M cell cycle arrest. Vif was able to mediate rapid degradation of human APOBEC3G and the PPP2R5D regulatory B56 subunit of the PP2A phosphatase holoenzyme in mouse cells, thus demonstrating that Vif NL4-3 's modulation of the cell cycle can be functionally uncoupled from some of its other defined roles in CUL5-dependent protein degradation. Vif was also unable to induce G 2 /M cell cycle arrest in other nonhuman cell types, including cells derived from nonhuman primates, leading us to propose that one or more human-specific cofactors underpin Vif's ability to modulate the cell cycle. IMPORTANCE Cells derived from mice and other rodents exhibit profound blocks to HIV-1 replication, thus hindering the development of a low-cost small-animal model for studying HIV/AIDS. Here, we engineered otherwise-nonpermissive mouse cells to express HIV-1-compatible versions of two species-specific host dependency factors, cyclin T1 (CCNT1) and exportin-1 (XPO1) (3T3.CX cells). We show that 3T3.CX cells rescue HIV-1

  11. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  13. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  14. Species-specific associations between soil-transmitted helminths and micronutrients in Vietnamese schoolchildren

    DEFF Research Database (Denmark)

    de Gier, Brechje; Nga, Tran Thuy; Winichagoon, Pattanee

    2016-01-01

    6-9 years were recruited from two primary schools. STH infections were determined in stool samples. Hemoglobin, ferritin, retinol, and zinc were measured in blood samples, as well as C-reactive protein to control for inflammation. Iodine excretion was measured in urine. Associations of single...... and multiple infections with Ascaris lumbricoides, Trichuris trichiura, and hookworm with micronutrient status (hemoglobin, plasma ferritin, retinol, zinc, and urinary iodine) were estimated by multiple regression analysis. Ascaris infections showed a specific and intensity-dependent negative association...... with vitamin A. Trichuris and hookworm infections were associated with lower hemoglobin concentration, but not with plasma ferritin. Trichuris-infected children had zinc deficiency less often than uninfected children. In conclusion, our study shows species-specific associations between STH infections...

  15. LC-MS/MS Identification of Species-Specific Muscle Peptides in Processed Animal Proteins.

    Science.gov (United States)

    Marchis, Daniela; Altomare, Alessandra; Gili, Marilena; Ostorero, Federica; Khadjavi, Amina; Corona, Cristiano; Ru, Giuseppe; Cappelletti, Benedetta; Gianelli, Silvia; Amadeo, Francesca; Rumio, Cristiano; Carini, Marina; Aldini, Giancarlo; Casalone, Cristina

    2017-12-06

    An innovative analytical strategy has been applied to identify signature peptides able to distinguish among processed animal proteins (PAPs) derived from bovine, pig, fish, and milk products. Proteomics was first used to elucidate the proteome of each source. Starting from the identified proteins and using a funnel based approach, a set of abundant and well characterized peptides with suitable physical-chemical properties (signature peptides) and specific for each source was selected. An on-target LC-ESI-MS/MS method (MRM mode) was set up using standard peptides and was then applied to selectively identify the PAP source and also to distinguish proteins from bovine carcass and milk proteins. We believe that the method described meets the request of the European Commission which has developed a strategy for gradually lifting the "total ban" toward "species to species ban", therefore requiring official methods for species-specific discrimination in feed.

  16. Development of an improved species specific PCR test for detection of Haemophilus parasuis

    DEFF Research Database (Denmark)

    Angen, Øystein; Oliveira, Simone; Ahrens, Peter

    2007-01-01

    , the present PCR test was found to be 100% species specific for H. parasuis, in contrast to the PCR test of Oliveira et al., which also tested positive for strains belonging to A. indolicus, A. porcinus, and A. minor, species commonly occurring in the upper respiratory tract. However, when the PCR test...... with representatives of H. parasuis. The test was further evaluated on 55 clinical samples from 16 Danish pigs suspected for being infected with H. parasuis, showing polyserositis or septicemia at autopsy as well as on 492 nasal swabs. The test was compared with the performance of a PCR test earlier published...... by Oliveira et al. [Oliveira, S., Galina, L., Pijoan, C., 2001. Development of a PCR test to diagnose Haemophilus parasuis infections. J. Vet. Diagn. Invest. 13, 495-501]. The sensitivity of the present PCR test was found to be slightly lower when applied on clinical samples from diseased pigs and 10-fold...

  17. In vivo synthesized 34S enriched amino acid standards for species specific isotope dilution of proteins

    DEFF Research Database (Denmark)

    Hermann, Gerrit; Moller, Laura Hyrup; Gammelgaard, Bente

    2016-01-01

    (ICP-MS) combined to anion exchange showed that very high concentrated spike material could be produced with [small mu ]mol amounts of proteinogenic sulfur containing amino acids per g cell dry weight. An enrichment of 34S to 96.3 +/- 0.4% (n = 3) and 98.5 +/- 0.4% (n = 3) for cysteic acid...... with the concept of species specific isotope dilution analysis (IDA). The method relies on the determination of the two sulfur containing amino acids, cysteine and methionine by sulfur speciation analysis and is hence applicable to any protein containing sulfur. In vivo synthesis using 34S as sulfur source...... and methionine sulfone, respectively, was assessed. The established IDA method was validated for the absolute quantification of commercially available lysozyme and ceruloplasmin standards including the calculation of a total combined uncertainty budget....

  18. Temporal Lobe Lesions and Perception of Species-Specific Vocalizations by Macaques

    Science.gov (United States)

    Heffner, Henry E.; Heffner, Rickye S.

    1984-10-01

    Japanese macaques were trained to discriminate two forms of their coo vocalization before and after unilateral and bilateral ablation of the temporal cortex. Unilateral ablation of the left superior temporal gyrus, including auditory cortex, resulted in an initial impairment in the discrimination, but similar unilateral ablation of the right superior temporal gyrus had no effect. Bilateral temporal lesions including auditory cortex completely abolished the ability of the animals to discriminate their coos. Neither unilateral nor bilateral ablation of cortex dorsal to and sparing the auditory cortex had any effect on the discrimination. The perception of species-specific vocalizations by Japanese macaques seems to be mediated by the temporal cortex, with the left hemisphere playing a predominant role.

  19. Identification of campylobacteria isolated from Danish broilers by phenotypic tests and species-specific PCR assays

    DEFF Research Database (Denmark)

    Wainø, M.; Bang, Dang Duong; Lund, Marianne

    2003-01-01

    campylobacterial cultures, 108 Campylobacter jejuni cultures and 351 campylobacterial cultures other than Camp. jejuni were subjected to various species-specific PCR assays. On the basis of the genotypic tests, it was demonstrated that Camp. jejuni and Camp. coli constituted approx. 99% of all cultures, while...... other species identified were Helicobacter pullorum, Camp. lari and Camp. upsaliensis. However, 29% of the 309 Camp. coli cultures identified by phenotypic tests were hippurate-variable or negative Camp. jejuni cultures, whereas some Camp. lari cultures and unspeciated campylobacter cultures belonged...... and Impact of the Study: Future phenotypic test schemes should be designed to allow a more accurate differentiation of Campylobacter and related species. Preferably, the phenotypic tests should be supplemented with a genotypic strategy to disclose the true campylobacterial species diversity in broilers....

  20. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis.

    Science.gov (United States)

    Disson, Olivier; Grayo, Solène; Huillet, Eugénie; Nikitas, Georgios; Langa-Vives, Francina; Dussurget, Olivier; Ragon, Marie; Le Monnier, Alban; Babinet, Charles; Cossart, Pascale; Lecuit, Marc

    2008-10-23

    The ability to cross host barriers is an essential virulence determinant of invasive microbial pathogens. Listeria monocytogenes is a model microorganism that crosses human intestinal and placental barriers, and causes severe maternofetal infections by an unknown mechanism. Several studies have helped to characterize the bacterial invasion proteins InlA and InlB. However, their respective species specificity has complicated investigations on their in vivo role. Here we describe two novel and complementary animal models for human listeriosis: the gerbil, a natural host for L. monocytogenes, and a knock-in mouse line ubiquitously expressing humanized E-cadherin. Using these two models, we uncover the essential and interdependent roles of InlA and InlB in fetoplacental listeriosis, and thereby decipher the molecular mechanism underlying the ability of a microbe to target and cross the placental barrier.

  1. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  2. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  3. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  4. Species-specific variation in the phosphorus nutritional sources by microphytoplankton in a Mediterranean estuary

    Directory of Open Access Journals (Sweden)

    MARLY CAROLINA MARTINEZ SOTO

    2015-08-01

    Full Text Available We investigated the species-specific phosphorus (P nutrition sources in the microphytoplankton community in the Mahon estuary (Minorca, Western Mediterranean in 2011, under two contrasting hydrographic scenarios. Estuarine flow, nutrient concentrations, phytoplankton community composition and enzyme-labeled fluorescence (ELF were measured in June and October, corresponding to the beginning and the end of summer. Dissolved inorganic nitrogen (DIN and inorganic phosphate (Pi exhibited enhanced concentrations in the inner estuary where N:P molar ratios suggested P-limitation in both surveys. Pi was low and variable (0.09±0.02 μmol•l-1 in June and 0.06±0.02 μmol•l-1 in October, whereas organic phosphorus remained a more reliable P source. Even though ambient Pi concentrations were slightly higher on June, when the microphytoplankton assemblage was dominated by dinoflagellates, the percentage of cells expressing ELF labeling was notably higher (65% of total cells than in October (12%, when the presence of diatoms characterized the microphytoplankton community. ELF was mainly expressed by dinoflagellate taxa, whereas diatoms only expressed significant AP in the inner estuary during the June survey. A P-addition bioassay in which response of AP to Pi enrichment was evaluated showed remarkable reduction in AP with increasing Pi. However, some dinoflagellate species maintained AP even when Pi was supplied in excess. We suggest that in the case of some dinoflagellate species AP is not as tightly controlled by ambient Pi as previously believed. AP activity in these species could indicate selective use of organic phosphorus, or slow metabolic response to changes in P forms, rather than physiological stress to low Pi availability. We emphasize the importance of identifying the links between the different P sources and the species-specific requirements, in order to understand the ecological response to anthropogenic biogeochemical perturbations.

  5. Species-specific escape of Plasmodium sporozoites from oocysts of avian, rodent, and human malarial parasites.

    Science.gov (United States)

    Orfano, Alessandra S; Nacif-Pimenta, Rafael; Duarte, Ana P M; Villegas, Luis M; Rodrigues, Nilton B; Pinto, Luciana C; Campos, Keillen M M; Pinilla, Yudi T; Chaves, Bárbara; Barbosa Guerra, Maria G V; Monteiro, Wuelton M; Smith, Ryan C; Molina-Cruz, Alvaro; Lacerda, Marcus V G; Secundino, Nágila F C; Jacobs-Lorena, Marcelo; Barillas-Mury, Carolina; Pimenta, Paulo F P

    2016-08-02

    Malaria is transmitted when an infected mosquito delivers Plasmodium sporozoites into a vertebrate host. There are many species of Plasmodium and, in general, the infection is host-specific. For example, Plasmodium gallinaceum is an avian parasite, while Plasmodium berghei infects mice. These two parasites have been extensively used as experimental models of malaria transmission. Plasmodium falciparum and Plasmodium vivax are the most important agents of human malaria, a life-threatening disease of global importance. To complete their life cycle, Plasmodium parasites must traverse the mosquito midgut and form an oocyst that will divide continuously. Mature oocysts release thousands of sporozoites into the mosquito haemolymph that must reach the salivary gland to infect a new vertebrate host. The current understanding of the biology of oocyst formation and sporozoite release is mostly based on experimental infections with P. berghei, and the conclusions are generalized to other Plasmodium species that infect humans without further morphological analyses. Here, it is described the microanatomy of sporozoite escape from oocysts of four Plasmodium species: the two laboratory models, P. gallinaceum and P. berghei, and the two main species that cause malaria in humans, P. vivax and P. falciparum. It was found that sporozoites have species-specific mechanisms of escape from the oocyst. The two model species of Plasmodium had a common mechanism, in which the oocyst wall breaks down before sporozoites emerge. In contrast, P. vivax and P. falciparum sporozoites show a dynamic escape mechanism from the oocyst via polarized propulsion. This study demonstrated that Plasmodium species do not share a common mechanism of sporozoite escape, as previously thought, but show complex and species-specific mechanisms. In addition, the knowledge of this phenomenon in human Plasmodium can facilitate transmission-blocking studies and not those ones only based on the murine and avian models.

  6. Teat apex colonization with coagulase-negative Staphylococcus species before parturition: Distribution and species-specific risk factors.

    Science.gov (United States)

    De Visscher, A; Piepers, S; Haesebrouck, F; De Vliegher, S

    2016-02-01

    Coagulase-negative staphylococci (CNS) are the main cause of bovine intramammary infections and are also abundantly present in extramammary habitats such as teat apices. Teat apex colonization (TAC) with CNS has already been explored in lactating dairy cows at the species level, whereas this is not true for dry cows and end-term heifers. Therefore, the aim of this observational study was to describe CNS TAC in nonlactating dairy cows and end-term heifers in Flemish dairy herds and to identify associated risk factors at the herd, cow, and quarter level. All CNS were molecularly identified to the species level using transfer RNA intergenic spacer PCR (tDNA-PCR) and sequencing of the 16S rRNA gene, allowing for species-specific statistical analyses using multivariable, multilevel logistic regression. Staphylococcus devriesei, Staphylococcus chromogenes, Staphylococcus haemolyticus, and Staphylococcus equorum were the most frequently isolated species. Staphylococcus chromogenes was the sole species colonizing teat apices of cows and heifers in all herds, whereas large between-herd differences were observed for the other species. Teat apices of red and white Holstein Friesians, of quarters dried off without an internal teat sealer, and swabbed in months with lower precipitation and higher ambient temperature were significantly more likely to be colonized by S. devriesei. Slightly dirty teat apices and teat apices swabbed in months with lower precipitation had higher odds of being colonized by S. chromogenes, whereas teat apices sampled in months with lower precipitation and higher ambient temperature were more likely to be colonized by S. haemolyticus. Dirty teat apices and teat apices swabbed in months with lower ambient temperature in combination with low precipitation had higher odds of being colonized by S. equorum. Diverse factors explaining CNS TAC, yet mostly related to humidity, ambient temperature, and hygiene, substantiate differences in epidemiological

  7. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  8. Assessment of DNA quality in processed tuna muscle tissues

    Directory of Open Access Journals (Sweden)

    Zora Piskatá

    2016-06-01

    Full Text Available Authentication of tuna fish products is necessary to assure consumers of accurate labelling of food products. The quality of species specific DNA crucially affects the efficiency of amplification during the subsequent PCR. The problem in DNA detection in canned products lies in the possibility of the fragmentation of DNA during the processing technologies and the use of ingredients (oil, salt, spice, that may inhibit the PCR reaction. In this study three DNA extraction methods were compared: DNeasy Blood and Tissue Kit, DNeasy mericon Food Kit and Chemagic DNA tissue 10 Kit. The quantity and quality of DNA were evaluated by measuring DNA concentration and ratios A260/A280. Several parameters were estimated: the effect of whole and mechanically treated muscle, sterilization procedure used in canned process (high temperature in combination with high pressure and addition of raw materials. The highest DNA concentrations were observed in non-processed muscle that is not influenced by the sterilization process. Canned whole muscle demonstrated lower DNA yield, and furthermore, the mechanical treatment (canned ground resulted in lower values of DNA concentration that was registered by using all three types of DNA extraction kits. DNeasy mericon Food Kit produced DNA of higher concentration in non-processed sample, Chemagic DNA tissue 10 Kit delivered higher DNA yields than kits DNeasy Blood and Tissue Kit and DNeasy mericon Food Kit in canned samples, although the purity was lower, but still within the range 1.7 - 2.0. DNA was considered to be satisfactorily pure in all three types of samples and using all three types of DNA isolation. In case of the samples enriched of ingredients and treated with sterilization process as whole or ground muscle Chemagic DNA tissue 10 Kit produced in all samples (whole and ground muscle the highest values of DNA concentration, but almost all values of A260/A280 were lower than 1.7. Therefore DNeasy mericon Food Kit

  9. Crystallization and preliminary X-ray diffraction analysis of two N-terminal fragments of the DNA-cleavage domain of topoisomerase IV from Staphylococcus aureus

    Energy Technology Data Exchange (ETDEWEB)

    Carr, Stephen B., E-mail: bmbsbc@bmb.leeds.ac.uk [Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom); Makris, George [Omega Mediation Hellas Ltd, Clinical and Pharma Consulting, 11525 N. Psychiko, Athens (Greece); Phillips, Simon E. V.; Thomas, Christopher D. [Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom)

    2006-11-01

    The crystallization and data collection of topoisomerase IV from S. aureus is described. Phasing by molecular replacement proved difficult owing to the presence of translational NCS and strategies used to overcome this are discussed. DNA topoisomerase IV removes undesirable topological features from DNA molecules in order to help maintain chromosome stability. Two constructs of 56 and 59 kDa spanning the DNA-cleavage domain of the A subunit of topoisomerase IV from Staphylococcus aureus (termed GrlA56 and GrlA59) have been crystallized. Crystals were grown at 291 K using the sitting-drop vapour-diffusion technique with PEG 3350 as a precipitant. Preliminary X-ray analysis revealed that GrlA56 crystals belong to space group P2{sub 1}, diffract to a resolution of 2.9 Å and possess unit-cell parameters a = 83.6, b = 171.5, c = 87.8 Å, β = 90.1°, while crystals of GrlA59 belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 41.5, b = 171.89, c = 87.9 Å. These crystals diffract to a resolution of 2.8 Å. This is the first report of the crystallization and preliminary X-ray analysis of the DNA-cleavage domain of a topoisomerase IV from a Gram-positive organism.

  10. Crystallization and preliminary X-ray diffraction analysis of two N-terminal fragments of the DNA-cleavage domain of topoisomerase IV from Staphylococcus aureus

    International Nuclear Information System (INIS)

    Carr, Stephen B.; Makris, George; Phillips, Simon E. V.; Thomas, Christopher D.

    2006-01-01

    The crystallization and data collection of topoisomerase IV from S. aureus is described. Phasing by molecular replacement proved difficult owing to the presence of translational NCS and strategies used to overcome this are discussed. DNA topoisomerase IV removes undesirable topological features from DNA molecules in order to help maintain chromosome stability. Two constructs of 56 and 59 kDa spanning the DNA-cleavage domain of the A subunit of topoisomerase IV from Staphylococcus aureus (termed GrlA56 and GrlA59) have been crystallized. Crystals were grown at 291 K using the sitting-drop vapour-diffusion technique with PEG 3350 as a precipitant. Preliminary X-ray analysis revealed that GrlA56 crystals belong to space group P2 1 , diffract to a resolution of 2.9 Å and possess unit-cell parameters a = 83.6, b = 171.5, c = 87.8 Å, β = 90.1°, while crystals of GrlA59 belong to space group P2 1 2 1 2, with unit-cell parameters a = 41.5, b = 171.89, c = 87.9 Å. These crystals diffract to a resolution of 2.8 Å. This is the first report of the crystallization and preliminary X-ray analysis of the DNA-cleavage domain of a topoisomerase IV from a Gram-positive organism

  11. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  12. Analysis of endophytic bacterial communities of potato by plating and denaturing gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments

    NARCIS (Netherlands)

    Garbeva, P.; Overbeek, van L.S.; Vuurde, van J.W.L.; Elsas, van J.D.

    2001-01-01

    The diversity of endophytic bacterial populations of potato (Solanum tuberosum cv Desiree) was assessed using a combination of dilution plating of plant macerates followed by isolation and characterization of isolates, and direct PCR-DGGE on the basis of DNA extracted from plants. The culturable

  13. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    -A and MBP-B were analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 112 unrelated Danes, 140 unrelated Greenland Eskimos, and 88 Danish mother/child pairs were analyzed. The distributions of MBP phenotypes were in Hardy-Weinberg equilibrium in both...

  14. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...

  15. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  16. Species-specific intrinsic water use efficiency and its mediation of carbon assimilation during the drought

    Science.gov (United States)

    Yi, K.; Wenzel, M. K.; Maxwell, J. T.; Novick, K. A.; Gray, A.; Roman, D. T.

    2015-12-01

    Drought is expected to occur more frequently and intensely in the future, and many studies have suggested frequent and intense droughts can significantly alter carbon and water cycling in forest ecosystems, consequently decreasing the ability of forests to assimilate carbon. Predicting the impact of drought on forest ecosystem processes requires an understanding of species-specific responses to drought, especially in eastern US where species composition is highly dynamic. An emerging approach for describing species-specific drought response is to classify the plant water use strategy into isohydric and anisohydric behaviors. Trees utilizing isohydric behavior regulate water potential by closing stomata to reduce water loss during drought conditions, while anisohydric trees allow water potential to drop by sustaining stomatal conductance, but with the risk of hydraulic failure caused by cavitation of xylem tissues. Since catastrophic cavitation occurs infrequently in the relatively wet eastern U.S., we hypothesize that 1) tree growth of isohydric trees will be more limited during the drought than the anisohydric trees due to decreased stomatal conductance, but 2) variation in intrinsic water use efficient (iWUE) during drought in isohydric trees will mediate the effects of drought on carbon assimilation. We will test these hypotheses by 1) analyzing tree-ring chronologies and dendrometer data on productivity, and 2) estimating intrinsic water use efficiency (iWUE) at multiple scales by analyzing gas exchange data for the leaf-level, inter-annual variability of d13C in tree stem cores for the tree-level, and eddy covariance technique for the stand-level. Our study site is the Morgan-Monroe State Forest (Indiana, USA). A 46 m flux tower has been continuously recording the carbon, water and energy fluxes, and tree diameter has been measured every 2 weeks using dendrometers, since 1998. Additional research, including gas exchange measurements performed during the

  17. Species-specific associations between overstory and understory tree species in a semideciduous tropical forest

    Directory of Open Access Journals (Sweden)

    Flaviana Maluf Souza

    2015-03-01

    Full Text Available We investigated the occurrence of associations between overstory and understory tree species in a semideciduous tropical forest. We identified and measured all trees of nine canopy species with diameter at breast height ≥4.8 cm in a 10.24 ha plot and recorded all individuals beneath their canopies ("understory individuals" within the same diameter class. The total density of understory individuals did not significantly differ under different overstory species. One overstory species (Ceiba speciosa showed higher understory species richness compared with five other species. There was a strong positive association between three overstory species (Esenbeckia leiocarpa, Savia dictyocarpa, and C. speciosa and the density of seven understory species (Balfourodendron riedelianum, Chrysophyllum gonocarpum, E. leiocarpa, Holocalyx balansae, Machaerium stipitatum, Rhaminidium elaeocarpum, and S. dictyocarpa. These results probably reflect the outcome of a complex set of interactions including facilitation and competition, and further studies are necessary to better understand the magnitude and type of the effects of individual overstory species on understory species. The occurrence of species-specific associations shown here reinforces the importance of non-random processes in structuring plant communities and suggest that the influence of overstory species on understory species in high-diversity forests may be more significant than previously thought.

  18. Plants of the fynbos biome harbour host species-specific bacterial communities.

    Science.gov (United States)

    Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel

    2016-08-01

    The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Species-specific effects of soil fauna on fungal foraging and decomposition.

    Science.gov (United States)

    Crowther, Thomas W; Boddy, Lynne; Jones, T Hefin

    2011-10-01

    Decomposer fungi are primary decomposing agents in terrestrial soils. Their mycelial networks play an important role in nutrient mineralisation and distribution, but are also nutritious resources for various soil invertebrates. Global climate change is predicted to alter the diversity and community composition of these soil fauna. To understand whether changes in invertebrate species diversity are likely to affect fungal-mediated decomposition, this study compared the grazing potentials of different invertebrate taxa and functional groups. Specifically, the grazing impacts of seven invertebrate taxa on the growth and spatial distribution of six basidiomycete fungi growing from beech wood blocks in soil microcosms were explored. Wood decay rates by fungi were also compared. The consequences of grazing were both taxon- and species-specific. Generally, macro-invertebrates caused the greatest damage, while meso- and micro-invertebrates often stimulated mycelial growth. Invertebrate size, preferences and population dynamics are likely to influence grazing potentials. Effects of grazing varied between fungi, with mycelial morphology and biochemistry possibly influencing susceptibility. Heavy grazing indirectly increased fungal-mediated wood decomposition. Changes in invertebrate community composition are predicted to have consequences for fungal growth, activity and community structure in woodland soils. Abiotic climate change factors including CO(2) and temperature affect mycelial productivity directly, but the indirect effects, mediated through changes in the soil invertebrate community, may be equally important in controlling ecosystem functioning.

  20. Diastereoisomer- and species-specific distribution of hexabromocyclododecane (HBCD) in fish and marine invertebrates.

    Science.gov (United States)

    Son, Min-Hui; Kim, Jongchul; Shin, Eun-Su; Seo, Sung-Hee; Chang, Yoon-Seok

    2015-12-30

    The levels and distributional characteristics of hexabromocyclododecane (HBCD) diastereoisomers have been largely reported for various fish and select shellfish. In this study, we reclassified a number and variety of marine invertebrates, including shellfish, to further contribute to the comprehensive understanding of the effects and assessment of human exposure to HBCD. Overall, 30 marine invertebrate species (n=188) were investigated and the following order of ∑2HBCD (α- and γ-HBCD) was observed: fish>chordata>cephalopoda>echinodermata>bivalve>crustacea. The marine invertebrates that were reclassified into nektonic and benthic organisms showed similar concentration of ∑2HBCD. The feeding habits and modes of the marine organisms were considered to compare the degree of bioaccumulation and diastereoisomer-specific distribution of HBCD due to the effects of the environment in and around pollution sources, as well as the organisms' metabolic capacities. To the best of our knowledge, this is the first study to examine the species-specific distribution patterns of HBCD for both fish and marine invertebrates. We expect to significantly expand the understanding of the environmental fate of HBCD for marine organisms. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Species-specific calls evoke asymmetric activity in the monkey's temporal poles.

    Science.gov (United States)

    Poremba, Amy; Malloy, Megan; Saunders, Richard C; Carson, Richard E; Herscovitch, Peter; Mishkin, Mortimer

    2004-01-29

    It has often been proposed that the vocal calls of monkeys are precursors of human speech, in part because they provide critical information to other members of the species who rely on them for survival and social interactions. Both behavioural and lesion studies suggest that monkeys, like humans, use the auditory system of the left hemisphere preferentially to process vocalizations. To investigate the pattern of neural activity that might underlie this particular form of functional asymmetry in monkeys, we measured local cerebral metabolic activity while the animals listened passively to species-specific calls compared with a variety of other classes of sound. Within the superior temporal gyrus, significantly greater metabolic activity occurred on the left side than on the right, only in the region of the temporal pole and only in response to monkey calls. This functional asymmetry was absent when these regions were separated by forebrain commissurotomy, suggesting that the perception of vocalizations elicits concurrent interhemispheric interactions that focus the auditory processing within a specialized area of one hemisphere.

  2. Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

    Science.gov (United States)

    Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

    2016-01-19

    Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Behavioral Relevance of Species-Specific Vasotocin Anatomy in Gregarious Finches

    Directory of Open Access Journals (Sweden)

    Aubrey M Kelly

    2013-12-01

    Full Text Available Despite substantial species differences in the vasotocin/vasopressin (VT/VP circuitry of the medial bed nucleus of the stria terminalis (BSTm and lateral septum (LS; a primary projection target of BSTm VT/VP cells, functional consequences of this variation are poorly known. Previous experiments in the highly gregarious zebra finch (Estrildidae: Taeniopygia guttata demonstrate that BSTm VT neurons promote gregariousness in a male-specific manner and reduce anxiety in both sexes. However, in contrast to the zebra finch, the less gregarious Angolan blue waxbill (Estrildidae: Uraeginthus angolensis exhibits fewer VT-immunoreactive cells in the BSTm as well as differences in receptor distribution across the LS subnuclei, suggesting that knockdown of VT production in the BSTm would produce behavioral effects in Angolan blue waxbills that are distinct from zebra finches. Thus, we here quantified social contact, gregariousness (i.e. preference for the larger of two groups, and anxiety-like behavior following bilateral antisense knockdown of VT production in the BSTm of male and female Angolan blue waxbills. We find that BSTm VT neurons promote social contact, but not gregariousness (as in male zebra finches, and that antisense effects on social contact are significantly stronger in male waxbills than in females. Knockdown of BSTm VT production has no effect on anxiety-like behavior. These data provide novel evidence that species differences in the VT/VP circuitry arising in the BSTm are accompanied by species-specific effects on affiliation behaviors.

  4. Species-Specific Mechanisms of Neuron Subtype Specification Reveal Evolutionary Plasticity of Amniote Brain Development

    Directory of Open Access Journals (Sweden)

    Tadashi Nomura

    2018-03-01

    Full Text Available Summary: Highly ordered brain architectures in vertebrates consist of multiple neuron subtypes with specific neuronal connections. However, the origin of and evolutionary changes in neuron specification mechanisms remain unclear. Here, we report that regulatory mechanisms of neuron subtype specification are divergent in developing amniote brains. In the mammalian neocortex, the transcription factors (TFs Ctip2 and Satb2 are differentially expressed in layer-specific neurons. In contrast, these TFs are co-localized in reptilian and avian dorsal pallial neurons. Multi-potential progenitors that produce distinct neuronal subtypes commonly exist in the reptilian and avian dorsal pallium, whereas a cis-regulatory element of avian Ctip2 exhibits attenuated transcription suppressive activity. Furthermore, the neuronal subtypes distinguished by these TFs are not tightly associated with conserved neuronal connections among amniotes. Our findings reveal the evolutionary plasticity of regulatory gene functions that contribute to species differences in neuronal heterogeneity and connectivity in developing amniote brains. : Neuronal heterogeneity is essential for assembling intricate neuronal circuits. Nomura et al. find that species-specific transcriptional mechanisms underlie diversities of excitatory neuron subtypes in mammalian and non-mammalian brains. Species differences in neuronal subtypes and connections suggest functional plasticity of regulatory genes for neuronal specification during amniote brain evolution. Keywords: Ctip2, Satb2, multi-potential progenitors, transcriptional regulation, neuronal connectivity

  5. Rapid species specific identification and subtyping of Yersinia enterocolitica by MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Stephan, Roger; Cernela, Nicole; Ziegler, Dominik; Pflüger, Valentin; Tonolla, Mauro; Ravasi, Damiana; Fredriksson-Ahomaa, Maria; Hächler, Herbert

    2011-11-01

    Yersinia enterocolitica are Gram-negative pathogens and known as important causes of foodborne infections. Rapid and reliable identification of strains of the species Y. enterocolitica within the genus Yersinia and the differentiation of the pathogenic from the non-pathogenic biotypes has become increasingly important. We evaluated here the application of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid species identification and subtyping of Y. enterocolitica. To this end, we developed a reference MS database library including 19 Y. enterocolitica (non-pathogenic biotype 1A and pathogenic biotypes 2 and 4) as well as 24 non-Y. enterocolitica strains, belonging to eleven different other Yersinia spp. The strains provided reproducible and unique mass spectra profiles covering a wide molecular mass range (2000 to 30,000 Da). Species-specific and biotype-specific biomarker protein mass patterns were determined for Y. enterocolitica. The defined biomarker mass patterns (SARAMIS SuperSpectrum™) were validated using 117 strains from various Y. enterocolitica bioserotypes in a blind-test. All strains were correctly identified and for all strains the mass spectrometry-based identification scheme yielded identical results compared to a characterization by a combination of biotyping and serotyping. Our study demonstrates that MALDI-TOF-MS is a reliable and powerful tool for the rapid identification of Y. enterocolitica strains to the species level and allows subtyping of strains to the biotype level. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Endometrial Polyps and Benign Endometrial Hyperplasia Present Increased Prevalence of DNA Fragmentation Factors 40 and 45 (DFF40 and DFF45) Together With the Antiapoptotic B-Cell Lymphoma (Bcl-2) Protein Compared With Normal Human Endometria.

    Science.gov (United States)

    Banas, Tomasz; Pitynski, Kazimierz; Mikos, Marcin; Cielecka-Kuszyk, Joanna

    2017-09-13

    DNA fragmentation factor 40 (DFF40) is a key executor of apoptosis. It localizes to the nucleus together with DNA fragmentation factor 45 (DFF45), which acts as a DFF40 inhibitor and chaperone. B-cell lymphoma (Bcl-2) protein is a proven antiapoptotic factor present in the cytoplasm. In this study, we aimed to investigate DFF40, DFF45, and Bcl-2 immunoexpression in endometrial polyps (EPs) and benign endometrial hyperplasia (BEH) tissue compared with that in normal proliferative endometrium (NPE) and normal secretory endometrium (NSE) as well as normal post menopausal endometrium (NAE). This study used archived samples from 65 and 62 cases of EPs and BEH, respectively. The control group consisted of 52 NPE, 54 NSE, and 54 NAE specimens. Immunohistochemistry was used to detect DFF40, DFF45, and Bcl-2. DFF40, DFF45, and Bcl-2 were more highly expressed in the glandular layer of EPs and BEH compared with the stroma, and this was not influenced by menopausal status. Both glandular and stromal expression of DFF40, DFF45, and Bcl-2 were significantly higher in EPs compared with NPE, NSE, and NAE. Glandular BEH tissue showed significantly higher DFF40, DFF45, and Bcl-2 expression than in NPE, NSE, and NAE. No differences in the glandular expression of DFF40, DFF45, and Bcl-2 were observed between EP and BEH tissues, while Bcl-2 stromal expression in BEH was significantly lower than in EPs. Glandular, menopause-independent DFF40, DFF45, and Bcl-2 overexpression may play an important role in the pathogenesis of EPs and BEH.

  7. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  8. A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

    Science.gov (United States)

    Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

    2015-10-30

    Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

  9. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.

    Science.gov (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D

    1988-09-12

    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  10. Species-specific responses of Late Quaternary megafauna to climate and humans

    DEFF Research Database (Denmark)

    Lorenzen, Eline; Nogues, David Bravo; Orlando, Ludovic Antoine Alexandre

    2011-01-01

    Despite decades of research, the roles of climate and humans in driving the dramatic extinctions of large-bodied mammals during the Late Quaternary period remain contentious. Here we use ancient DNA, species distribution models and the human fossil record to elucidate how climate and humans shape...

  11. UV-induced cell damage is species-specific among aquatic phagotrophic protists

    NARCIS (Netherlands)

    Sommaruga, R; Buma, AGJ

    2000-01-01

    The sensitivity to ultraviolet radiation (UVR, 280-400 nm) of ten species of freshwater and marine phagotrophic protists was assessed in short-term (4 h) laboratory experiments. Changes in the motility and morphology of the cells, as well as direct quantification of DNA damage, were evaluated. The

  12. Mercury speciation analysis in seafood by species-specific isotope dilution: method validation and occurrence data

    Energy Technology Data Exchange (ETDEWEB)

    Clemens, Stephanie; Guerin, Thierry [Agence Nationale de Securite Sanitaire de l' Alimentation, Laboratoire de Securite des Aliments de Maisons-Alfort, Unite des Contaminants Inorganiques et Mineraux de l' Environnement, ANSES, Maisons-Alfort (France); Monperrus, Mathilde; Donard, Olivier F.X.; Amouroux, David [IPREM UMR 5254 CNRS - Universite de Pau et des Pays de l' Adour, Laboratoire de Chimie Analytique Bio-Inorganique et Environnement, Institut des Sciences Analytiques et de Physico-chimie pour l' Environnement et les Materiaux, Pau Cedex (France)

    2011-11-15

    Methylmercury (MeHg) and total mercury (THg) in seafood were determined using species-specific isotope dilution analysis and gas chromatography combined with inductively coupled plasma mass spectrometry. Sample preparation methods (extraction and derivation step) were evaluated on certified reference materials using isotopically enriched Hg species. Solid-liquid extraction, derivation by propylation and automated agitation gave excellent accuracy and precision results. Satisfactory figures of merit for the selected method were obtained in terms of limit of quantification (1.2 {mu}g Hg kg{sup -1} for MeHg and 1.4 {mu}g Hg kg{sup -1} for THg), repeatability (1.3-1.7%), intermediate precision reproducibility (1.5% for MeHg and 2.2% for THg) and trueness (bias error less than 7%). By means of a recent strategy based on accuracy profiles ({beta}-expectation tolerance intervals), the selected method was successfully validated in the range of approximately 0.15-5.1 mg kg{sup -1} for MeHg and 0.27-5.2 mg kg{sup -1} for THg. Probability {beta} was set to 95% and the acceptability limits to {+-}15%. The method was then applied to 62 seafood samples representative of consumption in the French population. The MeHg concentrations were generally low (1.9-588 {mu}g kg{sup -1}), and the percentage of MeHg varied from 28% to 98% in shellfish and from 84% to 97% in fish. For all real samples tested, methylation and demethylation reactions were not significant, except in one oyster sample. The method presented here could be used for monitoring food contamination by MeHg and inorganic Hg in the future to more accurately assess human exposure. (orig.)

  13. Species-Specific Effects on Ecosystem Functioning Can Be Altered by Interspecific Interactions.

    Science.gov (United States)

    Clare, David S; Spencer, Matthew; Robinson, Leonie A; Frid, Christopher L J

    2016-01-01

    Biological assemblages are constantly undergoing change, with species being introduced, extirpated and experiencing shifts in their densities. Theory and experimentation suggest that the impacts of such change on ecosystem functioning should be predictable based on the biological traits of the species involved. However, interspecific interactions could alter how species affect functioning, with the strength and sign of interactions potentially depending on environmental context (e.g. homogenous vs. heterogeneous conditions) and the function considered. Here, we assessed how concurrent changes to the densities of two common marine benthic invertebrates, Corophium volutator and Hediste diversicolor, affected the ecological functions of organic matter consumption and benthic-pelagic nutrient flux. Complementary experiments were conducted within homogenous laboratory microcosms and naturally heterogeneous field plots. When the densities of the species were increased within microcosms, interspecific interactions enhanced effects on organic matter consumption and reduced effects on nutrient flux. Trait-based predictions of how each species would affect functioning were only consistently supported when the density of the other species was low. In field plots, increasing the density of either species had a positive effect on organic matter consumption (with no significant interspecific interactions) but no effect on nutrient flux. Our results indicate that species-specific effects on ecosystem functioning can be altered by interspecific interactions, which can be either facilitative (positive) or antagonistic (negative) depending on the function considered. The impacts of biodiversity change may therefore not be predictable based solely on the biological traits of the species involved. Possible explanations for why interactions were detected in microcosms but not in the field are discussed.

  14. Species-Specific Effects on Ecosystem Functioning Can Be Altered by Interspecific Interactions.

    Directory of Open Access Journals (Sweden)

    David S Clare

    Full Text Available Biological assemblages are constantly undergoing change, with species being introduced, extirpated and experiencing shifts in their densities. Theory and experimentation suggest that the impacts of such change on ecosystem functioning should be predictable based on the biological traits of the species involved. However, interspecific interactions could alter how species affect functioning, with the strength and sign of interactions potentially depending on environmental context (e.g. homogenous vs. heterogeneous conditions and the function considered. Here, we assessed how concurrent changes to the densities of two common marine benthic invertebrates, Corophium volutator and Hediste diversicolor, affected the ecological functions of organic matter consumption and benthic-pelagic nutrient flux. Complementary experiments were conducted within homogenous laboratory microcosms and naturally heterogeneous field plots. When the densities of the species were increased within microcosms, interspecific interactions enhanced effects on organic matter consumption and reduced effects on nutrient flux. Trait-based predictions of how each species would affect functioning were only consistently supported when the density of the other species was low. In field plots, increasing the density of either species had a positive effect on organic matter consumption (with no significant interspecific interactions but no effect on nutrient flux. Our results indicate that species-specific effects on ecosystem functioning can be altered by interspecific interactions, which can be either facilitative (positive or antagonistic (negative depending on the function considered. The impacts of biodiversity change may therefore not be predictable based solely on the biological traits of the species involved. Possible explanations for why interactions were detected in microcosms but not in the field are discussed.

  15. Pyrosequencing reveals highly diverse and species-specific microbial communities in sponges from the Red Sea

    KAUST Repository

    Lee, Onon

    2010-11-18

    Marine sponges are associated with a remarkable array of microorganisms. Using a tag pyrosequencing technology, this study was the first to investigate in depth the microbial communities associated with three Red Sea sponges, Hyrtios erectus, Stylissa carteri and Xestospongia testudinaria. We revealed highly diverse sponge-associated bacterial communities with up to 1000 microbial operational taxonomic units (OTUs) and richness estimates of up to 2000 species. Altogether, 26 bacterial phyla were detected from the Red Sea sponges, 11 of which were absent from the surrounding sea water and 4 were recorded in sponges for the first time. Up to 100 OTUs with richness estimates of up to 300 archaeal species were revealed from a single sponge species. This is by far the highest archaeal diversity ever recorded for sponges. A non-negligible proportion of unclassified reads was observed in sponges. Our results demonstrated that the sponge-associated microbial communities remained highly consistent in the same sponge species from different locations, although they varied at different degrees among different sponge species. A significant proportion of the tag sequences from the sponges could be assigned to one of the sponge-specific clusters previously defined. In addition, the sponge-associated microbial communities were consistently divergent from those present in the surrounding sea water. Our results suggest that the Red Sea sponges possess highly sponge-specific or even sponge-species-specific microbial communities that are resistant to environmental disturbance, and much of their microbial diversity remains to be explored. © 2011 International Society for Microbial Ecology All rights reserved.

  16. Effect of a pre-freezing treatment with cholesterol-loaded cyclodextrins on boar sperm longevity, capacitation dynamics, ability to adhere to porcine oviductal epithelial cells in vitro and DNA fragmentation dynamics.

    Science.gov (United States)

    Tomás, C; Blanch, E; Fazeli, A; Mocé, E

    2013-01-01

    The aim of this work was to examine how a pre-freezing treatment with cholesterol-loaded cyclodextrins (CLC) affects boar sperm longevity, capacitation dynamics, ability to bind to a porcine telomerase-immortalised oviductal epithelial cell line (TERT-OPEC) in vitro and DNA integrity dynamics after freeze-thawing. Although the samples treated with CLC exhibited lower sperm quality than the control samples (P0.05) after long-term incubation (26h at 37 or 16°C). Additionally, the CLC-treated spermatozoa underwent similar capacitation and DNA fragmentation dynamics as the control spermatozoa (P>0.05). However, CLC-treated spermatozoa were better able to bind to TERT-OPEC in vitro (POPEC in vitro, which could have an effect on the establishment of the sperm reservoir in the ampullary--isthmic junction in vivo. Additionally, frozen-thawed spermatozoa can be stored at 16°C for at least 6h without a significant observable decline in sperm quality, which could be beneficial for the transport of thawed diluted doses of spermatozoa from the laboratory to the farm.

  17. Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism.

    Science.gov (United States)

    Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B

    2006-03-01

    Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.

  18. Aberration of mitosis by hexavalent chromium in some Fabaceae members is mediated by species-specific microtubule disruption.

    Science.gov (United States)

    Eleftheriou, Eleftherios P; Michalopoulou, Vasiliki A; Adamakis, Ioannis-Dimosthenis S

    2015-05-01

    Because the detrimental effects of chromium (Cr) to higher plants have been poorly investigated, the present study was undertaken to verify the toxic attributes of hexavalent chromium [Cr(VI)] to plant mitotic microtubules (MTs), to determine any differential disruption of MTs during mitosis of taxonomically related species and to clarify the relationship between the visualized chromosomal aberrations and the Cr(VI)-induced MT disturbance. For this purpose, 5-day-old uniform seedlings of Vicia faba, Pisum sativum, Vigna sinensis and Vigna angularis, all belonging to the Fabaceae family, were exposed to 250 μM Cr(VI) supplied as potassium dichromate (K₂Cr₂O₇) for 24, 72 and 120 h and others in distilled water serving as controls. Root tip samples were processed for tubulin immunolabelling (for MT visualization) and DNA fluorescent staining (for chromosomal visualization). Microscopic preparations of cell squashes were then examined and photographed by confocal laser scanning microscopy (CLSM). Cr(VI) halted seedling growth turning roots brown and necrotic. Severe chromosomal abnormalities and differential disturbance of the corresponding MT arrays were found in all mitotic phases. In particular, in V. faba MTs were primarily depolymerized and replaced by atypical tubulin conformations, whereas in P. sativum, V. sinensis and V. angularis they became bundled in a time-dependent manner. In P. sativum, the effects were milder compared to those of the other species, but in all cases MT disturbance adversely affected the proper aggregation of chromosomes on the metaphase plate, their segregation at anaphase and organization of the new nuclei at telophase. Cr(VI) is very toxic to seedling growth. The particular effect depends on the exact stage the cell is found at the time of Cr(VI) entrance and is species-specific. Mitotic MT arrays are differentially deranged by Cr(VI) in the different species examined, even if they are taxonomically related, while their

  19. Species-Specific Monoclonal Antibodies to Escherichia coli-Expressed p36 Cytosolic Protein of Mycoplasma hyopneumoniae

    Science.gov (United States)

    Caron, J.; Sawyer, N.; Moumen, B. Ben Abdel; Bouh, K. Cheikh Saad; Dea, S.

    2000-01-01

    The p36 protein of Mycoplasma hyopneumoniae is a cytosolic protein carrying species-specific antigenic determinants. Based on the genomic sequence of the reference strain ATCC 25934, primers were designed for PCR amplification of the p36-encoding gene (948 bp). These primers were shown to be specific to M. hyopneumoniae since no DNA amplicons could be obtained with other mycoplasma species and pathogenic bacteria that commonly colonize the porcine respiratory tract. The amplified p36 gene was subcloned into the pGEX-4T-1 vector to be expressed in Escherichia coli as a fusion protein with glutathione S-transferase (GST). The GST-p36 recombinant fusion protein was purified by affinity chromatography and cut by thrombin, and the enriched p36 protein was used to immunize female BALB/c mice for the production of anti-p36 monoclonal antibodies (MAbs). The polypeptide specificity of the nine MAbs obtained was confirmed by Western immunoblotting with cell lysates prepared from the homologous strain. Cross-reactivity studies of the anti-p36 MAbs towards two other M. hyopneumoniae reference strains (ATCC 25095 and J strains) and Quebec field strains that had been isolated in culture suggested that these anti-p36 MAbs were directed against a highly conserved epitope, or closely located epitopes, of the p36 protein. No reactivity was demonstrated against other mycoplasma species tested. Clinical signs and lesions suggestive of enzootic pneumonia were reproduced in specific-pathogen-free pigs infected experimentally with a virulent Quebec field strain (IAF-DM9827) of M. hyopneumoniae. The bacteria could be recovered from lung homogenates of pigs that were killed after the 3-week observation period by both PCR and cultivation procedures. Furthermore, the anti-p36 MAbs permitted effective detection by indirect immunofluorescence of M. hyopneumoniae in frozen lung sections from experimentally infected pigs. However, attempts to use the recombinant p36 protein as an antigen in an

  20. DNA restriction fragment length polymorphism analysis of Mycobacterium tuberculosis isolates from HIV-seropositive and HIV-seronegative patients in Kampala, Uganda

    Directory of Open Access Journals (Sweden)

    Katabazi Fred A

    2009-02-01

    Full Text Available Abstract Background The identification and differentiation of strains of Mycobacterium tuberculosis by DNA fingerprinting has provided a better understanding of the epidemiology and tracing the transmission of tuberculosis. We set out to determine if there was a relationship between the risk of belonging to a group of tuberculosis patients with identical mycobacterial DNA fingerprint patterns and the HIV sero-status of the individuals in a high TB incidence peri-urban setting of Kampala, Uganda. Methods One hundred eighty three isolates of Mycobacterium tuberculosis from 80 HIV seropositive and 103 HIV seronegative patients were fingerprinted by standard IS6110-RFLP. Using the BioNumerics software, strains were considered to be clustered if at least one other patient had an isolate with identical RFLP pattern. Results One hundred and eighteen different fingerprint patterns were obtained from the 183 isolates. There were 34 clusters containing 54% (99/183 of the patients (average cluster size of 2.9, and a majority (96.2% of the strains possessed a high copy number (≥ 5 copies of the IS6110 element. When strains with P = 0.615, patients aged P = 0.100, and sex (aOR 1.12, 95%CI 0.60–2.06, P = 0.715. Conclusion The sample showed evidence of a high prevalence of recent transmission with a high average cluster size, but infection with an isolate with a fingerprint found to be part of a cluster was not associated with any demographic or clinical characteristics, including HIV status.

  1. Elucidating Microbial Species-Specific Effects on Organic Matter Transformation in Marine Sediments

    Science.gov (United States)

    Mahmoudi, N.; Enke, T. N.; Beaupre, S. R.; Teske, A.; Cordero, O. X.; Pearson, A.

    2017-12-01

    Microbial transformation and decomposition of organic matter in sediments constitutes one of the largest fluxes of carbon in marine environments. Mineralization of sedimentary organic matter by microorganisms results in selective degradation such that bioavailable or accessible compounds are rapidly metabolized while more recalcitrant, complex compounds are preserved and buried in sediment. Recent studies have found that the ability to use different carbon sources appears to vary among microorganisms, suggesting that the availability of certain pools of carbon can be specific to the taxa that utilize the pool. This implies that organic matter mineralization in marine environments may depend on the metabolic potential of the microbial populations that are present and active. The goal of our study was to investigate the extent to which organic matter availability and transformation may be species-specific using sediment from Guaymas Basin (Gulf of California). We carried out time-series incubations using bacterial isolates and sterilized sediment in the IsoCaRB system which allowed us to measure the production rates and natural isotopic signatures (δ13C and Δ14C) of microbially-respired CO2. Separate incubations using two different marine bacterial isolates (Vibrio sp. and Pseudoalteromonas sp.) and sterilized Guaymas Basin sediment under oxic conditions showed that the rate and total quantity of organic matter metabolized by these two species differs. Approximately twice as much CO2 was collected during the Vibrio sp. incubation compared to the Pseudoalteromonas sp. incubation. Moreover, the rate at which organic matter was metabolized by the Vibrio sp. was much higher than the Pseudoalteromonas sp. indicating the intrinsic availability of organic matter in sediments may depend on the species that is present and active. Isotopic analyses of microbially respired CO2 will be used to constrain the type and age of organic matter that is accessible to each species

  2. Organ- and species-specific accumulation of metals in two land snail species (Gastropoda, Pulmonata)

    Energy Technology Data Exchange (ETDEWEB)

    Boshoff, Magdalena, E-mail: magdalena.boshoff@ua.ac.be [University of Antwerp, Systemic Physiological and Ecotoxicological Research, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Jordaens, Kurt [Royal Museum for Central Africa (JEMU), Leuvensesteenweg 13, B-3080 Tervuren (Belgium); University of Antwerp, Evolutionary Ecology Group, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Backeljau, Thierry [University of Antwerp, Evolutionary Ecology Group, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Royal Belgian Institute of Natural Sciences (JEMU), Vautierstraat 29, B-1000 Brussels (Belgium); Lettens, Suzanna [Research Institute for Nature and Forest (INBO), Kliniekstraat 25, B-1070 Brussels (Belgium); Tack, Filip [Ghent University, Laboratory of Analytical Chemistry and Applied Ecochemistry, Coupure Links 265, B-9000 Ghent (Belgium); Vandecasteele, Bart [Institute for Agricultural and Fisheries Research (ILVO), Burg van Gansberghelaan 109, B-9820 Merelbeke (Belgium); De Jonge, Maarten; Bervoets, Lieven [University of Antwerp, Systemic Physiological and Ecotoxicological Research, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

    2013-04-01

    In order to evaluate the usefulness of terrestrial gastropods as bioindicators there is a need for studies that simultaneously compare (1) concentrations of metals in reference and polluted plots, (2) species within the same polluted habitat, (3) metal accumulation patterns in different organs and (4) metal accumulation patterns in relation to soil physicochemical properties. This study aims to assess metal accumulation patterns in two land snail species. Instead of analyzing an organism as a whole, investigating the partitioning of metals in different organs can provide information on the actual toxicological relevant fractions. Therefore, concentrations of Ag, Cd, Cr, Cu, Ni and Zn were examined in five different organs of Cepaea nemoralis, as well as in the foot and the body of Succinea putris. Snails were sampled at four polluted dredged sediment disposal localities and three adjacent less polluted reference plots situated along waterways in Flanders, Belgium. Due to the small size and problematic dissection of S. putris only the concentrations in the foot of both species could be compared. For this reason only, C. nemoralis can be described as a better bioindicator species that allows a far more detailed analysis of organ metal accumulation. This study showed that organs other than the digestive gland may be involved in the immobilization and detoxification of metals. Furthermore, pH, soil fractionation (clay %, silt %, sand %) and organic matter, correlate with metal accumulation in organs. However, most often the soil metal concentrations did not correlate with the concentrations found in snail organs. Metal concentrations in organs of both species (1) differed among polluted plots but rarely between polluted and reference plots within a locality, (2) were organ-specific (digestive gland > foot > albumen gland = spermoviduct = ovotestis), (3) were species-specific and (4) depended on the metal type (high Cd and Cu concentrations were observed in the

  3. 利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

    Institute of Scientific and Technical Information of China (English)

    范惠玲; 白生文; 李华清; 孙万仓

    2016-01-01

    Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系,也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官,并分离与自交亲和性有关的 cDNA 片段,以芸芥的一对近等基因系,自交亲和系(SC)与自交不亲和系(SI)为试材,利用差异显示 RT-PCR 技术分别对开花前和开花后的叶片、花药和柱头进行鉴定。结果表明,不论开花前还是开花后,芸芥自交亲和系与自交不亲和系的叶片或花药间的扩增带型是一样的,但在

  4. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

    Science.gov (United States)

    Li, Lin-Feng; Häkkinen, Markku; Yuan, Yong-Ming; Hao, Gang; Ge, Xue-Jun

    2010-10-01

    Musaceae is a small paleotropical family. Three genera have been recognised within this family although the generic delimitations remain controversial. Most species of the family (around 65 species) have been placed under the genus Musa and its infrageneric classification has long been disputed. In this study, we obtained nuclear ribosomal ITS and chloroplast (atpB-rbcL, rps16, and trnL-F) DNA sequences of 36 species (42 accessions of ingroups representing three genera) together with 10 accessions of ingroups retrieved from GenBank database and 4 accessions of outgroups, to construct the phylogeny of the family, with a special reference to the infrageneric classification of the genus Musa. Our phylogenetic analyses elaborated previous results in supporting the monophyly of the family and suggested that Musella and Ensete may be congeneric or at least closely related, but refuted the previous infrageneric classification of Musa. None of the five sections of Musa previously defined based on morphology was recovered as monophyletic group in the molecular phylogeny. Two infrageneric clades were identified, which corresponded well to the basic chromosome numbers of x=11 and 10/9/7, respectively: the former clade comprises species from the sections Musa and Rhodochlamys while the latter contains sections of Callimusa, Australimusa, and Ingentimusa. Copyright 2010 Elsevier Inc. All rights reserved.

  5. High Aneuploidy Rates Observed in Embryos Derived from Donated Oocytes are Related to Male Aging and High Percentages of Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    Javier García-Ferreyra

    2015-01-01

    Full Text Available Capsule Male aging effects on aneuploidy rates in embryos. Objective Paternal age is associated with decreasing sperm quality; however, it is unknown if it influences chromosomal abnormalities in embryos. The objective of this study is to evaluate if the aneuploidy rates in embryos are affected by advanced paternal age. Methods A total of 286 embryos, obtained from 32 in vitro fertilization/intracytoplasmic sperm injection cycles with donated oocytes in conjunction with preimplantation genetic diagnosis, were allocated according to paternal age in three groups: Group A: ≤39 years (n = 44 embryos; Group B: 40-49 years (n = 154 embryos; and Group C: ≥50 years (n = 88 embryos. Fertilization rates, embryo quality at day 3, blastocyst development, and aneuploidy embryo rates were then compared. Results There was no difference in the seminal parameters (volume, concentration, and motility in the studied groups. Fertilization rate, percentages of zygotes underwent cleavage, and good quality embryos on day 3 were similar between the three evaluated groups. The group of men ≥50 years had significantly more sperm with damaged DNA, low blastocyst development rate, and higher aneuploidy rates in embryos compared to the other two evaluated groups ( P 50 years old.

  6. Systematic development of Phytophthora species-specific mitochondrial diagnostic markers for economically important members of the genus

    Science.gov (United States)

    The genus Phytophthora contains many invasive species to the USA that have the potential to cause significant damage to agriculture and native ecosystems. A genus and species-specific diagnostic assay was previously reported based on mitochondrial gene order differences that allowed for the systemat...

  7. Putative and unique gene sequence utilization for the design of species specific probes as modeled by Lactobacillus plantarum

    Science.gov (United States)

    The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...

  8. Diphtheria toxin- and Pseudomonas A toxin-mediated apoptosis. ADP ribosylation of elongation factor-2 is required for DNA fragmentation and cell lysis and synergy with tumor necrosis factor-alpha.

    Science.gov (United States)

    Morimoto, H; Bonavida, B

    1992-09-15

    We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings

  9. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    Directory of Open Access Journals (Sweden)

    Leyla Esfandiari

    2016-07-01

    Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  10. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  11. Malazy, a degenerate, species-specific transposable element in Cercospora zeae-maydis.

    Science.gov (United States)

    Shim, Won-Bo; Dunkle, Larry D

    2005-01-01

    Two fungal pathogens, Cercospora zeae-maydis Groups I and II, cause gray leaf spot of maize. During the sequencing of a cosmid library from C. zeae-maydis Group I, we discovered a sequence with high similarity to Maggy, a transposable element from Magnaporthe grisea. The element from C. zeae-maydis, named Malazy, contained 194-base-pair terminal repeats and sequences with high similarity to reverse transcriptase and integrase, components of the POL gene in the gypsy-like retrotransposons in fungi. Sequences with similarity to other POL gene components, protease and ribonuclease, were not detected in Malazy. A single copy of the element was detected by PCR and Southern analyses in all six North American isolates of C. zeae-maydis Group I but was not detected in the four isolates of C. zeae-maydis Group II from three continents or in phylogenetically related species. Fragments of the core domains of reverse transcriptase and integrase contained a high frequency of stop codons that were conserved in all six isolates of Group I. Additional C:G to T:A transitions in occasional isolates usually were silent mutations, while two resulted in isolate-specific stop codons. The absence of Malazy from related species suggests that it was acquired after the divergence of C. zeae-maydis Groups I and II. The high frequency of stop codons and the presence of a single copy of the element suggest that it was inactivated soon after it was acquired. Because the element is inactive and because reading frames for other genes were not found in sequences flanking the element, Malazy does not appear to be the cause of differences leading to speciation or genetic diversity between C. zeae-maydis Groups I and II.

  12. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  13. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  14. Total and species-specific quantitative analyses of trace elements in sediment by isotope dilution inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    Inagaki, Kazumi; Takatsu, Akiko; Yarita, Takashi; Okamoto, Kensaku; Chiba, Koichi

    2009-01-01

    Isotope dilution inductively coupled plasma mass spectrometry (ID-ICP-MS) is one of the reliable methods for total and species-specific quantitative analysis of trace elements. However, several technical problems (e.g. spectral interference caused from sample constituents) should be overcome to obtain reliable analytical results when environmental samples are analyzed by ID-ICP-MS. In our laboratory, various methods based on ID-ICP-MS have been investigated for reliable quantitative analyses of trace elements in environmental samples. In this paper, coprecipitate separation/ID-ICP-MS for the determination of trace elements in sediment, cation exchange disk filtration/ID-ICP-MS for the determination of selenium in sediment, species-specific ID-ICP-MS using 118 Sn/labeled organotin compounds for the determination of butyltins and phenyltins, and the application of the ID-ICP-MS methods to the certification of sediment reference materials are described. (author)

  15. What difference does it make if viruses are strain-, rather than species-specific?

    Directory of Open Access Journals (Sweden)

    Tron Frede Thingstad

    2015-04-01

    Full Text Available Theoretical work has suggested an important role of lytic viruses in controlling the diversity of their prokaryotic hosts. Yet, providing strong experimental or observational support (or refutation for this has proven evasive. Such models have usually assumed host groups to correspond to the species level, typically represented by 16S rDNA data. Recent model developments take into account the resolution of species into strains with differences in their susceptibility to viral attack. With strains as the host groups, the models will have explicit viral control of abundance at strain level, combined with explicit predator or resource control at community level, but the direct viral control at species level then disappears. Abundance of a species therefore emerges as the combination of how many strains, and at what abundance, this species can establish in competition with other species from a seeding community. We here discuss how species diversification and strain diversification may introduce competitors and defenders, respectively, and that the balance between the two may be a factor in the control of species diversity in mature natural communities. These models suggest that the balance between the two may be a factor in the control of species diversity in mature natural communities. These models can also give a dominance of individuals from strains with high cost of resistance; suggesting that the high proportion of dormant cells among pelagic heterotrophic prokaryotes may reflect their need for expensive defense rather than the lack of suitable growth substrates in their environment.

  16. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  17. Inhibitory and toxic effects of extracellular self-DNA in litter: a mechanism for negative plant-soil feedbacks?

    Science.gov (United States)

    Mazzoleni, Stefano; Bonanomi, Giuliano; Incerti, Guido; Chiusano, Maria Luisa; Termolino, Pasquale; Mingo, Antonio; Senatore, Mauro; Giannino, Francesco; Cartenì, Fabrizio; Rietkerk, Max; Lanzotti, Virginia

    2015-02-01

    Plant-soil negative feedback (NF) is recognized as an important factor affecting plant communities. The objectives of this work were to assess the effects of litter phytotoxicity and autotoxicity on root proliferation, and to test the hypothesis that DNA is a driver of litter autotoxicity and plant-soil NF. The inhibitory effect of decomposed litter was studied in different bioassays. Litter biochemical changes were evaluated with nuclear magnetic resonance (NMR) spectroscopy. DNA accumulation in litter and soil was measured and DNA toxicity was assessed in laboratory experiments. Undecomposed litter caused nonspecific inhibition of root growth, while autotoxicity was produced by aged litter. The addition of activated carbon (AC) removed phytotoxicity, but was ineffective against autotoxicity. Phytotoxicity was related to known labile allelopathic compounds. Restricted (13) C NMR signals related to nucleic acids were the only ones negatively correlated with root growth on conspecific substrates. DNA accumulation was observed in both litter decomposition and soil history experiments. Extracted total DNA showed evident species-specific toxicity. Results indicate a general occurrence of litter autotoxicity related to the exposure to fragmented self-DNA. The evidence also suggests the involvement of accumulated extracellular DNA in plant-soil NF. Further studies are needed to further investigate this unexpected function of extracellular DNA at the ecosystem level and related cellular and molecular mechanisms. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  18. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  19. Univalents and fragments in the meiosis of mammals

    International Nuclear Information System (INIS)

    Vyglenov, A.

    1987-01-01

    The manifestation of univalents and fragments in spermatocytes in diakinese-metaphase was studied on mice, rats, Syrian hamsters and rabbits irradiated with various dose rates. It was established that the incidence of the univalents resulting from the separation of the XY and autosomic bivalents and of the fragments did not depend on the dose rate and there were no differences between the control and the irradiated animals. A species specificity was found in the manifestation of the gonosomic and to some extent of the autosomic univalents. To a certain extent the differences in the incidence of the autosomic univalents and particularly of the fragments most probably were a consequence of the various measuring methods. In comparative aspect, the investigated mammals rank as follows: with the lowest incidence of univalents and fragments was the macaque-rhesus, with higher was the rat, followed by the Syrian hamster and with very high - the mouse and rabbit

  20. Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

    Science.gov (United States)

    Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

    2017-11-01

    The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

  1. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  2. Cloning and Characterization of a Complex DNA Fingerprinting Probe for Candida parapsilosis

    Science.gov (United States)

    Enger, Lee; Joly, Sophie; Pujol, Claude; Simonson, Patricia; Pfaller, Michael; Soll, David R.

    2001-01-01

    Candida parapsilosis accounts for a significant number of nosocomial fungemias, but in fact, no effective and verified genetic fingerprinting method has emerged for assessing the relatedness of independent isolates for epidemiological studies. A complex 15-kb DNA fingerprinting probe, Cp3-13, was therefore isolated from a library of C. parapsilosis genomic DNA fragments. The efficacy of Cp3-13 for DNA fingerprinting was verified by a comparison of its clustering capacity with those of randomly amplified polymorphic DNA analysis and internally transcribed spacer region sequencing, by testing species specificity, and by assessing its capacity to identify microevolutionary changes both in vitro and in vivo. Southern blot hybridization of EcoRI/SalI-digested DNA with Cp3-13 provides a fingerprinting system that (i) identifies the same strain in independent isolates, (ii) discriminates between unrelated isolates, (iii) separates independent isolates into valid groups in a dendrogram, (iv) identifies microevolution in infecting populations, and (v) is amenable to automatic computer-assisted DNA fingerprint analysis. This probe is now available for epidemiological studies. PMID:11158125

  3. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  4. Analysis of genetic diversity and population structure of oil palm (Elaeis guineensis) from China and Malaysia based on species-specific simple sequence repeat markers.

    Science.gov (United States)

    Zhou, L X; Xiao, Y; Xia, W; Yang, Y D

    2015-12-08

    Genetic diversity and patterns of population structure of the 94 oil palm lines were investigated using species-specific simple sequence repeat (SSR) markers. We designed primers for 63 SSR loci based on their flanking sequences and conducted amplification in 94 oil palm DNA samples. The amplification result showed that a relatively high level of genetic diversity was observed between oil palm individuals according a set of 21 polymorphic microsatellite loci. The observed heterozygosity (Ho) was 0.3683 and 0.4035, with an average of 0.3859. The Ho value was a reliable determinant of the discriminatory power of the SSR primer combinations. The principal component analysis and unweighted pair-group method with arithmetic averaging cluster analysis showed the 94 oil palm lines were grouped into one cluster. These results demonstrated that the oil palm in Hainan Province of China and the germplasm introduced from Malaysia may be from the same source. The SSR protocol was effective and reliable for assessing the genetic diversity of oil palm. Knowledge of the genetic diversity and population structure will be crucial for establishing appropriate management stocks for this species.

  5. Interpreting sperm DNA damage in a diverse range of mammalian sperm by means of the two-tailed comet assay

    Science.gov (United States)

    Cortés-Gutiérrez, Elva I.; López-Fernández, Carmen; Fernández, José Luis; Dávila-Rodríguez, Martha I.; Johnston, Stephen D.; Gosálvez, Jaime

    2014-01-01

    Key Concepts The two-dimensional Two-Tailed Comet assay (TT-comet) protocol is a valuable technique to differentiate between single-stranded (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell.Protein lysis inherent with the TT-comet protocol accounts for differences in sperm protamine composition at a species-specific level to produce reliable visualization of sperm DNA damage.Alkaline treatment may break the sugar–phosphate backbone in abasic sites or at sites with deoxyribose damage, transforming these lesions into DNA breaks that are also converted into ssDNA. These lesions are known as Alkali Labile Sites “ALSs.”DBD–FISH permits the in situ visualization of DNA breaks, abasic sites or alkaline-sensitive DNA regions.The alkaline comet single assay reveals that all mammalian species display constitutive ALS related with the requirement of the sperm to undergo transient changes in DNA structure linked with chromatin packing.Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome.The TT is a valuable tool for identifying SSBs or DSBs in sperm cells with DNA fragmentation and can be therefore used for the purposes of fertility assessment. Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome. A series of methodologies to assess DNA damage in spermatozoa have been developed but most are unable to differentiate between single-stranded DNA breaks (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell. The two-dimensional Two-Tailed Comet assay (TT-comet) protocol highlighted in this review overcomes this limitation and emphasizes the importance in accounting for the difference in sperm protamine composition at a species-specific level for the appropriate preparation of the assay. The TT-comet is a modification of the original comet assay that uses a two dimensional electrophoresis to

  6. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  7. Scar-less multi-part DNA assembly design automation

    Science.gov (United States)

    Hillson, Nathan J.

    2016-06-07

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

  8. Molecular characterization and chromosomal distribution of a species-specific transcribed centromeric satellite repeat from the olive fruit fly, Bactrocera oleae.

    Directory of Open Access Journals (Sweden)

    Konstantina T Tsoumani

    Full Text Available Satellite repetitive sequences that accumulate in the heterochromatin consist a large fraction of a genome and due to their properties are suggested to be implicated in centromere function. Current knowledge of heterochromatic regions of Bactrocera oleae genome, the major pest of the olive tree, is practically nonexistent. In our effort to explore the repetitive DNA portion of B. oleae genome, a novel satellite sequence designated BoR300 was isolated and cloned. The present study describes the genomic organization, abundance and chromosomal distribution of BoR300 which is organized in tandem, forming arrays of 298 bp-long monomers. Sequence analysis showed an AT content of 60.4%, a CENP-B like-motif and a high curvature value based on predictive models. Comparative analysis among randomly selected monomers demonstrated a high degree of sequence homogeneity (88%-97% of BoR300 repeats, which are present at approximately 3,000 copies per haploid genome accounting for about 0.28% of the total genomic DNA, based on two independent qPCR approaches. In addition, expression of the repeat was also confirmed through RT-PCR, by which BoR300 transcripts were detected in both sexes. Fluorescence in situ hybridization (FISH of BoR300 on mitotic metaphases and polytene chromosomes revealed signals to the centromeres of two out of the six chromosomes which indicated a chromosome-specific centromeric localization. Moreover, BoR300 is not conserved in the closely related Bactrocera species tested and it is also absent in other dipterans, but it's rather restricted to the B. oleae genome. This feature of species-specificity attributed to BoR300 satellite makes it a good candidate as an identification probe of the insect among its relatives at early development stages.

  9. The induction of species-specific immunity against Schistosoma japonicum by exposure of rats to ultra-violet attenuated cercariae

    International Nuclear Information System (INIS)

    Moloney, N.A.; Webbe, G.; Hinchcliffe, P.

    1987-01-01

    Single percutaneous immunizations of Fischer rats with 1000 ultra-violet attenuated Schistosoma japonicum cercariae induced 52-88% resistance to challenge 4 weeks later. Increasing this to 3 immunizations induced 90% resistance to challenge, and this level of protection remained undiminished for up to 40 weeks after vaccination. Rats vaccinated with gamma-irradiated S. mansoni cercariae were resistant to challenge with S. mansoni but not S. japonicum. Similarly rats vaccinated with u.v.-attenuated S. japonicum cercariae were not resistant to heterologous challenge. Thus irradiated vaccines are species-specific in both permissive and non-permissive hosts. (author)

  10. DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

    Science.gov (United States)

    Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

    2015-01-01

    Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

  11. Species-specific control of external superoxide levels by the coral holobiont during a natural bleaching event

    Science.gov (United States)

    Diaz, Julia M.; Hansel, Colleen M.; Apprill, Amy; Brighi, Caterina; Zhang, Tong; Weber, Laura; McNally, Sean; Xun, Liping

    2016-12-01

    The reactive oxygen species superoxide (O2.-) is both beneficial and detrimental to life. Within corals, superoxide may contribute to pathogen resistance but also bleaching, the loss of essential algal symbionts. Yet, the role of superoxide in coral health and physiology is not completely understood owing to a lack of direct in situ observations. By conducting field measurements of superoxide produced by corals during a bleaching event, we show substantial species-specific variation in external superoxide levels, which reflect the balance of production and degradation processes. Extracellular superoxide concentrations are independent of light, algal symbiont abundance and bleaching status, but depend on coral species and bacterial community composition. Furthermore, coral-derived superoxide concentrations ranged from levels below bulk seawater up to ~120 nM, some of the highest superoxide concentrations observed in marine systems. Overall, these results unveil the ability of corals and/or their microbiomes to regulate superoxide in their immediate surroundings, which suggests species-specific roles of superoxide in coral health and physiology.

  12. Species-specific patterns of diel migration into the Oxygen Minimum Zone by euphausiids in the Humboldt Current Ecosystem

    Science.gov (United States)

    Antezana, Tarsicio

    2009-12-01

    A series of stratified bongo net samples taken over a 2 day period at ca. 18°S, about 20 nm off the coast of Peru, South America, suggest species-specific patterns of diel vertical migration into the Oxygen Minimum Zone (OMZ) of the Humboldt Current Ecosystem (HCE). The OMZ was the most dramatic feature of the water column and seemed to determine the extent of migration: Stylocheiron affine migrated only to the shallow oxycline; whereas Euphausia mucronata, Euphausia eximia, Euphausia distinguenda and Euphausia tenera migrated to the core of the OMZ; and Nematoscelis gracilis to beneath the core of the OMZ. Some differences were also found in the timing and duration of the ascent and descent, and residence times in shallow and deep layers. E. mucronata, N. gracilis and E. distinguenda displayed a normal descent during sunrise, and ascent during sunset. E. eximia and E. tenera also descended during sunrise but seemed to begin their ascent earlier in the afternoon and consequently shortened their deep residence times. S. affine showed the most extended residence times at the shallow layer and the shortest vertical displacement. Day and night vertical stratification and differences in the timing of migration into and out of the OMZ of the HCE suggest a community structure based on habitat partitioning whereby species avoided co-occurrence in time and space. Species-specific patterns of vertical stratification and migratory chronology are examined with regard to body and gill sizes, feeding adaptations of euphausiids, and potential food resources at the OMZ.

  13. Species-Specific Variations in the Nutritional Quality of Southern Ocean Phytoplankton in Response to Elevated pCO2

    Directory of Open Access Journals (Sweden)

    Cathryn Wynn-Edwards

    2014-06-01

    Full Text Available Increased seawater pCO2 has the potential to alter phytoplankton biochemistry, which in turn may negatively affect the nutritional quality of phytoplankton as food for grazers. Our aim was to identify how Antarctic phytoplankton, Pyramimonas gelidicola, Phaeocystis antarctica, and Gymnodinium sp., respond to increased pCO2. Cultures were maintained in a continuous culture setup to ensure stable CO2 concentrations. Cells were subjected to a range of pCO2 from ambient to 993 µatm. We measured phytoplankton response in terms of cell size, cellular carbohydrate content, and elemental, pigment and fatty acid composition and content. We observed few changes in phytoplankton biochemistry with increasing CO2 concentration which were species-specific and predominantly included differences in the fatty acid composition. The C:N ratio was unaffected by CO2 concentration in the three species, while carbohydrate content decreased in Pyramimonas gelidicola, but increased in Phaeocystis antarctica. We found a significant reduction in the content of nutritionally important polyunsaturated fatty acids in Pyramimonas gelidicola cultures under high CO2 treatment, while cellular levels of the polyunsaturated fatty acid 20:5ω3, EPA, in Gymnodinium sp. increased. These changes in fatty acid profile could affect the nutritional quality of phytoplankton as food for grazers, however, further research is needed to identify the mechanisms for the observed species-specific changes and to improve our ability to extrapolate laboratory-based experiments on individual species to natural communities.

  14. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  15. Reliable discrimination of 10 ungulate species using high resolution melting analysis of faecal DNA.

    Directory of Open Access Journals (Sweden)

    Ana Ramón-Laca

    Full Text Available Identifying species occupying an area is essential for many ecological and conservation studies. Faecal DNA is a potentially powerful method for identifying cryptic mammalian species. In New Zealand, 10 species of ungulate (Order: Artiodactyla have established wild populations and are managed as pests because of their impacts on native ecosystems. However, identifying the ungulate species present within a management area based on pellet morphology is unreliable. We present a method that enables reliable identification of 10 ungulate species (red deer, sika deer, rusa deer, fallow deer, sambar deer, white-tailed deer, Himalayan tahr, Alpine chamois, feral sheep, and feral goat from swabs of faecal pellets. A high resolution melting (HRM assay, targeting a fragment of the 12S rRNA gene, was developed. Species-specific primers were designed and combined in a multiplex PCR resulting in fragments of different length and therefore different melting behaviour for each species. The method was developed using tissue from each of the 10 species, and was validated in blind trials. Our protocol enabled species to be determined for 94% of faecal pellet swabs collected during routine monitoring by the New Zealand Department of Conservation. Our HRM method enables high-throughput and cost-effective species identification from low DNA template samples, and could readily be adapted to discriminate other mammalian species from faecal DNA.

  16. Internal Transcribed Spacer (ITS), an ideal DNA barcode for species ...

    African Journals Online (AJOL)

    Background: DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. Materials and Methods: In the present study, four potential DNA barcodes, namely rbcL, matK, ...

  17. The relationships between termite mound CH4/CO2 emissions and internal concentration ratios are species specific

    Directory of Open Access Journals (Sweden)

    H. Jamali

    2013-04-01

    Full Text Available We investigated the relative importance of CH4 and CO2 fluxes from soil and termite mounds at four different sites in the tropical savannas of northern Australia near Darwin and assessed different methods to indirectly predict CH4 fluxes based on CO2 fluxes and internal gas concentrations. The annual flux from termite mounds and surrounding soil was dominated by CO2 with large variations among sites. On a carbon dioxide equivalent (CO2-e basis, annual CH4 flux estimates from termite mounds were 5- to 46-fold smaller than the concurrent annual CO2 flux estimates. Differences between annual soil CO2 and soil CH4 (CO2-e fluxes were even greater, soil CO2 fluxes being almost three orders of magnitude greater than soil CH4 (CO2-e fluxes at site. The contribution of CH4 and CO2 emissions from termite mounds to the total CH4 and CO2 emissions from termite mounds and soil in CO2-e was less than 1%. There were significant relationships between mound CH4 flux and mound CO2 flux, enabling the prediction of CH4 flux from measured CO2 flux; however, these relationships were clearly termite species specific. We also observed significant relationships between mound flux and gas concentration inside mound, for both CH4 and CO2, and for all termite species, thereby enabling the prediction of flux from measured mound internal gas concentration. However, these relationships were also termite species specific. Using the relationship between mound internal gas concentration and flux from one species to predict mound fluxes from other termite species (as has been done in the past would result in errors of more than 5-fold for mound CH4 flux and 3-fold for mound CO2 flux. This study highlights that CO2 fluxes from termite mounds are generally more than one order of magnitude greater than CH4 fluxes. There are species-specific relationships between CH4 and CO2 fluxes from a mound, and between the inside mound concentration of a gas and the mound flux emission of the

  18. The relationship between termite mound CH4/CO2 emissions and internal concentration ratios are species specific

    Science.gov (United States)

    Jamali, H.; Livesley, S. J.; Hutley, L. B.; Fest, B.; Arndt, S. K.

    2012-12-01

    1. We investigated the relative importance of CH4 and CO2 fluxes from soil and termite mounds at four different sites in the tropical savannas of Northern Australia near Darwin and assessed different methods to indirectly predict CH4 fluxes based on CO2 fluxes and internal gas concentrations. 2. The annual flux from termite mounds and surrounding soil was dominated by CO2 with large variations among sites. On a CO2-e basis, annual CH4 flux estimates from termite mounds were 5- to 46-fold smaller than the concurrent annual CO2 flux estimates. Differences between annual soil CO2 and soil CH4 (CO2-e) fluxes were even greater, soil CO2 fluxes being almost three orders of magnitude greater than soil CH4 (CO2-e) fluxes at site. 3. There were significant relationships between mound CH4 flux and mound CO2 flux, enabling the prediction of CH4 flux from measured CO2 flux, however, these relationships were clearly termite species specific. 4. We also observed significant relationships between mound flux and gas concentration inside mound, for both CH4 and CO2, and for all termite species, thereby enabling the prediction of flux from measured mound internal gas concentration. However, these relationships were also termite species specific. Using the relationship between mound internal gas concentration and flux from one species to predict mound fluxes from other termite species (as has been done in past) would result in errors of more than 5-fold for CH4 and 3-fold for CO2. 5. This study highlights that CO2 fluxes from termite mounds are generally more than one order of magnitude greater than CH4 fluxes. There are species-specific relationships between CH4 and CO2 fluxes from a~mound, and between the inside mound concentration of a gas and the mound flux emission of the same gas, but these relationships vary greatly among termite species. Consequently, there is no generic relationship that will allow for the prediction of CH4 fluxes from termite mounds of all species.

  19. The relationships between termite mound CH4/CO2 emissions and internal concentration ratios are species specific

    Science.gov (United States)

    Jamali, H.; Livesley, S. J.; Hutley, L. B.; Fest, B.; Arndt, S. K.

    2013-04-01

    We investigated the relative importance of CH4 and CO2 fluxes from soil and termite mounds at four different sites in the tropical savannas of northern Australia near Darwin and assessed different methods to indirectly predict CH4 fluxes based on CO2 fluxes and internal gas concentrations. The annual flux from termite mounds and surrounding soil was dominated by CO2 with large variations among sites. On a carbon dioxide equivalent (CO2-e) basis, annual CH4 flux estimates from termite mounds were 5- to 46-fold smaller than the concurrent annual CO2 flux estimates. Differences between annual soil CO2 and soil CH4 (CO2-e) fluxes were even greater, soil CO2 fluxes being almost three orders of magnitude greater than soil CH4 (CO2-e) fluxes at site. The contribution of CH4 and CO2 emissions from termite mounds to the total CH4 and CO2 emissions from termite mounds and soil in CO2-e was less than 1%. There were significant relationships between mound CH4 flux and mound CO2 flux, enabling the prediction of CH4 flux from measured CO2 flux; however, these relationships were clearly termite species specific. We also observed significant relationships between mound flux and gas concentration inside mound, for both CH4 and CO2, and for all termite species, thereby enabling the prediction of flux from measured mound internal gas concentration. However, these relationships were also termite species specific. Using the relationship between mound internal gas concentration and flux from one species to predict mound fluxes from other termite species (as has been done in the past) would result in errors of more than 5-fold for mound CH4 flux and 3-fold for mound CO2 flux. This study highlights that CO2 fluxes from termite mounds are generally more than one order of magnitude greater than CH4 fluxes. There are species-specific relationships between CH4 and CO2 fluxes from a mound, and between the inside mound concentration of a gas and the mound flux emission of the same gas, but

  20. Is the C-terminal insertional signal in Gram-negative bacterial outer membrane proteins species-specific or not?

    Directory of Open Access Journals (Sweden)

    Paramasivam Nagarajan

    2012-09-01

    Full Text Available Abstract Background In Gram-negative bacteria, the outer membrane is composed of an asymmetric lipid bilayer of phopspholipids and lipopolysaccharides, and the transmembrane proteins that reside in this membrane are almost exclusively β-barrel proteins. These proteins are inserted into the membrane by a highly conserved and essential machinery, the BAM complex. It recognizes its substrates, unfolded outer membrane proteins (OMPs, through a C-terminal motif that has been speculated to be species-specific, based on theoretical and experimental results from only two species, Escherichia coli and Neisseria meningitidis, where it was shown on the basis of individual sequences and motifs that OMPs from the one cannot easily be over expressed in the other, unless the C-terminal motif was adapted. In order to determine whether this species specificity is a general phenomenon, we undertook a large-scale bioinformatics study on all predicted OMPs from 437 fully sequenced proteobacterial strains. Results We were able to verify the incompatibility reported between Escherichia coli and Neisseria meningitidis, using clustering techniques based on the pairwise Hellinger distance between sequence spaces for the C-terminal motifs of individual organisms. We noticed that the amino acid position reported to be responsible for this incompatibility between Escherichia coli and Neisseria meningitidis does not play a major role for determining species specificity of OMP recognition by the BAM complex. Instead, we found that the signal is more diffuse, and that for most organism pairs, the difference between the signals is hard to detect. Notable exceptions are the Neisseriales, and Helicobacter spp. For both of these organism groups, we describe the specific sequence requirements that are at the basis of the observed difference. Conclusions Based on the finding that the differences between the recognition motifs of almost all organisms are small, we assume that

  1. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  2. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  3. Species-Specific Thiol-Disulfide Equilibrium Constant: A Tool To Characterize Redox Transitions of Biological Importance.

    Science.gov (United States)

    Mirzahosseini, Arash; Somlyay, Máté; Noszál, Béla

    2015-08-13

    Microscopic redox equilibrium constants, a new species-specific type of physicochemical parameters, were introduced and determined to quantify thiol-disulfide equilibria of biological significance. The thiol-disulfide redox equilibria of glutathione with cysteamine, cysteine, and homocysteine were approached from both sides, and the equilibrium mixtures were analyzed by quantitative NMR methods to characterize the highly composite, co-dependent acid-base and redox equilibria. The directly obtained, pH-dependent, conditional constants were then decomposed by a new evaluation method, resulting in pH-independent, microscopic redox equilibrium constants for the first time. The 80 different, microscopic redox equilibrium constant values show close correlation with the respective thiolate basicities and provide sound means for the development of potent agents against oxidative stress.

  4. Species-specific activity of SIV Nef and HIV-1 Vpu in overcoming restriction by tetherin/BST2.

    Directory of Open Access Journals (Sweden)

    Bin Jia

    2009-05-01

    Full Text Available Tetherin, also known as BST2, CD317 or HM1.24, was recently identified as an interferon-inducible host-cell factor that interferes with the detachment of virus particles from infected cells. HIV-1 overcomes this restriction by expressing an accessory protein, Vpu, which counteracts tetherin. Since lentiviruses of the SIV(smm/mac/HIV-2 lineage do not have a vpu gene, this activity has likely been assumed by other viral gene products. We found that deletion of the SIV(mac239 nef gene significantly impaired virus release in cells expressing rhesus macaque tetherin. Virus release could be restored by expressing Nef in trans. However, Nef was unable to facilitate virus release in the presence of human tetherin. Conversely, Vpu enhanced virus release in the presence of human tetherin, but not in the presence of rhesus tetherin. In accordance with the species-specificity of Nef in mediating virus release, SIV Nef downregulated cell-surface expression of rhesus tetherin, but did not downregulate human tetherin. The specificity of SIV Nef for rhesus tetherin mapped to four amino acids in the cytoplasmic domain of the molecule that are missing from human tetherin, whereas the specificity of Vpu for human tetherin mapped to amino acid differences in the transmembrane domain. Nef alleles of SIV(smm, HIV-2 and HIV-1 were also able to rescue virus release in the presence of both rhesus macaque and sooty mangabey tetherin, but were generally ineffective against human tetherin. Thus, the ability of Nef to antagonize tetherin from these Old World primates appears to be conserved among the primate lentiviruses. These results identify Nef as the viral gene product of SIV that opposes restriction by tetherin in rhesus macaques and sooty mangabeys, and reveal species-specificity in the activities of both Nef and Vpu in overcoming tetherin in their respective hosts.

  5. Characterization of Foodborne Strains of Staphylococcus aureus by Shotgun Proteomics: Functional Networks, Virulence Factors and Species-Specific Peptide Biomarkers

    Science.gov (United States)

    Carrera, Mónica; Böhme, Karola; Gallardo, José M.; Barros-Velázquez, Jorge; Cañas, Benito; Calo-Mata, Pilar

    2017-01-01

    In the present work, we applied a shotgun proteomics approach for the fast and easy characterization of 20 different foodborne strains of Staphylococcus aureus (S. aureus), one of the most recognized foodborne pathogenic bacteria. A total of 644 non-redundant proteins were identified and analyzed via an easy and rapid protein sample preparation procedure. The results allowed the differentiation of several proteome datasets from the different strains (common, accessory, and unique datasets), which were used to determine relevant functional pathways and differentiate the strains into different Euclidean hierarchical clusters. Moreover, a predicted protein-protein interaction network of the foodborne S. aureus strains was created. The whole confidence network contains 77 nodes and 769 interactions. Most of the identified proteins were surface-associated proteins that were related to pathways and networks of energy, lipid metabolism and virulence. Twenty-seven virulence factors were identified, and most of them corresponded to autolysins, N-acetylmuramoyl-L-alanine amidases, phenol-soluble modulins, extracellular fibrinogen-binding proteins and virulence factor EsxA. Potential species-specific peptide biomarkers were screened. Twenty-one species-specific peptide biomarkers, belonging to eight different proteins (nickel-ABC transporter, N-acetylmuramoyl-L-alanine amidase, autolysin, clumping factor A, gram-positive signal peptide YSIRK, cysteine protease/staphopain, transcriptional regulator MarR, and transcriptional regulator Sar-A), were proposed to identify S. aureus. These results constitute the first major dataset of peptides and proteins of foodborne S. aureus strains. This repository may be useful for further studies, for the development of new therapeutic treatments for S. aureus food intoxications and for microbial source-tracking in foodstuffs. PMID:29312172

  6. Species specific and environment induced variation of δ13C and δ15N in alpine plants

    Directory of Open Access Journals (Sweden)

    Yang eYang

    2015-06-01

    Full Text Available Stable carbon and nitrogen isotope signals in plant tissues integrate plant-environment interactions over long periods. In this study, we hypothesized that humid alpine life conditions are narrowing the scope for significant deviations from common carbon, water and nitrogen relations as captured by stable isotope signals. We explored the variation in δ13C and δ15N in 32 plant species from tissue type to ecosystem scale across a suite of locations at c. 2500 m elevation in the Swiss Alps. Foliar δ13C and δ15N varied among species by about 3-4 ‰ and 7-8 ‰ respectively. However, there was no overall difference in means of δ13C and δ15N for species sampled in different plant communities or when bulk plant dry matter harvests of different plant communities were compared. δ13C was found to be highly species specific, so that the ranking among species was mostly maintained across 11 habitats. However, δ15N varied significantly from place to place in all species (a range of 2.7 ‰ except in Fabaceae (Trifolium alpinum and Juncaceae (Luzula lutea. There was also a substantial variation among individuals of the same species collected next to each other. No difference was found in foliar δ15N of non-legumes, which were either collected next to or away from the most common legume, T. alpinum. δ15N data place Cyperaceae and Juncaceae, just like Fabaceae, in a low discrimination category, well separated from other families. Soil δ15N was higher than in plants and increased with soil depth. The results indicate a high functional diversity in alpine plants that is similar to that reported for low elevation plants. We conclude that the surprisingly high variation in δ13C and δ15N signals in the studied high elevation plants is largely species specific (genetic and insensitive to obvious environmental cues.

  7. Detection and Characterization of Reactive Oxygen and Nitrogen Species in Biological Systems by Monitoring Species-Specific Products.

    Science.gov (United States)

    Hardy, Micael; Zielonka, Jacek; Karoui, Hakim; Sikora, Adam; Michalski, Radosław; Podsiadły, Radosław; Lopez, Marcos; Vasquez-Vivar, Jeannette; Kalyanaraman, Balaraman; Ouari, Olivier

    2018-05-20

    Since the discovery of the superoxide dismutase enzyme, the generation and fate of short-lived oxidizing, nitrosating, nitrating, and halogenating species in biological systems has been of great interest. Despite the significance of reactive oxygen species (ROS) and reactive nitrogen species (RNS) in numerous diseases and intracellular signaling, the rigorous detection of ROS and RNS has remained a challenge. Recent Advances: Chemical characterization of the reactions of selected ROS and RNS with electron paramagnetic resonance (EPR) spin traps and fluorescent probes led to the establishment of species-specific products, which can be used for specific detection of several forms of ROS and RNS in cell-free systems and in cultured cells in vitro and in animals in vivo. Profiling oxidation products from the ROS and RNS probes provides a rigorous method for detection of those species in biological systems. Formation and detection of species-specific products from the probes enables accurate characterization of the oxidative environment in cells. Measurement of the total signal (fluorescence, chemiluminescence, etc.) intensity does not allow for identification of the ROS/RNS formed. It is critical to identify the products formed by using chromatographic or other rigorous techniques. Product analyses should be accompanied by monitoring of the intracellular probe level, another factor controlling the yield of the product(s) formed. More work is required to characterize the chemical reactivity of the ROS/RNS probes, and to develop new probes/detection approaches enabling real-time, selective monitoring of the specific products formed from the probes. Antioxid. Redox Signal. 28, 1416-1432.

  8. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  9. PCR-based molecular discrimination of Pandora neoaphidis isolates from related entomopathogenic fungi and development of species-specific diagnostic primers.

    Science.gov (United States)

    Tymon, Anna M; Shah, Paresh A; Pell, Judith K

    2004-04-01

    Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.

  10. Species-specific diagnostics of Apis mellifera trypanosomatids: A nine-year survey (2007-2015) for trypanosomatids and microsporidians in Serbian honey bees.

    Science.gov (United States)

    Stevanovic, Jevrosima; Schwarz, Ryan S; Vejnovic, Branislav; Evans, Jay D; Irwin, Rebecca E; Glavinic, Uros; Stanimirovic, Zoran

    2016-09-01

    In this study, honey bees collected in Serbia over 9 consecutive years (2007-2015) were retrospectively surveyed to determine the prevalence of eukaryotic gut parasites by molecular screening of archival DNA samples. We developed species-specific primers for PCR to detect the two known honey bee trypanosomatid species, Crithidia mellificae and the recently described Lotmaria passim. These primers were validated for target specificity under single and mixed-species conditions as well as against the bumblebee trypanosomatid Crithidia bombi. Infections by Nosema apis and Nosema ceranae (Microsporidia) were also determined using PCR. Samples from 162 colonies (18 from each year) originating from 57 different localities were surveyed. L. passim was detected in every year with an overall frequency of 62.3% and annual frequencies ranging from 38.9% to 83.3%. This provides the earliest confirmed record to date for L. passim and the first report of this species in Serbia. N. ceranae was ubiquitous, occurring in every year and at 95.7% overall frequency, ranging annually from 83.3% to 100%. The majority of colonies (60.5%) were co-infected with L. passim and N. ceranae, but colony infections by each species were statistically independent of one another over the nine years. Although C. mellificae and N. apis have both been reported recently at low frequency in Europe, neither of these species was detected in Serbia. These results support the hypothesis that L. passim has predominated over C. mellificae in A. mellifera during the past decade. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria

    Directory of Open Access Journals (Sweden)

    O'Gara Fergal

    2010-11-01

    Full Text Available Abstract Background Catabolite repression control (CRC is an important global control system in Pseudomonas that fine tunes metabolism in order optimise growth and metabolism in a range of different environments. The mechanism of CRC in Pseudomonas spp. centres on the binding of a protein, Crc, to an A-rich motif on the 5' end of an mRNA resulting in translational down-regulation of target genes. Despite the identification of several Crc targets in Pseudomonas spp. the Crc regulon has remained largely unexplored. Results In order to predict direct targets of Crc, we used a bioinformatics approach based on detection of A-rich motifs near the initiation of translation of all protein-encoding genes in twelve fully sequenced Pseudomonas genomes. As expected, our data predict that genes related to the utilisation of less preferred nutrients, such as some carbohydrates, nitrogen sources and aromatic carbon compounds are targets of Crc. A general trend in this analysis is that the regulation of transporters is conserved across species whereas regulation of specific enzymatic steps or transcriptional activators are often conserved only within a species. Interestingly, some nucleoid associated proteins (NAPs such as HU and IHF are predicted to be regulated by Crc. This finding indicates a possible role of Crc in indirect control over a subset of genes that depend on the DNA bending properties of NAPs for expression or repression. Finally, some virulence traits such as alginate and rhamnolipid production also appear to be regulated by Crc, which links nutritional status cues with the regulation of virulence traits. Conclusions Catabolite repression control regulates a broad spectrum of genes in Pseudomonas. Some targets are genus-wide and are typically related to central metabolism, whereas other targets are species-specific, or even unique to particular strains. Further study of these novel targets will enhance our understanding of how Pseudomonas

  12. Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.

    Science.gov (United States)

    Browne, Patrick; Barret, Matthieu; O'Gara, Fergal; Morrissey, John P

    2010-11-25

    Catabolite repression control (CRC) is an important global control system in Pseudomonas that fine tunes metabolism in order optimise growth and metabolism in a range of different environments. The mechanism of CRC in Pseudomonas spp. centres on the binding of a protein, Crc, to an A-rich motif on the 5' end of an mRNA resulting in translational down-regulation of target genes. Despite the identification of several Crc targets in Pseudomonas spp. the Crc regulon has remained largely unexplored. In order to predict direct targets of Crc, we used a bioinformatics approach based on detection of A-rich motifs near the initiation of translation of all protein-encoding genes in twelve fully sequenced Pseudomonas genomes. As expected, our data predict that genes related to the utilisation of less preferred nutrients, such as some carbohydrates, nitrogen sources and aromatic carbon compounds are targets of Crc. A general trend in this analysis is that the regulation of transporters is conserved across species whereas regulation of specific enzymatic steps or transcriptional activators are often conserved only within a species. Interestingly, some nucleoid associated proteins (NAPs) such as HU and IHF are predicted to be regulated by Crc. This finding indicates a possible role of Crc in indirect control over a subset of genes that depend on the DNA bending properties of NAPs for expression or repression. Finally, some virulence traits such as alginate and rhamnolipid production also appear to be regulated by Crc, which links nutritional status cues with the regulation of virulence traits. Catabolite repression control regulates a broad spectrum of genes in Pseudomonas. Some targets are genus-wide and are typically related to central metabolism, whereas other targets are species-specific, or even unique to particular strains. Further study of these novel targets will enhance our understanding of how Pseudomonas bacteria integrate nutritional status cues with the regulation

  13. Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria

    LENUS (Irish Health Repository)

    Browne, Patrick

    2010-11-25

    Abstract Background Catabolite repression control (CRC) is an important global control system in Pseudomonas that fine tunes metabolism in order optimise growth and metabolism in a range of different environments. The mechanism of CRC in Pseudomonas spp. centres on the binding of a protein, Crc, to an A-rich motif on the 5\\' end of an mRNA resulting in translational down-regulation of target genes. Despite the identification of several Crc targets in Pseudomonas spp. the Crc regulon has remained largely unexplored. Results In order to predict direct targets of Crc, we used a bioinformatics approach based on detection of A-rich motifs near the initiation of translation of all protein-encoding genes in twelve fully sequenced Pseudomonas genomes. As expected, our data predict that genes related to the utilisation of less preferred nutrients, such as some carbohydrates, nitrogen sources and aromatic carbon compounds are targets of Crc. A general trend in this analysis is that the regulation of transporters is conserved across species whereas regulation of specific enzymatic steps or transcriptional activators are often conserved only within a species. Interestingly, some nucleoid associated proteins (NAPs) such as HU and IHF are predicted to be regulated by Crc. This finding indicates a possible role of Crc in indirect control over a subset of genes that depend on the DNA bending properties of NAPs for expression or repression. Finally, some virulence traits such as alginate and rhamnolipid production also appear to be regulated by Crc, which links nutritional status cues with the regulation of virulence traits. Conclusions Catabolite repression control regulates a broad spectrum of genes in Pseudomonas. Some targets are genus-wide and are typically related to central metabolism, whereas other targets are species-specific, or even unique to particular strains. Further study of these novel targets will enhance our understanding of how Pseudomonas bacteria integrate

  14. Synchronization of DNA array replication kinetics

    Science.gov (United States)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  15. Coagulase-negative Staphylococcus species in bulk milk: Prevalence, distribution, and associated subgroup- and species-specific risk factors.

    Science.gov (United States)

    De Visscher, A; Piepers, S; Haesebrouck, F; Supré, K; De Vliegher, S

    2017-01-01

    Coagulase-negative staphylococci (CNS) have become the main pathogens causing bovine mastitis in recent years. A huge variation in species distribution among herds has been observed in several studies, emphasizing the need to identify subgroup- and species-specific herd-level factors to improve our understanding of the differences in ecological and epidemiological nature between species. The use of bulk milk samples enables the inclusion of a large(r) number of herds needed to identify herd-level risk factors and increases the likelihood of recovering enough isolates per species needed for conducting subgroup- and, eventually, species-specific analyses at the same time. This study aimed to describe the prevalence and distribution of CNS species in bulk milk samples and to identify associated subgroup- and species-specific herd-level factors. Ninety percent of all bulk milk samples yielded CNS. Staphylococcus equorum was the predominant species, followed by Staphylococcus haemolyticus and Staphylococcus epidermidis. A seasonal effect was observed for several CNS species. Bulk milk samples from herds with a loose-pack or a tiestall housing system were more likely to yield CNS species compared with herds with a freestall barn, except for S. epidermidis, Staphylococcus simulans, and Staphylococcus cohnii. In September, herds in which udders were clipped had lower odds of yielding Staphylococcus chromogenes, S. simulans, and Staphylococcus xylosus, the CNS species assumed to be most relevant for udder health, in their bulk milk than herds in which udder clipping was not practiced. Bulk milk of herds participating in a monthly veterinary udder health-monitoring program was more likely to yield these 3 CNS species. Herds always receiving their milk quality premium or predisinfecting teats before attachment of the milking cluster had lower odds of having S. equorum in their bulk milk. Herds not using a single dry cotton or paper towel for each cow during premilking udder

  16. Effect of silver nanoparticles on Mediterranean sea urchin embryonal development is species specific and depends on moment of first exposure.

    Science.gov (United States)

    Burić, Petra; Jakšić, Željko; Štajner, Lara; Dutour Sikirić, Maja; Jurašin, Darija; Cascio, Claudia; Calzolai, Luigi; Lyons, Daniel Mark

    2015-10-01

    With the ever growing use of nanoparticles in a broad range of industrial and consumer applications there is increasing likelihood that such nanoparticles will enter the aquatic environment and be transported through freshwater systems, eventually reaching estuarine or marine waters. Due to silver's known antimicrobial properties and widespread use of silver nanoparticles (AgNP), their environmental fate and impact is therefore of particular concern. In this context we have investigated the species-specific effects of low concentrations of 60 nm AgNP on embryonal development in Mediterranean sea urchins Arbacia lixula, Paracentrotus lividus and Sphaerechinus granularis. The sensitivity of urchin embryos was tested by exposing embryos to nanoparticle concentrations in the 1-100 μg L(-1) range, with times of exposure varying from 30 min to 24 h (1 h-48 h for S. granularis) post-fertilisation which corresponded with fertilized egg, 4 cell, blastula and gastrula development phases. The most sensitive species to AgNP was A. lixula with significant modulation of embryonal development at the lowest AgNP concentrations of 1-10 μg L(-1) with high numbers of malformed embryos or arrested development. The greatest impact on development was noted for those embryos first exposed to nanoparticles at 6 and 24 h post fertilisation. For P. lividus, similar effects were noted at higher concentrations of 50 μg L(-1) and 100 μg L(-1) for all times of first exposure. The S. granularis embryos indicated a moderate AgNP impact, and significant developmental abnormalities were recorded in the concentration range of 10-50 μg L(-1). As later post-fertilisation exposure times to AgNP caused greater developmental changes in spite of a shorter total exposure time led us to postulate on additional mechanisms of AgNP toxicity. The results herein indicate that toxic effects of AgNP are species-specific. The moment at which embryos first encounter AgNP is also shown to be

  17. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  18. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  19. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  20. Electron microscopy and three-dimensional reconstruction of native thin filaments reveal species-specific differences in regulatory strand densities

    Energy Technology Data Exchange (ETDEWEB)

    Cammarato, Anthony, E-mail: acammara@burnham.org [Department of Physiology and Biophysics, Boston University School of Medicine, 72 East Concord Street, Boston, MA 02118 (United States); Craig, Roger [Department of Cell Biology, University of Massachusetts Medical School, 55 Lake Avenue North, Worcester, MA 01655 (United States); Lehman, William [Department of Physiology and Biophysics, Boston University School of Medicine, 72 East Concord Street, Boston, MA 02118 (United States)

    2010-01-01

    Throughout the animal kingdom striated muscle contraction is regulated by the thin filament troponin-tropomyosin complex. Homologous regulatory components are shared among vertebrate and arthropod muscles; however, unique protein extensions and/or components characterize the latter. The Troponin T (TnT) isoforms of Drosophila indirect flight and tarantula femur muscle for example contain distinct C-terminal extensions and are {approx}20% larger overall than their vertebrate counterpart. Using electron microscopy and three-dimensional helical reconstruction of native Drosophila, tarantula and frog muscle thin filaments we have identified species-specific differences in tropomyosin regulatory strand densities. The strands on the arthropod thin filaments were significantly larger in diameter than those from vertebrates, although not significantly different from each other. These findings reflect differences in the regulatory troponin-tropomyosin complex, which are likely due to the larger TnT molecules aligning and extending along much of the tropomyosin strands' length. Such an arrangement potentially alters the physical properties of the regulatory strands and may help establish contractile characteristics unique to certain arthropod muscles.

  1. The tree-species-specific effect of forest bathing on perceived anxiety alleviation of young-adults in urban forests

    Directory of Open Access Journals (Sweden)

    Haoming Guan

    2017-12-01

    Full Text Available Forest bathing, i.e. spending time in a forest to walk, view and breathe in a forest, can alleviate the mental depression of visitors, but the tree-species-specific effect of this function by the urban forest is unknown. In this study, sixty-nine university students (aged 19-22, male ratio: 38% were recruited as participants to visit urban forests dominated by birch (Betula platyphylla Suk., maple (Acer triflorum Komarov and oak (Quercus mongolica Fisch. ex Ledeb trees in a park at the center of Changchun City, Northeast China. In the maple forest only the anxiety from study interest was decreased, while the anxiety from employment pressure was alleviated to the most extent in the birch forest. Participants perceived more anxiety from lesson declined in the oak forest than in the birch forest. Body parameters of weight and age were correlated with the anti-anxiety scores. In the oak forest, female participants can perceive more anxiety alleviation than male participants. For university students, forest bathing in our study can promote their study interest. Forest bathing can be more effective to alleviate the anxiety of young adults with greater weight. The birch forest was recommended to be visited by students to alleviate the pressure of employment worry, and the oak forest was recommended to be visited by girls.

  2. Spatio-temporal and species-specific variation in PBDE levels/patterns in British Columbia's coastal waters

    International Nuclear Information System (INIS)

    Ikonomou, Michael G.; Fernandez, Marc P.; Hickman, Zachary L.

    2006-01-01

    Congener-specific levels of PBDEs were measured in the livers and some muscle tissues of Dungeness crab (Cancer magister), English sole (Pleuronectes vetulus) and spiny dogfish (Squalus acanthias). Highest concentrations (1200-560 ng/g lipid) were found in crab collected near heavily urbanized areas (pop. ∼0.3-1.8 million), followed by moderate levels at pulp/paper mills sites (∼150 ng/g), and lowest levels occurred in areas that were somewhat removed from industrial/populated areas (<24 ng/g). Temporal increases in total PBDEs and particularly in BDE-47 for Dungeness crab collected near pulp and paper and urbanized areas between 1994 and 2000 were observed. These correspond to Canadian and worldwide trends seen for PBDEs in biota. English sole and dogfish showed a pattern similar to that of the Columbia River whitefish samples, which corresponded closely to the patterns in the 'penta' commercial mixture. Conversely, Dungeness crab were enriched in lower chlorinated PBDEs, particularly BDE-47 and BDE-49, compared to the fish and shark species from BC. - PBDEs in biota and sediments from the West Coast of Canada reflect temporal, species-specific and geographic distributions

  3. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  4. Immunoreactivity between venoms and commercial antiserums in four Chinese snakes and venom identification by species-specific antibody.

    Science.gov (United States)

    Gao, Jian-Fang; Wang, Jin; Qu, Yan-Fu; Ma, Xiao-Mei; Ji, Xiang

    2013-01-31

    We studied the immunoreactivity between venoms and commercial antiserums in four Chinese venomous snakes, Bungarus multicinctus, Naja atra, Deinagkistrodon acutus and Gloydius brevicaudus. Venoms from the four snakes shared common antigenic components, and most venom components expressed antigenicity in the immunological reaction between venoms and antiserums. Antiserums cross-reacted with heterologous venoms. Homologous venom and antiserum expressed the highest reaction activity in all cross-reactions. Species-specific antibodies (SSAbs) were obtained from four antiserums by immunoaffinity chromatography: the whole antiserum against each species was gradually passed through a medium system coated with heterologous venoms, and the cross-reacting components in antiserum were immunoabsorbed by the common antigens in heterologous venoms; the unbound components (i.e., SSAbs) were collected, and passed through Hitrap G protein column and concentrated. The SSAbs were found to have high specificity by western blot and enzyme-linked immunosorbent assay (ELISA). A 6-well ELISA strip coated with SSAbs was used to assign a venom sample and blood and urine samples from the envenomed rats to a given snake species. Our detections could differentiate positive and negative samples, and identify venoms of a snake species in about 35 min. The ELISA strips developed in this study are clinically useful in rapid and reliable identification of venoms from the above four snake species. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. High-Throughput Sequencing Reveals Diverse Sets of Conserved, Nonconserved, and Species-Specific miRNAs in Jute

    Directory of Open Access Journals (Sweden)

    Md. Tariqul Islam

    2015-01-01

    Full Text Available MicroRNAs play a pivotal role in regulating a broad range of biological processes, acting by cleaving mRNAs or by translational repression. A group of plant microRNAs are evolutionarily conserved; however, others are expressed in a species-specific manner. Jute is an agroeconomically important fibre crop; nonetheless, no practical information is available for microRNAs in jute to date. In this study, Illumina sequencing revealed a total of 227 known microRNAs and 17 potential novel microRNA candidates in jute, of which 164 belong to 23 conserved families and the remaining 63 belong to 58 nonconserved families. Among a total of 81 identified microRNA families, 116 potential target genes were predicted for 39 families and 11 targets were predicted for 4 among the 17 identified novel microRNAs. For understanding better the functions of microRNAs, target genes were analyzed by Gene Ontology and their pathways illustrated by KEGG pathway analyses. The presence of microRNAs identified in jute was validated by stem-loop RT-PCR followed by end point PCR and qPCR for randomly selected 20 known and novel microRNAs. This study exhaustively identifies microRNAs and their target genes in jute which will ultimately pave the way for understanding their role in this crop and other crops.

  6. Structural and functional conservation of CLEC-2 with the species-specific regulation of transcript expression in evolution.

    Science.gov (United States)

    Wang, Lan; Ren, Shifang; Zhu, Haiyan; Zhang, Dongmei; Hao, Yuqing; Ruan, Yuanyuan; Zhou, Lei; Lee, Chiayu; Qiu, Lin; Yun, Xiaojing; Xie, Jianhui

    2012-08-01

    CLEC-2 was first identified by sequence similarity to C-type lectin-like molecules with immune functions and has been reported as a receptor for the platelet-aggregating snake venom toxin rhodocytin and the endogenous sialoglycoprotein podoplanin. Recent researches indicate that CLEC-2-deficient mice were lethal at the embryonic stage associated with disorganized and blood-filled lymphatic vessels and severe edema. In view of a necessary role of CLEC-2 in the individual development, it is of interest to investigate its phylogenetic homology and highly conserved functional regions. In this work, we reported that CLEC-2 from different species holds with an extraordinary conservation by sequence alignment and phylogenetic tree analysis. The functional structures including N-linked oligosaccharide sites and ligand-binding domain implement a structural and functional conservation in a variety of species. The glycosylation sites (N120 and N134) are necessary for the surface expression CLEC-2. CLEC-2 from different species possesses the binding activity of mouse podoplanin. Nevertheless, the expression of CLEC-2 is regulated with a species-specific manner. The alternative splicing of pre-mRNA, a regulatory mechanism of gene expression, and the binding sites on promoter for several key transcription factors vary between different species. Therefore, CLEC-2 shares high sequence homology and functional identity. However the transcript expression might be tightly regulated by different mechanisms in evolution.

  7. Species-specific accumulation of polybrominated diphenyl ether flame retardants in birds of prey from the Chesapeake Bay region, USA

    Energy Technology Data Exchange (ETDEWEB)

    Chen Da, E-mail: chen@vims.ed [Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, College of William and Mary, Gloucester Point, VA 23062 (United States); Hale, Robert C. [Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, College of William and Mary, Gloucester Point, VA 23062 (United States); Watts, Bryan D. [Center for Conservation Biology, College of William and Mary, Williamsburg, VA 23185 (United States); La Guardia, Mark J.; Harvey, Ellen [Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, College of William and Mary, Gloucester Point, VA 23062 (United States); Mojica, Elizabeth K. [Center for Conservation Biology, College of William and Mary, Williamsburg, VA 23185 (United States)

    2010-05-15

    Compared to organochlorines, little is known about polybrominated diphenyl ether (PBDE) contamination of birds of prey breeding in the Chesapeake Bay, the largest estuary in the U.S. This study examined and compared PBDE contamination in eggs of osprey, double-crested cormorant, brown pelican and peregrine falcon from this area. Several legacy persistent organic pollutants such as PCBs and DDE were also investigated. The level of urbanization of the landscape appeared to influence the level of PBDE exposure. PBDE congener distribution patterns varied between piscivorous and terrestrial-feeding birds. This suggests individual congeners may be subject to differences in bioaccumulation, biomagnification or metabolism in the aquatic and terrestrial food webs. Biomagnification of PBDEs was studied in the Bay aquatic food chains for the first time. A biomagnification factor of 25.1 was estimated for SIGMAPBDEs for the fish - osprey egg food chain. Hazard quotients, applied as a preliminary evaluation, indicated that PBDEs may pose a moderate hazard to ospreys and peregrine falcons through impairment of reproductive performance. - Birds of prey breeding in the Chesapeake Bay (USA) exhibited species-specific PBDE accumulation patterns.

  8. Species-specific accumulation of polybrominated diphenyl ether flame retardants in birds of prey from the Chesapeake Bay region, USA

    International Nuclear Information System (INIS)

    Chen Da; Hale, Robert C.; Watts, Bryan D.; La Guardia, Mark J.; Harvey, Ellen; Mojica, Elizabeth K.

    2010-01-01

    Compared to organochlorines, little is known about polybrominated diphenyl ether (PBDE) contamination of birds of prey breeding in the Chesapeake Bay, the largest estuary in the U.S. This study examined and compared PBDE contamination in eggs of osprey, double-crested cormorant, brown pelican and peregrine falcon from this area. Several legacy persistent organic pollutants such as PCBs and DDE were also investigated. The level of urbanization of the landscape appeared to influence the level of PBDE exposure. PBDE congener distribution patterns varied between piscivorous and terrestrial-feeding birds. This suggests individual congeners may be subject to differences in bioaccumulation, biomagnification or metabolism in the aquatic and terrestrial food webs. Biomagnification of PBDEs was studied in the Bay aquatic food chains for the first time. A biomagnification factor of 25.1 was estimated for ΣPBDEs for the fish - osprey egg food chain. Hazard quotients, applied as a preliminary evaluation, indicated that PBDEs may pose a moderate hazard to ospreys and peregrine falcons through impairment of reproductive performance. - Birds of prey breeding in the Chesapeake Bay (USA) exhibited species-specific PBDE accumulation patterns.

  9. Uncovering iron regulation with species-specific transcriptome patterns in Atlantic and coho salmon during a Caligus rogercresseyi infestation.

    Science.gov (United States)

    Valenzuela-Muñoz, V; Boltaña, S; Gallardo-Escárate, C

    2017-09-01

    Salmon species cultured in Chile evidence different levels of susceptibility to the sea louse Caligus rogercresseyi. These differences have mainly been associated with specific immune responses. Moreover, iron regulation seems to be an important mechanism to confer immunity during the host infestation. This response called nutritional immunity has been described in bacterial infections, despite that no comprehensive studies involving in marine ectoparasites infestation have been reported. With this aim, we analysed the transcriptome profiles of Atlantic and coho salmon infected with C. rogercresseyi to evidence modulation of the iron metabolism as a proxy of nutritional immune responses. Whole transcriptome sequencing was performed in samples of skin and head kidney from Atlantic and coho salmon infected with sea lice. RNA-seq analyses revealed significant upregulation of transcripts in both salmon species at 7 and 14 dpi in skin and head kidney, respectively. However, iron regulation transcripts were differentially modulated, evidencing species-specific expression profiles. Genes related to heme degradation and iron transport such as hepcidin, transferrin and haptoglobin were primary upregulated in Atlantic salmon; meanwhile, in coho salmon, genes associated with heme biosynthesis were strongly transcribed. In summary, Atlantic salmon, which are more susceptible to infestation, presented molecular mechanisms to deplete cellular iron availability, suggesting putative mechanisms of nutritional immunity. In contrast, resistant coho salmon were less affected by sea lice, mainly activating pro-inflammatory mechanisms to cope with infestation. © 2017 John Wiley & Sons Ltd.

  10. Species-Specific Antimonial Sensitivity in Leishmania Is Driven by Post-Transcriptional Regulation of AQP1

    Science.gov (United States)

    Mandal, Goutam; Mandal, Srotoswati; Sharma, Mansi; Charret, Karen Santos; Papadopoulou, Barbara; Bhattacharjee, Hiranmoy; Mukhopadhyay, Rita

    2015-01-01

    Leishmania is a digenetic protozoan parasite causing leishmaniasis in humans. The different clinical forms of leishmaniasis are caused by more than twenty species of Leishmania that are transmitted by nearly thirty species of phlebotomine sand flies. Pentavalent antimonials (such as Pentostam or Glucantime) are the first line drugs for treating leishmaniasis. Recent studies suggest that pentavalent antimony (Sb(V)) acts as a pro-drug, which is converted to the more active trivalent form (Sb(III)). However, sensitivity to trivalent antimony varies among different Leishmania species. In general, Leishmania species causing cutaneous leishmaniasis (CL) are more sensitive to Sb(III) than the species responsible for visceral leishmaniasis (VL). Leishmania aquaglyceroporin (AQP1) facilitates the adventitious passage of antimonite down a concentration gradient. In this study, we show that Leishmania species causing CL accumulate more antimonite, and therefore exhibit higher sensitivity to antimonials, than the species responsible for VL. This species-specific differential sensitivity to antimonite is directly proportional to the expression levels of AQP1 mRNA. We show that the stability of AQP1 mRNA in different Leishmania species is regulated by their respective 3’-untranslated regions. The differential regulation of AQP1 mRNA explains the distinct antimonial sensitivity of each species. PMID:25714343

  11. Persistent organochlorines in 13 shark species from offshore and coastal waters of Korea: Species-specific accumulation and contributing factors.

    Science.gov (United States)

    Lee, Hyun-Kyung; Jeong, Yunsun; Lee, Sunggyu; Jeong, Woochang; Choy, Eun-Jung; Kang, Chang-Keun; Lee, Won-Chan; Kim, Sang-Jo; Moon, Hyo-Bang

    2015-05-01

    Data on persistent organochlorines (OCs) in sharks are scarce. Concentrations of OCs such as polychlorinated biphenyls (PCBs) and organochlorine pesticides (OCPs) were determined in the muscle tissue of 13 shark species (n=105) collected from offshore (Indian and Pacific Oceans) and coastal waters of Korea, to investigate species-specific accumulation of OCs and to assess the potential health risks associated with consumption of shark meat. Overall OC concentrations were highly variable not only among species but also within the same species of shark. The concentrations of PCBs, DDTs, chlordanes, hexachlorobenzene, and heptachlor in all shark species ranged from shark in our study were relatively lower than those reported in other studies. Aggressive shark species and species inhabiting the Indian Ocean had the highest levels of OCs. Inter-species differences in the concentrations and accumulation profiles of OCs among shark species could be explained by differences in feeding habit and sampling locations. Several confounding factors such as growth velocity, trophic position, and regional contamination status may affect the bioaccumulation of OCs in sharks. Hazard ratios of non-cancer risk for all the OCs were below one, whereas the hazard ratios of lifetime cancer risks of PCBs and DDTs exceeded one, implying potential carcinogenic effects in the general population in Korea. This is the first report to document the occurrence of OCs in sharks from Korea. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Species-specific differences in adaptive phenotypic plasticity in an ecologically relevant trophic trait: hypertrophic lips in Midas cichlid fishes.

    Science.gov (United States)

    Machado-Schiaffino, Gonzalo; Henning, Frederico; Meyer, Axel

    2014-07-01

    The spectacular species richness of cichlids and their diversity in morphology, coloration, and behavior have made them an ideal model for the study of speciation and adaptive evolution. Hypertrophic lips evolved repeatedly and independently in African and Neotropical cichlid radiations. Cichlids with hypertrophic lips forage predominantly in rocky crevices and it has been hypothesized that mechanical stress caused by friction could result in larger lips through phenotypic plasticity. To test the influence of the environment on the size and development of lips, we conducted a series of breeding and feeding experiments on Midas cichlids. Full-sibs of Amphilophus labiatus (thick-lipped) and Amphilophus citrinellus (thin-lipped) each were split into a control group which was fed food from the water column and a treatment group whose food was fixed to substrates. We found strong evidence for phenotypic plasticity on lip area in the thick-lipped species, but not in the thin-lipped species. Intermediate phenotypic values were observed in hybrids from thick- and thin-lipped species reared under "control" conditions. Thus, both a genetic, but also a phenotypic plastic component is involved in the development of hypertrophic lips in Neotropical cichlids. Moreover, species-specific adaptive phenotypic plasticity was found, suggesting that plasticity is selected for in recent thick-lipped species. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  13. Electron microscopy and three-dimensional reconstruction of native thin filaments reveal species-specific differences in regulatory strand densities

    International Nuclear Information System (INIS)

    Cammarato, Anthony; Craig, Roger; Lehman, William

    2010-01-01

    Throughout the animal kingdom striated muscle contraction is regulated by the thin filament troponin-tropomyosin complex. Homologous regulatory components are shared among vertebrate and arthropod muscles; however, unique protein extensions and/or components characterize the latter. The Troponin T (TnT) isoforms of Drosophila indirect flight and tarantula femur muscle for example contain distinct C-terminal extensions and are ∼20% larger overall than their vertebrate counterpart. Using electron microscopy and three-dimensional helical reconstruction of native Drosophila, tarantula and frog muscle thin filaments we have identified species-specific differences in tropomyosin regulatory strand densities. The strands on the arthropod thin filaments were significantly larger in diameter than those from vertebrates, although not significantly different from each other. These findings reflect differences in the regulatory troponin-tropomyosin complex, which are likely due to the larger TnT molecules aligning and extending along much of the tropomyosin strands' length. Such an arrangement potentially alters the physical properties of the regulatory strands and may help establish contractile characteristics unique to certain arthropod muscles.

  14. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  15. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  16. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  17. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  18. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  19. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  20. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  1. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  2. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase cha