WorldWideScience

Sample records for source enabling detection

  1. Microcantilever-Enabled Neutron Detection

    Directory of Open Access Journals (Sweden)

    Kevin R. Kyle

    2014-04-01

    Full Text Available A new concept for neutron radiation detection was demonstrated using piezoresistive microcantilevers as the active sensing element. Microcantilevers were used to measure the tiny volumetric changes in a sensing material upon absorption of neutron radiation and transmutation into a new element. Highly ordered inorganic crystalline lattices of boron-rich materials dispersed in polymeric rubber matrices were shown to act as volumetric neutron transducers.

  2. Moving Sources Detection System

    International Nuclear Information System (INIS)

    Coulon, Romain; Kondrasovs, Vladimir; Boudergui, Karim; Normand, Stephane

    2013-06-01

    To monitor radioactivity passing through a pipe or in a given container such as a train or a truck, radiation detection systems are commonly employed. These detectors could be used in a network set along the source track to increase the overall detection efficiency. However detection methods are based on counting statistics analysis. The method usually implemented consists in trigging an alarm when an individual signal rises over a threshold initially estimated in regards to the natural background signal. The detection efficiency is then proportional to the number of detectors in use, due to the fact that each sensor is taken as a standalone sensor. A new approach is presented in this paper taking into account the temporal periodicity of the signals taken by all distributed sensors as a whole. This detection method is not based only on counting statistics but also on the temporal series analysis aspect. Therefore, a specific algorithm is then developed in our lab for this kind of applications and shows a significant improvement, especially in terms of detection efficiency and false alarms reduction. We also plan on extracting information from the source vector. This paper presents the theoretical approach and some preliminary results obtain in our laboratory. (authors)

  3. Policy Enabling Environment for Corporate Renewable Energy Sourcing

    Energy Technology Data Exchange (ETDEWEB)

    2017-05-09

    Interest in renewable energy (RE) procurement in new markets is on the rise. Corporations are increasing their commitments to procuring RE, motivated by an interest in using clean energy sources and reducing their energy expenses. Many large companies have facilities and supply chains in multiple countries, and are interested in procuring renewable energy in the grids where they use energy. The policy environment around the world plays a key role in shaping where and how corporations will invest in renewables. This fact sheet details findings from a recent 21st Century Power Partnership report, Policies to Enable Corporate Renewable Energy Sourcing Internationally.

  4. Advanced ultrafast fiber laser sources enabled by fiber nonlinearities

    International Nuclear Information System (INIS)

    Liu, Wei

    2017-05-01

    Development of high power/energy ultrafast fiber lasers for scientific research and industrial applications is one of the most exciting fields in ultrafast optics. This thesis demonstrated new means to improve two essential properties - which are indispensable for novel applications such as high-harmonic generation (HHG) and multiphoton microscopy (MPM) - of an ultrafast fiber laser system: energy scaling capability and wavelength tunability. High photon-flux extreme ultraviolet sources enabled by HHG desire high power (>100 W), high repetition-rate (>1 MHz) ultrafast driving laser sources. We have constructed from scratch a high-power Yb-fiber laser system using the well-known chirped-pulse amplification (CPA) technique. Such a CPA system capable of producing ∝200-W average power consists of a monolithic Yb-fiber oscillator, an all-fiber stretcher, a pre-amplifier chain, a main amplifier constructed from rode-type large pitch fiber, and a diffraction-grating based compressor. To increase the HHG efficiency, ultrafast pulses with duration 130-W average power. The amplified pulses are compressed to 60-fs pulses with 100-W average power, constituting a suitable HHG driving source. MPM is a powerful biomedical imaging tool, featuring larger penetration depth while providing the capability of optical sectioning. Although femtosecond solid-state lasers have been widely accepted as the standard option as MPM driving sources, fiber-based sources have received growing research efforts due to their superior performance. In the second part of this thesis, we both theoretically and experimentally demonstrated a new method of producing wavelength widely tunable femtosecond pulses for driving MPM. We employed self-phase modulation to broaden a narrowband spectrum followed by bandpass filters to select the rightmost/leftmost spectral lobes. Widely tunable in 820-1225 nm, the resulting sources generated nearly transform-limited, ∝100 fs pulses. Using short fibers with large

  5. Advanced ultrafast fiber laser sources enabled by fiber nonlinearities

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wei

    2017-05-15

    Development of high power/energy ultrafast fiber lasers for scientific research and industrial applications is one of the most exciting fields in ultrafast optics. This thesis demonstrated new means to improve two essential properties - which are indispensable for novel applications such as high-harmonic generation (HHG) and multiphoton microscopy (MPM) - of an ultrafast fiber laser system: energy scaling capability and wavelength tunability. High photon-flux extreme ultraviolet sources enabled by HHG desire high power (>100 W), high repetition-rate (>1 MHz) ultrafast driving laser sources. We have constructed from scratch a high-power Yb-fiber laser system using the well-known chirped-pulse amplification (CPA) technique. Such a CPA system capable of producing ∝200-W average power consists of a monolithic Yb-fiber oscillator, an all-fiber stretcher, a pre-amplifier chain, a main amplifier constructed from rode-type large pitch fiber, and a diffraction-grating based compressor. To increase the HHG efficiency, ultrafast pulses with duration <60 fs are highly desired. We proposed and demonstrated a novel amplification technique, named as pre-chirp managed amplification (PCMA). We successfully constructed an Yb-fiber based PCMA system that outputs 75-MHz spectrally broadened pulses with >130-W average power. The amplified pulses are compressed to 60-fs pulses with 100-W average power, constituting a suitable HHG driving source. MPM is a powerful biomedical imaging tool, featuring larger penetration depth while providing the capability of optical sectioning. Although femtosecond solid-state lasers have been widely accepted as the standard option as MPM driving sources, fiber-based sources have received growing research efforts due to their superior performance. In the second part of this thesis, we both theoretically and experimentally demonstrated a new method of producing wavelength widely tunable femtosecond pulses for driving MPM. We employed self-phase modulation

  6. Ultrafast disk technology enables next generation micromachining laser sources

    Science.gov (United States)

    Heckl, Oliver H.; Weiler, Sascha; Luzius, Severin; Zawischa, Ivo; Sutter, Dirk

    2013-02-01

    Ultrashort pulsed lasers based on thin disk technology have entered the 100 W regime and deliver several tens of MW peak power without chirped pulse amplification. Highest uptime and insensitivity to back reflections make them ideal tools for efficient and cost effective industrial micromachining. Frequency converted versions allow the processing of a large variety of materials. On one hand, thin disk oscillators deliver more than 30 MW peak power directly out of the resonator in laboratory setups. These peak power levels are made possible by recent progress in the scaling of the pulse energy in excess of 40 μJ. At the corresponding high peak intensity, thin disk technology profits from the limited amount of material and hence the manageable nonlinearity within the resonator. Using new broadband host materials like for example the sesquioxides will eventually reduce the pulse duration during high power operation and further increase the peak power. On the other hand industry grade amplifier systems deliver even higher peak power levels. At closed-loop controlled 100W, the TruMicro Series 5000 currently offers the highest average ultrafast power in an industry proven product, and enables efficient micromachining of almost any material, in particular of glasses, ceramics or sapphire. Conventional laser cutting of these materials often requires UV laser sources with pulse durations of several nanoseconds and an average power in the 10 W range. Material processing based on high peak power laser sources makes use of multi-photon absorption processes. This highly nonlinear absorption enables micromachining driven by the fundamental (1030 nm) or frequency doubled (515 nm) wavelength of Yb:YAG. Operation in the IR or green spectral range reduces the complexity and running costs of industrial systems initially based on UV light sources. Where UV wavelength is required, the TruMicro 5360 with a specified UV crystal life-time of more than 10 thousand hours of continues

  7. Wind Power - A Power Source Enabled by Power Electronics

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Chen, Zhe

    2004-01-01

    . The deregulation of energy has lowered the investment in bigger power plants, which means the need for new electrical power sources may be very high in the near future. Two major technologies will play important roles to solve the future problems. One is to change the electrical power production sources from......The global electrical energy consumption is still rising and there is a steady demand to increase the power capacity. The production, distribution and the use of the energy should be as technological efficient as possible and incentives to save energy at the end-user should be set up...... the conventional, fossil (and short term) based energy sources to renewable energy sources. The other is to use high efficient power electronics in power systems, power production and end-user application. This paper discuss the most emerging renewable energy source, wind energy, which by means of power...

  8. Wind power - a power source now enabled by power electronics

    DEFF Research Database (Denmark)

    Blaabjerg, Frede; Iov, Florin

    2007-01-01

    energy at the end-user should be set up. Deregulation of energy has lowered the investment in larger power plants, which means the need for new electrical power sources may be increased in the near future. Two major technologies will play important roles to solve the future problems. One is to change......The global electrical energy consumption is still rising and there is a steady demand to increase the power capacity. It is expected that it has to be doubled within 20 years. The production, distribution and use of the energy should be as technological efficient as possible and incentives to save...... the electrical power production sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. Another is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss the most emerging...

  9. Enabling instrumentation and technology for 21st century light sources

    Energy Technology Data Exchange (ETDEWEB)

    Byrd, J.M.; Shea, T.J.; Denes, P.; Siddons, P.; Attwood, D.; Kaertner, F.; Moog, L.; Li, Y.; Sakdinawat, A.; Schlueter, R.

    2010-06-01

    We present the summary from the Accelerator Instrumentation and Technology working group, one of the five working groups that participated in the BES-sponsored Workshop on Accelerator Physics of Future Light Sources held in Gaithersburg, MD September 15-17, 2009. We describe progress and potential in three areas: attosecond instrumentation, photon detectors for user experiments, and insertion devices.

  10. Enabling vendor independent photoacoustic imaging systems with asynchronous laser source

    Science.gov (United States)

    Wu, Yixuan; Zhang, Haichong K.; Boctor, Emad M.

    2018-02-01

    Channel data acquisition, and synchronization between laser excitation and PA signal acquisition, are two fundamental hardware requirements for photoacoustic (PA) imaging. Unfortunately, however, neither is equipped by most clinical ultrasound scanners. Therefore, less economical specialized research platforms are used in general, which hinders a smooth clinical transition of PA imaging. In previous studies, we have proposed an algorithm to achieve PA imaging using ultrasound post-beamformed (USPB) RF data instead of channel data. This work focuses on enabling clinical ultrasound scanners to implement PA imaging, without requiring synchronization between the laser excitation and PA signal acquisition. Laser synchronization is inherently consisted of two aspects: frequency and phase information. We synchronize without communicating the laser and the ultrasound scanner by investigating USPB images of a point-target phantom in two steps. First, frequency information is estimated by solving a nonlinear optimization problem, under the assumption that the segmented wave-front can only be beamformed into a single spot when synchronization is achieved. Second, after making frequencies of two systems identical, phase delay is estimated by optimizing the image quality while varying phase value. The proposed method is validated through simulation, by manually adding both frequency and phase errors, then applying the proposed algorithm to correct errors and reconstruct PA images. Compared with the ground truth, simulation results indicate that the remaining errors in frequency correction and phase correction are 0.28% and 2.34%, respectively, which affirm the potential of overcoming hardware barriers on PA imaging through software solution.

  11. Nanomaterial-enabled Rapid Detection of Water Contaminants.

    Science.gov (United States)

    Mao, Shun; Chang, Jingbo; Zhou, Guihua; Chen, Junhong

    2015-10-28

    Water contaminants, e.g., inorganic chemicals and microorganisms, are critical metrics for water quality monitoring and have significant impacts on human health and plants/organisms living in water. The scope and focus of this review is nanomaterial-based optical, electronic, and electrochemical sensors for rapid detection of water contaminants, e.g., heavy metals, anions, and bacteria. These contaminants are commonly found in different water systems. The importance of water quality monitoring and control demands significant advancement in the detection of contaminants in water because current sensing technologies for water contaminants have limitations. The advantages of nanomaterial-based sensing technologies are highlighted and recent progress on nanomaterial-based sensors for rapid water contaminant detection is discussed. An outlook for future research into this rapidly growing field is also provided. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The Chandra Source Catalog: Background Determination and Source Detection

    Science.gov (United States)

    McCollough, Michael; Rots, Arnold; Primini, Francis A.; Evans, Ian N.; Glotfelty, Kenny J.; Hain, Roger; Anderson, Craig S.; Bonaventura, Nina R.; Chen, Judy C.; Davis, John E.; Doe, Stephen M.; Evans, Janet D.; Fabbiano, Giuseppina; Galle, Elizabeth C.; Danny G. Gibbs, II; Grier, John D.; Hall, Diane M.; Harbo, Peter N.; He, Xiang Qun (Helen); Houck, John C.; Karovska, Margarita; Kashyap, Vinay L.; Lauer, Jennifer; McCollough, Michael L.; McDowell, Jonathan C.; Miller, Joseph B.; Mitschang, Arik W.; Morgan, Douglas L.; Mossman, Amy E.; Nichols, Joy S.; Nowak, Michael A.; Plummer, David A.; Refsdal, Brian L.; Siemiginowska, Aneta L.; Sundheim, Beth A.; Tibbetts, Michael S.; van Stone, David W.; Winkelman, Sherry L.; Zografou, Panagoula

    2009-09-01

    The Chandra Source Catalog (CSC) is a major project in which all of the pointed imaging observations taken by the Chandra X-Ray Observatory are used to generate one of the most extensive X-ray source catalog produced to date. Early in the development of the CSC it was recognized that the ability to estimate local background levels in an automated fashion would be critical for essential CSC tasks such as source detection, photometry, sensitivity estimates, and source characterization. We present a discussion of how such background maps are created directly from the Chandra data and how they are used in source detection. The general background for Chandra observations is rather smoothly varying, containing only low spatial frequency components. However, in the case of ACIS data, a high spatial frequency component is added that is due to the readout streaks of the CCD chips. We discuss how these components can be estimated reliably using the Chandra data and what limitations and caveats should be considered in their use. We will discuss the source detection algorithm used for the CSC and the effects of the background images on the detection results. We will also touch on some the Catalog Inclusion and Quality Assurance criteria applied to the source detection results. This work is supported by NASA contract NAS8-03060 (CXC).

  13. Chandra Source Catalog: Background Determination and Source Detection

    Science.gov (United States)

    McCollough, Michael L.; Rots, A. H.; Primini, F. A.; Evans, I. N.; Glotfelty, K. J.; Hain, R.; Anderson, C. S.; Bonaventura, N. R.; Chen, J. C.; Davis, J. E.; Doe, S. M.; Evans, J. D.; Fabbiano, G.; Galle, E.; Gibbs, D. G.; Grier, J. D.; Hall, D. M.; Harbo, P. N.; He, X.; Houck, J. C.; Karovska, M.; Lauer, J.; McDowell, J. C.; Miller, J. B.; Mitschang, A. W.; Morgan, D. L.; Nichols, J. S.; Nowak, M. A.; Plummer, D. A.; Refsdal, B. L.; Siemiginowska, A. L.; Sundheim, B. A.; Tibbetts, M. S.; Van Stone, D. W.; Winkelman, S. L.; Zografou, P.

    2009-01-01

    The Chandra Source Catalog (CSC) is a major project in which all of the pointed imaging observations taken by the Chandra X-Ray Observatory will used to generate the most extensive X-ray source catalog produced to date. Early in the development of the CSC it was recognized that the ability to estimate local background levels in an automated fashion would be critical for essential CSC tasks such as source detection, photometry, sensitivity estimates, and source characterization. We present a discussion of how such background maps are created directly from the Chandra data and how they are used in source detection. The general background for Chandra observations is rather smoothly varying, containing only low spatial frequency components. However, in the case of ACIS data, a high spatial frequency component is added that is due to the readout streaks of the CCD chips. We discuss how these components can be estimated reliably using the Chandra data and what limitations and caveats should be considered in their use. We will discuss the source detection algorithm used for the CSC and the effects of the background images on the detection results. We will also touch on some the Catalog Inclusion and Quality Assurance criteria applied to the source detection results. This work is supported by NASA contract NAS8-03060 (CXC).

  14. Configuration of electro-optic fire source detection system

    Science.gov (United States)

    Fabian, Ram Z.; Steiner, Zeev; Hofman, Nir

    2007-04-01

    The recent fighting activities in various parts of the world have highlighted the need for accurate fire source detection on one hand and fast "sensor to shooter cycle" capabilities on the other. Both needs can be met by the SPOTLITE system which dramatically enhances the capability to rapidly engage hostile fire source with a minimum of casualties to friendly force and to innocent bystanders. Modular system design enable to meet each customer specific requirements and enable excellent future growth and upgrade potential. The design and built of a fire source detection system is governed by sets of requirements issued by the operators. This can be translated into the following design criteria: I) Long range, fast and accurate fire source detection capability. II) Different threat detection and classification capability. III) Threat investigation capability. IV) Fire source data distribution capability (Location, direction, video image, voice). V) Men portability. ) In order to meet these design criteria, an optimized concept was presented and exercised for the SPOTLITE system. Three major modular components were defined: I) Electro Optical Unit -Including FLIR camera, CCD camera, Laser Range Finder and Marker II) Electronic Unit -including system computer and electronic. III) Controller Station Unit - Including the HMI of the system. This article discusses the system's components definition and optimization processes, and also show how SPOTLITE designers successfully managed to introduce excellent solutions for other system parameters.

  15. Multi-sample immunoassay inside optical fiber capillary enabled by evanescent wave detection

    Directory of Open Access Journals (Sweden)

    Chun-Wei Wang

    2016-03-01

    Full Text Available A novel evanescent wave-based (EW microfluidic capillary fiber-optic biosensor (MCFOB has been developed using capillaries as a transducer embedded in a multichannel device to enhance the collection efficiency of the fluorescence signal. The capillary serves dual roles as a waveguide and a container, enabling more straightforward, consistent, and compact biosensor packaging compared to conventional optical fiber biosensors and microfluidic systems. In order to detect multiple samples in one device, the biosensor incorporates a polydimethysiloxane (PDMS multi-channel device, which also serves as cladding for the biosensor. In addition, this biosensor only consumes 10 μl of a sample and does not require hydrofluoric acid etching in the fabrication process. The orientation for signal collection is optimized by comparing the lateral and normal signal directions for detected glyceraldehyde 3-phosphate dehydrogenase (GAPDH. C-reactive protein (CRP is used to validate the MCFOB, and the limit of detection (LOD for CRP in the MCFOB is 1.94 ng/ml (74 pM. Moreover, the real-time measurement is demonstrated to verify that the evanescent wave is the only exciting light source in the MCFOB, which gives the potential for real-time measurement applications. Keywords: C-reactive protein, Capillary, Fiber-optic, Microfluidic, Evanescent wave, Immunoassay

  16. Detecting hidden sources-STUK/HUT team

    Energy Technology Data Exchange (ETDEWEB)

    Nikkinen, M.; Aarnio, P. [Helsinki Univ. of Technology, Espoo (Finland); Honkamaa, T.; Tiilikainen, H. [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)

    1997-12-31

    The task of the team was to locate and to identify hidden sources in a specified area in Padasjoki Auttoinen village. The team used AB-420 helicopter of the Finnish Frontier Guard. The team had two measuring systems: HPGe system (relative efficiency 18%) and 5`x5` NaI system. The team found two sources in real-time and additional two sources after 24 h analysis time. After the locations and characteristics of the sources were announced it was found out that altogether six sources would have been possible to find using the measured data. The total number of sources was ten. The NaI detector was good at detecting and locating the sources and HPGe was most useful in identification and calculation of the activity estimates. The following development should be made: 1) larger detectors are needed, 2) the software has to be improved. (This has been performed after the exercise) and 3) the navigation must be based on DGPS. visual navigation causes easily gaps between the flight lines and some sources may not be detected. (au).

  17. Detecting hidden sources-STUK/HUT team

    Energy Technology Data Exchange (ETDEWEB)

    Nikkinen, M; Aarnio, P [Helsinki Univ. of Technology, Espoo (Finland); Honkamaa, T; Tiilikainen, H [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)

    1998-12-31

    The task of the team was to locate and to identify hidden sources in a specified area in Padasjoki Auttoinen village. The team used AB-420 helicopter of the Finnish Frontier Guard. The team had two measuring systems: HPGe system (relative efficiency 18%) and 5`x5` NaI system. The team found two sources in real-time and additional two sources after 24 h analysis time. After the locations and characteristics of the sources were announced it was found out that altogether six sources would have been possible to find using the measured data. The total number of sources was ten. The NaI detector was good at detecting and locating the sources and HPGe was most useful in identification and calculation of the activity estimates. The following development should be made: 1) larger detectors are needed, 2) the software has to be improved. (This has been performed after the exercise) and 3) the navigation must be based on DGPS. visual navigation causes easily gaps between the flight lines and some sources may not be detected. (au).

  18. Detection of OH radicals from IRAS sources

    International Nuclear Information System (INIS)

    Lewis, B.M.; Eder, J.; Terzian, Y.

    1985-01-01

    An efficient method for detecting new OH/infrared stars is to begin with IRAS source positions, selected for appropriate infrared colours, and using radio-line observations to confirm the OH properties. The authors demonstrate the validity of this approach here, using the Arecibo 305 m radio-telescope to confirm the 1,612 MHz line observations of sources in IRAS Circulars 8 and 9; the present observations identify 21 new OH/infrared stars. The new sources have weaker 1,612 MHz fluxes, bluer (60-25) μm colours and a smaller mean separation between the principal emission peaks than previous samples. (author)

  19. Real-time tunability of chip-based light source enabled by microfluidic mixing

    DEFF Research Database (Denmark)

    Olsen, Brian Bilenberg; Rasmussen, Torben; Balslev, Søren

    2006-01-01

    We demonstrate real-time tunability of a chip-based liquid light source enabled by microfluidic mixing. The mixer and light source are fabricated in SU-8 which is suitable for integration in SU-8-based laboratory-on-a-chip microsystems. The tunability of the light source is achieved by changing...... the concentration of rhodamine 6G dye inside two integrated vertical resonators, since both the refractive index and the gain profile are influenced by the dye concentration. The effect on the refractive index and the gain profile of rhodamine 6G in ethanol is investigated and the continuous tuning of the laser...

  20. Advanced light source technologies that enable high-volume manufacturing of DUV lithography extensions

    Science.gov (United States)

    Cacouris, Theodore; Rao, Rajasekhar; Rokitski, Rostislav; Jiang, Rui; Melchior, John; Burfeindt, Bernd; O'Brien, Kevin

    2012-03-01

    Deep UV (DUV) lithography is being applied to pattern increasingly finer geometries, leading to solutions like double- and multiple-patterning. Such process complexities lead to higher costs due to the increasing number of steps required to produce the desired results. One of the consequences is that the lithography equipment needs to provide higher operating efficiencies to minimize the cost increases, especially for producers of memory devices that experience a rapid decline in sales prices of these products over time. In addition to having introduced higher power 193nm light sources to enable higher throughput, we previously described technologies that also enable: higher tool availability via advanced discharge chamber gas management algorithms; improved process monitoring via enhanced on-board beam metrology; and increased depth of focus (DOF) via light source bandwidth modulation. In this paper we will report on the field performance of these technologies with data that supports the desired improvements in on-wafer performance and operational efficiencies.

  1. Detecting Lung and Colorectal Cancer Recurrence Using Structured Clinical/Administrative Data to Enable Outcomes Research and Population Health Management.

    Science.gov (United States)

    Hassett, Michael J; Uno, Hajime; Cronin, Angel M; Carroll, Nikki M; Hornbrook, Mark C; Ritzwoller, Debra

    2017-12-01

    Recurrent cancer is common, costly, and lethal, yet we know little about it in community-based populations. Electronic health records and tumor registries contain vast amounts of data regarding community-based patients, but usually lack recurrence status. Existing algorithms that use structured data to detect recurrence have limitations. We developed algorithms to detect the presence and timing of recurrence after definitive therapy for stages I-III lung and colorectal cancer using 2 data sources that contain a widely available type of structured data (claims or electronic health record encounters) linked to gold-standard recurrence status: Medicare claims linked to the Cancer Care Outcomes Research and Surveillance study, and the Cancer Research Network Virtual Data Warehouse linked to registry data. Twelve potential indicators of recurrence were used to develop separate models for each cancer in each data source. Detection models maximized area under the ROC curve (AUC); timing models minimized average absolute error. Algorithms were compared by cancer type/data source, and contrasted with an existing binary detection rule. Detection model AUCs (>0.92) exceeded existing prediction rules. Timing models yielded absolute prediction errors that were small relative to follow-up time (differences by cancer type and dataset challenged efforts to create 1 common algorithm for all scenarios. Valid and reliable detection of recurrence using big data is feasible. These tools will enable extensive, novel research on quality, effectiveness, and outcomes for lung and colorectal cancer patients and those who develop recurrence.

  2. An update on carbon nanotube-enabled X-ray sources for biomedical imaging.

    Science.gov (United States)

    Puett, Connor; Inscoe, Christina; Hartman, Allison; Calliste, Jabari; Franceschi, Dora K; Lu, Jianping; Zhou, Otto; Lee, Yueh Z

    2018-01-01

    A new imaging technology has emerged that uses carbon nanotubes (CNT) as the electron emitter (cathode) for the X-ray tube. Since the performance of the CNT cathode is controlled by simple voltage manipulation, CNT-enabled X-ray sources are ideal for the repetitive imaging steps needed to capture three-dimensional information. As such, they have allowed the development of a gated micro-computed tomography (CT) scanner for small animal research as well as stationary tomosynthesis, an experimental technology for large field-of-view human imaging. The small animal CT can acquire images at specific points in the respiratory and cardiac cycles. Longitudinal imaging therefore becomes possible and has been applied to many research questions, ranging from tumor response to the noninvasive assessment of cardiac output. Digital tomosynthesis (DT) is a low-dose and low-cost human imaging tool that captures some depth information. Known as three-dimensional mammography, DT is now used clinically for breast imaging. However, the resolution of currently-approved DT is limited by the need to swing the X-ray source through space to collect a series of projection views. An array of fixed and distributed CNT-enabled sources provides the solution and has been used to construct stationary DT devices for breast, lung, and dental imaging. To date, over 100 patients have been imaged on Institutional Review Board-approved study protocols. Early experience is promising, showing an excellent conspicuity of soft-tissue features, while also highlighting technical and post-acquisition processing limitations that are guiding continued research and development. Additionally, CNT-enabled sources are being tested in miniature X-ray tubes that are capable of generating adequate photon energies and tube currents for clinical imaging. Although there are many potential applications for these small field-of-view devices, initial experience has been with an X-ray source that can be inserted into the

  3. An Open-Source Tool Set Enabling Analog-Digital-Software Co-Design

    Directory of Open Access Journals (Sweden)

    Michelle Collins

    2016-02-01

    Full Text Available This paper presents an analog-digital hardware-software co-design environment for simulating and programming reconfigurable systems. The tool simulates, designs, as well as enables experimental measurements after compiling to configurable systems in the same integrated design tool framework. High level software in Scilab/Xcos (open-source programs similar to MATLAB/Simulink that converts the high-level block description by the user to blif format (sci2blif, which acts as an input to the modified VPR tool, including the code v p r 2 s w c s , encoding the specific platform through specific architecture files, resulting in a targetable switch list on the resulting configurable analog–digital system. The resulting tool uses an analog and mixed-signal library of components, enabling users and future researchers access to the basic analog operations/computations that are possible.

  4. Development of a clockwork light source to enable cervical inspection by village health workers

    Directory of Open Access Journals (Sweden)

    Steventon Richard

    2002-12-01

    Full Text Available Abstract Background Cervical cancer can often be prevented by screening and may be curable if identified and treated in its early stages. However, 80% of new cases occur in less-developed countries where cervical cancer screening programmes are small-scale or non-existent. This is a human tragedy of great proportion, with many of those affected being young mothers. There is some evidence that cancerous or precancerous lesions may be detected by visual inspection with acetic acid (VIA and field studies indicate that this technique is effective, safe and acceptable to women. However, the provision of a light source for inspection of the cervix presents a major problem in less-developed countries, where candles and torches often provide the only means of illumination. Our objective was to develop a light source based on clockwork technology, that required no batteries or external power source. Methods We adapted the design of a commercially available clockwork torch to provide a light source for cervical inspection. The light source was then tested under laboratory conditions in a comparison with other illumination methods typically used in this application. Results The light source gave illuminance levels greater than those produced by any other method tested, and also had considerable advantages in terms of ease of use and safety. Conclusion This design is small, compact, effective and safe to use and promises a better and more affordable means of visualising the cervix. Further field trials of VIA are now required which incorporate this light source.

  5. Policies for Enabling Corporate Sourcing of Renewable Energy Internationally: A 21st Century Power Partnership Report

    Energy Technology Data Exchange (ETDEWEB)

    Bird, Lori; Heeter, Jenny; O' Shaughnessy, Eric; Speer, Bethany; Volpi, Christina; Cook, Orrin; Jones, Todd; Taylor, Michael; Ralon, Pablo; Nilson, Emily

    2017-05-25

    This paper explores the policy and regulatory enabling environment for corporate sourcing of renewables. The paper has been developed in support of the Corporate Sourcing of Renewables Campaign, which was launched at the Clean Energy Ministerial (CEM) meeting in June 2016. Through the campaign, a subset of CEM member governments is collaborating with corporate and nongovernmental organization partners to facilitate increased corporate procurement of renewables and pursue supportive policies for corporate procurement. This paper finds that policy certainty is essential to creating vibrant markets for renewable energy. While policymakers may need to adjust policy mechanisms over time as markets go through different stages of maturity, they must also consider the economic decisions that end-users make in evaluating projects. Policy interaction is also important to consider because buyers seek assurances that their investments in renewables have impact and wish to make clear claims about their renewable energy purchases.

  6. Power scaling of ultrafast mid-IR source enabled by high-power fiber laser technology

    International Nuclear Information System (INIS)

    Zhou, Gengji

    2017-11-01

    Ultrafast laser sources with high repetition-rate (>10 MHz) and tunable in the mid-infrared (IR) wavelength range of 7-18 μm hold promise for many important spectroscopy applications. Currently, these ultrafast mid- to longwavelength-IR sources can most easily be achieved via difference-frequency generation (DFG) between a pump beam and a signal beam. However, current ultrafast mid- to longwavelength-IR sources feature a low average power, which limits their applications. In this thesis, we propose and demonstrate a novel approach to power scaling of DFG-based ultrafast mid-IR laser sources. The essence of this novel approach is the generation of a high-energy signal beam. Both the pump beam and the signal beam are derived from a home-built Yb-fiber laser system that emits 165-fs pulses centered at 1035 nm with 30-MHz repetition rate and 14.5-W average power (corresponding to 483-nJ pulse energy). We employ fiber-optic self-phase modulation (SPM) to broaden the laser spectrum and generate isolated spectral lobes. Filtering the rightmost spectral lobe leads to femtosecond pulses with >10 nJ pulse energy. Tunable between 1.1-1.2 μm, this SPM-enabled ultrafast source exhibits ∝100 times higher pulse energy than can be obtained from Raman soliton sources in this wavelength range. We use this SPM-enabled source as the signal beam and part of the Yb-fiber laser output as the pump beam. By performing DFG in GaSe crystals, we demonstrate that power scaling of a DFG-based mid-IR source can be efficiently achieved by increasing the signal energy. The resulting mid-IR source is tunable from 7.4 μm to 16.8 μm. Up to 5.04-mW mid-IR pulses centered at 11 μm are achieved. The corresponding pulse energy is 167 pJ, representing nearly one order of magnitude improvement compared with other reported DFG-based mid-IR sources at this wavelength. Despite of low pulse energy, Raman soliton sources have become a popular choice as the signal source. We carry out a detailed study on

  7. Power scaling of ultrafast mid-IR source enabled by high-power fiber laser technology

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Gengji

    2017-11-15

    Ultrafast laser sources with high repetition-rate (>10 MHz) and tunable in the mid-infrared (IR) wavelength range of 7-18 μm hold promise for many important spectroscopy applications. Currently, these ultrafast mid- to longwavelength-IR sources can most easily be achieved via difference-frequency generation (DFG) between a pump beam and a signal beam. However, current ultrafast mid- to longwavelength-IR sources feature a low average power, which limits their applications. In this thesis, we propose and demonstrate a novel approach to power scaling of DFG-based ultrafast mid-IR laser sources. The essence of this novel approach is the generation of a high-energy signal beam. Both the pump beam and the signal beam are derived from a home-built Yb-fiber laser system that emits 165-fs pulses centered at 1035 nm with 30-MHz repetition rate and 14.5-W average power (corresponding to 483-nJ pulse energy). We employ fiber-optic self-phase modulation (SPM) to broaden the laser spectrum and generate isolated spectral lobes. Filtering the rightmost spectral lobe leads to femtosecond pulses with >10 nJ pulse energy. Tunable between 1.1-1.2 μm, this SPM-enabled ultrafast source exhibits ∝100 times higher pulse energy than can be obtained from Raman soliton sources in this wavelength range. We use this SPM-enabled source as the signal beam and part of the Yb-fiber laser output as the pump beam. By performing DFG in GaSe crystals, we demonstrate that power scaling of a DFG-based mid-IR source can be efficiently achieved by increasing the signal energy. The resulting mid-IR source is tunable from 7.4 μm to 16.8 μm. Up to 5.04-mW mid-IR pulses centered at 11 μm are achieved. The corresponding pulse energy is 167 pJ, representing nearly one order of magnitude improvement compared with other reported DFG-based mid-IR sources at this wavelength. Despite of low pulse energy, Raman soliton sources have become a popular choice as the signal source. We carry out a detailed study on

  8. Self-phase modulation enabled, wavelength-tunable ultrafast fiber laser sources: an energy scalable approach.

    Science.gov (United States)

    Liu, Wei; Li, Chen; Zhang, Zhigang; Kärtner, Franz X; Chang, Guoqing

    2016-07-11

    We propose and demonstrate a new approach to implement a wavelength-tunable ultrafast fiber laser source suitable for multiphoton microscopy. We employ fiber-optic nonlinearities to broaden a narrowband optical spectrum generated by an Yb-fiber laser system and then use optical bandpass filters to select the leftmost or rightmost spectral lobes from the broadened spectrum. Detailed numerical modeling shows that self-phase modulation dominates the spectral broadening, self-steepening tends to blue shift the broadened spectrum, and stimulated Raman scattering is minimal. We also find that optical wave breaking caused by fiber dispersion slows down the shift of the leftmost/rightmost spectral lobes and therefore limits the wavelength tuning range of the filtered spectra. We show both numerically and experimentally that shortening the fiber used for spectral broadening while increasing the input pulse energy can overcome this dispersion-induced limitation; as a result, the filtered spectral lobes have higher power, constituting a powerful and practical approach for energy scaling the resulting femtosecond sources. We use two commercially available photonic crystal fibers to verify the simulation results. More specific, use of 20-mm fiber NL-1050-ZERO-2 enables us to implement an Yb-fiber laser based ultrafast source, delivering femtosecond (70-120 fs) pulses tunable from 825 nm to 1210 nm with >1 nJ pulse energy.

  9. Indirect detection of radiation sources through direct detection of radiolysis products

    Science.gov (United States)

    Farmer, Joseph C [Tracy, CA; Fischer, Larry E [Los Gatos, CA; Felter, Thomas E [Livermore, CA

    2010-04-20

    A system for indirectly detecting a radiation source by directly detecting radiolytic products. The radiation source emits radiation and the radiation produces the radiolytic products. A fluid is positioned to receive the radiation from the radiation source. When the fluid is irradiated, radiolytic products are produced. By directly detecting the radiolytic products, the radiation source is detected.

  10. Broadband integrated mid infrared light sources as enabling technology for point of care mid-infrared spectroscopy

    Science.gov (United States)

    2017-08-20

    AFRL-AFOSR-JP-TR-2017-0061 Broadband integrated mid-infrared light sources as enabling technology for point-of-care mid- infrared spectroscopy Alex...mid-infrared light sources as enabling technology for point-of-care mid-infrared spectroscopy 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA2386-16-1-4037...Broadband integrated mid-infrared light sources as enabling technology for point-of-care mid- infrared spectroscopy ” Date: 16th August 2017 Name

  11. The Net Enabled Waste Management Database as an international source of radioactive waste management information

    International Nuclear Information System (INIS)

    Csullog, G.W.; Friedrich, V.; Miaw, S.T.W.; Tonkay, D.; Petoe, A.

    2002-01-01

    The IAEA's Net Enabled Waste Management Database (NEWMDB) is an integral part of the IAEA's policies and strategy related to the collection and dissemination of information, both internal to the IAEA in support of its activities and external to the IAEA (publicly available). The paper highlights the NEWMDB's role in relation to the routine reporting of status and trends in radioactive waste management, in assessing the development and implementation of national systems for radioactive waste management, in support of a newly developed indicator of sustainable development for radioactive waste management, in support of reporting requirements for the Joint Convention on the Safety of Spent Fuel Management and on the Safety of Radioactive Waste Management, in support of IAEA activities related to the harmonization of waste management information at the national and international levels and in relation to the management of spent/disused sealed radioactive sources. (author)

  12. Multifunctional Nanotechnology-Enabled Sensors for Rapid Capture and Detection of Pathogens.

    Science.gov (United States)

    Mustafa, Fatima; Hassan, Rabeay Y A; Andreescu, Silvana

    2017-09-15

    Nanomaterial-based sensing approaches that incorporate different types of nanoparticles (NPs) and nanostructures in conjunction with natural or synthetic receptors as molecular recognition elements provide opportunities for the design of sensitive and selective assays for rapid detection of contaminants. This review summarizes recent advancements over the past ten years in the development of nanotechnology-enabled sensors and systems for capture and detection of pathogens. The most common types of nanostructures and NPs, their modification with receptor molecules and integration to produce viable sensing systems with biorecognition, amplification and signal readout are discussed. Examples of all-in-one systems that combine multifunctional properties for capture, separation, inactivation and detection are also provided. Current trends in the development of low-cost instrumentation for rapid assessment of food contamination are discussed as well as challenges for practical implementation and directions for future research.

  13. Functional neuroimaging of visuospatial working memory tasks enables accurate detection of attention deficit and hyperactivity disorder

    Directory of Open Access Journals (Sweden)

    Rubi Hammer

    2015-01-01

    Full Text Available Finding neurobiological markers for neurodevelopmental disorders, such as attention deficit and hyperactivity disorder (ADHD, is a major objective of clinicians and neuroscientists. We examined if functional Magnetic Resonance Imaging (fMRI data from a few distinct visuospatial working memory (VSWM tasks enables accurately detecting cases with ADHD. We tested 20 boys with ADHD combined type and 20 typically developed (TD boys in four VSWM tasks that differed in feedback availability (feedback, no-feedback and reward size (large, small. We used a multimodal analysis based on brain activity in 16 regions of interest, significantly activated or deactivated in the four VSWM tasks (based on the entire participants' sample. Dimensionality of the data was reduced into 10 principal components that were used as the input variables to a logistic regression classifier. fMRI data from the four VSWM tasks enabled a classification accuracy of 92.5%, with high predicted ADHD probability values for most clinical cases, and low predicted ADHD probabilities for most TDs. This accuracy level was higher than those achieved by using the fMRI data of any single task, or the respective behavioral data. This indicates that task-based fMRI data acquired while participants perform a few distinct VSWM tasks enables improved detection of clinical cases.

  14. An open source approach to enable the reproducibility of scientific workflows in the ocean sciences

    Science.gov (United States)

    Di Stefano, M.; Fox, P. A.; West, P.; Hare, J. A.; Maffei, A. R.

    2013-12-01

    Every scientist should be able to rerun data analyses conducted by his or her team and regenerate the figures in a paper. However, all too often the correct version of a script goes missing, or the original raw data is filtered by hand and the filtering process is undocumented, or there is lack of collaboration and communication among scientists working in a team. Here we present 3 different use cases in ocean sciences in which end-to-end workflows are tracked. The main tool that is deployed to address these use cases is based on a web application (IPython Notebook) that provides the ability to work on very diverse and heterogeneous data and information sources, providing an effective way to share the and track changes to source code used to generate data products and associated metadata, as well as to track the overall workflow provenance to allow versioned reproducibility of a data product. Use cases selected for this work are: 1) A partial reproduction of the Ecosystem Status Report (ESR) for the Northeast U.S. Continental Shelf Large Marine Ecosystem. Our goal with this use case is to enable not just the traceability but also the reproducibility of this biannual report, keeping track of all the processes behind the generation and validation of time-series and spatial data and information products. An end-to-end workflow with code versioning is developed so that indicators in the report may be traced back to the source datasets. 2) Realtime generation of web pages to be able to visualize one of the environmental indicators from the Ecosystem Advisory for the Northeast Shelf Large Marine Ecosystem web site. 3) Data and visualization integration for ocean climate forecasting. In this use case, we focus on a workflow to describe how to provide access to online data sources in the NetCDF format and other model data, and make use of multicore processing to generate video animation from time series of gridded data. For each use case we show how complete workflows

  15. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

    Directory of Open Access Journals (Sweden)

    Hironobu Yanagisawa

    2016-03-01

    Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

  16. Robotics-assisted mass spectrometry assay platform enabled by open-source electronics.

    Science.gov (United States)

    Chiu, Shih-Hao; Urban, Pawel L

    2015-02-15

    Mass spectrometry (MS) is an important analytical technique with numerous applications in clinical analysis, biochemistry, environmental analysis, geology and physics. Its success builds on the ability of MS to determine molecular weights of analytes, and elucidate their structures. However, sample handling prior to MS requires a lot of attention and labor. In this work we were aiming to automate processing samples for MS so that analyses could be conducted without much supervision of experienced analysts. The goal of this study was to develop a robotics and information technology-oriented platform that could control the whole analysis process including sample delivery, reaction-based assay, data acquisition, and interaction with the analyst. The proposed platform incorporates a robotic arm for handling sample vials delivered to the laboratory, and several auxiliary devices which facilitate and secure the analysis process. They include: multi-relay board, infrared sensors, photo-interrupters, gyroscopes, force sensors, fingerprint scanner, barcode scanner, touch screen panel, and internet interface. The control of all the building blocks is achieved through implementation of open-source electronics (Arduino), and enabled by custom-written programs in C language. The advantages of the proposed system include: low cost, simplicity, small size, as well as facile automation of sample delivery and processing without the intervention of the analyst. It is envisaged that this simple robotic system may be the forerunner of automated laboratories dedicated to mass spectrometric analysis of biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Nano-enabled sensors, electronics and energy source on polymer, paper and thread substrates

    Science.gov (United States)

    Mostafalu, Pooria

    Over the past decades, design and development of portable devices for monitoring of biomarkers especially for at risk patients is receiving considerable attention. These devices are either single use diagnostic platforms, wearable on body or on fabric, or they are implanted close to the tissue and organ that it monitors and cures. Sensors, energy sources, and data acquisition devices are the main components of a such monitoring platform. Sensors collect the information using bio-recognition tools such as enzymes and antibodies. Then, the transducers (electrodes, fluorophore, etc) convert it to the appropriate format, for instance electrical and optical signals. After that, data acquisition system amplifies and digitizes the signal and transfers the data to the recording instruments for further processing. Moreover, energy sources are necessary for powering the sensors and electronics. In wearable and implantable applications, these devices need to be flexible, light weight and biocompatible, and their performance should be similar to their rigid counterparts. In this dissertation we address these requirement for wearable and implantable devices. We showed integrated sensors, electronics, and energy sources on flexible polymers, paper, and thread. These devices provide many advantages for monitoring of the physiological condition of a patient and treatment accordingly. Real-time capability of the platform was enabled using wireless telemetry. One of the major innovations of this dissertation is the use of thread as a substrate for making medical diagnostic devices. While conventional substrates (glass, silicon, polyimide, PDMS etc) hold great promise for making wearable and implantable devices, their overall structure and form has remained essentially two dimensional, limiting their function to tissue surfaces such as skin. However, the ability to integrate functional components such as sensors, actuators, and electronics in a way that they penetrate multiple layers

  18. A Feasibility Study on Timber Damage Detection Using Piezoceramic-Transducer-Enabled Active Sensing

    Directory of Open Access Journals (Sweden)

    Jicheng Zhang

    2018-05-01

    Full Text Available In recent years, piezoelectric-based transducers and technologies have made significant progress towards structural health monitoring and damage evaluation for various metal and concrete structures. Timber is still commonly used as a construction material in practical engineering; however, there is a lack of research on the health monitoring of timber-based structures using piezoelectric-based transducers and methods. This paper conducts a feasibility study on timber damage detection using surface-mounted piezoelectric patches, which enable the stress-wave-based active sensing approach. Typical damage modes in timber frame structures, such as surface cracks and holes, were investigated in this study. In the active sensing approach, one piezoceramic transducer is used as an actuator to generate stress waves, which propagate along the surface of the timber structure, and other piezoceramic transducers function as sensors to detect the propagating stress waves. Defects, such as a crack or a hole, induce additional attenuation to the propagating stress wave. Based on this attenuation, the proposed method can detect the defects using the wavelet-packet-based damage index, demonstrating its implementation potential for real-time timber damage detection.

  19. Intrusion Detection using Open Source Tools

    OpenAIRE

    Jack TIMOFTE

    2008-01-01

    We have witnessed in the recent years that open source tools have gained popularity among all types of users, from individuals or small businesses to large organizations and enterprises. In this paper we will present three open source IDS tools: OSSEC, Prelude and SNORT.

  20. Luciferin Amides Enable in Vivo Bioluminescence Detection of Endogenous Fatty Acid Amide Hydrolase Activity.

    Science.gov (United States)

    Mofford, David M; Adams, Spencer T; Reddy, G S Kiran Kumar; Reddy, Gadarla Randheer; Miller, Stephen C

    2015-07-15

    Firefly luciferase is homologous to fatty acyl-CoA synthetases. We hypothesized that the firefly luciferase substrate d-luciferin and its analogs are fatty acid mimics that are ideally suited to probe the chemistry of enzymes that release fatty acid products. Here, we synthesized luciferin amides and found that these molecules are hydrolyzed to substrates for firefly luciferase by the enzyme fatty acid amide hydrolase (FAAH). In the presence of luciferase, these molecules enable highly sensitive and selective bioluminescent detection of FAAH activity in vitro, in live cells, and in vivo. The potency and tissue distribution of FAAH inhibitors can be imaged in live mice, and luciferin amides serve as exemplary reagents for greatly improved bioluminescence imaging in FAAH-expressing tissues such as the brain.

  1. Ionizing radiation source detection by personal TLD

    International Nuclear Information System (INIS)

    Marinkovic, O.; Mirkov, Z.

    2002-01-01

    The Laboratory for personal dosimetry has about 3000 workers under control. The most of them work in medicine. Some institutions, as big health centers, have different ionizing radiation sources. It is usefull to analyze what has been the source of irradiation, special when appears a dosimeter with high dose. Personal dosimetry equipment is Harshaw TLD Reader Model 6600 and dosimeters consist of two chips LiF TLD-100 assembled in bar-coded cards which are wearing in holders with one tissue-equivalent filter (to determine H(10)) and skin-equivalent the other (to determine H(0.07)). The calibration dosimeters have been irradiated in holders by different sources: x-ray (for 80keV and 100keV), 6 0C o, 9 0S r (for different distances from beta source) and foton beem (at radiotherapy accelerator by 6MeV, 10MeV and 18MeV). The dose ratio for two LiF cristals was calculated and represented with graphs. So, it is possible to calculate the ratio H(10)/H(0.07) for a personal TLD and analyze what has been the source of irradiation. Also, there is the calibration for determination the time of irradiation, according to glow curve deconvolution

  2. Selective Adsorption on Fluorinated Plastic Enables the Optical Detection of Molecular Pollutants in Water

    Science.gov (United States)

    Lanfranco, R.; Giavazzi, F.; Salina, M.; Tagliabue, G.; Di Nicolò, E.; Bellini, T.; Buscaglia, M.

    2016-05-01

    Amorphous fluorinated plastic can be produced with a refractive index similar to that of water, a condition that makes it essentially invisible when immersed in aqueous solutions. Because of this property, even a small amount of adsorbed molecules on the plastic-water interface provides a detectable optical signal. We investigate two distinct substrates made of this material, characterized by different interface areas: a prism and a microporous membrane. We demonstrate that both substrates enable the label-free detection of molecular compounds in water even without any surface functionalization. The adsorption of molecules on the planar surface of the prism provides an increase of optical reflectivity, whereas the adsorption on the internal surface of the microporous membrane yields an increase of scattered light. Despite the different mechanisms, we find a similar optical response upon adsorption. We confirm this result by a theoretical model accounting for both reflection and scattering. We investigate the spontaneous adsorption process for different kinds of molecules: surfactants with different charges, a protein (lysozyme), and a constituent of gasoline (hexane). The measured equilibrium and kinetic constants for adsorption differ by orders of magnitudes among the different classes of molecules. By suitable analytical models, accounting for the effects of mass limitation and transport, we find a simple and general scaling of the adsorption parameters with the molecular size.

  3. Coded moderator approach for fast neutron source detection and localization at standoff

    Energy Technology Data Exchange (ETDEWEB)

    Littell, Jennifer [Department of Nuclear Engineering, University of Tennessee, 305 Pasqua Engineering Building, Knoxville, TN 37996 (United States); Lukosi, Eric, E-mail: elukosi@utk.edu [Department of Nuclear Engineering, University of Tennessee, 305 Pasqua Engineering Building, Knoxville, TN 37996 (United States); Institute for Nuclear Security, University of Tennessee, 1640 Cumberland Avenue, Knoxville, TN 37996 (United States); Hayward, Jason; Milburn, Robert; Rowan, Allen [Department of Nuclear Engineering, University of Tennessee, 305 Pasqua Engineering Building, Knoxville, TN 37996 (United States)

    2015-06-01

    Considering the need for directional sensing at standoff for some security applications and scenarios where a neutron source may be shielded by high Z material that nearly eliminates the source gamma flux, this work focuses on investigating the feasibility of using thermal neutron sensitive boron straw detectors for fast neutron source detection and localization. We utilized MCNPX simulations to demonstrate that, through surrounding the boron straw detectors by a HDPE coded moderator, a source-detector orientation-specific response enables potential 1D source localization in a high neutron detection efficiency design. An initial test algorithm has been developed in order to confirm the viability of this detector system's localization capabilities which resulted in identification of a 1 MeV neutron source with a strength equivalent to 8 kg WGPu at 50 m standoff within ±11°.

  4. Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins

    International Nuclear Information System (INIS)

    Zeimpekis, I; Sun, K; Hu, C; Ditshego, N M J; De Planque, M R R; Chong, H M H; Morgan, H; Ashburn, P; Thomas, O

    2016-01-01

    We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH"−"1 is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH"−"1 measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%. (paper)

  5. Sources of the Geomagnetic Field and theModern Data That Enable Their Investigation

    DEFF Research Database (Denmark)

    Olsen, Nils; Hulot, Gauthier; Sabaka, Terence J.

    2010-01-01

    Abstract The geomagnetic field one canmeasure at the Earth’s surface or on board satellites is the sumof contributions frommany different sources.These sources have different physical origins and can be found both below (in the form of electrical currents and magnetized material) and above (only...

  6. Tetrodotoxin: Chemistry, Toxicity, Source, Distribution and Detection

    Directory of Open Access Journals (Sweden)

    Vaishali Bane

    2014-02-01

    Full Text Available Tetrodotoxin (TTX is a naturally occurring toxin that has been responsible for human intoxications and fatalities. Its usual route of toxicity is via the ingestion of contaminated puffer fish which are a culinary delicacy, especially in Japan. TTX was believed to be confined to regions of South East Asia, but recent studies have demonstrated that the toxin has spread to regions in the Pacific and the Mediterranean. There is no known antidote to TTX which is a powerful sodium channel inhibitor. This review aims to collect pertinent information available to date on TTX and its analogues with a special emphasis on the structure, aetiology, distribution, effects and the analytical methods employed for its detection.

  7. Sources of the Geomagnetic Field and the Modern Data That Enable Their Investigation

    DEFF Research Database (Denmark)

    Olsen, Nils; Hulot, Gauthier; Sabaka, Terence J.

    2014-01-01

    has a large and complicated magnetic field, a major part of which is produced by a self-sustaining dynamo operating in the fluid outer core. What is measured at or near the surface of the Earth, however, is the superposition of the core field and of additional fields caused by magnetized rocks......The geomagnetic field one can measure at the Earth’s surface or on board satellites is the sum of contributions from many different sources. These sources have different physical origins and can be found both below (in the form of electrical currents and magnetized material) and above (only...... in the form of electrical currents) the Earth’s surface. Each source happens to produce a contribution with rather specific spatio-temporal properties. This fortunate situation is what makes the identification and investigation of the contribution of each source possible, provided appropriate observational...

  8. Induced Temporal Signatures for Point-Source Detection

    International Nuclear Information System (INIS)

    Stephens, Daniel L.; Runkle, Robert C.; Carlson, Deborah K.; Peurrung, Anthony J.; Seifert, Allen; Wyatt, Cory R.

    2005-01-01

    Detection of radioactive point-sized sources is inherently divided into two regimes encompassing stationary and moving detectors. The two cases differ in their treatment of background radiation and its influence on detection sensitivity. In the stationary detector case the statistical fluctuation of the background determines the minimum detectable quantity. In the moving detector case the detector may be subjected to widely and irregularly varying background radiation, as a result of geographical and environmental variation. This significant systematic variation, in conjunction with the statistical variation of the background, requires a conservative threshold to be selected to yield the same false-positive rate as the stationary detection case. This results in lost detection sensitivity for real sources. This work focuses on a simple and practical modification of the detector geometry that increase point-source recognition via a distinctive temporal signature. A key part of this effort is the integrated development of both detector geometries that induce a highly distinctive signature for point sources and the development of statistical algorithms able to optimize detection of this signature amidst varying background. The identification of temporal signatures for point sources has been demonstrated and compared with the canonical method showing good results. This work demonstrates that temporal signatures are efficient at increasing point-source discrimination in a moving detector system

  9. Design Enhancements of the Fourier Kelvin Stellar Interferometer to Enable Detection of Earth Twins

    Science.gov (United States)

    Barry, Richard K.; Danchi, William C.; Lopez, Bruno; Rinehart, Stephan; Augereau, Jean-Charles; Beust, Herve; Bonfils, Xavier; Borde, Pascal; Kern, Pierre; Leger, Alain; hide

    2009-01-01

    During the last few years, considerable effort has been directed towards very large-scale (> $5 billion) missions to detect and characterize Mars-radius to Earth-radius planets around nearby stars; such as the Terrestrial Planet Finder Interferometer and Darwin missions. However, technological issues such as formation flying and control of systematic noise sources will likely prevent these missions from entering Phase A until at least the end of the next decade. Presently more than 350 planets have been discovered by a variety of techniques, and little is known about the majority of them other than their approximate mass. However, a simplified nulling interferometer operating in the near- to mid-infrared (e.g. approx. 5-15 microns), like the enhanced version of the Fourier Kelvin Stellar Interferometer (FKSI), can characterize the atmospheres of a large sample of the known planets - including Earth twins. Many other scientific problems can be addressed with a system like FKSI, including the studies of debris disks, active galactic nuclei, and low mass companions around nearby stars. We report results of a recent engineering study on an enhanced version of FKSI that includes 1-meter primary mirrors, 20-meter boom length, and an advanced sun shield that will provide a 45-degree FOR and 40K operating temperature for all optics including siderostats.

  10. Inexpensive, Open-Source, Internet of Things-Enabled Sensing Stations for Environmental Parameter Measurements

    Science.gov (United States)

    Marchetto, P. M.; Hofmeister, K.; Walter, M. T.

    2015-12-01

    In the age of the Internet, data is inherently portable. Given the shrinking numbers of stream gauges in the US under the banner of the USGS and the lack of collocation of sensors for environmental parameters, it is clear the only way to collect these data is with near real-time, multi-parameters sensing stations. We are designing a system that can be built and deployed for under $300 by community groups interested in learning more about the land that they are protecting, such as conservation groups, or groups interested in the basic science behind sensing and ecology, such as makerspaces. Sensing stations like these will enable a greater diversity of data collection while increasing public awareness of environmental issues and the research process.

  11. OpenMC In Situ Source Convergence Detection

    Energy Technology Data Exchange (ETDEWEB)

    Aldrich, Garrett Allen [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Univ. of California, Davis, CA (United States); Dutta, Soumya [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); The Ohio State Univ., Columbus, OH (United States); Woodring, Jonathan Lee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-05-07

    We designed and implemented an in situ version of particle source convergence for the OpenMC particle transport simulator. OpenMC is a Monte Carlo based-particle simulator for neutron criticality calculations. For the transport simulation to be accurate, source particles must converge on a spatial distribution. Typically, convergence is obtained by iterating the simulation by a user-settable, fixed number of steps, and it is assumed that convergence is achieved. We instead implement a method to detect convergence, using the stochastic oscillator for identifying convergence of source particles based on their accumulated Shannon Entropy. Using our in situ convergence detection, we are able to detect and begin tallying results for the full simulation once the proper source distribution has been confirmed. Our method ensures that the simulation is not started too early, by a user setting too optimistic parameters, or too late, by setting too conservative a parameter.

  12. Enabling three-dimensional densitometric measurements using laboratory source X-ray micro-computed tomography

    Science.gov (United States)

    Pankhurst, M. J.; Fowler, R.; Courtois, L.; Nonni, S.; Zuddas, F.; Atwood, R. C.; Davis, G. R.; Lee, P. D.

    2018-01-01

    We present new software allowing significantly improved quantitative mapping of the three-dimensional density distribution of objects using laboratory source polychromatic X-rays via a beam characterisation approach (c.f. filtering or comparison to phantoms). One key advantage is that a precise representation of the specimen material is not required. The method exploits well-established, widely available, non-destructive and increasingly accessible laboratory-source X-ray tomography. Beam characterisation is performed in two stages: (1) projection data are collected through a range of known materials utilising a novel hardware design integrated into the rotation stage; and (2) a Python code optimises a spectral response model of the system. We provide hardware designs for use with a rotation stage able to be tilted, yet the concept is easily adaptable to virtually any laboratory system and sample, and implicitly corrects the image artefact known as beam hardening.

  13. Identifying Business Barriers and Enablers for the Adoption of Open Source Software

    DEFF Research Database (Denmark)

    Holck, Jesper; Holm Larsen, Michael; Pedersen, Mogens Kuhn

    2004-01-01

    The main research interest in Open Source Software (OSS) has been in answering the questions of why individuals and organizations without economic compensation contribute to OSS projects and how these projects are organized. In this paper we instead focus on managerial decisions for acquisition...... models for these relationships is an important challenge, which we will deal with in a research project, of which this paper should be seen as a first step....

  14. Plagiarism and Source Deception Detection Based on Syntax Analysis

    Directory of Open Access Journals (Sweden)

    Eman Salih Al-Shamery

    2017-02-01

    Full Text Available In this research, the shingle algorithm with Jaccard method are employed as a new approach to detect deception in sources in addition to detect plagiarism . Source deception occurs as a result of taking a particular text from a source and relative it to another source, while plagiarism occurs in the documents as a result of taking part or all of the text belong to another research, this approach is based on Shingle algorithm with Jaccard coefficient , Shingling is an efficient way to compare the set of shingle in the files that contain text which are used as a feature to measure the syntactic similarity of the documents and it will work with Jaccard coefficient that measures similarity between sample sets . In this proposed system, text will be checked whether it contains syntax plagiarism or not and gives a percentage of similarity with other documents , As well as research sources will be checked to detect deception in source , by matching it with available sources from Turnitin report of the same research by using shingle algorithm with Jaccard coefficient. The motivations of this work is to discovery of literary thefts that occur on the researches , especially what students are doing in their researches , also discover the deception that occurs in the sources.

  15. Enabling Global Lunar Sample Return and Life-Detection Studies Using a Deep-Space Gateway

    Science.gov (United States)

    Cohen, B. A.; Eigenbrode, J. A.; Young, K. E.; Bleacher, J. E.; Trainer, M. E.

    2018-02-01

    The Deep Space Gateway could uniquely enable a lunar robotic sampling campaign that would provide incredible science return as well as feed forward to Mars and Europa by testing instrument sterility and ability to distinguish biogenic signals.

  16. Open Knee: Open Source Modeling & Simulation to Enable Scientific Discovery and Clinical Care in Knee Biomechanics

    Science.gov (United States)

    Erdemir, Ahmet

    2016-01-01

    Virtual representations of the knee joint can provide clinicians, scientists, and engineers the tools to explore mechanical function of the knee and its tissue structures in health and disease. Modeling and simulation approaches such as finite element analysis also provide the possibility to understand the influence of surgical procedures and implants on joint stresses and tissue deformations. A large number of knee joint models are described in the biomechanics literature. However, freely accessible, customizable, and easy-to-use models are scarce. Availability of such models can accelerate clinical translation of simulations, where labor intensive reproduction of model development steps can be avoided. The interested parties can immediately utilize readily available models for scientific discovery and for clinical care. Motivated by this gap, this study aims to describe an open source and freely available finite element representation of the tibiofemoral joint, namely Open Knee, which includes detailed anatomical representation of the joint's major tissue structures, their nonlinear mechanical properties and interactions. Three use cases illustrate customization potential of the model, its predictive capacity, and its scientific and clinical utility: prediction of joint movements during passive flexion, examining the role of meniscectomy on contact mechanics and joint movements, and understanding anterior cruciate ligament mechanics. A summary of scientific and clinically directed studies conducted by other investigators are also provided. The utilization of this open source model by groups other than its developers emphasizes the premise of model sharing as an accelerator of simulation-based medicine. Finally, the imminent need to develop next generation knee models are noted. These are anticipated to incorporate individualized anatomy and tissue properties supported by specimen-specific joint mechanics data for evaluation, all acquired in vitro from varying age

  17. Research on point source simulating the γ-ray detection efficiencies of stander source

    International Nuclear Information System (INIS)

    Tian Zining; Jia Mingyan; Shen Maoquan; Yang Xiaoyan; Cheng Zhiwei

    2010-01-01

    For φ 75 mm x 25 mm sample, the full energy peak efficiencies on different heights of sample radius were obtained using the point sources, and the function parameters about the full energy peak efficiencies of point sources based on radius was fixed. The 59.54 keV γ-ray, 661.66 keV γ-ray, 1173.2 keV γ-ray, 1332.5 keV γ-ray detection efficiencies on different height of samples were obtained, based on the full energy peak efficiencies of point sources and its height, and the function parameters about the full energy peak efficiencies of surface sources based on sample height was fixed. The detection efficiency of (75 mm x 25 mm calibration source can be obtained by integrality, the detection efficiencies simulated by point sources are consistent with the results of stander source in 10%. Therefore, the calibration method of stander source can be substituted by the point source simulation method, and it tis feasible when there is no stander source.) (authors)

  18. Group IV Light Sources to Enable the Convergence of Photonics and Electronics

    Directory of Open Access Journals (Sweden)

    Shinichi eSaito

    2014-09-01

    Full Text Available Group IV lasers are expected to revolutionize chip-to-chip optical communications in terms of cost, scalability, yield, and compatibility to the existing infrastructure of silicon industries for mass production. Here, we review the current state-of-the-art developments of silicon and germanium light sources towards monolithic integration. Quantum confinement of electrons and holes in nano-structures has been the primary route for light emission from silicon, and we can use advanced silicon technologies using top-down patterning processes to fabricate these nano-structures, including fin-type vertical multiple quantum wells. Moreover, the electromagnetic environment can also be manipulated in a photonic crystal nano-cavity to enhance the efficiency of light extraction and emission by the Purcell effect. Germanium is also widely investigated as an active material in Group IV photonics, and novel epitaxial growth technologies are being developed to make a high quality germanium layer on a silicon substrate. To develop a practical germanium laser, various technologies are employed for tensile-stress engineering and high electron doping to compensate the indirect valleys in the conduction band. These challenges are aiming to contribute towards the convergence of electronics and photonics on a silicon chip.

  19. In situ focus characterization by ablation technique to enable optics alignment at an XUV FEL source

    Czech Academy of Sciences Publication Activity Database

    Gerasimova, N.; Dziarzhytski, S.; Weigelt, H.; Chalupský, Jaromír; Hájková, Věra; Vyšín, Luděk; Juha, Libor

    2013-01-01

    Roč. 84, č. 6 (2013), "065104-1"-"065104-6" ISSN 0034-6748 R&D Projects: GA MŠk ED1.1.00/02.0061; GA MŠk EE.2.3.20.0087; GA ČR(CZ) GAP108/11/1312; GA ČR GAP205/11/0571; GA MŠk EE2.3.30.0057; GA MŠk(CZ) LG13029; GA ČR GAP208/10/2302; GA ČR GA13-28721S Grant - others:ELI Beamlines(XE) CZ.1.05/1.1.00/02.0061; OP VK 2 LaserGen(XE) CZ.1.07/2.3.00/20.0087; OP VK 4 POSTDOK(XE) CZ.1.07/2.3.00/30.0057; AVČR(CZ) M100101221 Institutional support: RVO:68378271 Keywords : free electron lasers * laser ablation * laser beams * optical focusing * ultraviolet sources Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.584, year: 2013

  20. Detection of supernova neutrinos at spallation neutron sources

    Science.gov (United States)

    Huang, Ming-Yang; Guo, Xin-Heng; Young, Bing-Lin

    2016-07-01

    After considering supernova shock effects, Mikheyev-Smirnov-Wolfenstein effects, neutrino collective effects, and Earth matter effects, the detection of supernova neutrinos at the China Spallation Neutron Source is studied and the expected numbers of different flavor supernova neutrinos observed through various reaction channels are calculated with the neutrino energy spectra described by the Fermi-Dirac distribution and the “beta fit” distribution respectively. Furthermore, the numerical calculation method of supernova neutrino detection on Earth is applied to some other spallation neutron sources, and the total expected numbers of supernova neutrinos observed through different reactions channels are given. Supported by National Natural Science Foundation of China (11205185, 11175020, 11275025, 11575023)

  1. Nuisance Source Population Modeling for Radiation Detection System Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Sokkappa, P; Lange, D; Nelson, K; Wheeler, R

    2009-10-05

    A major challenge facing the prospective deployment of radiation detection systems for homeland security applications is the discrimination of radiological or nuclear 'threat sources' from radioactive, but benign, 'nuisance sources'. Common examples of such nuisance sources include naturally occurring radioactive material (NORM), medical patients who have received radioactive drugs for either diagnostics or treatment, and industrial sources. A sensitive detector that cannot distinguish between 'threat' and 'benign' classes will generate false positives which, if sufficiently frequent, will preclude it from being operationally deployed. In this report, we describe a first-principles physics-based modeling approach that is used to approximate the physical properties and corresponding gamma ray spectral signatures of real nuisance sources. Specific models are proposed for the three nuisance source classes - NORM, medical and industrial. The models can be validated against measured data - that is, energy spectra generated with the model can be compared to actual nuisance source data. We show by example how this is done for NORM and medical sources, using data sets obtained from spectroscopic detector deployments for cargo container screening and urban area traffic screening, respectively. In addition to capturing the range of radioactive signatures of individual nuisance sources, a nuisance source population model must generate sources with a frequency of occurrence consistent with that found in actual movement of goods and people. Measured radiation detection data can indicate these frequencies, but, at present, such data are available only for a very limited set of locations and time periods. In this report, we make more general estimates of frequencies for NORM and medical sources using a range of data sources such as shipping manifests and medical treatment statistics. We also identify potential data sources for industrial

  2. Verification of Minimum Detectable Activity for Radiological Threat Source Search

    Science.gov (United States)

    Gardiner, Hannah; Myjak, Mitchell; Baciak, James; Detwiler, Rebecca; Seifert, Carolyn

    2015-10-01

    The Department of Homeland Security's Domestic Nuclear Detection Office is working to develop advanced technologies that will improve the ability to detect, localize, and identify radiological and nuclear sources from airborne platforms. The Airborne Radiological Enhanced-sensor System (ARES) program is developing advanced data fusion algorithms for analyzing data from a helicopter-mounted radiation detector. This detector platform provides a rapid, wide-area assessment of radiological conditions at ground level. The NSCRAD (Nuisance-rejection Spectral Comparison Ratios for Anomaly Detection) algorithm was developed to distinguish low-count sources of interest from benign naturally occurring radiation and irrelevant nuisance sources. It uses a number of broad, overlapping regions of interest to statistically compare each newly measured spectrum with the current estimate for the background to identify anomalies. We recently developed a method to estimate the minimum detectable activity (MDA) of NSCRAD in real time. We present this method here and report on the MDA verification using both laboratory measurements and simulated injects on measured backgrounds at or near the detection limits. This work is supported by the US Department of Homeland Security, Domestic Nuclear Detection Office, under competitively awarded contract/IAA HSHQDC-12-X-00376. This support does not constitute an express or implied endorsement on the part of the Gov't.

  3. Calibration experiments of neutron source identification and detection in soil

    International Nuclear Information System (INIS)

    Gorin, N. V.; Lipilina, E. N.; Rukavishnikov, G. V.; Shmakov, D. V.; Ulyanov, A. I.

    2007-01-01

    In the course of detection of fissile materials in soil, series of calibration experiments were carried out on in laboratory conditions on an experimental installation, presenting a mock-up of an endless soil with various heterogeneous bodies in it, fissile material, measuring boreholes. A design of detecting device, methods of neutrons detection are described. Conditions of neutron background measuring are given. Soil density, humidity, chemical composition of soil was measured. Sensitivity of methods of fissile materials detection and identification in soil was estimated in the calibration experiments. Minimal detectable activity and the distance at which it can be detected were defined. Characteristics of neutron radiation in a borehole mock-up were measured; dependences of method sensitivities from water content in soil, source-detector distance and presence of heterogeneous bodies were examined. Possibility of direction detection to a fissile material as neutron source from a borehole using a collimator is shown. Identification of fissile material was carried out by measuring the gamma-spectrum. Mathematical modeling was carried out using the PRIZMA code (Developed in RFNC-VNIITF) and MCNP code (Developed in LANL). Good correlation of calculational and experimental values was shown. The methodic were shown to be applicable in the field conditions

  4. Free and open source enabling technologies for patient-centric, guideline-based clinical decision support: a survey.

    Science.gov (United States)

    Leong, T Y; Kaiser, K; Miksch, S

    2007-01-01

    Guideline-based clinical decision support is an emerging paradigm to help reduce error, lower cost, and improve quality in evidence-based medicine. The free and open source (FOS) approach is a promising alternative for delivering cost-effective information technology (IT) solutions in health care. In this paper, we survey the current FOS enabling technologies for patient-centric, guideline-based care, and discuss the current trends and future directions of their role in clinical decision support. We searched PubMed, major biomedical informatics websites, and the web in general for papers and links related to FOS health care IT systems. We also relied on our background and knowledge for specific subtopics. We focused on the functionalities of guideline modeling tools, and briefly examined the supporting technologies for terminology, data exchange and electronic health record (EHR) standards. To effectively support patient-centric, guideline-based care, the computerized guidelines and protocols need to be integrated with existing clinical information systems or EHRs. Technologies that enable such integration should be accessible, interoperable, and scalable. A plethora of FOS tools and techniques for supporting different knowledge management and quality assurance tasks involved are available. Many challenges, however, remain in their implementation. There are active and growing trends of deploying FOS enabling technologies for integrating clinical guidelines, protocols, and pathways into the main care processes. The continuing development and maturation of such technologies are likely to make increasingly significant contributions to patient-centric, guideline-based clinical decision support.

  5. Detection of aeroacoustic sound sources on aircraft and wind turbines

    NARCIS (Netherlands)

    Oerlemans, Stefan

    2009-01-01

    This thesis deals with the detection of aeroacoustic sound sources on aircraft and wind turbines using phased microphone arrays. First, the reliability of the array technique is assessed using airframe noise measurements in open and closed wind tunnels. It is demonstrated that quantitative acoustic

  6. Plagiarism Detection Algorithm for Source Code in Computer Science Education

    Science.gov (United States)

    Liu, Xin; Xu, Chan; Ouyang, Boyu

    2015-01-01

    Nowadays, computer programming is getting more necessary in the course of program design in college education. However, the trick of plagiarizing plus a little modification exists among some students' home works. It's not easy for teachers to judge if there's plagiarizing in source code or not. Traditional detection algorithms cannot fit this…

  7. Geometric effects in alpha particle detection from distributed air sources

    International Nuclear Information System (INIS)

    Gil, L.R.; Leitao, R.M.S.; Marques, A.; Rivera, A.

    1994-08-01

    Geometric effects associated to detection of alpha particles from distributed air sources, as it happens in Radon and Thoron measurements, are revisited. The volume outside which no alpha particle may reach the entrance window of the detector is defined and determined analytically for rectangular and cylindrical symmetry geometries. (author). 3 figs

  8. Complex Event Detection via Multi Source Video Attributes (Open Access)

    Science.gov (United States)

    2013-10-03

    Complex Event Detection via Multi-Source Video Attributes Zhigang Ma† Yi Yang‡ Zhongwen Xu‡§ Shuicheng Yan Nicu Sebe† Alexander G. Hauptmann...under its International Research Centre @ Singapore Fund- ing Initiative and administered by the IDM Programme Of- fice, and the Intelligence Advanced

  9. Understanding enabling capacities for managing the 'wicked problem' of nonpoint source water pollution in catchments: a conceptual framework.

    Science.gov (United States)

    Patterson, James J; Smith, Carl; Bellamy, Jennifer

    2013-10-15

    Nonpoint source (NPS) water pollution in catchments is a 'wicked' problem that threatens water quality, water security, ecosystem health and biodiversity, and thus the provision of ecosystem services that support human livelihoods and wellbeing from local to global scales. However, it is a difficult problem to manage because water catchments are linked human and natural systems that are complex, dynamic, multi-actor, and multi-scalar in nature. This in turn raises questions about understanding and influencing change across multiple levels of planning, decision-making and action. A key challenge in practice is enabling implementation of local management action, which can be influenced by a range of factors across multiple levels. This paper reviews and synthesises important 'enabling' capacities that can influence implementation of local management action, and develops a conceptual framework for understanding and analysing these in practice. Important enabling capacities identified include: history and contingency; institutional arrangements; collaboration; engagement; vision and strategy; knowledge building and brokerage; resourcing; entrepreneurship and leadership; and reflection and adaptation. Furthermore, local action is embedded within multi-scalar contexts and therefore, is highly contextual. The findings highlight the need for: (1) a systemic and integrative perspective for understanding and influencing change for managing the wicked problem of NPS water pollution; and (2) 'enabling' social and institutional arenas that support emergent and adaptive management structures, processes and innovations for addressing NPS water pollution in practice. These findings also have wider relevance to other 'wicked' natural resource management issues facing similar implementation challenges. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Precise Automatic Image Coregistration Tools to Enable Pixel-Level Change Detection, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Automated detection of land cover changes between multitemporal images (i.e., images captured at different times) has long been a goal of the remote sensing...

  11. Passive Detection of Narrowband Sources Using a Sensor Array

    Energy Technology Data Exchange (ETDEWEB)

    Chambers, D H; Candy, J V; Guidry, B L

    2007-10-24

    In this report we derive a model for a highly scattering medium, implemented as a set of MATLAB functions. This model is used to analyze an approach for using time-reversal to enhance the detection of a single frequency source in a highly scattering medium. The basic approach is to apply the singular value decomposition to the multistatic response matrix for a time-reversal array system. We then use the array in a purely passive mode, measuring the response to the presence of a source. The measured response is projected onto the singular vectors, creating a time-reversal pseudo-spectrum. We can then apply standard detection techniques to the pseudo-spectrum to determine the presence of a source. If the source is close to a particular scatterer in the medium, then we would expect an enhancement of the inner product between the array response to the source with the singular vector associated with that scatterer. In this note we begin by deriving the Foldy-Lax model of a highly scattering medium, calculate both the field emitted by the source and the multistatic response matrix of a time-reversal array system in the medium, then describe the initial analysis approach.

  12. Detecting people of interest from internet data sources

    Science.gov (United States)

    Cardillo, Raymond A.; Salerno, John J.

    2006-04-01

    In previous papers, we have documented success in determining the key people of interest from a large corpus of real-world evidence. Our recent efforts focus on exploring additional domains and data sources. Internet data sources such as email, web pages, and news feeds make it easier to gather a large corpus of documents for various domains, but detecting people of interest in these sources introduces new challenges. Analyzing these massive sources magnifies entity resolution problems, and demands a storage management strategy that supports efficient algorithmic analysis and visualization techniques. This paper discusses the techniques we used in order to analyze the ENRON email repository, which are also applicable to analyzing web pages returned from our "Buddy" meta-search engine.

  13. An overview of gravitational waves theory, sources and detection

    CERN Document Server

    Auger, Gerard

    2017-01-01

    This book describes detection techniques used to search for and analyze gravitational waves (GW). It covers the whole domain of GW science, starting from the theory and ending with the experimental techniques (both present and future) used to detect them. The theoretical sections of the book address the theory of general relativity and of GW, followed by the theory of GW detection. The various sources of GW are described as well as the methods used to analyse them and to extract their physical parameters. It includes an analysis of the consequences of GW observations in terms of astrophysics as well as a description of the different detectors that exist and that are planned for the future. With the recent announcement of GW detection and the first results from LISA Pathfinder, this book will allow non-specialists to understand the present status of the field and the future of gravitational wave science

  14. Coherent detection passive optical access network enabling converged delivery of broadcast and dedicated broadband services

    DEFF Research Database (Denmark)

    Osadchiy, Alexey Vladimirovich; Prince, Kamau; Guerrero Gonzalez, Neil

    2011-01-01

    We propose a passive optical network architecture based on coherent detection for converged delivery of broadcast services from a dedicated remote broadcast server and user-specific services from a local central office. We experimentally demonstrate this architecture with mixed traffic types....... The broadcast channels were transmitted over 78 km of single mode fiber to a central office where they were multiplexed with the unicast channels for further fiber transmission over 34-km to reach the access network. Successful detection of all channels is demonstrated....

  15. Genomics-enabled sensor platform for rapid detection of viruses related to disease outbreak.

    Energy Technology Data Exchange (ETDEWEB)

    Brozik, Susan M; Manginell, Ronald P; Moorman, Matthew W; Xiao, Xiaoyin; Edwards, Thayne L.; Anderson, John Moses; Pfeifer, Kent Bryant; Branch, Darren W.; Wheeler, David Roger; Polsky, Ronen; Lopez, DeAnna M.; Ebel, Gregory D.; Prasad, Abhishek N.; Brozik, James A.; Rudolph, Angela R.; Wong, Lillian P.

    2013-09-01

    Bioweapons and emerging infectious diseases pose growing threats to our national security. Both natural disease outbreak and outbreaks due to a bioterrorist attack are a challenge to detect, taking days after the outbreak to identify since most outbreaks are only recognized through reportable diseases by health departments and reports of unusual diseases by clinicians. In recent decades, arthropod-borne viruses (arboviruses) have emerged as some of the most significant threats to human health. They emerge, often unexpectedly, from cryptic transmission foci causing localized outbreaks that can rapidly spread to multiple continents due to increased human travel and trade. Currently, diagnosis of acute infections requires amplification of viral nucleic acids, which can be costly, highly specific, technically challenging and time consuming. No diagnostic devices suitable for use at the bedside or in an outbreak setting currently exist. The original goals of this project were to 1) develop two highly sensitive and specific diagnostic assays for detecting RNA from a wide range of arboviruses; one based on an electrochemical approach and the other a fluorescent based assay and 2) develop prototype microfluidic diagnostic platforms for preclinical and field testing that utilize the assays developed in goal 1. We generated and characterized suitable primers for West Nile Virus RNA detection. Both optical and electrochemical transduction technologies were developed for DNA-RNA hybridization detection and were implemented in microfluidic diagnostic sensing platforms that were developed in this project.

  16. Intensity and Compactness Enabled Saliency Estimation for Leakage Detection in Diabetic and Malarial Retinopathy.

    Science.gov (United States)

    Zhao, Yitian; Zheng, Yalin; Liu, Yonghuai; Yang, Jian; Zhao, Yifan; Chen, Duanduan; Wang, Yongtian

    2017-01-01

    Leakage in retinal angiography currently is a key feature for confirming the activities of lesions in the management of a wide range of retinal diseases, such as diabetic maculopathy and paediatric malarial retinopathy. This paper proposes a new saliency-based method for the detection of leakage in fluorescein angiography. A superpixel approach is firstly employed to divide the image into meaningful patches (or superpixels) at different levels. Two saliency cues, intensity and compactness, are then proposed for the estimation of the saliency map of each individual superpixel at each level. The saliency maps at different levels over the same cues are fused using an averaging operator. The two saliency maps over different cues are fused using a pixel-wise multiplication operator. Leaking regions are finally detected by thresholding the saliency map followed by a graph-cut segmentation. The proposed method has been validated using the only two publicly available datasets: one for malarial retinopathy and the other for diabetic retinopathy. The experimental results show that it outperforms one of the latest competitors and performs as well as a human expert for leakage detection and outperforms several state-of-the-art methods for saliency detection.

  17. Enabling real-time detection of electrochemical desorption phenomena with sub-monolayer sensitivity

    DEFF Research Database (Denmark)

    Trimarco, Daniel Bøndergaard; Scott, Søren Bertelsen; Thilsted, Anil Haraksingh

    2018-01-01

    -time detection of reaction products and intermediates during electrochemistry experiments. Herein, we present a new type of electrochemistry – mass spectrometry (EC-MS) based on a versatile gas inlet to vacuum fabricated onto a silicon microchip, and compare it to established techniques with focus...

  18. Facile detection of toxic ingredients in seafood using biologically enabled photonic crystal materials

    Science.gov (United States)

    Kong, Xianming; Squire, Kenneth; Wang, Alan X.

    2018-02-01

    Surface-enhanced Raman scattering (SERS) spectroscopy has attracted considerable attention recently as a powerful detection platform in biosensing because of the wealth of inherent information ascertained about the chemical and molecular composition of a sample. However, real-world samples are often composed of many components, which renders the detection of constitutes of mixed samples very challenging for SERS sensing. Accordingly, separation techniques are needed before SERS measurements. Thin layer chromatography (TLC) is a simple, fast and costeffective technique for analyte separation and can a play pivotal role for on-site sensing. However, combining TLC with SERS is only successful to detect a limited number of analytes that have large Raman scattering cross sections. As a kind of biogenic amine, histamine (2-(4-imidazolyl)-ethylamine) has a relationship with many health problems resulting from seafood consumption occurring worldwide. Diatomaceous earth consists of fossilized remains of diatoms, a type of hard-shelled algae. As a kind of natural photonic biosilica from geological deposits, it has a variety of unique properties including highly porous structure, excellent adsorption capacity, and low cost. In addition, the two dimensional periodic pores on diatomite earth with hierarchical nanoscale photonic crystal features can enhance the localized optical field. Herein, we fabricate TLC plates from diatomite as the stationary phase combining with SERS to separate and detect histamine from seafood samples. We have proved that the diatomite on the TLC plate not only functions as stationary phase, but also provides additional Raman enhancement, in which the detection limit of 2 ppm was achieved for pyrene in mixture.

  19. Enabling tools for high-throughput detection of metabolites: Metabolic engineering and directed evolution applications.

    Science.gov (United States)

    Lin, Jyun-Liang; Wagner, James M; Alper, Hal S

    2017-12-01

    Within the Design-Build-Test Cycle for strain engineering, rapid product detection and selection strategies remain challenging and limit overall throughput. Here we summarize a wide variety of modalities that transduce chemical concentrations into easily measured absorbance, luminescence, and fluorescence signals. Specifically, we cover protein-based biosensors (including transcription factors), nucleic acid-based biosensors, coupled enzyme reactions, bioorthogonal chemistry, and fluorescent and chromogenic dyes and substrates as modalities for detection. We focus on the use of these methods for strain engineering and enzyme discovery and conclude with remarks on the current and future state of biosensor development for application in the metabolic engineering field. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Thalamocortical network activity enables chronic tic detection in humans with Tourette syndrome

    Directory of Open Access Journals (Sweden)

    Jonathan B. Shute

    2016-01-01

    Full Text Available Tourette syndrome (TS is a neuropsychiatric disorder characterized by multiple motor and vocal tics. Deep brain stimulation (DBS is an emerging therapy for severe cases of TS. We studied two patients with TS implanted with bilateral Medtronic Activa PC + S DBS devices, capable of chronic recordings, with depth leads in the thalamic centromedian–parafascicular complex (CM-PF and subdural strips over the precentral gyrus. Low-frequency (1–10 Hz CM-PF activity was observed during tics, as well as modulations in beta rhythms over the motor cortex. Tics were divided into three categories: long complex, complex, and simple. Long complex tics, tics involving multiple body regions and lasting longer than 5 s, were concurrent with a highly detectable thalamocortical signature (average recall [sensitivity] 88.6%, average precision 96.3%. Complex tics were detected with an average recall of 63.9% and precision of 36.6% and simple tics an average recall of 39.3% and precision of 37.9%. The detections were determined using data from both patients.

  1. Thalamocortical network activity enables chronic tic detection in humans with Tourette syndrome.

    Science.gov (United States)

    Shute, Jonathan B; Okun, Michael S; Opri, Enrico; Molina, Rene; Rossi, P Justin; Martinez-Ramirez, Daniel; Foote, Kelly D; Gunduz, Aysegul

    2016-01-01

    Tourette syndrome (TS) is a neuropsychiatric disorder characterized by multiple motor and vocal tics. Deep brain stimulation (DBS) is an emerging therapy for severe cases of TS. We studied two patients with TS implanted with bilateral Medtronic Activa PC + S DBS devices, capable of chronic recordings, with depth leads in the thalamic centromedian-parafascicular complex (CM-PF) and subdural strips over the precentral gyrus. Low-frequency (1-10 Hz) CM-PF activity was observed during tics, as well as modulations in beta rhythms over the motor cortex. Tics were divided into three categories: long complex, complex, and simple. Long complex tics, tics involving multiple body regions and lasting longer than 5 s, were concurrent with a highly detectable thalamocortical signature (average recall [sensitivity] 88.6%, average precision 96.3%). Complex tics were detected with an average recall of 63.9% and precision of 36.6% and simple tics an average recall of 39.3% and precision of 37.9%. The detections were determined using data from both patients.

  2. Accelerating fissile material detection with a neutron source

    Science.gov (United States)

    Rowland, Mark S.; Snyderman, Neal J.

    2018-01-30

    A neutron detector system for discriminating fissile material from non-fissile material wherein a digital data acquisition unit collects data at high rate, and in real-time processes large volumes of data directly to count neutrons from the unknown source and detecting excess grouped neutrons to identify fission in the unknown source. The system includes a Poisson neutron generator for in-beam interrogation of a possible fissile neutron source and a DC power supply that exhibits electrical ripple on the order of less than one part per million. Certain voltage multiplier circuits, such as Cockroft-Walton voltage multipliers, are used to enhance the effective of series resistor-inductor circuits components to reduce the ripple associated with traditional AC rectified, high voltage DC power supplies.

  3. Note: Electrical detection and quantification of spin rectification effect enabled by shorted microstrip transmission line technique

    International Nuclear Information System (INIS)

    Soh, Wee Tee; Ong, C. K.; Peng, Bin; Chai, Guozhi

    2014-01-01

    We describe a shorted microstrip method for the sensitive quantification of Spin Rectification Effect (SRE). SRE for a Permalloy (Ni 80 Fe 20 ) thin film strip sputtered onto SiO 2 substrate is demonstrated. Our method obviates the need for simultaneous lithographic patterning of the sample and transmission line, therefore greatly simplifying the SRE measurement process. Such a shorted microstrip method can allow different contributions to SRE (anisotropic magnetoresistance, Hall effect, and anomalous Hall effect) to be simultaneously determined. Furthermore, SRE signals from unpatterned 50 nm thick Permalloy films of area dimensions 5 mm × 10 mm can even be detected

  4. A Comparison of Source Code Plagiarism Detection Engines

    Science.gov (United States)

    Lancaster, Thomas; Culwin, Fintan

    2004-06-01

    Automated techniques for finding plagiarism in student source code submissions have been in use for over 20 years and there are many available engines and services. This paper reviews the literature on the major modern detection engines, providing a comparison of them based upon the metrics and techniques they deploy. Generally the most common and effective techniques are seen to involve tokenising student submissions then searching pairs of submissions for long common substrings, an example of what is defined to be a paired structural metric. Computing academics are recommended to use one of the two Web-based detection engines, MOSS and JPlag. It is shown that whilst detection is well established there are still places where further research would be useful, particularly where visual support of the investigation process is possible.

  5. Galactic Sources Detected in the NuSTAR Serendipitous Survey

    Energy Technology Data Exchange (ETDEWEB)

    Tomsick, John A.; Clavel, Maïca; Chiu, Jeng-Lun [Space Sciences Laboratory, 7 Gauss Way, University of California, Berkeley, CA 94720-7450 (United States); Lansbury, George B.; Aird, James [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom); Rahoui, Farid [Department of Astronomy, Harvard University, 60 Garden Street, Cambridge, MA 02138 (United States); Fornasini, Francesca M.; Hong, JaeSub; Grindlay, Jonathan E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Alexander, David M. [Centre for Extragalactic Astronomy, Department of Physics, University of Durham, South Road, Durham DH1 3LE (United Kingdom); Bodaghee, Arash [Georgia College and State University, Milledgeville, GA 31061 (United States); Hailey, Charles J.; Mori, Kaya [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Harrison, Fiona A. [California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Krivonos, Roman A. [Space Research Institute of the Russian Academy of Sciences, Profsoyuznaya Str. 84/32, 117997, Moscow (Russian Federation); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States)

    2017-06-01

    The Nuclear Spectroscopic Telescope Array (NuSTAR) provides an improvement in sensitivity at energies above 10 keV by two orders of magnitude over non-focusing satellites, making it possible to probe deeper into the Galaxy and universe. Lansbury and collaborators recently completed a catalog of 497 sources serendipitously detected in the 3–24 keV band using 13 deg{sup 2} of NuSTAR coverage. Here, we report on an optical and X-ray study of 16 Galactic sources in the catalog. We identify 8 of them as stars (but some or all could have binary companions), and use information from Gaia to report distances and X-ray luminosities for 3 of them. There are 4 CVs or CV candidates, and we argue that NuSTAR J233426–2343.9 is a relatively strong CV candidate based partly on an X-ray spectrum from XMM-Newton . NuSTAR J092418–3142.2, which is the brightest serendipitous source in the Lansbury catalog, and NuSTAR J073959–3147.8 are low-mass X-ray binary candidates, but it is also possible that these 2 sources are CVs. One of the sources is a known high-mass X-ray binary (HMXB), and NuSTAR J105008–5958.8 is a new HMXB candidate that has strong Balmer emission lines in its optical spectrum and a hard X-ray spectrum. We discuss the implications of finding these HMXBs for the surface density (log N –log S ) and luminosity function of Galactic HMXBs. We conclude that with the large fraction of unclassified sources in the Galactic plane detected by NuSTAR in the 8–24 keV band, there could be a significant population of low-luminosity HMXBs.

  6. Liquid Crystal Enabled Early Stage Detection of Beta Amyloid Formation on Lipid Monolayers

    Energy Technology Data Exchange (ETDEWEB)

    Sadati, Monirosadat [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Apik, Aslin Izmitli [Chemical and Biological Engineering, University of Wisconsin, Madison WI 53706 USA; Armas-Perez, Julio C. [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Martinez-Gonzalez, Jose [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Hernandez-Ortiz, Juan P. [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Departamento de Materiales y Minerales, Facultad de Minas, Universidad Nacional de Colombia, Sede Medellín, Calle 75 # 79A-51, Bloque M17 Medellín Colombia; Abbott, Nicholas L. [Chemical and Biological Engineering, University of Wisconsin, Madison WI 53706 USA; de Pablo, Juan J. [Institute for Molecular Engineering, University of Chicago, Chicago IL 60637 USA; Argonne National Laboratory, Argonne IL 60439 USA

    2015-09-09

    Liquid crystals (LCs) can serve as sensitive reporters of interfacial events, and this property has been used for sensing of synthetic or biological toxins. Here it is demonstrated that LCs can distinguish distinct molecular motifs and exhibit a specific response to beta-sheet structures. That property is used to detect the formation of highly toxic protofibrils involved in neurodegenerative diseases, where it is crucial to develop methods that probe the early-stage aggregation of amyloidogenic peptides in the vicinity of biological membranes. In the proposed method, the amyloid fibrils formed at the lipid-decorated LC interface can change the orientation of LCs and form elongated and branched structures that are amplified by the mesogenic medium; however, nonamyloidogenic peptides form ellipsoidal domains of tilted LCs. Moreover, a theoretical and computational analysis is used to reveal the underlying structure of the LC, thereby providing a detailed molecular-level view of the interactions and mechanisms responsible for such motifs. The corresponding signatures can be detected at nanomolar concentrations of peptide by polarized light microscopy and much earlier than the ones that can be identified by fluorescence-based techniques. As such, it offers the potential for early diagnoses of neurodegenerative diseases and for facile testing of inhibitors of amyloid formation.

  7. Perfusion MDCT enables early detection of therapeutic response to antiangiogenic therapy.

    Science.gov (United States)

    Sabir, Adeel; Schor-Bardach, Rachel; Wilcox, Carol J; Rahmanuddin, Syed; Atkins, Michael B; Kruskal, Jonathan B; Signoretti, Sabina; Raptopoulos, Vassilios D; Goldberg, S Nahum

    2008-07-01

    The objective of our study was to determine whether perfusion CT can be used to detect early changes in therapeutic response to antiangiogenic therapy in an animal tumor model. Twenty-five rats implanted with R3230 mammary adenocarcinoma (diameter, 1.2-2.0 cm) randomly received 7.5 or 30 mg/kg of an antiangiogenic agent, sorafenib, by daily gavage for 4 (n = 4), 9 (n = 9), or 14 (n = 5) days. Seven untreated animals served as a control group. Perfusion MDCT was performed at days 0, 4, 9, and 14 with 0.4 mL of ioversol (350 mg/mL) and included four 5-mm slices covering the entire tumor volume. Changes in tumor growth were determined by volumetric analysis of CT data. Serial changes in tumor volume and blood flow were assessed and correlated with pathology findings. All control tumors grew larger (from 2.0 +/- 0.7 cm(3) at day 0 to 5.9 +/- 1.0 cm(3) at day 14), whereas all treated tumors shrank (from 2.5 +/- 1.1 to 2.1 +/- 1.0 cm(3)), with a statistically significant rate of growth or shrinkage in both groups (p histopathologic viability despite the fact that these tumors were shrinking in size from day 4 onward (day 4, 2.18 +/- 0.8 cm(3); day 9, 1.98 +/- 0.8 cm(3)). Perfusion MDCT can detect focal blood flow changes even when the tumor is shrinking, possibly indicating early reversal of tumor responsiveness to antiangiogenic therapy. Given that changes in tumor volume after antiangiogenic therapy do not necessarily correlate with true treatment response, physiologic imaging of tumor perfusion may be necessary.

  8. Backpropagating Action Potentials Enable Detection of Extrasynaptic Glutamate by NMDA Receptors

    Directory of Open Access Journals (Sweden)

    Yu-Wei Wu

    2012-05-01

    Full Text Available Synaptic NMDA receptors (NMDARs are crucial for neural coding and plasticity. However, little is known about the adaptive function of extrasynaptic NMDARs occurring mainly on dendritic shafts. Here, we find that in CA1 pyramidal neurons, backpropagating action potentials (bAPs recruit shaft NMDARs exposed to ambient glutamate. In contrast, spine NMDARs are “protected,” under baseline conditions, from such glutamate influences by perisynaptic transporters: we detect bAP-evoked Ca2+ entry through these receptors upon local synaptic or photolytic glutamate release. During theta-burst firing, NMDAR-dependent Ca2+ entry either downregulates or upregulates an h-channel conductance (Gh of the cell depending on whether synaptic glutamate release is intact or blocked. Thus, the balance between activation of synaptic and extrasynaptic NMDARs can determine the sign of Gh plasticity. Gh plasticity in turn regulates dendritic input probed by local glutamate uncaging. These results uncover a metaplasticity mechanism potentially important for neural coding and memory formation.

  9. Advanced Laser-Compton Gamma-Ray Sources for Nuclear Materials Detection, Assay and Imaging

    Science.gov (United States)

    Barty, C. P. J.

    2015-10-01

    Highly-collimated, polarized, mono-energetic beams of tunable gamma-rays may be created via the optimized Compton scattering of pulsed lasers off of ultra-bright, relativistic electron beams. Above 2 MeV, the peak brilliance of such sources can exceed that of the world's largest synchrotrons by more than 15 orders of magnitude and can enable for the first time the efficient pursuit of nuclear science and applications with photon beams, i.e. Nuclear Photonics. Potential applications are numerous and include isotope-specific nuclear materials management, element-specific medical radiography and radiology, non-destructive, isotope-specific, material assay and imaging, precision spectroscopy of nuclear resonances and photon-induced fission. This review covers activities at the Lawrence Livermore National Laboratory related to the design and optimization of mono-energetic, laser-Compton gamma-ray systems and introduces isotope-specific nuclear materials detection and assay applications enabled by them.

  10. Some statistical problems inherent in radioactive-source detection

    International Nuclear Information System (INIS)

    Barnett, C.S.

    1978-01-01

    Some of the statistical questions associated with problems of detecting random-point-process signals embedded in random-point-process noise are examined. An example of such a problem is that of searching for a lost radioactive source with a moving detection system. The emphasis is on theoretical questions, but some experimental and Monte Carlo results are used to test the theoretical results. Several idealized binary decision problems are treated by starting with simple, specific situations and progressing toward more general problems. This sequence of decision problems culminates in the minimum-cost-expectation rule for deciding between two Poisson processes with arbitrary intensity functions. As an example, this rule is then specialized to the detector-passing-a-point-source decision problem. Finally, Monte Carlo techniques are used to develop and test one estimation procedure: the maximum-likelihood estimation of a parameter in the intensity function of a Poisson process. For the Monte Carlo test this estimation procedure is specialized to the detector-passing-a-point-source case. Introductory material from probability theory is included so as to make the report accessible to those not especially conversant with probabilistic concepts and methods. 16 figures

  11. Research and development of a compact fusion neutron source for humanitarian landmine detection

    International Nuclear Information System (INIS)

    Yoshikawa, K.; Masuda, K.; Yamamoto, Y.; Takamatsu, T.; Toku, H.; Nagasaki, K.; Hotta, E.; Yamauchi, K.; Ohnishi, M.; Osawa, H.

    2005-01-01

    Research and development of the advanced anti-personnel landmine detection system by using a compact discharge-type D-D fusion neutron source called IECF (Inertial-Electrostatic Confinement Fusion) are described. Landmines are to be identified through increased backscattering of neutrons by the hydrogen atoms, and specific-energy capture γ-ray emission by hydrogen and nitrogen atoms with thermalized neutrons in the landmine explosives. For this purpose, improvements of the IECF device were studied for drastic enhancement of neutron production rates of more than 10 8 n/s in pulsed operation including R and D of robust power sources, as well as analyses of envisaged detection system with multi-sensors in parallel in order to show promising and practical features of this detection system for humanitarian landmine detection, particularly, in the aridic, or dry Afghanistan deserted area, where the soil moisture remains between 3-8%, which eventually enables effectively detection of hydrogen anomaly inherent in the landmine explosives. In this paper, improvements of the IECF are focused to be described. (author)

  12. Detection of Nuclear Sources by UAV Teleoperation Using a Visuo-Haptic Augmented Reality Interface

    Directory of Open Access Journals (Sweden)

    Jacopo Aleotti

    2017-09-01

    Full Text Available A visuo-haptic augmented reality (VHAR interface is presented enabling an operator to teleoperate an unmanned aerial vehicle (UAV equipped with a custom CdZnTe-based spectroscopic gamma-ray detector in outdoor environments. The task is to localize nuclear radiation sources, whose location is unknown to the user, without the close exposure of the operator. The developed detector also enables identification of the localized nuclear sources. The aim of the VHAR interface is to increase the situation awareness of the operator. The user teleoperates the UAV using a 3DOF haptic device that provides an attractive force feedback around the location of the most intense detected radiation source. Moreover, a fixed camera on the ground observes the environment where the UAV is flying. A 3D augmented reality scene is displayed on a computer screen accessible to the operator. Multiple types of graphical overlays are shown, including sensor data acquired by the nuclear radiation detector, a virtual cursor that tracks the UAV and geographical information, such as buildings. Experiments performed in a real environment are reported using an intense nuclear source.

  13. Detection of Nuclear Sources by UAV Teleoperation Using a Visuo-Haptic Augmented Reality Interface.

    Science.gov (United States)

    Aleotti, Jacopo; Micconi, Giorgio; Caselli, Stefano; Benassi, Giacomo; Zambelli, Nicola; Bettelli, Manuele; Zappettini, Andrea

    2017-09-29

    A visuo-haptic augmented reality (VHAR) interface is presented enabling an operator to teleoperate an unmanned aerial vehicle (UAV) equipped with a custom CdZnTe-based spectroscopic gamma-ray detector in outdoor environments. The task is to localize nuclear radiation sources, whose location is unknown to the user, without the close exposure of the operator. The developed detector also enables identification of the localized nuclear sources. The aim of the VHAR interface is to increase the situation awareness of the operator. The user teleoperates the UAV using a 3DOF haptic device that provides an attractive force feedback around the location of the most intense detected radiation source. Moreover, a fixed camera on the ground observes the environment where the UAV is flying. A 3D augmented reality scene is displayed on a computer screen accessible to the operator. Multiple types of graphical overlays are shown, including sensor data acquired by the nuclear radiation detector, a virtual cursor that tracks the UAV and geographical information, such as buildings. Experiments performed in a real environment are reported using an intense nuclear source.

  14. Magnetoencephalographic accuracy profiles for the detection of auditory pathway sources.

    Science.gov (United States)

    Bauer, Martin; Trahms, Lutz; Sander, Tilmann

    2015-04-01

    The detection limits for cortical and brain stem sources associated with the auditory pathway are examined in order to analyse brain responses at the limits of the audible frequency range. The results obtained from this study are also relevant to other issues of auditory brain research. A complementary approach consisting of recordings of magnetoencephalographic (MEG) data and simulations of magnetic field distributions is presented in this work. A biomagnetic phantom consisting of a spherical volume filled with a saline solution and four current dipoles is built. The magnetic fields outside of the phantom generated by the current dipoles are then measured for a range of applied electric dipole moments with a planar multichannel SQUID magnetometer device and a helmet MEG gradiometer device. The inclusion of a magnetometer system is expected to be more sensitive to brain stem sources compared with a gradiometer system. The same electrical and geometrical configuration is simulated in a forward calculation. From both the measured and the simulated data, the dipole positions are estimated using an inverse calculation. Results are obtained for the reconstruction accuracy as a function of applied electric dipole moment and depth of the current dipole. We found that both systems can localize cortical and subcortical sources at physiological dipole strength even for brain stem sources. Further, we found that a planar magnetometer system is more suitable if the position of the brain source can be restricted in a limited region of the brain. If this is not the case, a helmet-shaped sensor system offers more accurate source estimation.

  15. Stochastic Industrial Source Detection Using Lower Cost Methods

    Science.gov (United States)

    Thoma, E.; George, I. J.; Brantley, H.; Deshmukh, P.; Cansler, J.; Tang, W.

    2017-12-01

    Hazardous air pollutants (HAPs) can be emitted from a variety of sources in industrial facilities, energy production, and commercial operations. Stochastic industrial sources (SISs) represent a subcategory of emissions from fugitive leaks, variable area sources, malfunctioning processes, and improperly controlled operations. From the shared perspective of industries and communities, cost-effective detection of mitigable SIS emissions can yield benefits such as safer working environments, cost saving through reduced product loss, lower air shed pollutant impacts, and improved transparency and community relations. Methods for SIS detection can be categorized by their spatial regime of operation, ranging from component-level inspection to high-sensitivity kilometer scale surveys. Methods can be temporally intensive (providing snap-shot measures) or sustained in both time-integrated and continuous forms. Each method category has demonstrated utility, however, broad adoption (or routine use) has thus far been limited by cost and implementation viability. Described here are a subset of SIS methods explored by the U.S EPA's next generation emission measurement (NGEM) program that focus on lower cost methods and models. An emerging systems approach that combines multiple forms to help compensate for reduced performance factors of lower cost systems is discussed. A case study of a multi-day HAP emission event observed by a combination of low cost sensors, open-path spectroscopy, and passive samplers is detailed. Early field results of a novel field gas chromatograph coupled with a fast HAP concentration sensor is described. Progress toward near real-time inverse source triangulation assisted by pre-modeled facility profiles using the Los Alamos Quick Urban & Industrial Complex (QUIC) model is discussed.

  16. Detection, Source Location, and Analysis of Volcano Infrasound

    Science.gov (United States)

    McKee, Kathleen F.

    The study of volcano infrasound focuses on low frequency sound from volcanoes, how volcanic processes produce it, and the path it travels from the source to our receivers. In this dissertation we focus on detecting, locating, and analyzing infrasound from a number of different volcanoes using a variety of analysis techniques. These works will help inform future volcano monitoring using infrasound with respect to infrasonic source location, signal characterization, volatile flux estimation, and back-azimuth to source determination. Source location is an important component of the study of volcano infrasound and in its application to volcano monitoring. Semblance is a forward grid search technique and common source location method in infrasound studies as well as seismology. We evaluated the effectiveness of semblance in the presence of significant topographic features for explosions of Sakurajima Volcano, Japan, while taking into account temperature and wind variations. We show that topographic obstacles at Sakurajima cause a semblance source location offset of 360-420 m to the northeast of the actual source location. In addition, we found despite the consistent offset in source location semblance can still be a useful tool for determining periods of volcanic activity. Infrasonic signal characterization follows signal detection and source location in volcano monitoring in that it informs us of the type of volcanic activity detected. In large volcanic eruptions the lowermost portion of the eruption column is momentum-driven and termed the volcanic jet or gas-thrust zone. This turbulent fluid-flow perturbs the atmosphere and produces a sound similar to that of jet and rocket engines, known as jet noise. We deployed an array of infrasound sensors near an accessible, less hazardous, fumarolic jet at Aso Volcano, Japan as an analogue to large, violent volcanic eruption jets. We recorded volcanic jet noise at 57.6° from vertical, a recording angle not normally feasible

  17. Detecting analogical resemblance without retrieving the source analogy.

    Science.gov (United States)

    Kostic, Bogdan; Cleary, Anne M; Severin, Kaye; Miller, Samuel W

    2010-06-01

    We examined whether people can detect analogical resemblance to an earlier experimental episode without being able to recall the experimental source of the analogical resemblance. We used four-word analogies (e.g., robin-nest/beaver-dam), in a variation of the recognition-without-cued-recall method (Cleary, 2004). Participants studied word pairs (e.g., robin-nest) and were shown new word pairs at test, half of which analogically related to studied word pairs (e.g., beaver-dam) and half of which did not. For each test pair, participants first attempted to recall an analogically similar pair from the study list. Then, regardless of whether successful recall occurred, participants were prompted to rate the familiarity of the test pair, which was said to indicate the likelihood that a pair that was analogically similar to the test pair had been studied. Across three experiments, participants demonstrated an ability to detect analogical resemblance without recalling the source analogy. Findings are discussed in terms of their potential relevance to the study of analogical reasoning and insight, as well as to the study of familiarity and recognition memory.

  18. Detection of aeroacoustic sound sources on aircraft and wind turbines

    International Nuclear Information System (INIS)

    Oerlemans, S.

    2009-01-01

    This thesis deals with the detection of aeroacoustic sound sources on aircraft and wind turbines using phased microphone arrays. First, the reliability of the array technique is assessed using airframe noise measurements in open and closed wind tunnels. It is demonstrated that quantitative acoustic measurements are possible in both wind tunnels. Then, the array technique is applied to characterize the noise sources on two modern large wind turbines. It is shown that practically all noise emitted to the ground is produced by the outer part of the blades during their downward movement. This asymmetric source pattern, which causes the typical swishing noise during the passage of the blades, can be explained by trailing edge noise directivity and convective amplification. Next, a semi-empirical prediction method is developed for the noise from large wind turbines. The prediction code is successfully validated against the experimental results, not only with regard to sound levels, spectra, and directivity, but also with regard to the noise source distribution in the rotor plane and the temporal variation in sound level (swish). The validated prediction method is then applied to calculate wind turbine noise footprints, which show that large swish amplitudes can occur even at large distance. The influence of airfoil shape on blade noise is investigated through acoustic wind tunnel tests on a series of wind turbine airfoils. Measurements are carried out at various wind speeds and angles of attack, with and without upstream turbulence and boundary layer tripping. The speed dependence, directivity, and tonal behaviour are determined for both trailing edge noise and inflow turbulence noise. Finally, two noise reduction concepts are tested on a large wind turbine: acoustically optimized airfoils and trailing edge serrations. Both blade modifications yield a significant trailing edge noise reduction at low frequencies, but also cause increased tip noise at high frequencies

  19. Neutron activation analysis detection limits using 252Cf sources

    International Nuclear Information System (INIS)

    DiPrete, D.P.; Sigg, R.A.

    2000-01-01

    The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes

  20. Monitoring Agent for Detecting Malicious Packet Drops for Wireless Sensor Networks in the Microgrid and Grid-Enabled Vehicles

    Directory of Open Access Journals (Sweden)

    Jongbin Ko

    2012-05-01

    Full Text Available Of the range of wireless communication technologies, wireless sensor networks (WSN will be one of the most appropriate technologies for the Microgrid and Grid-enabled Vehicles in the Smartgrid. To ensure the security of WSN, the detection of attacks is more efficient than their prevention because of the lack of computing power. Malicious packet drops are the easiest means of attacking WSNs. Thus, the sensors used for constructing a WSN require a packet drop monitoring agent, such as Watchdog. However, Watchdog has a partial drop problem such that an attacker can manipulate the packet dropping rate below the minimum misbehaviour monitoring threshold. Furthermore, Watchdog does not consider real traffic situations, such as congestion and collision, and so it has no way of recognizing whether a packet drop is due to a real attack or network congestion. In this paper, we propose a malicious packet drop monitoring agent, which considers traffic conditions. We used the actual traffic volume on neighbouring nodes and the drop rate while monitoring a sending node for specific period. It is more effective in real network scenarios because unlike Watchdog it considers the actual traffic, which only uses the Pathrater. Moreover, our proposed method does not require authentication, packet encryption or detection packets. Thus, there is a lower likelihood of detection failure due to packet spoofing, Man-In-the Middle attacks or Wormhole attacks. To test the suitability of our proposed concept for a series of network scenarios, we divided the simulations into three types: one attack node, more than one attack nodes and no attack nodes. The results of the simulations meet our expectations.

  1. Detection of extended galactic sources with an underwater neutrino telescope

    International Nuclear Information System (INIS)

    Leisos, A.; Tsirigotis, A. G.; Tzamarias, S. E.; Lenis, D.

    2014-01-01

    In this study we investigate the discovery capability of a Very Large Volume Neutrino Telescope to Galactic extended sources. We focus on the brightest HESS gamma rays sources which are considered also as very high energy neutrino emitters. We use the unbinned method taking into account both the spatial and the energy distribution of high energy neutrinos and we investigate parts of the Galactic plane where nearby potential neutrino emitters form neutrino source clusters. Neutrino source clusters as well as isolated neutrino sources are combined to estimate the observation period for 5 sigma discovery of neutrino signals from these objects

  2. New oil condition monitoring system, Wearsens® enables continuous, online detection of critical operating conditions and wear damage

    Directory of Open Access Journals (Sweden)

    Manfred Mauntz

    2015-12-01

    Full Text Available A new oil sensor system is presented for the continuous, online measurement of the wear in turbines, industrial gears, generators, hydraulic systems and transformers. Detection of change is much earlier than existing technologies such as particle counting, vibration measurement or recording temperature. Thus targeted, corrective procedures and/or maintenance can be carried out before actual damage occurs. Efficient machine utilization, accurately timed preventive maintenance, increased service life and a reduction of downtime can all be achieved. The presented sensor system effectively controls the proper operation conditions of bearings and cogwheels in gears. The online diagnostics system measures components of the specific complex impedance of oils. For instance, metal abrasion due to wear debris, broken oil molecules, forming acids or oil soaps, result in an increase of the electrical conductivity, which directly correlates with the degree of contamination of the oil. For additivated lubricants, the stage of degradation of the additives can also be derived from changes in the dielectric constant. The determination of impurities or reduction in the quality of the oil and the quasi continuous evaluation of wear and chemical aging follow the holistic approach of a real-time monitoring of an alteration in the condition of the oil-machine system. Once the oil condition monitoring sensors are installed on the wind turbine, industrial gearbox and test stands, the measuring data can be displayed and evaluated elsewhere. The signals are transmitted to a web-based condition monitoring system via LAN, WLAN or serial interfaces of the sensor unit. Monitoring of the damage mechanisms during proper operation below the tolerance limits of the components enables specific preventive maintenance independent of rigid inspection intervals.

  3. Detection of Nuclear Sources by UAV Teleoperation Using a Visuo-Haptic Augmented Reality Interface

    OpenAIRE

    Jacopo Aleotti; Giorgio Micconi; Stefano Caselli; Giacomo Benassi; Nicola Zambelli; Manuele Bettelli; Andrea Zappettini

    2017-01-01

    A visuo-haptic augmented reality (VHAR) interface is presented enabling an operator to teleoperate an unmanned aerial vehicle (UAV) equipped with a custom CdZnTe-based spectroscopic gamma-ray detector in outdoor environments. The task is to localize nuclear radiation sources, whose location is unknown to the user, without the close exposure of the operator. The developed detector also enables identification of the localized nuclear sources. The aim of the VHAR interface is to increase the sit...

  4. 1H-detected MAS solid-state NMR experiments enable the simultaneous mapping of rigid and dynamic domains of membrane proteins

    Science.gov (United States)

    Gopinath, T.; Nelson, Sarah E. D.; Veglia, Gianluigi

    2017-12-01

    Magic angle spinning (MAS) solid-state NMR (ssNMR) spectroscopy is emerging as a unique method for the atomic resolution structure determination of native membrane proteins in lipid bilayers. Although 13C-detected ssNMR experiments continue to play a major role, recent technological developments have made it possible to carry out 1H-detected experiments, boosting both sensitivity and resolution. Here, we describe a new set of 1H-detected hybrid pulse sequences that combine through-bond and through-space correlation elements into single experiments, enabling the simultaneous detection of rigid and dynamic domains of membrane proteins. As proof-of-principle, we applied these new pulse sequences to the membrane protein phospholamban (PLN) reconstituted in lipid bilayers under moderate MAS conditions. The cross-polarization (CP) based elements enabled the detection of the relatively immobile residues of PLN in the transmembrane domain using through-space correlations; whereas the most dynamic region, which is in equilibrium between folded and unfolded states, was mapped by through-bond INEPT-based elements. These new 1H-detected experiments will enable one to detect not only the most populated (ground) states of biomacromolecules, but also sparsely populated high-energy (excited) states for a complete characterization of protein free energy landscapes.

  5. Pt Electrodes Enable the Formation of μ4-O Centers in MOF-5 from Multiple Oxygen Sources.

    Science.gov (United States)

    Li, Minyuan M; Dincă, Mircea

    2017-10-04

    The μ 4 -O 2- ions in the Zn 4 O(O 2 C-) 6 secondary building units of Zn 4 O(1,4-benzenedicarboxylate) 3 (MOF-5) electrodeposited under cathodic bias can be sourced from nitrate, water, and molecular oxygen when using platinum gauze as working electrodes. The use of Zn(ClO 4 ) 2 ·6H 2 O, anhydrous Zn(NO 3 ) 2 , or anhydrous Zn(CF 3 SO 3 ) 2 as Zn 2+ sources under rigorous control of other sources of oxygen, including water and O 2 , confirm that the source of the μ 4 -O 2- ions can be promiscuous. Although this finding reveals a relatively complicated manifold of electrochemical processes responsible for the crystallization of MOF-5 under cathodic bias, it further highlights the importance of hydroxide intermediates in the formation of the Zn 4 O(O 2 C-R) secondary building units in this iconic material and is illustrative of the complicated crystallization mechanisms of metal-organic frameworks in general.

  6. moocRP: Enabling Open Learning Analytics with an Open Source Platform for Data Distribution, Analysis, and Visualization

    Science.gov (United States)

    Pardos, Zachary A.; Whyte, Anthony; Kao, Kevin

    2016-01-01

    In this paper, we address issues of transparency, modularity, and privacy with the introduction of an open source, web-based data repository and analysis tool tailored to the Massive Open Online Course community. The tool integrates data request/authorization and distribution workflow features as well as provides a simple analytics module upload…

  7. Using Stable Isotopes to Detect Land Use Change and Nitrogen Sources in Aquatic Systems

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, K. M. [National Isotope Center, GNS Science, Lower Hutt (New Zealand)

    2013-05-15

    Changing land use is one of the primary causes of increased sedimentation and nutrient levels in aquatic systems, resulting in contamination and reduction of biodiversity. Detecting and quantifying these inputs is the first step towards remediation, and enabling targeted reductions of transport processes into waterways from human impacted land surfaces. More recently, stable isotope analyses are being used as detection and quantification tools in aquatic environments. Carbon ({delta}{sup 13}C) and nitrogen ({delta}{sup 15}N) isotopes of sediments, as well as algae and invertebrates from aquatic systems can be used as proxies to record both short and long term environmental change. Excess nitrogen (or nitrogen-compounds) derived from urbanization, industry, forestry, farming and agriculture, increase the bioavailability of nitrogen to aquatic organisms, changing their natural {delta}15N isotopic signatures. Allochthonous (terrestrial) input from soil destabilization and human activity in surrounding catchments changes {delta}{sup 13}C isotopic compositions and increases the C:N ratio of sediments. Heavy metal and other organic pollutants can also be used to indicate urbanization and industrial contamination. The combined use of carbon and nitrogen isotopes, C:N ratios and heavy metals are powerful environmental monitoring tools, which are useful indicators of source and transport pathways of terrestrial derived material and anthropogenic pollutants into streams, rivers and estuaries. (author)

  8. Tunable optical frequency comb enabled scalable and cost-effective multiuser orthogonal frequency-division multiple access passive optical network with source-free optical network units.

    Science.gov (United States)

    Chen, Chen; Zhang, Chongfu; Liu, Deming; Qiu, Kun; Liu, Shuang

    2012-10-01

    We propose and experimentally demonstrate a multiuser orthogonal frequency-division multiple access passive optical network (OFDMA-PON) with source-free optical network units (ONUs), enabled by tunable optical frequency comb generation technology. By cascading a phase modulator (PM) and an intensity modulator and dynamically controlling the peak-to-peak voltage of a PM driven signal, a tunable optical frequency comb source can be generated. It is utilized to assist the configuration of a multiple source-free ONUs enhanced OFDMA-PON where simultaneous and interference-free multiuser upstream transmission over a single wavelength can be efficiently supported. The proposed multiuser OFDMA-PON is scalable and cost effective, and its feasibility is successfully verified by experiment.

  9. Laurentide Ice-Sheet Meltwater Sources to the Gulf of Mexico During the Last Deglaciation: Assessing Data Reconstructions Using Water Isotope Enabled Simulations

    Science.gov (United States)

    Vetter, L.; LeGrande, A. N.; Ullman, D. J.; Carlson, A. E.

    2017-12-01

    Sediment cores from the Gulf of Mexico show evidence of meltwater derived from the Laurentide Ice Sheet during the last deglaciation. Recent studies using geochemical measurements of individual foraminifera suggest changes in the oxygen isotopic composition of the meltwater as deglaciation proceeded. Here we use the water isotope enabled climate model simulations (NASA GISS ModelE-R) to investigate potential sources of meltwater within the ice sheet. We find that initial melting of the ice sheet from the southern margin contributed an oxygen isotope value reflecting a low-elevation, local precipitation source. As deglacial melting proceeded, meltwater delivered to the Gulf of Mexico had a more negative oxygen isotopic value, which the climate model simulates as being sourced from the high-elevation, high-latitude interior of the ice sheet. This study demonstrates the utility of combining stable isotope analyses with climate model simulations to investigate past changes in the hydrologic cycle.

  10. Key enzymes enabling the growth of Arthrobacter sp. strain JBH1 with nitroglycerin as the sole source of carbon and nitrogen.

    Science.gov (United States)

    Husserl, Johana; Hughes, Joseph B; Spain, Jim C

    2012-05-01

    Flavoprotein reductases that catalyze the transformation of nitroglycerin (NG) to dinitro- or mononitroglycerols enable bacteria containing such enzymes to use NG as the nitrogen source. The inability to use the resulting mononitroglycerols limits most strains to incomplete denitration of NG. Recently, Arthrobacter strain JBH1 was isolated for the ability to grow on NG as the sole source of carbon and nitrogen, but the enzymes and mechanisms involved were not established. Here, the enzymes that enable the Arthrobacter strain to incorporate NG into a productive pathway were identified. Enzyme assays indicated that the transformation of nitroglycerin to mononitroglycerol is NADPH dependent and that the subsequent transformation of mononitroglycerol is ATP dependent. Cloning and heterologous expression revealed that a flavoprotein catalyzes selective denitration of NG to 1-mononitroglycerol (1-MNG) and that 1-MNG is transformed to 1-nitro-3-phosphoglycerol by a glycerol kinase homolog. Phosphorylation of the nitroester intermediate enables the subsequent denitration of 1-MNG in a productive pathway that supports the growth of the isolate and mineralization of NG.

  11. Detecting the leakage source of a reservoir using isotopes.

    Science.gov (United States)

    Yi, Peng; Yang, Jing; Wang, Yongdong; Mugwanezal, Vincent de Paul; Chen, Li; Aldahan, Ala

    2018-07-01

    A good monitoring method is vital for understanding the sources of a water reservoir leakage and planning for effective restoring. Here we present a combination of several tracers ( 222 Rn, oxygen and hydrogen isotopes, anions and temperature) for identification of water leakage sources in the Pushihe pumped storage power station which is in the Liaoning province, China. The results show an average 222 Rn activity of 6843 Bq/m 3 in the leakage water, 3034 Bq/m 3 in the reservoir water, and 41,759 Bq/m 3 in the groundwater. Considering that 222 Rn activity in surface water is typically less than 5000 Bq/m 3 , the low level average 222 Rn activity in the leakage water suggests the reservoir water as the main source of water. Results of the oxygen and hydrogen isotopes show comparable ranges and values in the reservoir and the leakage water samples. However, important contribution of the groundwater (up to 36%) was present in some samples from the bottom and upper parts of the underground powerhouse, while the leakage water from some other parts indicate the reservoir water as the dominant source. The isotopic finding suggests that the reservoir water is the main source of the leakage water which is confirmed by the analysis of anions (nitrate, sulfate, and chloride) in the water samples. The combination of these tracer methods for studying dam water leakage improves the accuracy of identifying the source of leaks and provide a scientific reference for engineering solutions to ensure the dam safety. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Real breakthrough in detection of radioactive sources by portal monitors with plastic detectors and New Advanced Source Identification Algorithm (ASIA-New)

    Energy Technology Data Exchange (ETDEWEB)

    Stavrov, Andrei; Yamamoto, Eugene [Rapiscan Systems, Inc., 14000 Mead Street, Longmont, CO, 80504 (United States)

    2015-07-01

    Radiation Portal Monitors (RPM) with plastic detectors represent the main instruments used for primary border (customs) radiation control. RPM are widely used because they are simple, reliable, relatively inexpensive and have a high sensitivity. However, experience using the RPM in various countries has revealed the systems have some grave shortcomings. There is a dramatic decrease of the probability of detection of radioactive sources under high suppression of the natural gamma background (radiation control of heavy cargoes, containers and, especially, trains). NORM (Naturally Occurring Radioactive Material) existing in objects under control trigger the so-called 'nuisance alarms', requiring a secondary inspection for source verification. At a number of sites, the rate of such alarms is so high it significantly complicates the work of customs and border officers. This paper presents a brief description of new variant of algorithm ASIA-New (New Advanced Source Identification Algorithm), which was developed by the Rapiscan company. It also demonstrates results of different tests and the capability of a new system to overcome the shortcomings stated above. New electronics and ASIA-New enables RPM to detect radioactive sources under a high background suppression (tested at 15-30%) and to verify the detected NORM (KCl) and the artificial isotopes (Co- 57, Ba-133 and other). New variant of ASIA is based on physical principles, a phenomenological approach and analysis of some important parameter changes during the vehicle passage through the monitor control area. Thanks to this capability main advantage of new system is that this system can be easily installed into any RPM with plastic detectors. Taking into account that more than 4000 RPM has been installed worldwide their upgrading by ASIA-New may significantly increase probability of detection and verification of radioactive sources even masked by NORM. This algorithm was tested for 1,395 passages of

  13. Detecting New Pedestrian Facilities from VGI Data Sources

    Science.gov (United States)

    Zhong, S.; Xie, Z.

    2017-12-01

    Pedestrian facility (e.g. footbridge, pedestrian crossing and underground passage) information is an important basic data of location based service (LBS) for pedestrians. However, timely updating pedestrian facility information challenges due to facilities change frequently. Previous pedestrian facility information collecting and updating tasks are mainly completed by highly trained specialized persons. However, this conventional approach has several disadvantages such as high cost, long update cycle and so on. Volunteered Geographic Information (VGI) has proven efficiency to provide new, free and fast growing spatial data. Pedestrian trajectory, which can be seen as measurements of real pedestrian road, is one of the most valuable information of VGI data. Although the accuracy of the trajectories is not too high, due to the large number of measurements, an improvement of quality of the road information can be achieved. Thus, we develop a method for detecting new pedestrian facilities based on the current road network and pedestrian trajectories. Specifically, 1) by analyzing speed, distance and direction, those outliers of pedestrian trajectories are removed, 2) a road network matching algorithm is developed for eliminating redundant trajectories, and 3) a space-time cluster algorithm is adopted for detecting new walking facilities. The performance of the method is evaluated with a series of experiments conducted on a part of the road network of Heifei and a large number of real pedestrian trajectories, and verified the results by using Tencent Street map. The results show that the proposed method is able to detecting new pedestrian facilities from VGI data accurately. We believe that the proposed method provides an alternative way for general road data acquisition, and can improve the quality of LBS for pedestrians.

  14. EEG recordings as a source for the detection of IRBD

    DEFF Research Database (Denmark)

    Bisgaard, Sissel; Duun-Christensen, Bolette; Kempfner, Lykke

    2015-01-01

    The purpose of this pilot study was to develop a supportive algorithm for the detection of idiopathic Rapid Eye-Movement (REM) sleep Behaviour Disorder (iRBD) from EEG recordings. iRBD is defined as REM sleep without atonia with no current sign of neurodegenerative disease, and is one...... of the earliest known biomarkers of Parkinson's Disease (PD). It is currently diagnosed by polysomnography (PSG), primarily based on EMG recordings during REM sleep. The algorithm was developed using data collected from 42 control subjects and 34 iRBD subjects. A feature was developed to represent high amplitude...

  15. eSensor: an electrochemical detection-based DNA microarray technology enabling sample-to-answer molecular diagnostics

    Science.gov (United States)

    Liu, Robin H.; Longiaru, Mathew

    2009-05-01

    DNA microarrays are becoming a widespread tool used in life science and drug screening due to its many benefits of miniaturization and integration. Microarrays permit a highly multiplexed DNA analysis. Recently, the development of new detection methods and simplified methodologies has rapidly expanded the use of microarray technologies from predominantly gene expression analysis into the arena of diagnostics. Osmetech's eSensor® is an electrochemical detection platform based on a low-to- medium density DNA hybridization array on a cost-effective printed circuit board substrate. eSensor® has been cleared by FDA for Warfarin sensitivity test and Cystic Fibrosis Carrier Detection. Other genetic-based diagnostic and infectious disease detection tests are under development. The eSensor® platform eliminates the need for an expensive laser-based optical system and fluorescent reagents. It allows one to perform hybridization and detection in a single and small instrument without any fluidic processing and handling. Furthermore, the eSensor® platform is readily adaptable to on-chip sample-to-answer genetic analyses using microfluidics technology. The eSensor® platform provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus have a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

  16. Database Organisation in a Web-Enabled Free and Open-Source Software (foss) Environment for Spatio-Temporal Landslide Modelling

    Science.gov (United States)

    Das, I.; Oberai, K.; Sarathi Roy, P.

    2012-07-01

    Landslides exhibit themselves in different mass movement processes and are considered among the most complex natural hazards occurring on the earth surface. Making landslide database available online via WWW (World Wide Web) promotes the spreading and reaching out of the landslide information to all the stakeholders. The aim of this research is to present a comprehensive database for generating landslide hazard scenario with the help of available historic records of landslides and geo-environmental factors and make them available over the Web using geospatial Free & Open Source Software (FOSS). FOSS reduces the cost of the project drastically as proprietary software's are very costly. Landslide data generated for the period 1982 to 2009 were compiled along the national highway road corridor in Indian Himalayas. All the geo-environmental datasets along with the landslide susceptibility map were served through WEBGIS client interface. Open source University of Minnesota (UMN) mapserver was used as GIS server software for developing web enabled landslide geospatial database. PHP/Mapscript server-side application serve as a front-end application and PostgreSQL with PostGIS extension serve as a backend application for the web enabled landslide spatio-temporal databases. This dynamic virtual visualization process through a web platform brings an insight into the understanding of the landslides and the resulting damage closer to the affected people and user community. The landslide susceptibility dataset is also made available as an Open Geospatial Consortium (OGC) Web Feature Service (WFS) which can be accessed through any OGC compliant open source or proprietary GIS Software.

  17. Application of Emerging Open-source Embedded Systems for Enabling Low-cost Wireless Mini-observatory Nodes in the Coastal Zone

    Science.gov (United States)

    Glazer, B. T.

    2016-02-01

    Here, we describe the development of novel, low-cost, open-source instrumentation to enable wireless data transfer of biogeochemical sensors in the coastal zone. The platform is centered upon the Beaglebone Black single board computer. Process-inquiry in environmental sciences suffers from undersampling; enabling sustained and unattended data collection typically involves expensive instrumentation and infrastructure deployed as cabled observatories with little flexibility in deployment location following initial installation. High cost of commercially-available or custom electronic packages have not only limited the number of sensor node sites that can be targeted by reasonably well-funded academic researchers, but have also entirely prohibited widespread engagement with K-12, public non-profit, and `citizen scientist' STEM audiences. The new platform under development represents a balanced blend of research-grade sensors and low-cost open-source electronics that are easily assembled. Custom, robust, open-source code that remains customizable for specific node configurations can match a specific deployment's measurement needs, depending on the scientific research priorities. We have demonstrated prototype capabilities and versatility through lab testing and field deployments of multiple sensor nodes with multiple sensor inputs, all of which are streaming near-real-time data over wireless RF links to a shore-based base station. On shore, first-pass data processing QA/QC takes place and near-real-time plots are made available on the World Wide Web. Specifically, we have worked closely with an environmental and cultural management and restoration non-profit organization, and middle and high school science classes, engaging their interest in STEM application to local watershed processes. Ultimately, continued successful development of this pilot project can lead to a coastal oceanographic analogue of the popular Weather Underground personal weather station model.

  18. Sensor-enabled chem/bio contamination detection system dedicated to situational awareness of water distribution security status

    Science.gov (United States)

    Ginsberg, Mark D.; Smith, Eddy D.; VanBlaricum, Vicki; Hock, Vincent F.; Kroll, Dan; Russell, Kevin J.

    2010-04-01

    Both real events and models have proven that drinking water systems are vulnerable to deliberate and/or accidental contamination. Additionally, homeland security initiatives and modeling efforts have determined that it is relatively easy to orchestrate the contamination of potable water supplies. Such contamination can be accomplished with classic and non-traditional chemical agents, toxic industrial chemicals (TICs), and/or toxic industrial materials (TIMs). Subsequent research and testing has developed a proven network for detection and response to these threats. The method uses offthe- shelf, broad-spectrum analytical instruments coupled with advanced interpretive algorithms. The system detects and characterizes any backflow events involving toxic contaminants by employing unique chemical signature (fingerprint) response data. This instrumentation has been certified by the Office of Homeland Security for detecting deliberate and/or accidental contamination of critical water infrastructure. The system involves integration of several mature technologies (sensors, SCADA, dynamic models, and the HACH HST Guardian Blue instrumentation) into a complete, real-time, management system that also can be used to address other water distribution concerns, such as corrosion. This paper summarizes the reasons and results for installing such a distribution-based detection and protection system.

  19. An information technology enabled sustainability test-bed (ITEST) for occupancy detection through an environmental sensing network

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Bing; Lam, Khee Poh; Zhang, Rui; Chiou, Yun-Shang [Center for Building Performance and Diagnostics, Carnegie Mellon University, Pittsburgh, PA 15213 (United States); Andrews, Burton; Hoeynck, Michael; Benitez, Diego [Research and Technology Center, Robert BOSCH LLC, Pittsburgh, PA 15212 (United States)

    2010-07-15

    This paper describes a large-scale wireless and wired environmental sensor network test-bed and its application to occupancy detection in an open-plan office building. Detection of occupant presence has been used extensively in built environments for applications such as demand-controlled ventilation and security; however, the ability to discern the actual number of people in a room is beyond the scope of current sensing techniques. To address this problem, a complex sensor network is deployed in the Robert L. Preger Intelligent Workplace comprising a wireless ambient-sensing system, a wired carbon dioxide sensing system, and a wired indoor air quality sensing system. A wired camera network is implemented as well for establishing true occupancy levels to be used as ground truth information for deriving algorithmic relationships with the environment conditions. To our knowledge, this extensive and diverse ambient-sensing infrastructure of the ITEST setup as well as the continuous data-collection capability is unprecedented. Final results indicate that there are significant correlations between measured environmental conditions and occupancy status. An average of 73% accuracy on the occupancy number detection was achieved by Hidden Markov Models during testing periods. This paper serves as an exploration to the research of ITEST for occupancy detection in offices. In addition, its utility extends to a wide variety of other building technology research areas such as human-centered environmental control, security, energy efficient and sustainable green buildings. (author)

  20. Design of a Modular DNA Triangular-Prism Sensor Enabling Ratiometric and Multiplexed Biomolecule Detection on a Single Microbead.

    Science.gov (United States)

    Liu, Yu; Chen, Qiaoshu; Liu, Jianbo; Yang, Xiaohai; Guo, Qiuping; Li, Li; Liu, Wei; Wang, Kemin

    2017-03-21

    DNA nanostructures have emerged as powerful and versatile building blocks for the construction of programmable nanoscale structures and functional sensors for biomarker detection, disease diagnostics, and therapy. Here we integrated multiple sensing modules into a single DNA three-dimensional (3D) nanoarchitecture with a triangular-prism (TP) structure for ratiometric and multiplexed biomolecule detection on a single microbead. In our design, the complementary hybridization of three clip sequences formed TP nanoassemblies in which the six single-strand regions in the top and bottom faces act as binding sites for different sensing modules, including an anchor module, reference sequence module, and capture sequence module. The multifunctional modular TP nanostructures were thus exploited for ratiometric and multiplexed biomolecule detection on microbeads. Microbead imaging demonstrated that, after ratiometric self-calibration analysis, the imaging deviations resulting from uneven fluorescence intensity distribution and differing probe concentrations were greatly reduced. The rigid nanostructure also conferred the TP as a framework for geometric positioning of different capture sequences. The inclusion of multiple targets led to the formation of sandwich hybridization structures that gave a readily detectable optical response at different fluorescence channels and distinct fingerprint-like pattern arrays. This approach allowed us to discriminate multiplexed biomolecule targets in a simple and efficient fashion. In this module-designed strategy, the diversity of the controlled DNA assembly coupled with the geometrically well-defined rigid nanostructures of the TP assembly provides a flexible and reliable biosensing approach that shows great promise for biomedical applications.

  1. A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel.

    Science.gov (United States)

    Huang, Ling; Deng, Xiaohui; Li, Ronghua; Xia, Yanshi; Bai, Guihua; Siddique, Kadambot H M; Guo, Peiguo

    2018-04-20

    Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver staining is a widely used method for the detection of SSR markers in a polyacrylamide gel. However, conventional protocols for silver staining are technically demanding and time-consuming. Like many other biological laboratory techniques, silver staining protocols have been steadily optimized to improve detection efficiency. Here, we report a simplified silver staining method that significantly reduces reagent costs and enhances the detection resolution and picture clarity. The new method requires two major steps (impregnation and development) and three reagents (silver nitrate, sodium hydroxide, and formaldehyde), and only 7 min of processing for a non-denaturing polyacrylamide gel. Compared to previously reported protocols, this new method is easier, quicker and uses fewer chemical reagents for SSR detection. Therefore, this simple, low-cost, and effective silver staining protocol will benefit genetic mapping and marker-assisted breeding by a quick generation of SSR marker data.

  2. The AMERE project: Enabling real-time detection of radiation effects in individual cells in deep space

    Science.gov (United States)

    De Vos, Winnok H.; Meesen, Geert; Szpirer, Cedric; Scohy, Sophie; Cherukuri, Chaitanya; Evrard, Olivier; Hutsebaut, Xavier; Beghuin, Didier

    2012-12-01

    A major concern for long-term deep space missions is the detrimental impact of cosmic radiation on human health. Especially the presence of high-energy particles of high atomic mass (HZE) represents a serious threat. To contribute to a fundamental understanding of space radiation effects and to help improving risk assessment for humans on the Moon, the ESA Lunar Lander mission model payload includes a package dedicated to cell-based radiobiology experiments in the form of an Autonomous Microscope for Examination of Radiation Effects (AMERE). The purpose of this setup is to enable real-time visualization of DNA damage repair in living cells after traversal of HZE particles on the Moon. To assess the feasibility of this challenging experiment, we have analysed the biological and technological demands. In this article, we discuss the experimental concept, the biological considerations and describe the implications for system design.

  3. Assessment of an Onboard EO Sensor to Enable Detect-and-Sense Capability for UAVs Operating in a Cluttered Environment

    Science.gov (United States)

    2017-09-01

    rates of accidents. To ensure safe operation in such complex environment , the unmanned systems have to perform accurate and timely detection and...security. C. PROBLEM FORMULATION To ensure the safe operation of unmanned systems in modern complex environment , this thesis strives to answer two...computer vision algorithm work in a complex operating environment with multiple moving objects? This thesis examines the integration of the CV

  4. A New Paradigm of Technology-Enabled ‘Vital Signs’ for Early Detection of Health Change for Older Adults.

    Science.gov (United States)

    Rantz, Marilyn J; Skubic, Marjorie; Popescu, Mihail; Galambos, Colleen; Koopman, Richelle J; Alexander, Gregory L; Phillips, Lorraine J; Musterman, Katy; Back, Jessica; Miller, Steven J

    2015-01-01

    Environmentally embedded (nonwearable) sensor technology is in continuous use in elder housing to monitor a new set of ‘vital signs' that continuously measure the functional status of older adults, detect potential changes in health or functional status, and alert healthcare providers for early recognition and treatment of those changes. Older adult participants' respiration, pulse, and restlessness are monitored as they sleep. Gait speed, stride length, and stride time are calculated daily, and automatically assess for increasing fall risk. Activity levels are summarized and graphically displayed for easy interpretation. Falls are detected when they occur and alerts are sent immediately to healthcare providers, so time to rescue may be reduced. Automated health alerts are sent to healthcare staff, based on continuously running algorithms applied to the sensor data, days and weeks before typical signs or symptoms are detected by the person, family members, or healthcare providers. Discovering these new functional status ‘vital signs', developing automated methods for interpreting them, and alerting others when changes occur have the potential to transform chronic illness management and facilitate aging in place through the end of life. Key findings of research in progress at the University of Missouri are discussed in this viewpoint article, as well as obstacles to widespread adoption.

  5. FPGA-based High-Performance Collision Detection: An Enabling Technique for Image-Guided Robotic Surgery

    Directory of Open Access Journals (Sweden)

    Zhaorui Zhang

    2016-08-01

    Full Text Available Collision detection, which refers to the computational problem of finding the relative placement or con-figuration of two or more objects, is an essential component of many applications in computer graphics and robotics. In image-guided robotic surgery, real-time collision detection is critical for preserving healthy anatomical structures during the surgical procedure. However, the computational complexity of the problem usually results in algorithms that operate at low speed. In this paper, we present a fast and accurate algorithm for collision detection between Oriented-Bounding-Boxes (OBBs that is suitable for real-time implementation. Our proposed Sweep and Prune algorithm can perform a preliminary filtering to reduce the number of objects that need to be tested by the classical Separating Axis Test algorithm, while the OBB pairs of interest are preserved. These OBB pairs are re-checked by the Separating Axis Test algorithm to obtain accurate overlapping status between them. To accelerate the execution, our Sweep and Prune algorithm is tailor-made for the proposed method. Meanwhile, a high performance scalable hardware architecture is proposed by analyzing the intrinsic parallelism of our algorithm, and is implemented on FPGA platform. Results show that our hardware design on the FPGA platform can achieve around 8X higher running speed than the software design on a CPU platform. As a result, the proposed algorithm can achieve a collision frame rate of 1 KHz, and fulfill the requirement for the medical surgery scenario of Robot Assisted Laparoscopy.

  6. Process Model Improvement for Source Code Plagiarism Detection in Student Programming Assignments

    Science.gov (United States)

    Kermek, Dragutin; Novak, Matija

    2016-01-01

    In programming courses there are various ways in which students attempt to cheat. The most commonly used method is copying source code from other students and making minimal changes in it, like renaming variable names. Several tools like Sherlock, JPlag and Moss have been devised to detect source code plagiarism. However, for larger student…

  7. Goaf water detection using the grounded electrical source airborne transient electromagnetic system

    Science.gov (United States)

    Li, D.; Ji, Y.; Guan, S.; Wu, Y.; Wang, A.

    2017-12-01

    To detect the geoelectric characteristic of goaf water, the grounded electrical source airborne transient electromagnetic (GREATEM) system (developed by Jilin University, China) is applied to the goaf water detection since its advantages of considerable prospecting depth, lateral resolution and detection efficiency. For the test of GREATEM system in goaf water detection, an experimental survey was conducted at Qinshui coal mine (Shanxi province, China). After data acquisition, noise reduction and inversion, the resistivity profiles of survey area is presented. The results highly agree the investigation information provided by Shanxi Coal Geology Geophysical Surveying Exploration Institute (China), conforming that the GREATEM system is an effective technique for resistivity detection of goaf water.

  8. Early warning system for detection of protozoal contamination of source waters

    DEFF Research Database (Denmark)

    Al-Sabi, Mohammad Nafi Solaiman; Mogensen, Claus; Berg, Tommy W.

    2012-01-01

    Ensuring water quality is an ever increasing important issue world-wide. Currently, detection of protozoa in drinking water is a costly and time consuming process. We have developed an online, real-time sensor for detection of Cryptosporidium and Giardia spp. in a range of source waters. The novel...

  9. A cascade amplification strategy based on rolling circle amplification and hydroxylamine amplified gold nanoparticles enables chemiluminescence detection of adenosine triphosphate.

    Science.gov (United States)

    Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping

    2014-08-07

    A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.

  10. Multifunctional Pt(II) Reagents: Covalent Modifications of Pt Complexes Enable Diverse Structural Variation and In-Cell Detection.

    Science.gov (United States)

    White, Jonathan D; Haley, Michael M; DeRose, Victoria J

    2016-01-19

    To enhance the functionality of Pt-based reagents, several strategies have been developed that utilize Pt compounds modified with small, reactive handles. This Account encapsulates work done by us and other groups regarding the use of Pt(II) compounds with reactive handles for subsequent elaboration with fluorophores or other functional moieties. Described strategies include the incorporation of substituents for well-known condensation or nucleophilic displacement-type reactions and their use, for example, to tether spectroscopic handles to Pt reagents for in vivo investigation. Other chief uses of displacement-type reactions have included tethering various small molecules exhibiting pharmacological activity directly to Pt, thus adding synergistic effects. Click chemistry-based ligation techniques have also been applied, primarily with azide- and alkyne-appended Pt complexes. Orthogonally reactive click chemistry reactions have proven invaluable when more traditional nucleophilic displacement reactions induce side-reactivity with the Pt center or when systematic functionalization of a larger number of Pt complexes is desired. Additionally, a diverse assortment of Pt-fluorophore conjugates have been tethered via click chemistry conjugation. In addition to providing a convenient synthetic path for diversifying Pt compounds, the use of click-capable Pt complexes has proved a powerful strategy for postbinding covalent modification and detection with fluorescent probes. This strategy bypasses undesirable influences of the fluorophore camouflaged as reactivity due to Pt that may be present when detecting preattached Pt-fluorophore conjugates. Using postbinding strategies, Pt reagent distributions in HeLa and lung carcinoma (NCI-H460) cell cultures were observed with two different azide-modified Pt compounds, a monofunctional Pt(II)-acridine type and a difunctional Pt(II)-neutral complex. In addition, cellular distribution was observed with an alkyne-appended difunctional

  11. Detection of Interfacial Debonding in a Rubber-Steel-Layered Structure Using Active Sensing Enabled by Embedded Piezoceramic Transducers.

    Science.gov (United States)

    Feng, Qian; Kong, Qingzhao; Jiang, Jian; Liang, Yabin; Song, Gangbing

    2017-09-01

    Rubber-steel-layered structures are used in many engineering applications. Laminated rubber-steel bearing, as a type of seismic isolation device, is one of the most important applications of the rubber-steel-layered structures. Interfacial debonding in rubber-steel-layered structures is a typical failure mode, which can severely reduce their load-bearing capacity. In this paper, the authors developed a simple but effective active sensing approach using embedded piezoceramic transducers to provide an in-situ detection of the interfacial debonding between the rubber layers and steel plates. A sandwiched rubber-steel-layered specimen, consisting of one rubber layer and two steel plates, was fabricated as the test specimen. A novel installation technique, which allows the piezoceramic transducers to be fully embedded into the steel plates without changing the geometry and the surface conditions of the plates, was also developed in this research. The active sensing approach, in which designed stress waves can propagate between a pair of the embedded piezoceramic transducers (one as an actuator and the other one as a sensor), was employed to detect the steel-rubber debonding. When the rubber-steel debonding occurs, the debonded interfaces will attenuate the propagating stress wave, so that the amplitude of the received signal will decrease. The rubber-steel debonding was generated by pulling the two steel plates in opposite directions in a material-testing machine. The changes of the received signal before and after the debonding were characterized in a time domain and further quantified by using a wavelet packet-based energy index. Experiments on the healthy rubber-steel-layered specimen reveal that the piezoceramic-induced stress wave can propagate through the rubber layer. The destructive test on the specimen demonstrates that the piezoceramic-based active sensing approach can effectively detect the rubber-steel debonding failure in real time. The active sensing

  12. BlueDetect: An iBeacon-Enabled Scheme for Accurate and Energy-Efficient Indoor-Outdoor Detection and Seamless Location-Based Service

    Directory of Open Access Journals (Sweden)

    Han Zou

    2016-02-01

    Full Text Available The location and contextual status (indoor or outdoor is fundamental and critical information for upper-layer applications, such as activity recognition and location-based services (LBS for individuals. In addition, optimizations of building management systems (BMS, such as the pre-cooling or heating process of the air-conditioning system according to the human traffic entering or exiting a building, can utilize the information, as well. The emerging mobile devices, which are equipped with various sensors, become a feasible and flexible platform to perform indoor-outdoor (IO detection. However, power-hungry sensors, such as GPS and WiFi, should be used with caution due to the constrained battery storage on mobile device. We propose BlueDetect: an accurate, fast response and energy-efficient scheme for IO detection and seamless LBS running on the mobile device based on the emerging low-power iBeacon technology. By leveraging the on-broad Bluetooth module and our proposed algorithms, BlueDetect provides a precise IO detection service that can turn on/off on-board power-hungry sensors smartly and automatically, optimize their performances and reduce the power consumption of mobile devices simultaneously. Moreover, seamless positioning and navigation services can be realized by it, especially in a semi-outdoor environment, which cannot be achieved by GPS or an indoor positioning system (IPS easily. We prototype BlueDetect on Android mobile devices and evaluate its performance comprehensively. The experimental results have validated the superiority of BlueDetect in terms of IO detection accuracy, localization accuracy and energy consumption.

  13. BlueDetect: An iBeacon-Enabled Scheme for Accurate and Energy-Efficient Indoor-Outdoor Detection and Seamless Location-Based Service.

    Science.gov (United States)

    Zou, Han; Jiang, Hao; Luo, Yiwen; Zhu, Jianjie; Lu, Xiaoxuan; Xie, Lihua

    2016-02-22

    The location and contextual status (indoor or outdoor) is fundamental and critical information for upper-layer applications, such as activity recognition and location-based services (LBS) for individuals. In addition, optimizations of building management systems (BMS), such as the pre-cooling or heating process of the air-conditioning system according to the human traffic entering or exiting a building, can utilize the information, as well. The emerging mobile devices, which are equipped with various sensors, become a feasible and flexible platform to perform indoor-outdoor (IO) detection. However, power-hungry sensors, such as GPS and WiFi, should be used with caution due to the constrained battery storage on mobile device. We propose BlueDetect: an accurate, fast response and energy-efficient scheme for IO detection and seamless LBS running on the mobile device based on the emerging low-power iBeacon technology. By leveraging the on-broad Bluetooth module and our proposed algorithms, BlueDetect provides a precise IO detection service that can turn on/off on-board power-hungry sensors smartly and automatically, optimize their performances and reduce the power consumption of mobile devices simultaneously. Moreover, seamless positioning and navigation services can be realized by it, especially in a semi-outdoor environment, which cannot be achieved by GPS or an indoor positioning system (IPS) easily. We prototype BlueDetect on Android mobile devices and evaluate its performance comprehensively. The experimental results have validated the superiority of BlueDetect in terms of IO detection accuracy, localization accuracy and energy consumption.

  14. Electrochemical noise and impedance of Au electrode/electrolyte interfaces enabling extracellular detection of glioma cell populations.

    Science.gov (United States)

    Rocha, Paulo R F; Schlett, Paul; Kintzel, Ulrike; Mailänder, Volker; Vandamme, Lode K J; Zeck, Gunther; Gomes, Henrique L; Biscarini, Fabio; de Leeuw, Dago M

    2016-10-06

    Microelectrode arrays (MEA) record extracellular local field potentials of cells adhered to the electrodes. A disadvantage is the limited signal-to-noise ratio. The state-of-the-art background noise level is about 10 μVpp. Furthermore, in MEAs low frequency events are filtered out. Here, we quantitatively analyze Au electrode/electrolyte interfaces with impedance spectroscopy and noise measurements. The equivalent circuit is the charge transfer resistance in parallel with a constant phase element that describes the double layer capacitance, in series with a spreading resistance. This equivalent circuit leads to a Maxwell-Wagner relaxation frequency, the value of which is determined as a function of electrode area and molarity of an aqueous KCl electrolyte solution. The electrochemical voltage and current noise is measured as a function of electrode area and frequency and follow unambiguously from the measured impedance. By using large area electrodes the noise floor can be as low as 0.3 μVpp. The resulting high sensitivity is demonstrated by the extracellular detection of C6 glioma cell populations. Their minute electrical activity can be clearly detected at a frequency below about 10 Hz, which shows that the methodology can be used to monitor slow cooperative biological signals in cell populations.

  15. Global dust sources detection using MODIS Deep Blue Collection 6 aerosol products

    Science.gov (United States)

    Pérez García-Pando, C.; Ginoux, P. A.

    2015-12-01

    Our understanding of the global dust cycle is limited by a dearth of information about dust sources, especially small-scale features which could account for a large fraction of global emissions. Remote sensing sensors are the most useful tool to locate dust sources. These sensors include microwaves, visible channels, and lidar. On the global scale, major dust source regions have been identified using polar orbiting satellite instruments. The MODIS Deep Blue algorithm has been particularly useful to detect small-scale sources such as floodplains, alluvial fans, rivers, and wadis , as well as to identify anthropogenic sources from agriculture. The recent release of Collection 6 MODIS aerosol products allows to extend dust source detection to the entire land surfaces, which is quite useful to identify mid to high latitude dust sources and detect not only dust from agriculture but fugitive dust from transport and industrial activities. This presentation will overview the advantages and drawbacks of using MODIS Deep Blue for dust detection, compare to other instruments (polar orbiting and geostationary). The results of Collection 6 with a new dust screening will be compared against AERONET. Applications to long range transport of anthropogenic dust will be presented.

  16. Automated detection of extended sources in radio maps: progress from the SCORPIO survey

    Science.gov (United States)

    Riggi, S.; Ingallinera, A.; Leto, P.; Cavallaro, F.; Bufano, F.; Schillirò, F.; Trigilio, C.; Umana, G.; Buemi, C. S.; Norris, R. P.

    2016-08-01

    Automated source extraction and parametrization represents a crucial challenge for the next-generation radio interferometer surveys, such as those performed with the Square Kilometre Array (SKA) and its precursors. In this paper, we present a new algorithm, called CAESAR (Compact And Extended Source Automated Recognition), to detect and parametrize extended sources in radio interferometric maps. It is based on a pre-filtering stage, allowing image denoising, compact source suppression and enhancement of diffuse emission, followed by an adaptive superpixel clustering stage for final source segmentation. A parametrization stage provides source flux information and a wide range of morphology estimators for post-processing analysis. We developed CAESAR in a modular software library, also including different methods for local background estimation and image filtering, along with alternative algorithms for both compact and diffuse source extraction. The method was applied to real radio continuum data collected at the Australian Telescope Compact Array (ATCA) within the SCORPIO project, a pathfinder of the Evolutionary Map of the Universe (EMU) survey at the Australian Square Kilometre Array Pathfinder (ASKAP). The source reconstruction capabilities were studied over different test fields in the presence of compact sources, imaging artefacts and diffuse emission from the Galactic plane and compared with existing algorithms. When compared to a human-driven analysis, the designed algorithm was found capable of detecting known target sources and regions of diffuse emission, outperforming alternative approaches over the considered fields.

  17. Unifying Water Data Sources: How the CUAHSI Water Data Center is Enabling and Improving Access to a Growing Catalog of over 100 Data Providers

    Science.gov (United States)

    Pollak, J.; Berry, K.; Couch, A.; Arrigo, J.; Hooper, R. P.

    2013-12-01

    Scientific data about water are collected and distributed by numerous sources which can differ tremendously in scale. As competition for water resources increases, increasing access to and understanding of information about water will be critical. The mission of the new CUAHSI Water Data Center (WDC) is to provide those researchers who collect data a medium to publish their datasets and give those wanting to discover data the proper tools to efficiently find the data that they seek. These tools include standards-based data publication, data discovery tools based upon faceted and telescoping search, and a data analysis tool HydroDesktop that downloads and unifies data in standardized formats. The CUAHSI Hydrologic Information System (HIS) is a community developed and open source system for sharing water data. As a federated, web service oriented system it enables data publication for a diverse user population including scientific investigators (Research Coordination Networks, Critical Zone Observatories), government agencies (USGS, NASA, EPA), and citizen scientists (watershed associations). HydroDesktop is an end user application for data consumption in this system that the WDC supports. This application can be used for finding, downloading, and analyzing data from the HIS. It provides a GIS interface that allows users to incorporate spatial data that are not accessible via HIS, simple analysis tools to facilitate graphing and visualization, tools to export data to common file types, and provides an extensible architecture that developers can build upon. HydroDesktop, however, is just one example of a data access client for HIS. The web service oriented architecture enables data access by an unlimited number of clients provided they can consume the web services used in HIS. One such example developed at the WDC is the 'Faceted Search Client', which capitalizes upon exploratory search concepts to improve accuracy and precision during search. We highlight such

  18. Inkjet-printed point-of-care immunoassay on a nanoscale polymer brush enables subpicomolar detection of analytes in blood

    Science.gov (United States)

    Joh, Daniel Y.; Hucknall, Angus M.; Wei, Qingshan; Mason, Kelly A.; Lund, Margaret L.; Fontes, Cassio M.; Hill, Ryan T.; Blair, Rebecca; Zimmers, Zackary; Achar, Rohan K.; Tseng, Derek; Gordan, Raluca; Freemark, Michael; Ozcan, Aydogan; Chilkoti, Ashutosh

    2017-08-01

    The ELISA is the mainstay for sensitive and quantitative detection of protein analytes. Despite its utility, ELISA is time-consuming, resource-intensive, and infrastructure-dependent, limiting its availability in resource-limited regions. Here, we describe a self-contained immunoassay platform (the “D4 assay”) that converts the sandwich immunoassay into a point-of-care test (POCT). The D4 assay is fabricated by inkjet printing assay reagents as microarrays on nanoscale polymer brushes on glass chips, so that all reagents are “on-chip,” and these chips show durable storage stability without cold storage. The D4 assay can interrogate multiple analytes from a drop of blood, is compatible with a smartphone detector, and displays analytical figures of merit that are comparable to standard laboratory-based ELISA in whole blood. These attributes of the D4 POCT have the potential to democratize access to high-performance immunoassays in resource-limited settings without sacrificing their performance.

  19. A Facile, Nonreactive Hydrogen Peroxide (H2O2) Detection Method Enabled by Ion Chromatography with UV Detector.

    Science.gov (United States)

    Song, Mingrui; Wang, Junli; Chen, Baiyang; Wang, Lei

    2017-11-07

    Hydrogen peroxide (H 2 O 2 ) is ubiquitous in the natural environment, and it is now widely used for pollutant control in water and wastewater treatment processes. However, current analytical methods for H 2 O 2 inevitably require reactions between H 2 O 2 and other reactants to yield signals and are thus likely subjective to the interferences of coexisting colored, oxidative, and reductive compounds. In order to overcome these barriers, we herein for the first time propose to analyze H 2 O 2 by ion chromatography (IC) using an ultraviolet (UV) detector. The proposal is based on two principles: first, that H 2 O 2 can deprotonate to hydroperoxyl ion (HO 2 - ) when eluent pH is higher than the acid-dissociation coefficient of H 2 O 2 (pK a = 11.6); and second, that after separation from other compounds via IC column, H 2 O 2 can be quantified by a UV detector. Under favorable operating conditions, this method has successfully achieved acceptable recoveries (>91%) of H 2 O 2 dosed to ultrapure and natural waters, a calibration curve with R 2 > 0.99 for a wide range of H 2 O 2 concentrations from 0.1 to 50 mg/L and a method detection limit of 0.027 mg/L. In addition, this approach was shown to be capable of distinguishing H 2 O 2 from anions (e.g., fluoride and chloride) and organics (e.g., glycolate) and monochloramine, suggesting that it is insensitive to many neighboring compounds as long as they do not react quickly with H 2 O 2 . Hence, this study proves the combination of IC and UV detector a facile and reliable method for H 2 O 2 measurement.

  20. Low-Cost 3D Printers Enable High-Quality and Automated Sample Preparation and Molecular Detection.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available Most molecular diagnostic assays require upfront sample preparation steps to isolate the target's nucleic acids, followed by its amplification and detection using various nucleic acid amplification techniques. Because molecular diagnostic methods are generally rather difficult to perform manually without highly trained users, automated and integrated systems are highly desirable but too costly for use at point-of-care or low-resource settings. Here, we showcase the development of a low-cost and rapid nucleic acid isolation and amplification platform by modifying entry-level 3D printers that cost between $400 and $750. Our modifications consisted of replacing the extruder with a tip-comb attachment that houses magnets to conduct magnetic particle-based nucleic acid extraction. We then programmed the 3D printer to conduct motions that can perform high-quality extraction protocols. Up to 12 samples can be processed simultaneously in under 13 minutes and the efficiency of nucleic acid isolation matches well against gold-standard spin-column-based extraction technology. Additionally, we used the 3D printer's heated bed to supply heat to perform water bath-based polymerase chain reactions (PCRs. Using another attachment to hold PCR tubes, the 3D printer was programmed to automate the process of shuttling PCR tubes between water baths. By eliminating the temperature ramping needed in most commercial thermal cyclers, the run time of a 35-cycle PCR protocol was shortened by 33%. This article demonstrates that for applications in resource-limited settings, expensive nucleic acid extraction devices and thermal cyclers that are used in many central laboratories can be potentially replaced by a device modified from inexpensive entry-level 3D printers.

  1. Low-Cost 3D Printers Enable High-Quality and Automated Sample Preparation and Molecular Detection

    Science.gov (United States)

    Chan, Kamfai; Coen, Mauricio; Hardick, Justin; Gaydos, Charlotte A.; Wong, Kah-Yat; Smith, Clayton; Wilson, Scott A.; Vayugundla, Siva Praneeth; Wong, Season

    2016-01-01

    Most molecular diagnostic assays require upfront sample preparation steps to isolate the target’s nucleic acids, followed by its amplification and detection using various nucleic acid amplification techniques. Because molecular diagnostic methods are generally rather difficult to perform manually without highly trained users, automated and integrated systems are highly desirable but too costly for use at point-of-care or low-resource settings. Here, we showcase the development of a low-cost and rapid nucleic acid isolation and amplification platform by modifying entry-level 3D printers that cost between $400 and $750. Our modifications consisted of replacing the extruder with a tip-comb attachment that houses magnets to conduct magnetic particle-based nucleic acid extraction. We then programmed the 3D printer to conduct motions that can perform high-quality extraction protocols. Up to 12 samples can be processed simultaneously in under 13 minutes and the efficiency of nucleic acid isolation matches well against gold-standard spin-column-based extraction technology. Additionally, we used the 3D printer’s heated bed to supply heat to perform water bath-based polymerase chain reactions (PCRs). Using another attachment to hold PCR tubes, the 3D printer was programmed to automate the process of shuttling PCR tubes between water baths. By eliminating the temperature ramping needed in most commercial thermal cyclers, the run time of a 35-cycle PCR protocol was shortened by 33%. This article demonstrates that for applications in resource-limited settings, expensive nucleic acid extraction devices and thermal cyclers that are used in many central laboratories can be potentially replaced by a device modified from inexpensive entry-level 3D printers. PMID:27362424

  2. Sensitive assays enable detection of serum IgG antibodies against Clostridium difficile toxin A and toxin B in healthy subjects and patients with Clostridium difficile infection.

    Science.gov (United States)

    Zhao, Xuemei; Bender, Florent; Shukla, Rajiv; Kang, John J; Caro-Aguilar, Ivette; Laterza, Omar F

    2016-04-01

    Pathogenic Clostridium difficile produces two proinflammatory exotoxins, toxin A and toxin B. Low level of serum antitoxin IgG antibodies is a risk factor for the development of primary and recurrent C. difficile infection (CDI). We developed and validated two sensitive, titer-based electrochemiluminescence assays for the detection of serum antibody levels against C. difficile toxins A and B. These assays demonstrated excellent precision. The sensitivity of the assays allowed the detection of antitoxin A and antitoxin B IgG antibodies in all tested serum samples during assay validation. The validated titer-based assays enable assessment of antitoxin A and antitoxin B IgG antibodies as potential biomarkers to identify patients with CDI at increased risk for CDI recurrence.

  3. Detection of fission signatures induced by a low-energy neutron source

    International Nuclear Information System (INIS)

    Ocherashvili, A.; Becka, A.; Mayorovb, V.; Roesgen, E.; Crochemoreb, J.-M.; Mosconi, M.; Pedersen, B.; Heger, C.

    2015-01-01

    We present a method for the detection of special nuclear materials (SNM) in shielded containers which is both sensitive and applicable under field conditions. The method uses an external pulsed neutron source to induce fission in SNM and subsequent detection of the fast prompt fission neutrons. The detectors surrounding the container under investigation are liquid scintillation detectors able to distinguish gamma rays from fast neutrons by means of the pulse shape discrimination method (PSD). One advantage of these detectors, besides the ability for PSD analysis, is that the analogue signal from a detection event is of very short duration (typically few tens of nanoseconds). This allows the use of very short coincidence gates for the detection of the prompt fission neutrons in multiple detectors while benefiting from a low accidental (background) coincidence rate yielding a low detection limit. Another principle advantage of this method derives from the fact that the external neutron source is pulsed. By proper time gating the interrogation can be conducted by epithermal and thermal source neutrons only. These source neutrons do not appear in the fast neutron signal following the PSD analysis thus providing a fundamental method for separating the interrogating source neutrons from the sample response in form of fast fission neutrons. The paper describes laboratory tests with a configuration of eight detectors in the Pulsed Neutron Interrogation Test Assembly (PUNITA). The sensitivity of the coincidence signal to fissile mass is investigated for different sample configurations and interrogation regimes.

  4. The Cell-CT 3D Cell Imaging Technology Platform Enables the Detection of Lung Cancer Using the Non-Invasive LuCED Sputum Test

    Science.gov (United States)

    Meyer, Michael G.; Hayenga, Jon; Neumann, Thomas; Katdare, Rahul; Presley, Chris; Steinhauer, David; Bell, Timothy; Lancaster, Christy; Nelson, Alan C.

    2015-01-01

    The war against cancer has yielded important advances in the early diagnosis and treatment of certain cancer types, but the poor detection rate and 5-year survival rate for lung cancer remains little changed over the past 40 years. Early detection through emerging lung cancer screening programs promises the most reliable means of improving mortality. Sputum cytology has been tried without success because sputum contains few malignant cells that are difficult for cytologists to detect. However, research has shown that sputum contains diagnostic malignant cells and could serve as a means of lung cancer detection if those cells could be detected and correctly characterized. Recently, the National Lung Cancer Screening Trial reported that screening by three consecutive low-dose X-ray CT scans provides a 20% reduction in lung cancer mortality compared to chest X-ray. This reduction in mortality, however, comes with an unacceptable false positive rate that increases patient risks and the overall cost of lung cancer screening. This article reviews the LuCED® test for detecting early lung cancer. LuCED is based on patient sputum that is enriched for bronchial epithelial cells. The enriched sample is then processed on the Cell-CT®, which images cells in three dimensions with sub-micron resolution. Algorithms are applied to the 3D cell images to extract morphometric features that drive a classifier to identify cells that have abnormal characteristics. The final status of these candidate abnormal cells is established by the pathologist's manual review. LuCED promotes accurate cell classification which could enable cost effective detection of lung cancer. PMID:26148817

  5. Development of portable mass spectrometer with electron cyclotron resonance ion source for detection of chemical warfare agents in air.

    Science.gov (United States)

    Urabe, Tatsuya; Takahashi, Kazuya; Kitagawa, Michiko; Sato, Takafumi; Kondo, Tomohide; Enomoto, Shuichi; Kidera, Masanori; Seto, Yasuo

    2014-01-01

    A portable mass spectrometer with an electron cyclotron resonance ion source (miniECRIS-MS) was developed. It was used for in situ monitoring of trace amounts of chemical warfare agents (CWAs) in atmospheric air. Instrumental construction and parameters were optimized to realize a fast response, high sensitivity, and a small body size. Three types of CWAs, i.e., phosgene, mustard gas, and hydrogen cyanide were examined to check if the mass spectrometer was able to detect characteristic elements and atomic groups. From the results, it was found that CWAs were effectively ionized in the miniECRIS-MS, and their specific signals could be discerned over the background signals of air. In phosgene, the signals of the 35Cl+ and 37Cl+ ions were clearly observed with high dose-response relationships in the parts-per-billion level, which could lead to the quantitative on-site analysis of CWAs. A parts-per-million level of mustard gas, which was far lower than its lethal dosage (LCt50), was successfully detected with a high signal-stability of the plasma ion source. It was also found that the chemical forms of CWAs ionized in the plasma, i.e., monoatomic ions, fragment ions, and molecular ions, could be detected, thereby enabling the effective identification of the target CWAs. Despite the disadvantages associated with miniaturization, the overall performance (sensitivity and response time) of the miniECRIS-MS in detecting CWAs exceeded those of sector-type ECRIS-MS, showing its potential for on-site detection in the future. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. [Demand for and the Development of Detection Techniques for Source of Schistosome Infection in China].

    Science.gov (United States)

    Wang, Shi-ping; He, Xin; Zhou, Yun-fei

    2015-12-01

    Schistosomiasis is a type of zoonotic parasitosis that severely impairs human health. Rapid detection of infection sources is a key to the control of schistosomiasis. With the effective control of schistosomiasis in China, the detection techniques for infection sources have also been developed. The rate and the intensity of infection among humans and livestocks have been significantly decreased in China, as the control program has entered the transmission control stage in most of the endemic areas. Under this situation, the traditional etiological diagnosing techniques and common immunological methods can not afford rapid detection of infection sources of schistosomiasis. Instead, we are calling for detection methods with higher sensitivity, specificity and stability while being less time-consuming, more convenient and less costing. In recent years, many improved or novel detection methods have been applied for the epidemiological surveillance of schistosomiasis, such as the automatic scanning microscopic image acquisition system, PCR-ELISA, immunosensors, loop-mediated isothermal amplification, etc. The development of new monitoring techniques can facilitate rapid detection of schistosome infection sources in endemic areas.

  7. Detection of Point Sources on Two-Dimensional Images Based on Peaks

    Directory of Open Access Journals (Sweden)

    R. B. Barreiro

    2005-09-01

    Full Text Available This paper considers the detection of point sources in two-dimensional astronomical images. The detection scheme we propose is based on peak statistics. We discuss the example of the detection of far galaxies in cosmic microwave background experiments throughout the paper, although the method we present is totally general and can be used in many other fields of data analysis. We consider sources with a Gaussian profile—that is, a fair approximation of the profile of a point source convolved with the detector beam in microwave experiments—on a background modeled by a homogeneous and isotropic Gaussian random field characterized by a scale-free power spectrum. Point sources are enhanced with respect to the background by means of linear filters. After filtering, we identify local maxima and apply our detection scheme, a Neyman-Pearson detector that defines our region of acceptance based on the a priori pdf of the sources and the ratio of number densities. We study the different performances of some linear filters that have been used in this context in the literature: the Mexican hat wavelet, the matched filter, and the scale-adaptive filter. We consider as well an extension to two dimensions of the biparametric scale-adaptive filter (BSAF. The BSAF depends on two parameters which are determined by maximizing the number density of real detections while fixing the number density of spurious detections. For our detection criterion the BSAF outperforms the other filters in the interesting case of white noise.

  8. Bayesian analysis of energy and count rate data for detection of low count rate radioactive sources.

    Science.gov (United States)

    Klumpp, John; Brandl, Alexander

    2015-03-01

    A particle counting and detection system is proposed that searches for elevated count rates in multiple energy regions simultaneously. The system analyzes time-interval data (e.g., time between counts), as this was shown to be a more sensitive technique for detecting low count rate sources compared to analyzing counts per unit interval (Luo et al. 2013). Two distinct versions of the detection system are developed. The first is intended for situations in which the sample is fixed and can be measured for an unlimited amount of time. The second version is intended to detect sources that are physically moving relative to the detector, such as a truck moving past a fixed roadside detector or a waste storage facility under an airplane. In both cases, the detection system is expected to be active indefinitely; i.e., it is an online detection system. Both versions of the multi-energy detection systems are compared to their respective gross count rate detection systems in terms of Type I and Type II error rates and sensitivity.

  9. Feasible voltage-tap based quench detection in a Ag/Bi-2212 coil enabled by fast 3D normal zone propagation

    International Nuclear Information System (INIS)

    Shen, Tengming; Ye, Liyang; Li, Pei

    2016-01-01

    For this study, small insert solenoids have been built using a commercial Ag/Bi-2212 multifilamentary round wire, insulated with a new thin TiO 2 – polymer coating insulation (thickness in ~20 μm versus ~100 μm for a commonly used mullite braided sleeve insulation), and characterized in background magnetic field up to 14 T at 4.2 K to explore the high-field performance and quench detection of Bi-2212 magnets. The coil has no visible leakage and no electrical shorts after reaction, and it carries 280 A/mm -2 in a background field 14 T and generates an additional 1.7 T. A notable result is that, despite normal zones propagate slowly along the conductor, the hot spot temperature upon detection increases only from 40 K to 60 K when the resistive quench detection voltage threshold increases from 0.1 V to 1 V for all operating current density investigated, showing that quench detection using voltage taps is feasible for this coil. This is in a strong contrast to a coil we previously built to the same specifications but from wires insulated with the mullite braided sleeve insulation, for which the hot spot temperature upon detection increases from ~80 K to ~140 K while increasing from the detection voltage threshold from 0.1 V to 1 V, and thus for which quench detection using voltage taps presents significant risks, consistent with the common belief that the effectiveness of quench detection using voltage taps for superconducting magnets built using high temperature superconductors is seriously compromised by their slow normal zone propagation. This striking difference is ascribed to the fast transverse quench propagation enabled by thin insulation and improved thermal coupling between conductor turns. Finally, this work demonstrates that quench detection for high-temperature superconducting magnets highly depends on the design and construction of the coils such as insulation materials used and this dependence should be factored into the overall magnet design

  10. 21-cm signature of the first sources in the Universe: prospects of detection with SKA

    Science.gov (United States)

    Ghara, Raghunath; Choudhury, T. Roy; Datta, Kanan K.

    2016-07-01

    Currently several low-frequency experiments are being planned to study the nature of the first stars using the redshifted 21-cm signal from the cosmic dawn and Epoch of Reionization. Using a one-dimensional radiative transfer code, we model the 21-cm signal pattern around the early sources for different source models, I.e. the metal-free Population III (PopIII) stars, primordial galaxies consisting of Population II (PopII) stars, mini-QSOs and high-mass X-ray binaries (HMXBs). We investigate the detectability of these sources by comparing the 21-cm visibility signal with the system noise appropriate for a telescope like the SKA1-low. Upon integrating the visibility around a typical source over all baselines and over a frequency interval of 16 MHz, we find that it will be possible to make a ˜9σ detection of the isolated sources like PopII galaxies, mini-QSOs and HMXBs at z ˜ 15 with the SKA1-low in 1000 h. The exact value of the signal-to-noise ratio (SNR) will depend on the source properties, in particular on the mass and age of the source and the escape fraction of ionizing photons. The predicted SNR decreases with increasing redshift. We provide simple scaling laws to estimate the SNR for different values of the parameters which characterize the source and the surrounding medium. We also argue that it will be possible to achieve an SNR ˜9 even in the presence of the astrophysical foregrounds by subtracting out the frequency-independent component of the observed signal. These calculations will be useful in planning 21-cm observations to detect the first sources.

  11. Calculated Absolute Detection Efficiencies of Cylindrical Nal (Tl) Scintillation Crystals for Aqueous Spherical Sources

    Energy Technology Data Exchange (ETDEWEB)

    Strindehag, O; Tollander, B

    1968-08-15

    Calculated values of the absolute total detection efficiencies of cylindrical scintillation crystals viewing spherical sources of various sizes are presented. The calculation is carried out for 2 x 2 inch and 3 x 3 inch Nal(Tl) crystals and for sources which have the radii 1/4, 1/2, 3/4 and 1 times the crystal radius. Source-detector distances of 5-20 cm and gamma energies in the range 0.1 - 5 MeV are considered. The correction factor for absorption in the sample container wall and in the detector housing is derived and calculated for a practical case.

  12. Comparing Natural Gas Leakage Detection Technologies Using an Open-Source "Virtual Gas Field" Simulator.

    Science.gov (United States)

    Kemp, Chandler E; Ravikumar, Arvind P; Brandt, Adam R

    2016-04-19

    We present a tool for modeling the performance of methane leak detection and repair programs that can be used to evaluate the effectiveness of detection technologies and proposed mitigation policies. The tool uses a two-state Markov model to simulate the evolution of methane leakage from an artificial natural gas field. Leaks are created stochastically, drawing from the current understanding of the frequency and size distributions at production facilities. Various leak detection and repair programs can be simulated to determine the rate at which each would identify and repair leaks. Integrating the methane leakage over time enables a meaningful comparison between technologies, using both economic and environmental metrics. We simulate four existing or proposed detection technologies: flame ionization detection, manual infrared camera, automated infrared drone, and distributed detectors. Comparing these four technologies, we found that over 80% of simulated leakage could be mitigated with a positive net present value, although the maximum benefit is realized by selectively targeting larger leaks. Our results show that low-cost leak detection programs can rely on high-cost technology, as long as it is applied in a way that allows for rapid detection of large leaks. Any strategy to reduce leakage should require a careful consideration of the differences between low-cost technologies and low-cost programs.

  13. Source detection at 100 meter standoff with a time-encoded imaging system

    International Nuclear Information System (INIS)

    Brennan, J.; Brubaker, E.; Gerling, M.; Marleau, P.; Monterial, M.

    2017-01-01

    Here, we present the design, characterization, and testing of a laboratory prototype radiological search and localization system. The system, based on time-encoded imaging, uses the attenuation signature of neutrons in time, induced by the geometrical layout and motion of the system. We have demonstrated the ability to detect a ~1 mCi 252 Cf radiological source at 100 m standoff with 90% detection efficiency and 10% false positives against background in 12 min. As a result, this same detection efficiency is met at 15 s for a 40 m standoff, and 1.2 s for a 20 m standoff.

  14. A LIMIT ON THE NUMBER OF ISOLATED NEUTRON STARS DETECTED IN THE ROSAT ALL-SKY-SURVEY BRIGHT SOURCE CATALOG

    International Nuclear Information System (INIS)

    Turner, Monica L.; Rutledge, Robert E.; Letcavage, Ryan; Shevchuk, Andrew S. H.; Fox, Derek B.

    2010-01-01

    Using new and archival observations made with the Swift satellite and other facilities, we examine 147 X-ray sources selected from the ROSAT All-Sky-Survey Bright Source Catalog (RASS/BSC) to produce a new limit on the number of isolated neutron stars (INSs) in the RASS/BSC, the most constraining such limit to date. Independent of X-ray spectrum and variability, the number of INSs is ≤48 (90% confidence). Restricting attention to soft (kT eff < 200 eV), non-variable X-ray sources-as in a previous study-yields an all-sky limit of ≤31 INSs. In the course of our analysis, we identify five new high-quality INS candidates for targeted follow-up observations. A future all-sky X-ray survey with eROSITA, or another mission with similar capabilities, can be expected to increase the detected population of X-ray-discovered INSs from the 8-50 in the BSC, to (for a disk population) 240-1500, which will enable a more detailed study of neutron star population models.

  15. The resolution of point sources of light as analyzed by quantum detection theory

    Science.gov (United States)

    Helstrom, C. W.

    1972-01-01

    The resolvability of point sources of incoherent light is analyzed by quantum detection theory in terms of two hypothesis-testing problems. In the first, the observer must decide whether there are two sources of equal radiant power at given locations, or whether there is only one source of twice the power located midway between them. In the second problem, either one, but not both, of two point sources is radiating, and the observer must decide which it is. The decisions are based on optimum processing of the electromagnetic field at the aperture of an optical instrument. In both problems the density operators of the field under the two hypotheses do not commute. The error probabilities, determined as functions of the separation of the points and the mean number of received photons, characterize the ultimate resolvability of the sources.

  16. Resolution of point sources of light as analyzed by quantum detection theory.

    Science.gov (United States)

    Helstrom, C. W.

    1973-01-01

    The resolvability of point sources of incoherent thermal light is analyzed by quantum detection theory in terms of two hypothesis-testing problems. In the first, the observer must decide whether there are two sources of equal radiant power at given locations, or whether there is only one source of twice the power located midway between them. In the second problem, either one, but not both, of two point sources is radiating, and the observer must decide which it is. The decisions are based on optimum processing of the electromagnetic field at the aperture of an optical instrument. In both problems the density operators of the field under the two hypotheses do not commute. The error probabilities, determined as functions of the separation of the points and the mean number of received photons, characterize the ultimate resolvability of the sources.

  17. Acute gastrointestinal bleeding: detection of source and etiology with multi-detector-row CT

    Energy Technology Data Exchange (ETDEWEB)

    Scheffel, Hans; Pfammatter, Thomas; Marincek, Borut; Alkadhi, Hatem [University Hospital Zurich, Institute of Diagnostic Radiology, Zurich (Switzerland); Wildi, Stefan [University Hospital Zurich, Department of Visceral and Transplant Surgery, Zurich (Switzerland); Bauerfeind, Peter [University Hospital Zurich, Division of Gastroenterology, Zurich (Switzerland)

    2007-06-15

    This study was conducted to determine the ability of multi-detector-row computed tomography (CT) to identify the source and etiology of acute gastrointestinal bleeding. Eighteen patients with acute upper (n = 10) and lower (n = 8) gastrointestinal bleeding underwent 4-detector-row CT (n = 6), 16-detector-row CT (n = 11), and 64-slice CT (n = 1) with an arterial and portal venous phase of contrast enhancement. Unenhanced scans were performed in nine patients. CT scans were reviewed to determine conspicuity of bleeding source, underlying etiology, and for potential causes of false-negative prospective interpretations. Bleeding sources were prospectively identified with CT in 15 (83%) patients, and three (17%) bleeding sources were visualized in retrospect, allowing the characterization of all sources of bleeding with CT. Contrast extravasation was demonstrated with CT in all 11 patients with severe bleeding, but only in 1 of 7 patients with mild bleeding. The etiology could not be identified on unenhanced CT scans in any patient, whereas arterial-phase and portal venous-phase CT depicted etiology in 15 (83%) patients. Underlying etiology was correctly identified in all eight patients with mild GI bleeding. Multi-detector-row CT enables the identification of bleeding source and precise etiology in patients with acute gastrointestinal bleeding. (orig.)

  18. Acute gastrointestinal bleeding: detection of source and etiology with multi-detector-row CT

    International Nuclear Information System (INIS)

    Scheffel, Hans; Pfammatter, Thomas; Marincek, Borut; Alkadhi, Hatem; Wildi, Stefan; Bauerfeind, Peter

    2007-01-01

    This study was conducted to determine the ability of multi-detector-row computed tomography (CT) to identify the source and etiology of acute gastrointestinal bleeding. Eighteen patients with acute upper (n = 10) and lower (n = 8) gastrointestinal bleeding underwent 4-detector-row CT (n = 6), 16-detector-row CT (n = 11), and 64-slice CT (n = 1) with an arterial and portal venous phase of contrast enhancement. Unenhanced scans were performed in nine patients. CT scans were reviewed to determine conspicuity of bleeding source, underlying etiology, and for potential causes of false-negative prospective interpretations. Bleeding sources were prospectively identified with CT in 15 (83%) patients, and three (17%) bleeding sources were visualized in retrospect, allowing the characterization of all sources of bleeding with CT. Contrast extravasation was demonstrated with CT in all 11 patients with severe bleeding, but only in 1 of 7 patients with mild bleeding. The etiology could not be identified on unenhanced CT scans in any patient, whereas arterial-phase and portal venous-phase CT depicted etiology in 15 (83%) patients. Underlying etiology was correctly identified in all eight patients with mild GI bleeding. Multi-detector-row CT enables the identification of bleeding source and precise etiology in patients with acute gastrointestinal bleeding. (orig.)

  19. Development of three-dimensional patient face model that enables real-time collision detection and cutting operation for a dental simulator.

    Science.gov (United States)

    Yamaguchi, Satoshi; Yamada, Yuya; Yoshida, Yoshinori; Noborio, Hiroshi; Imazato, Satoshi

    2012-01-01

    The virtual reality (VR) simulator is a useful tool to develop dental hand skill. However, VR simulations with reactions of patients have limited computational time to reproduce a face model. Our aim was to develop a patient face model that enables real-time collision detection and cutting operation by using stereolithography (STL) and deterministic finite automaton (DFA) data files. We evaluated dependence of computational cost and constructed the patient face model using the optimum condition for combining STL and DFA data files, and assessed the computational costs for operation in do-nothing, collision, cutting, and combination of collision and cutting. The face model was successfully constructed with low computational costs of 11.3, 18.3, 30.3, and 33.5 ms for do-nothing, collision, cutting, and collision and cutting, respectively. The patient face model could be useful for developing dental hand skill with VR.

  20. Atmospheric Pressure Chemical Ionization Sources Used in The Detection of Explosives by Ion Mobility Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Waltman, Melanie J. [New Mexico Inst. of Mining and Technology, Socorro, NM (United States)

    2010-05-01

    Explosives detection is a necessary and wide spread field of research. From large shipping containers to airline luggage, numerous items are tested for explosives every day. In the area of trace explosives detection, ion mobility spectrometry (IMS) is the technique employed most often because it is a quick, simple, and accurate way to test many items in a short amount of time. Detection by IMS is based on the difference in drift times of product ions through the drift region of an IMS instrument. The product ions are created when the explosive compounds, introduced to the instrument, are chemically ionized through interactions with the reactant ions. The identity of the reactant ions determines the outcomes of the ionization process. This research investigated the reactant ions created by various ionization sources and looked into ways to manipulate the chemistry occurring in the sources.

  1. Detection limits for real-time source water monitoring using indigenous freshwater microalgae

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Jr, Miguel [ORNL; Greenbaum, Elias [ORNL

    2009-01-01

    This research identified toxin detection limits using the variable fluorescence of naturally occurring microalgae in source drinking water for five chemical toxins with different molecular structures and modes of toxicity. The five chemicals investigated were atrazine, Diuron, paraquat, methyl parathion, and potassium cyanide. Absolute threshold sensitivities of the algae for detection of the toxins in unmodified source drinking water were measured. Differential kinetics between the rate of action of the toxins and natural changes in algal physiology, such as diurnal photoinhibition, are significant enough that effects of the toxin can be detected and distinguished from the natural variance. This is true even for physiologically impaired algae where diminished photosynthetic capacity may arise from uncontrollable external factors such as nutrient starvation. Photoinhibition induced by high levels of solar radiation is a predictable and reversible phenomenon that can be dealt with using a period of dark adaption of 30 minutes or more.

  2. Research and Development of Landmine Detection System by a Compact Fusion Neutron Source

    International Nuclear Information System (INIS)

    Yoshikawa, Kiyoshi; Masuda, Kai; Toku, Hisayuki; Nagasaki, Kazunobu; Mizutani, Toshiyuki; Takamatsu, Teruhisa; Imoto, Masaki; Yamamoto, Yasushi; Ohnishi, Masami; Osawa, Hodaka; Hotta, Eiki; Kohno, Toshiyuki; Okino, Akitoshi; Watanabe, Masato; Yamauchi, Kunihito; Yuura, Morimasa; Shiroya, Seiji; Misawa, Tsuyoshi; Mori, Takamasa

    2005-01-01

    Current results are described on the research and development of an advanced anti-personnel landmine detection system by using a compact discharge-type fusion neutron source called IECF (Inertial-Electrostatic Confinement Fusion). Landmines are to be identified through backscattering of neutrons, and specific-energy capture γ-rays by hydrogen and nitrogen atoms in the landmine explosives.For this purpose, improvements in the IECF were made by various methods to achieve a drastic enhancement of neutron yields of more than 10 8 n/s in pulsed operation. This required R and D on the power source, as well as analysis of envisaged detection systems with multi-sensors. The results suggest promising and practical features for humanitarian landmine detection, particularly, in Afghanistan

  3. An automated multi-scale network-based scheme for detection and location of seismic sources

    Science.gov (United States)

    Poiata, N.; Aden-Antoniow, F.; Satriano, C.; Bernard, P.; Vilotte, J. P.; Obara, K.

    2017-12-01

    We present a recently developed method - BackTrackBB (Poiata et al. 2016) - allowing to image energy radiation from different seismic sources (e.g., earthquakes, LFEs, tremors) in different tectonic environments using continuous seismic records. The method exploits multi-scale frequency-selective coherence in the wave field, recorded by regional seismic networks or local arrays. The detection and location scheme is based on space-time reconstruction of the seismic sources through an imaging function built from the sum of station-pair time-delay likelihood functions, projected onto theoretical 3D time-delay grids. This imaging function is interpreted as the location likelihood of the seismic source. A signal pre-processing step constructs a multi-band statistical representation of the non stationary signal, i.e. time series, by means of higher-order statistics or energy envelope characteristic functions. Such signal-processing is designed to detect in time signal transients - of different scales and a priori unknown predominant frequency - potentially associated with a variety of sources (e.g., earthquakes, LFE, tremors), and to improve the performance and the robustness of the detection-and-location location step. The initial detection-location, based on a single phase analysis with the P- or S-phase only, can then be improved recursively in a station selection scheme. This scheme - exploiting the 3-component records - makes use of P- and S-phase characteristic functions, extracted after a polarization analysis of the event waveforms, and combines the single phase imaging functions with the S-P differential imaging functions. The performance of the method is demonstrated here in different tectonic environments: (1) analysis of the one year long precursory phase of 2014 Iquique earthquake in Chile; (2) detection and location of tectonic tremor sources and low-frequency earthquakes during the multiple episodes of tectonic tremor activity in southwestern Japan.

  4. Informatics enables public health surveillance

    Directory of Open Access Journals (Sweden)

    Scott J. N McNabb

    2017-01-01

    Full Text Available Over the past decade, the world has radically changed. New advances in information and communication technologies (ICT connect the world in ways never imagined. Public health informatics (PHI leveraged for public health surveillance (PHS, can enable, enhance, and empower essential PHS functions (i.e., detection, reporting, confirmation, analyses, feedback, response. However, the tail doesn't wag the dog; as such, ICT cannot (should not drive public health surveillance strengthening. Rather, ICT can serve PHS to more effectively empower core functions. In this review, we explore promising ICT trends for prevention, detection, and response, laboratory reporting, push notification, analytics, predictive surveillance, and using new data sources, while recognizing that it is the people, politics, and policies that most challenge progress for implementation of solutions.

  5. Fissile material detection and control facility with pulsed neutron sources and digital data processing

    International Nuclear Information System (INIS)

    Romodanov, V.L.; Chernikova, D.N.; Afanasiev, V.V.

    2010-01-01

    Full text: In connection with possible nuclear terrorism, there is long-felt need of devices for effective control of radioactive and fissile materials in the key points of crossing the state borders (airports, seaports, etc.), as well as various customs check-points. In International Science and Technology Center Projects No. 596 and No. 2978, a new physical method and digital technology have been developed for the detection of fissile and radioactive materials in models of customs facilities with a graphite moderator, pulsed neutron source and digital processing of responses from scintillation PSD detectors. Detectability of fissile materials, even those shielded with various radiation-absorbing screens, has been shown. The use of digital processing of scintillation signals in this facility is a necessary element, as neutrons and photons are discriminated in the time dependence of fissile materials responses at such loads on the electronic channels that standard types of spectrometers are inapplicable. Digital processing of neutron and photon responses practically resolves the problem of dead time and allows implementing devices, in which various energy groups of neutrons exist for some time after a pulse of source neutrons. Thus, it is possible to detect fissile materials deliberately concealed with shields having a large cross-section of absorption of photons and thermal neutrons. Two models of detection and the control of fissile materials were advanced: 1. the model based on graphite neutrons moderator and PSD scintillators with digital technology of neutrons and photons responses separation; 2. the model based on plastic scintillators and detecting of time coincidences of fission particles by digital technology. Facilities that count time coincidences of neutrons and photons occurring in the fission of fissile materials can use an Am Li source of neutrons, e.g. that is the case with the AWCC system. The disadvantages of the facility are related to the issues

  6. Detection prospects for high energy neutrino sources from the anisotropic matter distribution in the local universe

    DEFF Research Database (Denmark)

    Mertsch, Philipp; Rameez, Mohamed; Tamborra, Irene

    2017-01-01

    Constraints on the number and luminosity of the sources of the cosmic neutrinos detected by IceCube have been set by targeted searches for point sources. We set complementary constraints by using the 2MASS Redshift Survey (2MRS) catalogue, which maps the matter distribution of the local Universe....... Assuming that the distribution of the neutrino sources follows that of matter we look for correlations between `warm' spots on the IceCube skymap and the 2MRS matter distribution. Through Monte Carlo simulations of the expected number of neutrino multiplets and careful modelling of the detector performance...... (including that of IceCube-Gen2) we demonstrate that sources with local density exceeding $10^{-6} \\, \\text{Mpc}^{-3}$ and neutrino luminosity $L_{\

  7. A dual neutron/gamma source for the Fissmat Inspection for Nuclear Detection (FIND) system.

    Energy Technology Data Exchange (ETDEWEB)

    Doyle, Barney Lee (Sandia National Laboratories, Albuquerque, NM); King, Michael; Rossi, Paolo (Sandia National Laboratories, Albuquerque, NM); McDaniel, Floyd Del (Sandia National Laboratories, Albuquerque, NM); Morse, Daniel Henry; Antolak, Arlyn J.; Provencio, Paula Polyak (Sandia National Laboratories, Albuquerque, NM); Raber, Thomas N.

    2008-12-01

    Shielded special nuclear material (SNM) is very difficult to detect and new technologies are needed to clear alarms and verify the presence of SNM. High-energy photons and neutrons can be used to actively interrogate for heavily shielded SNM, such as highly enriched uranium (HEU), since neutrons can penetrate gamma-ray shielding and gamma-rays can penetrate neutron shielding. Both source particles then induce unique detectable signals from fission. In this LDRD, we explored a new type of interrogation source that uses low-energy proton- or deuteron-induced nuclear reactions to generate high fluxes of mono-energetic gammas or neutrons. Accelerator-based experiments, computational studies, and prototype source tests were performed to obtain a better understanding of (1) the flux requirements, (2) fission-induced signals, background, and interferences, and (3) operational performance of the source. The results of this research led to the development and testing of an axial-type gamma tube source and the design/construction of a high power coaxial-type gamma generator based on the {sup 11}B(p,{gamma}){sup 12}C nuclear reaction.

  8. Detection of emission sources using passive-remote Fourier transform infrared spectroscopy

    International Nuclear Information System (INIS)

    Demirgian, J.C.; Macha, S.M.; Darby, S.M.; Ditillo, J.

    1995-01-01

    The detection and identification of toxic chemicals released in the environment is important for public safety. Passive-remote Fourier transform infrared (FTIR) spectrometers can be used to detect these releases. Their primary advantages are their small size and ease of setup and use. Open-path FTIR spectrometers are used to detect concentrations of pollutants from a fixed frame of reference. These instruments detect plumes, but they are too large and difficult to aim to be used to track a plume to its source. Passive remote FTIR spectrometers contain an interferometer, optics, and a detector. They can be used on tripods and in some cases can be hand-held. A telescope can be added to most units. We will discuss the capability of passive-remote FTIR spectrometers to detect the origin of plumes. Low concentration plumes were released using a custom-constructed vaporizer. These plumes were detected with different spectrometers from different distances. Passive-remote spectrometers were able to detect small 10 cm on a side chemical releases at concentration-pathlengths at the low parts per million-meter (ppm-m) level

  9. Health system barriers and enablers to early access to breast cancer screening, detection, and diagnosis: a global analysis applied to the MENA region.

    Science.gov (United States)

    Bowser, D; Marqusee, H; El Koussa, M; Atun, R

    2017-11-01

    To identify barriers and enablers that impact access to early screening, detection, and diagnosis of breast cancer both globally and more specifically in the Middle East and North Africa (MENA) region (with a specific focus on Egypt, Jordan, Oman, Saudi Arabia, United Arab Emirates [UAE], and Kuwait) with a specific focus on the health system. A systematic review of literature. We conducted a systematic reviewing using the PRISMA methodology. We searched PubMed, Global Index Medicus, and EMBASE for studies on 'breast cancer', 'breast neoplasm,' or 'screening, early detection, and early diagnosis' as well as key words related to the following barriers: religion, culture, health literacy, lack of knowledge/awareness/understanding, attitudes, fatalism/fear, shame/embarrassment, and physician gender from January 1, 2000 until September 1, 2016. Two independent reviewers screened both titles and abstracts. The application of inclusion and exclusion criteria yielded a final list of articles. A conceptual framework was used to guide the thematic analysis and examine health system barriers and enablers to breast cancer screening at the broader macro health system level, at the health provider level, and the individual level. The analysis was conducted globally and in the MENA region. A total of 11,936 references were identified through the initial search strategy, of which 55 were included in the final thematic analysis. The results found the following barriers and enablers to access to breast cancer screening at the health system level, the health provider level, and the individual level: health system structures such as health insurance and care coordination systems, costs, time concerns, provider characteristics including gender of the provider, quality of care issues, medical concerns, and fear. In addition, the following seven barriers and enablers were identified at the health system or provider level as significantly impacting screening for breast cancer: (1) access

  10. Real-time implementation of logo detection on open source BeagleBoard

    Science.gov (United States)

    George, M.; Kehtarnavaz, N.; Estevez, L.

    2011-03-01

    This paper presents the real-time implementation of our previously developed logo detection and tracking algorithm on the open source BeagleBoard mobile platform. This platform has an OMAP processor that incorporates an ARM Cortex processor. The algorithm combines Scale Invariant Feature Transform (SIFT) with k-means clustering, online color calibration and moment invariants to robustly detect and track logos in video. Various optimization steps that are carried out to allow the real-time execution of the algorithm on BeagleBoard are discussed. The results obtained are compared to the PC real-time implementation results.

  11. Application of digital lock-in detection to Hefei Light Source turn-by-turn system

    International Nuclear Information System (INIS)

    Yang Yongliang; Wang Junhua; Sun Baogen; Chen Yuanbo; Zhou Zeran

    2010-01-01

    This paper introduces the digital lock-in detection theory and discusses its feasibility to obtain the damping rate in turn-by-turn measurement systems. Numerical simulations of this method were carried out with Matlab. Then principle presenting beam experiments were conducted on the Hefei Light Source (HLS) storage ring. The measured beta oscillation growth time is about 0.26 ms and the damping time is about 1.2 ms. Simulation and experimental results show that, the digital lock-in detection method is effective in damping rate measurement in turn-by-turn measurement systems. (authors)

  12. An open source cryostage and software analysis method for detection of antifreeze activity

    DEFF Research Database (Denmark)

    Lørup Buch, Johannes; Ramløv, H

    2016-01-01

    AFP could reliably be told apart from controls after only two minutes of recrystallisation. The goal of providing a fast, cheap and easy method for detecting antifreeze proteins in solution was met, and further development of the system can be followed at https://github.com/pechano/cryostage.......The aim of this study is to provide the reader with a simple setup that can detect antifreeze proteins (AFP) by inhibition of ice recrystallisation in very small sample sizes. This includes an open source cryostage, a method for preparing and loading samples as well as a software analysis method...

  13. Highly sensitive time resolved singlet oxygen luminescence detection using LEDs as the excitation source

    International Nuclear Information System (INIS)

    Hackbarth, S; Schlothauer, J; Preuss, A; Röder, B

    2013-01-01

    For the first time singlet oxygen luminescence kinetics in living cells were detected at high precision using LED light for excitation. As LED technology evolves, the light intensity emitted by standard LEDs allows photosensitized singlet oxygen luminescence detection in solution and cell suspensions. We present measurements superior to those of most actual laser powered setups regarding precision of singlet oxygen kinetics in solutions and cell suspensions. Data presented here show that LED based setups allow the determination of the photosensitizer triplet and singlet oxygen decay times in vitro with an accuracy of 0.1 μs. This enables monitoring of the photosensitizer efficiency and interaction with the cellular components using illumination doses small enough not to cause cell death. (letter)

  14. Adapting astronomical source detection software to help detect animals in thermal images obtained by unmanned aerial systems

    Science.gov (United States)

    Longmore, S. N.; Collins, R. P.; Pfeifer, S.; Fox, S. E.; Mulero-Pazmany, M.; Bezombes, F.; Goodwind, A.; de Juan Ovelar, M.; Knapen, J. H.; Wich, S. A.

    2017-02-01

    In this paper we describe an unmanned aerial system equipped with a thermal-infrared camera and software pipeline that we have developed to monitor animal populations for conservation purposes. Taking a multi-disciplinary approach to tackle this problem, we use freely available astronomical source detection software and the associated expertise of astronomers, to efficiently and reliably detect humans and animals in aerial thermal-infrared footage. Combining this astronomical detection software with existing machine learning algorithms into a single, automated, end-to-end pipeline, we test the software using aerial video footage taken in a controlled, field-like environment. We demonstrate that the pipeline works reliably and describe how it can be used to estimate the completeness of different observational datasets to objects of a given type as a function of height, observing conditions etc. - a crucial step in converting video footage to scientifically useful information such as the spatial distribution and density of different animal species. Finally, having demonstrated the potential utility of the system, we describe the steps we are taking to adapt the system for work in the field, in particular systematic monitoring of endangered species at National Parks around the world.

  15. Migration to Current Open Source Technologies by MagIC Enables a More Responsive Website, Quicker Development Times, and Increased Community Engagement

    Science.gov (United States)

    Jarboe, N.; Minnett, R.; Koppers, A.; Constable, C.; Tauxe, L.; Jonestrask, L.

    2017-12-01

    The Magnetics Information Consortium (MagIC) supports an online database for the paleo, geo, and rock magnetic communities ( https://earthref.org/MagIC ). Researchers can upload data into the archive and download data as selected with a sophisticated search system. MagIC has completed the transition from an Oracle backed, Perl based, server oriented website to an ElasticSearch backed, Meteor based thick client website technology stack. Using JavaScript on both the sever and the client enables increased code reuse and allows easy offloading many computational operations to the client for faster response. On-the-fly data validation, column header suggestion, and spreadsheet online editing are some new features available with the new system. The 3.0 data model, method codes, and vocabulary lists can be browsed via the MagIC website and more easily updated. Source code for MagIC is publicly available on GitHub ( https://github.com/earthref/MagIC ). The MagIC file format is natively compatible with the PmagPy ( https://github.com/PmagPy/PmagPy) paleomagnetic analysis software. MagIC files can now be downloaded from the database and viewed and interpreted in the PmagPy GUI based tool, pmag_gui. Changes or interpretations of the data can then be saved by pmag_gui in the MagIC 3.0 data format and easily uploaded to the MagIC database. The rate of new contributions to the database has been increasing with many labs contributing measurement level data for the first time in the last year. Over a dozen file format conversion scripts are available for translating non-MagIC measurement data files into the MagIC format for easy uploading. We will continue to work with more labs until the whole community has a manageable workflow for contributing their measurement level data. MagIC will continue to provide a global repository for archiving and retrieving paleomagnetic and rock magnetic data and, with the new system in place, be able to more quickly respond to the community

  16. Data-Fusion for a Vision-Aided Radiological Detection System: Sensor dependence and Source Tracking

    Science.gov (United States)

    Stadnikia, Kelsey; Martin, Allan; Henderson, Kristofer; Koppal, Sanjeev; Enqvist, Andreas

    2018-01-01

    The University of Florida is taking a multidisciplinary approach to fuse the data between 3D vision sensors and radiological sensors in hopes of creating a system capable of not only detecting the presence of a radiological threat, but also tracking it. The key to developing such a vision-aided radiological detection system, lies in the count rate being inversely dependent on the square of the distance. Presented in this paper are the results of the calibration algorithm used to predict the location of the radiological detectors based on 3D distance from the source to the detector (vision data) and the detectors count rate (radiological data). Also presented are the results of two correlation methods used to explore source tracking.

  17. WASTK: A Weighted Abstract Syntax Tree Kernel Method for Source Code Plagiarism Detection

    Directory of Open Access Journals (Sweden)

    Deqiang Fu

    2017-01-01

    Full Text Available In this paper, we introduce a source code plagiarism detection method, named WASTK (Weighted Abstract Syntax Tree Kernel, for computer science education. Different from other plagiarism detection methods, WASTK takes some aspects other than the similarity between programs into account. WASTK firstly transfers the source code of a program to an abstract syntax tree and then gets the similarity by calculating the tree kernel of two abstract syntax trees. To avoid misjudgment caused by trivial code snippets or frameworks given by instructors, an idea similar to TF-IDF (Term Frequency-Inverse Document Frequency in the field of information retrieval is applied. Each node in an abstract syntax tree is assigned a weight by TF-IDF. WASTK is evaluated on different datasets and, as a result, performs much better than other popular methods like Sim and JPlag.

  18. Detection limits of pollutants in water for PGNAA using Am-Be source

    International Nuclear Information System (INIS)

    Khelifi, R.; Amokrane, A.; Bode, P.

    2007-01-01

    A basic PGNAA facility with an Am-Be neutron source is described to analyze the pollutants in water. The properties of neutron flux were determined by MCNP calculations. In order to determine the efficiency curve of a HPGe detector, the prompt-gamma rays from chlorine were used and an exponential curve was fitted. The detection limits for typical water sample are also estimated using the statistical fluctuations of the background level in the areas of recorded the prompt-gamma spectrum

  19. Detection of a Very Bright Source Close to the LMC Supernova SN 1987A: Erratum

    Science.gov (United States)

    Nisenson, P.; Papaliolios, C.; Karovska, M.; Noyes, R.

    1988-01-01

    In the Letter "Detection of a Very Bright Source Close to the LMC Supernova SN 1987A" by P. Nisenson, C. Papaliolios, M. Karovska, and R. Noyes (1987 Ap. J. [Letters], 320, L15), two of the figure labels for Figure 1 were inadvertently transposed in the production process. A corrected version of the figure appears as Plate L4. The Journal regrets the error.

  20. Limit of detection of a fiber optics gyroscope using a super luminescent radiation source

    International Nuclear Information System (INIS)

    Sandoval R, G.E.; Nikolaev, V.A.

    2003-01-01

    The main objective of this work is to establish the dependence of characteristics of the fiber optics gyroscope (FOG) with respect to the parameters of the super luminescent emission source based on doped optical fiber with rare earth elements (Super luminescent Fiber Source, SFS), argument the pumping rate election of the SFS to obtain characteristics limits of the FOG sensibility. By using this type of emission source in the FOG is recommend to use the rate when the direction of the pumping signal coincide with the super luminescent signal. The most results are the proposition and argumentation of the SFS election as emission source to be use in the FOG of the phase type. Such a decision allow to increase the characteristics of the FOG sensibility in comparison with the use of luminescent source of semiconductors emission which are extensively used in the present time. The use of emission source of the SFS type allow to come closer to the threshold of the obtained sensibility limit (detection limit) which is determined with the shot noise. (Author)

  1. Limit of detection of a fiber optics gyroscope using a super luminescent radiation source

    CERN Document Server

    Sandoval, G E

    2003-01-01

    The main objective of this work is to establish the dependence of characteristics of the fiber optics gyroscope (FOG) with respect to the parameters of the super luminescent emission source based on doped optical fiber with rare earth elements (Super luminescent Fiber Source, SFS), argument the pumping rate election of the SFS to obtain characteristics limits of the FOG sensibility. By using this type of emission source in the FOG is recommend to use the rate when the direction of the pumping signal coincide with the super luminescent signal. The most results are the proposition and argumentation of the SFS election as emission source to be use in the FOG of the phase type. Such a decision allow to increase the characteristics of the FOG sensibility in comparison with the use of luminescent source of semiconductors emission which are extensively used in the present time. The use of emission source of the SFS type allow to come closer to the threshold of the obtained sensibility limit (detection limit) which i...

  2. Event Coverage Detection and Event Source Determination in Underwater Wireless Sensor Networks

    Directory of Open Access Journals (Sweden)

    Zhangbing Zhou

    2015-12-01

    Full Text Available With the advent of the Internet of Underwater Things, smart things are deployed in the ocean space and establish underwater wireless sensor networks for the monitoring of vast and dynamic underwater environments. When events are found to have possibly occurred, accurate event coverage should be detected, and potential event sources should be determined for the enactment of prompt and proper responses. To address this challenge, a technique that detects event coverage and determines event sources is developed in this article. Specifically, the occurrence of possible events corresponds to a set of neighboring sensor nodes whose sensory data may deviate from a normal sensing range in a collective fashion. An appropriate sensor node is selected as the relay node for gathering and routing sensory data to sink node(s. When sensory data are collected at sink node(s, the event coverage is detected and represented as a weighted graph, where the vertices in this graph correspond to sensor nodes and the weight specified upon the edges reflects the extent of sensory data deviating from a normal sensing range. Event sources are determined, which correspond to the barycenters in this graph. The results of the experiments show that our technique is more energy efficient, especially when the network topology is relatively steady.

  3. A Method for Harmonic Sources Detection based on Harmonic Distortion Power Rate

    Science.gov (United States)

    Lin, Ruixing; Xu, Lin; Zheng, Xian

    2018-03-01

    Harmonic sources detection at the point of common coupling is an essential step for harmonic contribution determination and harmonic mitigation. The harmonic distortion power rate index is proposed for harmonic source location based on IEEE Std 1459-2010 in the paper. The method only based on harmonic distortion power is not suitable when the background harmonic is large. To solve this problem, a threshold is determined by the prior information, when the harmonic distortion power is larger than the threshold, the customer side is considered as the main harmonic source, otherwise, the utility side is. A simple model of public power system was built in MATLAB/Simulink and field test results of typical harmonic loads verified the effectiveness of proposed method.

  4. Detection and monitoring of pollutant sources with Lidar/Dial techniques

    International Nuclear Information System (INIS)

    Gaudio, P; Gelfusa, M; Malizia, A; Parracino, S; Richetta, M; De Leo, L; Perrimezzi, C; Bellecci, C

    2015-01-01

    It's well known that air pollution due to anthropogenic sources can have adverse effects on humans and the ecosystem. Therefore, in the last years, surveying large regions of the atmosphere in an automatic way has become a strategic objective of various public health organizations for early detection of pollutant sources in urban and industrial areas.The Lidar and Dial techniques have become well established laser based methods for the remote sensing of the atmosphere. They are often implemented to probe almost any level of the atmosphere and to acquire information to validate theoretical models about different topics of atmospheric physics. They can also be used for environment surveying by monitoring particles, aerosols and molecules.The aim of the present work is to demonstrate the potential of these methods to detect pollutants emitted from local sources (such as particulate and/or chemical compounds) and to evaluate their concentration. This is exemplified with the help of experimental data acquired in an industrial area in the south of Italy by mean of experimental campaign by use of pollutants simulated source. For this purpose, two mobile systems Lidar and Dial have been developed by the authors. In this paper there will be presented the operating principles of the system and the results of the experimental campaign. (paper)

  5. Exploring three faint source detections methods for aperture synthesis radio images

    Science.gov (United States)

    Peracaula, M.; Torrent, A.; Masias, M.; Lladó, X.; Freixenet, J.; Martí, J.; Sánchez-Sutil, J. R.; Muñoz-Arjonilla, A. J.; Paredes, J. M.

    2015-04-01

    Wide-field radio interferometric images often contain a large population of faint compact sources. Due to their low intensity/noise ratio, these objects can be easily missed by automated detection methods, which have been classically based on thresholding techniques after local noise estimation. The aim of this paper is to present and analyse the performance of several alternative or complementary techniques to thresholding. We compare three different algorithms to increase the detection rate of faint objects. The first technique consists of combining wavelet decomposition with local thresholding. The second technique is based on the structural behaviour of the neighbourhood of each pixel. Finally, the third algorithm uses local features extracted from a bank of filters and a boosting classifier to perform the detections. The methods' performances are evaluated using simulations and radio mosaics from the Giant Metrewave Radio Telescope and the Australia Telescope Compact Array. We show that the new methods perform better than well-known state of the art methods such as SEXTRACTOR, SAD and DUCHAMP at detecting faint sources of radio interferometric images.

  6. Hypothesis tests for the detection of constant speed radiation moving sources

    Energy Technology Data Exchange (ETDEWEB)

    Dumazert, Jonathan; Coulon, Romain; Kondrasovs, Vladimir; Boudergui, Karim; Sannie, Guillaume; Gameiro, Jordan; Normand, Stephane [CEA, LIST, Laboratoire Capteurs Architectures Electroniques, 99 Gif-sur-Yvette, (France); Mechin, Laurence [CNRS, UCBN, Groupe de Recherche en Informatique, Image, Automatique et Instrumentation de Caen, 4050 Caen, (France)

    2015-07-01

    Radiation Portal Monitors are deployed in linear network to detect radiological material in motion. As a complement to single and multichannel detection algorithms, inefficient under too low signal to noise ratios, temporal correlation algorithms have been introduced. Test hypothesis methods based on empirically estimated mean and variance of the signals delivered by the different channels have shown significant gain in terms of a tradeoff between detection sensitivity and false alarm probability. This paper discloses the concept of a new hypothesis test for temporal correlation detection methods, taking advantage of the Poisson nature of the registered counting signals, and establishes a benchmark between this test and its empirical counterpart. The simulation study validates that in the four relevant configurations of a pedestrian source carrier under respectively high and low count rate radioactive background, and a vehicle source carrier under the same respectively high and low count rate radioactive background, the newly introduced hypothesis test ensures a significantly improved compromise between sensitivity and false alarm, while guaranteeing the stability of its optimization parameter regardless of signal to noise ratio variations between 2 to 0.8. (authors)

  7. Fermi Non-detections of Four X-Ray Jet Sources and Implications for the IC/CMB Mechanism

    Science.gov (United States)

    Breiding, Peter; Meyer, Eileen T.; Georganopoulos, Markos; Keenan, M. E.; DeNigris, N. S.; Hewitt, Jennifer

    2017-11-01

    Since its launch in 1999, the Chandra X-ray observatory has discovered several dozen X-ray jets associated with powerful quasars. In many cases, the X-ray spectrum is hard and appears to come from a second spectral component. The most popular explanation for the kpc-scale X-ray emission in these cases has been inverse-Compton (IC) scattering of Cosmic Microwave Background (CMB) photons by relativistic electrons in the jet (the IC/CMB model). Requiring the IC/CMB emission to reproduce the observed X-ray flux density inevitably predicts a high level of gamma-ray emission, which should be detectable with the Fermi Large Area Telescope (LAT). In previous work, we found that gamma-ray upper limits from the large-scale jets of 3C 273 and PKS 0637-752 violate the predictions of the IC/CMB model. Here, we present Fermi/LAT flux density upper limits for the X-ray jets of four additional sources: PKS 1136-135, PKS 1229-021, PKS 1354+195, and PKS 2209+080. We show that these limits violate the IC/CMB predictions at a very high significance level. We also present new Hubble Space Telescope observations of the quasar PKS 2209+080 showing a newly detected optical jet, and Atacama Large Millimeter/submillimeter Array band 3 and 6 observations of all four sources, which provide key constraints on the spectral shape that enable us to rule out the IC/CMB model.

  8. External phenome analysis enables a rational federated query strategy to detect changing rates of treatment-related complications associated with multiple myeloma.

    Science.gov (United States)

    Warner, Jeremy L; Alterovitz, Gil; Bodio, Kelly; Joyce, Robin M

    2013-01-01

    Electronic health records (EHRs) are increasingly useful for health services research. For relatively uncommon conditions, such as multiple myeloma (MM) and its treatment-related complications, a combination of multiple EHR sources is essential for such research. The Shared Health Research Information Network (SHRINE) enables queries for aggregate results across participating institutions. Development of a rational search strategy in SHRINE may be augmented through analysis of pre-existing databases. We developed a SHRINE query for likely non-infectious treatment-related complications of MM, based upon an analysis of the Multiparameter Intelligent Monitoring in Intensive Care (MIMIC II) database. Using this query strategy, we found that the rate of likely treatment-related complications significantly increased from 2001 to 2007, by an average of 6% a year (p=0.01), across the participating SHRINE institutions. This finding is in keeping with increasingly aggressive strategies in the treatment of MM. This proof of concept demonstrates that a staged approach to federated queries, using external EHR data, can yield potentially clinically meaningful results.

  9. Space-Based Detection of Missing Sulfur Dioxide Sources of Global Air Pollution

    Science.gov (United States)

    McLinden, Chris A.; Fioletov, Vitali; Shephard, Mark W.; Krotkov, Nick; Li, Can; Martin, Randall V.; Moran, Michael D.; Joiner, Joanna

    2016-01-01

    Sulfur dioxide is designated a criteria air contaminant (or equivalent) by virtually all developed nations. When released into the atmosphere, sulfur dioxide forms sulfuric acid and fine particulate matter, secondary pollutants that have significant adverse effects on human health, the environment and the economy. The conventional, bottom-up emissions inventories used to assess impacts, however, are often incomplete or outdated, particularly for developing nations that lack comprehensive emission reporting requirements and infrastructure. Here we present a satellite-based, global emission inventory for SO2 that is derived through a simultaneous detection, mapping and emission-quantifying procedure, and thereby independent of conventional information sources. We find that of the 500 or so large sources in our inventory, nearly 40 are not captured in leading conventional inventories. These missing sources are scattered throughout the developing world-over a third are clustered around the Persian Gulf-and add up to 7 to 14 Tg of SO2 yr(exp -1), or roughly 6-12% of the global anthropogenic source. Our estimates of national total emissions are generally in line with conventional numbers, but for some regions, and for SO2 emissions from volcanoes, discrepancies can be as large as a factor of three or more. We anticipate that our inventory will help eliminate gaps in bottom-up inventories, independent of geopolitical borders and source types.

  10. Detection prospects for high energy neutrino sources from the anisotropic matter distribution in the local Universe

    Energy Technology Data Exchange (ETDEWEB)

    Mertsch, Philipp; Rameez, Mohamed; Tamborra, Irene, E-mail: mertsch@nbi.ku.dk, E-mail: mohamed.rameez@nbi.ku.dk, E-mail: tamborra@nbi.ku.dk [Niels Bohr International Academy, Niels Bohr Institute, Blegdamsvej 17, 2100 Copenhagen (Denmark)

    2017-03-01

    Constraints on the number and luminosity of the sources of the cosmic neutrinos detected by IceCube have been set by targeted searches for point sources. We set complementary constraints by using the 2MASS Redshift Survey (2MRS) catalogue, which maps the matter distribution of the local Universe. Assuming that the distribution of the neutrino sources follows that of matter, we look for correlations between ''warm'' spots on the IceCube skymap and the 2MRS matter distribution. Through Monte Carlo simulations of the expected number of neutrino multiplets and careful modelling of the detector performance (including that of IceCube-Gen2), we demonstrate that sources with local density exceeding 10{sup −6} Mpc{sup −3} and neutrino luminosity L {sub ν} ∼< 10{sup 42} erg s{sup −1} (10{sup 41} erg s{sup −1}) will be efficiently revealed by our method using IceCube (IceCube-Gen2). At low luminosities such as will be probed by IceCube-Gen2, the sensitivity of this analysis is superior to requiring statistically significant direct observation of a point source.

  11. Design and construction of an explosive detection system by Tna methods, using 252Cf radioisotope source

    International Nuclear Information System (INIS)

    Tavakkoli Farsouli, A.

    1999-01-01

    Bombs concealed in luggage have threatened human life and property throughout the world's traffic. The plastic explosives could not checked by the X-ray detecting device. Thermal Neutron Activation method has been tested in the present work for non-destructive detection of explosives. A radioisotope neutron source 252 Cf and two gamma spectroscopy systems have been used as a tool to find explosives, regardless of the bomb's shape and the packing materials. The MCNP code has been used to design the neutronic section of the system. The measured thermal neutron fluxes by the gold foils in some location of the system were in good agreement with those data obtained by the MCNP code. Also, detection limits for nitrogen in various counting times were measured. The measurements show that the system is capable to detect 417 gr of HMX explosive material (158 gr nitrogen) by 10 minutes of counting time. To modify the system and to decrease the detection limits some opinions are given

  12. Shadow Detection Based on Regions of Light Sources for Object Extraction in Nighttime Video

    Directory of Open Access Journals (Sweden)

    Gil-beom Lee

    2017-03-01

    Full Text Available Intelligent video surveillance systems detect pre-configured surveillance events through background modeling, foreground and object extraction, object tracking, and event detection. Shadow regions inside video frames sometimes appear as foreground objects, interfere with ensuing processes, and finally degrade the event detection performance of the systems. Conventional studies have mostly used intensity, color, texture, and geometric information to perform shadow detection in daytime video, but these methods lack the capability of removing shadows in nighttime video. In this paper, a novel shadow detection algorithm for nighttime video is proposed; this algorithm partitions each foreground object based on the object’s vertical histogram and screens out shadow objects by validating their orientations heading toward regions of light sources. From the experimental results, it can be seen that the proposed algorithm shows more than 93.8% shadow removal and 89.9% object extraction rates for nighttime video sequences, and the algorithm outperforms conventional shadow removal algorithms designed for daytime videos.

  13. Passive monitoring for near surface void detection using traffic as a seismic source

    Science.gov (United States)

    Zhao, Y.; Kuzma, H. A.; Rector, J.; Nazari, S.

    2009-12-01

    In this poster we present preliminary results based on our several field experiments in which we study seismic detection of voids using a passive array of surface geophones. The source of seismic excitation is vehicle traffic on nearby roads, which we model as a continuous line source of seismic energy. Our passive seismic technique is based on cross-correlation of surface wave fields and studying the resulting power spectra, looking for "shadows" caused by the scattering effect of a void. High frequency noise masks this effect in the time domain, so it is difficult to see on conventional traces. Our technique does not rely on phase distortions caused by small voids because they are generally too tiny to measure. Unlike traditional impulsive seismic sources which generate highly coherent broadband signals, perfect for resolving phase but too weak for resolving amplitude, vehicle traffic affords a high power signal a frequency range which is optimal for finding shallow structures. Our technique results in clear detections of an abandoned railroad tunnel and a septic tank. The ultimate goal of this project is to develop a technology for the simultaneous imaging of shallow underground structures and traffic monitoring near these structures.

  14. Use of Portal Monitors for Detection of Technogenic Radioactive Sources in Scrap Metal

    Science.gov (United States)

    Solovev, D. B.; Merkusheva, A. E.

    2017-11-01

    The article considers the features of organization of scrap-metal primary radiation control on the specialized enterprises engaging in its deep processing and storage at using by primary technical equipment - radiation portal monitors. The issue of this direction relevance, validity of radiation control implementation with the use of radiation portal monitors, physical and organizational bases of radiation control are considered in detail. The emphasis is put on the considerable increase in the number of technogenic radioactive sources detected in scrap-metal that results in the entering into exploitation of radioactive metallic structures as different building wares. One of reasons of such increase of the number of technogenic radioactive sources getting for processing with scrap-metal is the absence of any recommendations on the radiation portal monitors exploitation. The practical division of the article offers to recommendation on tuning of the modes of work of radiation portal monitors depending on influence the weather factor thus allowing to considerably increase the percent of technogenic radioactive sources detection.

  15. Detection of environmental sources of Histoplasma capsulatum in Chiang Mai, Thailand, by nested PCR.

    Science.gov (United States)

    Norkaew, Treepradab; Ohno, Hideaki; Sriburee, Pojana; Tanabe, Koichi; Tharavichitkul, Prasit; Takarn, Piyawan; Puengchan, Tanpalang; Bumrungsri, Sara; Miyazaki, Yoshitsugu

    2013-12-01

    Histoplasmosis is a systemic mycosis caused by inhaling spores of Histoplasma capsulatum, a dimorphic fungus. This fungus grows in soil contaminated with bat and avian excreta. Each year, patients with disseminated histoplasmosis have been diagnosed in Chiang Mai, northern Thailand. No published information is currently available on the environmental sources of this fungus in Chiang Mai or anywhere else in Thailand. The aim of this study was to detect H. capsulatum in soil samples contaminated with bat guano and avian droppings by nested PCR. Two hundred and sixty-five samples were collected from the following three sources: soil contaminated with bat guano, 88 samples; soil contaminated with bird droppings, 86 samples; and soil contaminated with chicken droppings, 91 samples. Genomic DNA was directly extracted from each sample, and H. capsulatum was detected by nested PCR using a primer set specific to a gene encoding 100-kDa-like protein (HcI, HcII and HcIII, HcIV). Histoplasma capsulatum was detected in seven of 88 soil samples contaminated with bat guano, one of 21 soil samples contaminated with pigeon droppings and 10 of 91 soil samples contaminated with chicken droppings. The results indicate the possibility of the association of bat guano and chicken droppings with H. capsulatum in this area of Thailand.

  16. Astronomers Detect Powerful Bursting Radio Source Discovery Points to New Class of Astronomical Objects

    Science.gov (United States)

    2005-03-01

    Astronomers at Sweet Briar College and the Naval Research Laboratory (NRL) have detected a powerful new bursting radio source whose unique properties suggest the discovery of a new class of astronomical objects. The researchers have monitored the center of the Milky Way Galaxy for several years and reveal their findings in the March 3, 2005 edition of the journal, “Nature”. This radio image of the central region of the Milky Way Galaxy holds a new radio source, GCRT J1745-3009. The arrow points to an expanding ring of debris expelled by a supernova. CREDIT: N.E. Kassim et al., Naval Research Laboratory, NRAO/AUI/NSF Principal investigator, Dr. Scott Hyman, professor of physics at Sweet Briar College, said the discovery came after analyzing some additional observations from 2002 provided by researchers at Northwestern University. “"We hit the jackpot!” Hyman said referring to the observations. “An image of the Galactic center, made by collecting radio waves of about 1-meter in wavelength, revealed multiple bursts from the source during a seven-hour period from Sept. 30 to Oct. 1, 2002 — five bursts in fact, and repeating at remarkably constant intervals.” Hyman, four Sweet Briar students, and his NRL collaborators, Drs. Namir Kassim and Joseph Lazio, happened upon transient emission from two radio sources while studying the Galactic center in 1998. This prompted the team to propose an ongoing monitoring program using the National Science Foundation’s Very Large Array (VLA) radio telescope in New Mexico. The National Radio Astronomy Observatory, which operates the VLA, approved the program. The data collected, laid the groundwork for the detection of the new radio source. “Amazingly, even though the sky is known to be full of transient objects emitting at X- and gamma-ray wavelengths,” NRL astronomer Dr. Joseph Lazio pointed out, “very little has been done to look for radio bursts, which are often easier for astronomical objects to produce

  17. Development of the detection technology of the source area derived from nuclear activities

    International Nuclear Information System (INIS)

    Suh, Kyungsuk; Kim, Ingyu; Keum, Dongkwon; Lim, Kwangmuk; Lee, Jinyong

    2012-07-01

    - It is necessary to establish of the overall preparedness for analysis of the nuclear activities near the neighboring countries by increasing of the construction of the nuclear power plants and reprocessing facilities in China, North Korean Japan and Russia. - In Korea, the analysis and measurements for nuclear activities have been conducted, however the detection technology to find out the source area has not been developed. It is important to estimate the source origin of the radioisotope from the neighboring countries including Korea in the aspects of the surveillance and safety for the covert nuclear activities in Northeast Asia region - In this study, the data DB, treatment of the weather data and the development of connection module were conducted to track the origin of the radioisotope in the first year of the research. It had constructed the DB like the reactor types, places in China, Taiwan, Japan and Korea and the release amounts of the noble gas released into the air

  18. Development of the detection technology of the source area derived from nuclear activities

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Kyungsuk; Kim, Ingyu; Keum, Dongkwon; Lim, Kwangmuk; Lee, Jinyong

    2012-07-15

    - It is necessary to establish of the overall preparedness for analysis of the nuclear activities near the neighboring countries by increasing of the construction of the nuclear power plants and reprocessing facilities in China, North Korean Japan and Russia. - In Korea, the analysis and measurements for nuclear activities have been conducted, however the detection technology to find out the source area has not been developed. It is important to estimate the source origin of the radioisotope from the neighboring countries including Korea in the aspects of the surveillance and safety for the covert nuclear activities in Northeast Asia region - In this study, the data DB, treatment of the weather data and the development of connection module were conducted to track the origin of the radioisotope in the first year of the research. It had constructed the DB like the reactor types, places in China, Taiwan, Japan and Korea and the release amounts of the noble gas released into the air.

  19. Using an alternate light source to detect electrically singed feathers and hair in a forensic setting.

    Science.gov (United States)

    Viner, Tabitha C; Kagan, Rebecca A; Johnson, Jennifer L

    2014-01-01

    Mortality due to electrical injury in wildlife may occur in the form of lightning strike or power line contact. Evidence of electrical contact may be grossly obvious, with extensive singeing, curling, and blackening of feathers, fur, or skin. Occasionally, changes may be subtle, owing to lower current or reduced conductivity, making a definitive diagnosis of electrocution more difficult. We describe the use of an alternate light source in the examination of cases of lightning strike and power line contact in wildlife, and the enhanced detection of changes due to electrical currents in the hair and feathers of affected animals. Subtle changes in the wing feathers of 12 snow geese and 1 wolf that were struck by separate lightning events were made obvious by the use of an alternate light source. Similarly, this technique can be used to strengthen the evidence for power line exposure in birds. Published by Elsevier Ireland Ltd.

  20. Molecular detection of Fasciola hepatica in water sources of District Nowshehra Khyber Pakhtunkhwa Pakistan

    Science.gov (United States)

    Khan, Imran; Khan, Amir Muhammad; Ayaz, Khan, Sanaullah; Anees, Muhammad; Khan, Shaukat Ali

    2012-12-01

    Fascioliasis is spread through contamination of water sources and cause morbidity throughout the world. In the current study 300 water samples were processed by PCR for detection of Fasciola hepatica. The overall prevalence in different water sources was 9.66 % (29/300). Highest prevalence was recorded in drain water16 % (16/100) followed by tube well water 10% (4/40), open well water 8 % (8/100) and the lowest was recorded in tap water 1.66 %(1/60). The significant difference P < 0.05 was recorded during data analysis. The highest prevalence was recorded in summer. It was concluded from the study that cleaning and filtration should be adopted to avoid the health hazards against water borne zoonotic parasites.

  1. Design and construction of tank robot for detection and searching of radiation sources

    International Nuclear Information System (INIS)

    Rio Isman; Djiwo Harsono; Adi Abimanyu

    2016-01-01

    Developments of robotics technology can be implemented for searching the lost radiation source. Radiation source lost case allows the radiation dose exceeding NBD received by radiation worker when security precautions are taken. This research propose a robot tank that can help in detection and searching radiation sources. The robot consists of a micro controller board Arduino Mega 2560, XBee Pro S radio frequency modules, Gaps receiver U-B lox Neo-Mn-0-01, a servo motor and two DC motors. In this research, the amount of radiation is calculated in 0-5 volt analog voltage that is simulated using a potentiometer and then converted to a digital voltage value (0-1023) using ADC 10 bit Arduino Mega 2560. Results of the research show that the robot has a size of 28.7 cm x 24.8 cm x 11 cm, able to move forward with a speed of 0.477 m/s and are capable to rotate in 24 angles. Data transmission can be performed wireless up to 113 m in an open area without any changes of format and length of the data. Robot capable to rotate and move towards the angle which has the largest voltage readings so can predict the location of the radiation source. (author)

  2. CERN Web Application Detection. Refactoring and release as open source software

    CERN Document Server

    Lizonczyk, Piotr

    2015-01-01

    This paper covers my work during my assignment as participant of CERN Summer Students 2015 programme. The project was aimed at refactoring and publication of the Web Application Detection tool, which was developed at CERN and priorly used internally by the Computer Security team. The range of tasks performed include initial refactoring of code, which was developed like a script rather than a Python package, through extracting components that were not specific to CERN usage, the subsequent final release of the source code on GitHub and the integration with third-party software i.e. the w3af tool. Ultimately, Web Application Detection software received positive responses, being downloaded ca. 1500 times at the time of writing this report.

  3. Symbiotic Stars in X-rays. II. Faint Sources Detected with XMM-Newton and Chandra

    Science.gov (United States)

    Nunez, N. E.; Luna, G. J. M.; Pillitteri, I.; Mukai, K.

    2014-01-01

    We report the detection from four symbiotic stars that were not known to be X-ray sources. These four object show a ß-type X-ray spectrum, that is, their spectra can be modeled with an absorbed optically thin thermal emission with temperatures of a few million degrees. Photometric series obtained with the Optical Monitor on board XMM-Newton from V2416 Sgr and NSV 25735 support the proposed scenario where the X-ray emission is produced in a shock-heated region inside the symbiotic nebulae.

  4. Detection of air pollution sources in Israel by isotope-induced XRF

    International Nuclear Information System (INIS)

    Boazi, M.; Shenberg, C.

    1978-01-01

    Aerosol samples from urban, industrial and traffic areas were collected and analyzed for various elements using isotope-induced XRF. A 10 mCi 241 Am annular source, enclosed in lead housing, was used to excite the K X-rays of an iodine target. A lithium drifted silicon diode (25 mm 2 area, 3.0 mm depletion depth) with a 0.125 mm beryllium window, was used for detection. The detector was coupled through a low-noise preamplifier and a linear amplifier to a 400-channel analyzer. The resolution (FWHM) for the 6.4 keV FeKsub(α) X-rays was approximately 180 eV. The correlation between the multielement content of the samples and their sources was studied. It was found necessary to analyze samples before and after ashing because, while ashing improves the peak-to-background ratio, volatile elements may be lost. Samples collected at heights of 1.5 and 15 m were found to have the same elemental composition. Samples collected on consecutive filters showed sharp elemental fractionation. An example of source identification is given for a high traffic area as compared with an area in which a large bromine plant is located. In both cases different Pb:Br ratios were observed, with high bromine concentration in the latter. The analytical method used was based on the detection of characteristic K and L X-rays induced by a 241 Am-I source-target assembly. (T.G.)

  5. Single sources in the low-frequency gravitational wave sky: properties and time to detection by pulsar timing arrays

    Science.gov (United States)

    Kelley, Luke Zoltan; Blecha, Laura; Hernquist, Lars; Sesana, Alberto; Taylor, Stephen R.

    2018-06-01

    We calculate the properties, occurrence rates and detection prospects of individually resolvable `single sources' in the low-frequency gravitational wave (GW) spectrum. Our simulations use the population of galaxies and massive black hole binaries from the Illustris cosmological hydrodynamic simulations, coupled to comprehensive semi-analytic models of the binary merger process. Using mock pulsar timing arrays (PTA) with, for the first time, varying red-noise models, we calculate plausible detection prospects for GW single sources and the stochastic GW background (GWB). Contrary to previous results, we find that single sources are at least as detectable as the GW background. Using mock PTA, we find that these `foreground' sources (also `deterministic'/`continuous') are likely to be detected with ˜20 yr total observing baselines. Detection prospects, and indeed the overall properties of single sources, are only moderately sensitive to binary evolution parameters - namely eccentricity and environmental coupling, which can lead to differences of ˜5 yr in times to detection. Red noise has a stronger effect, roughly doubling the time to detection of the foreground between a white-noise only model (˜10-15 yr) and severe red noise (˜20-30 yr). The effect of red noise on the GWB is even stronger, suggesting that single source detections may be more robust. We find that typical signal-to-noise ratios for the foreground peak near f = 0.1 yr-1, and are much less sensitive to the continued addition of new pulsars to PTA.

  6. Detection of pulmonary nodules at paediatric CT: maximum intensity projections and axial source images are complementary

    International Nuclear Information System (INIS)

    Kilburn-Toppin, Fleur; Arthurs, Owen J.; Tasker, Angela D.; Set, Patricia A.K.

    2013-01-01

    Maximum intensity projection (MIP) images might be useful in helping to differentiate small pulmonary nodules from adjacent vessels on thoracic multidetector CT (MDCT). The aim was to evaluate the benefits of axial MIP images over axial source images for the paediatric chest in an interobserver variability study. We included 46 children with extra-pulmonary solid organ malignancy who had undergone thoracic MDCT. Three radiologists independently read 2-mm axial and 10-mm MIP image datasets, recording the number of nodules, size and location, overall time taken and confidence. There were 83 nodules (249 total reads among three readers) in 46 children (mean age 10.4 ± 4.98 years, range 0.3-15.9 years; 24 boys). Consensus read was used as the reference standard. Overall, three readers recorded significantly more nodules on MIP images (228 vs. 174; P < 0.05), improving sensitivity from 67% to 77.5% (P < 0.05) but with lower positive predictive value (96% vs. 85%, P < 0.005). MIP images took significantly less time to read (71.6 ± 43.7 s vs. 92.9 ± 48.7 s; P < 0.005) but did not improve confidence levels. Using 10-mm axial MIP images for nodule detection in the paediatric chest enhances diagnostic performance, improving sensitivity and reducing reading time when compared with conventional axial thin-slice images. Axial MIP and axial source images are complementary in thoracic nodule detection. (orig.)

  7. Nasu 1.4 GHz Interferometer Transient Radio Source Survey and Improvement in Detection of Radio Sources

    International Nuclear Information System (INIS)

    Matsumura, Nobuo; Kuniyoshi, Masaya; Takefuji, Kazuhiro; Niinuma, Kotaro; Kida, Sumiko; Takeuchi, Akihiko; Asuma, Kuniyuki; Daishido, Tsuneaki

    2006-01-01

    We have surveyed 1.4GHz transient radio sources in Nasu Pulsar Observatory. To investigate such sources, both immediacy and accuracy are severely maintained. We have developed Data Transfer System and improved antenna control system. Now we have received the fringe data from transient radio source candidates. To get reliable information, we carefully analyze with Fringe Band Pass Filter software and Fringe Fitting method

  8. Open-Source Radiation Exposure Extraction Engine (RE3) with Patient-Specific Outlier Detection.

    Science.gov (United States)

    Weisenthal, Samuel J; Folio, Les; Kovacs, William; Seff, Ari; Derderian, Vana; Summers, Ronald M; Yao, Jianhua

    2016-08-01

    We present an open-source, picture archiving and communication system (PACS)-integrated radiation exposure extraction engine (RE3) that provides study-, series-, and slice-specific data for automated monitoring of computed tomography (CT) radiation exposure. RE3 was built using open-source components and seamlessly integrates with the PACS. RE3 calculations of dose length product (DLP) from the Digital imaging and communications in medicine (DICOM) headers showed high agreement (R (2) = 0.99) with the vendor dose pages. For study-specific outlier detection, RE3 constructs robust, automatically updating multivariable regression models to predict DLP in the context of patient gender and age, scan length, water-equivalent diameter (D w), and scanned body volume (SBV). As proof of concept, the model was trained on 811 CT chest, abdomen + pelvis (CAP) exams and 29 outliers were detected. The continuous variables used in the outlier detection model were scan length (R (2)  = 0.45), D w (R (2) = 0.70), SBV (R (2) = 0.80), and age (R (2) = 0.01). The categorical variables were gender (male average 1182.7 ± 26.3 and female 1047.1 ± 26.9 mGy cm) and pediatric status (pediatric average 710.7 ± 73.6 mGy cm and adult 1134.5 ± 19.3 mGy cm).

  9. Detecting and analyzing soil phosphorus loss associated with critical source areas using a remote sensing approach.

    Science.gov (United States)

    Lou, Hezhen; Yang, Shengtian; Zhao, Changsen; Shi, Liuhua; Wu, Linna; Wang, Yue; Wang, Zhiwei

    2016-12-15

    The detection of critical source areas (CSAs) is a key step in managing soil phosphorus (P) loss and preventing the long-term eutrophication of water bodies at regional scale. Most related studies, however, focus on a local scale, which prevents a clear understanding of the spatial distribution of CSAs for soil P loss at regional scale. Moreover, the continual, long-term variation in CSAs was scarcely reported. It is impossible to identify the factors driving the variation in CSAs, or to collect land surface information essential for CSAs detection, by merely using the conventional methodologies at regional scale. This study proposes a new regional-scale approach, based on three satellite sensors (ASTER, TM/ETM and MODIS), that were implemented successfully to detect CSAs at regional scale over 15years (2000-2014). The approach incorporated five factors (precipitation, slope, soil erosion, land use, soil total phosphorus) that drive soil P loss from CSAs. Results show that the average area of critical phosphorus source areas (CPSAs) was 15,056km 2 over the 15-year period, and it occupied 13.8% of the total area, with a range varying from 1.2% to 23.0%, in a representative, intensive agricultural area of China. In contrast to previous studies, we found that the locations of CSAs with P loss are spatially variable, and are more dispersed in their distribution over the long term. We also found that precipitation acts as a key driving factor in the variation of CSAs at regional scale. The regional-scale method can provide scientific guidance for managing soil phosphorus loss and preventing the long-term eutrophication of water bodies at regional scale, and shows great potential for exploring factors that drive the variation in CSAs at global scale. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Detection of embedded radiation sources using temporal variation of gamma spectral data.

    Energy Technology Data Exchange (ETDEWEB)

    Shokair, Isaac R.

    2011-09-01

    Conventional full spectrum gamma spectroscopic analysis has the objective of quantitative identification of all the isotopes present in a measurement. For low energy resolution detectors, when photopeaks alone are not sufficient for complete isotopic identification, such analysis requires template spectra for all the isotopes present in the measurement. When many isotopes are present it is difficult to make the correct identification and this process often requires many trial solutions by highly skilled spectroscopists. This report investigates the potential of a new analysis method which uses spatial/temporal information from multiple low energy resolution measurements to test the hypothesis of the presence of a target spectrum of interest in these measurements without the need to identify all the other isotopes present. This method is referred to as targeted principal component analysis (TPCA). For radiation portal monitor applications, multiple measurements of gamma spectra are taken at equally spaced time increments as a vehicle passes through the portal and the TPCA method is directly applicable to this type of measurement. In this report we describe the method and investigate its application to the problem of detection of a radioactive localized source that is embedded in a distributed source in the presence of an ambient background. Examples using simulated spectral measurements indicate that this method works very well and has the potential for automated analysis for RPM applications. This method is also expected to work well for isotopic detection in the presence of spectrally and spatially varying backgrounds as a result of vehicle-induced background suppression. Further work is needed to include effects of shielding, to understand detection limits, setting of thresholds, and to estimate false positive probability.

  11. A novel method for detecting light source for digital images forensic

    Science.gov (United States)

    Roy, A. K.; Mitra, S. K.; Agrawal, R.

    2011-06-01

    Manipulation in image has been in practice since centuries. These manipulated images are intended to alter facts — facts of ethics, morality, politics, sex, celebrity or chaos. Image forensic science is used to detect these manipulations in a digital image. There are several standard ways to analyze an image for manipulation. Each one has some limitation. Also very rarely any method tried to capitalize on the way image was taken by the camera. We propose a new method that is based on light and its shade as light and shade are the fundamental input resources that may carry all the information of the image. The proposed method measures the direction of light source and uses the light based technique for identification of any intentional partial manipulation in the said digital image. The method is tested for known manipulated images to correctly identify the light sources. The light source of an image is measured in terms of angle. The experimental results show the robustness of the methodology.

  12. Particle Filter with Integrated Voice Activity Detection for Acoustic Source Tracking

    Directory of Open Access Journals (Sweden)

    Anders M. Johansson

    2007-01-01

    Full Text Available In noisy and reverberant environments, the problem of acoustic source localisation and tracking (ASLT using an array of microphones presents a number of challenging difficulties. One of the main issues when considering real-world situations involving human speakers is the temporally discontinuous nature of speech signals: the presence of silence gaps in the speech can easily misguide the tracking algorithm, even in practical environments with low to moderate noise and reverberation levels. A natural extension of currently available sound source tracking algorithms is the integration of a voice activity detection (VAD scheme. We describe a new ASLT algorithm based on a particle filtering (PF approach, where VAD measurements are fused within the statistical framework of the PF implementation. Tracking accuracy results for the proposed method is presented on the basis of synthetic audio samples generated with the image method, whereas performance results obtained with a real-time implementation of the algorithm, and using real audio data recorded in a reverberant room, are published elsewhere. Compared to a previously proposed PF algorithm, the experimental results demonstrate the improved robustness of the method described in this work when tracking sources emitting real-world speech signals, which typically involve significant silence gaps between utterances.

  13. Application of leftover sample material from waterborne protozoa monitoring for the molecular detection of Bacteroidales and fecal source tracking markers

    Science.gov (United States)

    In this study, we examined the potential for detecting fecal bacteria and microbial source tracking markers in samples discarded during the concentration of Cryptosporidium and Giardia using USEPA Method 1623. Recovery rates for different fecal bacteria were determined using sp...

  14. Near-infrared Polarimetry of the Outflow Source AFGL 6366S: Detection of Circular Polarization

    Science.gov (United States)

    Kwon, Jungmi; Nakagawa, Takao; Tamura, Motohide; Hough, James H.; Kandori, Ryo; Choi, Minho; Kang, Miju; Cho, Jungyeon; Nakajima, Yasushi; Nagata, Tetsuya

    2018-07-01

    We have carried out near-infrared circular and linear imaging polarimetry of the AFGL 6366S region. There is one large infrared reflection nebula associated with the AFGL 6366S cluster and one small infrared reflection nebula associated with AFGL 6366S NE. Prominent and extended polarized nebulosities over the AFGL 6366S cluster field are found to be composed of several components and local nebula peaks, and those nebulosities are illuminated by at least three sources, which is roughly consistent with a previous study. However, the detailed linear polarization patterns and their degrees differ from the earlier study. The brightest regions of the nebulae are illuminated by the IRAS/WISE source. In addition, we report the first detection of circular polarization (CP) in the reflection nebula associated with AFGL 6366S. The CP is as large as approximately 4% in the K s band, and the maximum CP extent is approximately 0.45 pc, which is comparable to that for the largest CP regions known to date, such as Orion and Mon R2, although the CP degrees are much smaller. The CP pattern is mostly quadrupolar, and its morphology resembles the shape of the C18O dense core. Therefore, the CP region is probably illuminated by the IRAS/WISE source and its polarization is amplified by the dichroic absorption of the dense core associated with the cluster. This is the ninth source whose degrees of CPs are measured to be greater than 3%, suggesting that large and extended infrared CP regions are common among mid- to high-mass young stellar objects.

  15. In-source collision induced dissociation of inorganic explosives for mass spectrometric signature detection and chemical imaging

    Energy Technology Data Exchange (ETDEWEB)

    Forbes, Thomas P., E-mail: thomas.forbes@nist.gov; Sisco, Edward

    2015-09-10

    The trace detection, bulk quantification, and chemical imaging of inorganic explosives and components was demonstrated utilizing in-source collision induced dissociation (CID) coupled with laser desorption/ionization mass spectrometry (LDI-MS). The incorporation of in-source CID provided direct control over the extent of adduct and cluster fragmentation as well as organic noise reduction for the enhanced detection of both the elemental and molecular ion signatures of fuel-oxidizer mixtures and other inorganic components of explosive devices. Investigation of oxidizer molecular anions, specifically, nitrates, chlorates, and perchlorates, identified that the optimal in-source CID existed at the transition between fragmentation of the ionic salt bonds and molecular anion bonds. The chemical imaging of oxidizer particles from latent fingerprints was demonstrated, including both cation and anion components in positive and negative mode mass spectrometry, respectively. This investigation demonstrated LDI-MS with in-source CID as a versatile tool for security fields, as well as environmental monitoring and nuclear safeguards, facilitating the detection of elemental and molecular inorganic compounds at nanogram levels. - Highlights: • In-source CID enhanced detection of elemental inorganics up to 1000-fold. • In-source CID optimization of polyatomic oxidizers enhanced detection up to 100-fold. • Optimal CID identified at transition from breaking ionic salt to molecular anion bonds. • Trace detection of inorganic explosives at nanogram levels was demonstrated. • Oxidizer particles were chemically imaged directly from latent fingerprints.

  16. Participatory mapping of target areas to enable operational larval source management to suppress malaria vector mosquitoes in Dar es Salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Dongus Stefan

    2007-09-01

    Full Text Available Abstract Background Half of the population of Africa will soon live in towns and cities where it can be protected from malaria by controlling aquatic stages of mosquitoes. Rigorous but affordable and scaleable methods for mapping and managing mosquito habitats are required to enable effective larval control in urban Africa. Methods A simple community-based mapping procedure that requires no electronic devices in the field was developed to facilitate routine larval surveillance in Dar es Salaam, Tanzania. The mapping procedure included (1 community-based development of sketch maps and (2 verification of sketch maps through technical teams using laminated aerial photographs in the field which were later digitized and analysed using Geographical Information Systems (GIS. Results Three urban wards of Dar es Salaam were comprehensively mapped, covering an area of 16.8 km2. Over thirty percent of this area were not included in preliminary community-based sketch mapping, mostly because they were areas that do not appear on local government residential lists. The use of aerial photographs and basic GIS allowed rapid identification and inclusion of these key areas, as well as more equal distribution of the workload of malaria control field staff. Conclusion The procedure developed enables complete coverage of targeted areas with larval control through comprehensive spatial coverage with community-derived sketch maps. The procedure is practical, affordable, and requires minimal technical skills. This approach can be readily integrated into malaria vector control programmes, scaled up to towns and cities all over Tanzania and adapted to urban settings elsewhere in Africa.

  17. Sources

    International Nuclear Information System (INIS)

    Duffy, L.P.

    1991-01-01

    This paper discusses the sources of radiation in the narrow perspective of radioactivity and the even narrow perspective of those sources that concern environmental management and restoration activities at DOE facilities, as well as a few related sources. Sources of irritation, Sources of inflammatory jingoism, and Sources of information. First, the sources of irritation fall into three categories: No reliable scientific ombudsman to speak without bias and prejudice for the public good, Technical jargon with unclear definitions exists within the radioactive nomenclature, and Scientific community keeps a low-profile with regard to public information. The next area of personal concern are the sources of inflammation. This include such things as: Plutonium being described as the most dangerous substance known to man, The amount of plutonium required to make a bomb, Talk of transuranic waste containing plutonium and its health affects, TMI-2 and Chernobyl being described as Siamese twins, Inadequate information on low-level disposal sites and current regulatory requirements under 10 CFR 61, Enhanced engineered waste disposal not being presented to the public accurately. Numerous sources of disinformation regarding low level radiation high-level radiation, Elusive nature of the scientific community, The Federal and State Health Agencies resources to address comparative risk, and Regulatory agencies speaking out without the support of the scientific community

  18. Testing seismic amplitude source location for fast debris-flow detection at Illgraben, Switzerland

    Science.gov (United States)

    Walter, Fabian; Burtin, Arnaud; McArdell, Brian W.; Hovius, Niels; Weder, Bianca; Turowski, Jens M.

    2017-06-01

    Heavy precipitation can mobilize tens to hundreds of thousands of cubic meters of sediment in steep Alpine torrents in a short time. The resulting debris flows (mixtures of water, sediment and boulders) move downstream with velocities of several meters per second and have a high destruction potential. Warning protocols for affected communities rely on raising awareness about the debris-flow threat, precipitation monitoring and rapid detection methods. The latter, in particular, is a challenge because debris-flow-prone torrents have their catchments in steep and inaccessible terrain, where instrumentation is difficult to install and maintain. Here we test amplitude source location (ASL) as a processing scheme for seismic network data for early warning purposes. We use debris-flow and noise seismograms from the Illgraben catchment, Switzerland, a torrent system which produces several debris-flow events per year. Automatic in situ detection is currently based on geophones mounted on concrete check dams and radar stage sensors suspended above the channel. The ASL approach has the advantage that it uses seismometers, which can be installed at more accessible locations where a stable connection to mobile phone networks is available for data communication. Our ASL processing uses time-averaged ground vibration amplitudes to estimate the location of the debris-flow front. Applied to continuous data streams, inversion of the seismic amplitude decay throughout the network is robust and efficient, requires no manual identification of seismic phase arrivals and eliminates the need for a local seismic velocity model. We apply the ASL technique to a small debris-flow event on 19 July 2011, which was captured with a temporary seismic monitoring network. The processing rapidly detects the debris-flow event half an hour before arrival at the outlet of the torrent and several minutes before detection by the in situ alarm system. An analysis of continuous seismic records furthermore

  19. Testing seismic amplitude source location for fast debris-flow detection at Illgraben, Switzerland

    Directory of Open Access Journals (Sweden)

    F. Walter

    2017-06-01

    Full Text Available Heavy precipitation can mobilize tens to hundreds of thousands of cubic meters of sediment in steep Alpine torrents in a short time. The resulting debris flows (mixtures of water, sediment and boulders move downstream with velocities of several meters per second and have a high destruction potential. Warning protocols for affected communities rely on raising awareness about the debris-flow threat, precipitation monitoring and rapid detection methods. The latter, in particular, is a challenge because debris-flow-prone torrents have their catchments in steep and inaccessible terrain, where instrumentation is difficult to install and maintain. Here we test amplitude source location (ASL as a processing scheme for seismic network data for early warning purposes. We use debris-flow and noise seismograms from the Illgraben catchment, Switzerland, a torrent system which produces several debris-flow events per year. Automatic in situ detection is currently based on geophones mounted on concrete check dams and radar stage sensors suspended above the channel. The ASL approach has the advantage that it uses seismometers, which can be installed at more accessible locations where a stable connection to mobile phone networks is available for data communication. Our ASL processing uses time-averaged ground vibration amplitudes to estimate the location of the debris-flow front. Applied to continuous data streams, inversion of the seismic amplitude decay throughout the network is robust and efficient, requires no manual identification of seismic phase arrivals and eliminates the need for a local seismic velocity model. We apply the ASL technique to a small debris-flow event on 19 July 2011, which was captured with a temporary seismic monitoring network. The processing rapidly detects the debris-flow event half an hour before arrival at the outlet of the torrent and several minutes before detection by the in situ alarm system. An analysis of continuous seismic

  20. Electron Signal Detection for the Beam-Finder Wire of the Linac Coherent Light Source Undulator

    International Nuclear Information System (INIS)

    Wu, Juhao; Emma, P.; Field, R.C.; SLAC

    2006-01-01

    The Linac Coherent Light Source (LCLS) is a SASE x-ray Free-Electron Laser (FEL) based on the final kilometer of the Stanford Linear Accelerator. The tight tolerances for positioning the electron beam close to the undulator axis calls for the introduction of Beam Finder Wire (BFW) device. A BFW device close to the upstream end of the undulator segment and a quadrupole close to the down stream end of the undulator segment will allow a beam-based undulator segment alignment. Based on the scattering of the electrons on the BFW, we can detect the electron signal in the main dump bends after the undulator to find the beam position. We propose to use a threshold Cherenkov counter for this purpose. According to the signal strength at such a Cherenkov counter, we then suggest choice of material and size for such a BFW device in the undulator

  1. Multi-element sewer slime impact pattern--a quantitative characteristic enabling identification of the source of heavy metal discharges into sewer systems.

    Science.gov (United States)

    Kintrup, J; Wünsch, G

    2001-11-01

    The capability of sewer slime to accumulate heavy metals from municipal wastewater can be exploited to identify the sources of sewage sludge pollution. Former investigations of sewer slime looked for a few elements only and could, therefore, not account for deviations of the enrichment efficiency of the slime or for irregularities from sampling. Results of ICP-MS multi element determinations were analyzed by multivariate statistical methods. A new dimensionless characteristic "sewer slime impact" is proposed, which is zero for unloaded samples. Patterns expressed in this data format specifically extract the information required to identify the type of pollution and polluter quicker and with less effort and cost than hitherto.

  2. The optimal on-source region size for detections with counting-type telescopes

    Energy Technology Data Exchange (ETDEWEB)

    Klepser, Stefan

    2017-01-15

    The on-source region is typically a circular area with radius θ in which the signal is expected to appear with the shape of the instrument point spread function (PSF). This paper addresses the question of what is the θ that maximises the probability of detection for a given PSF width and background event density. In the high count number limit and assuming a Gaussian PSF profile, the optimum is found to be at ζ{sup 2}{sub ∞}∼2.51 times the squared PSF width σ{sup 2}{sub PSF39}. While this number is shown to be a good choice in many cases, a dynamic formula for cases of lower count numbers, which favour larger on-source regions, is given. The recipe to get to this parametrisation can also be applied to cases with a non-Gaussian PSF. This result can standardise and simplify analysis procedures, reduce trials and eliminate the need for experience-based ad hoc cut definitions or expensive case-by-case Monte Carlo simulations.

  3. Application of wireless sensor network to problems of detection and tracking of radioactive sources

    International Nuclear Information System (INIS)

    Dupuy, P

    2006-01-01

    International efforts are being conducted to warranty a continuous control of radioactive sources. A theoretical and practical study has been achieved about the feasibility of installing wireless sensor networks on nuclear installations, or plants that uses radioactive material. The study is faced through the implementation of a system designed over the relatively new platform of motes, that gives a great flexibility for distributing sensors taking advantages of new wireless technologies and high-level programming. The work shows an analysis of the state of the technique of sensors, detectors, antennas and power supply including nuclear power supply. It also shows contributions on these fields by experimentation and proposed designs. Three applications that justify the technology are shown and a demonstration project is proposed. The social improvements of the system basically are a technical approach to the continuous control of radioactive sources during their life cycle and the online monitoring of the staff with the possibility of identifying and optimizing the procedures that are the maximum of expositions in practice or detecting potentials expositions [es

  4. The optimal on-source region size for detections with counting-type telescopes

    International Nuclear Information System (INIS)

    Klepser, Stefan

    2017-01-01

    The on-source region is typically a circular area with radius θ in which the signal is expected to appear with the shape of the instrument point spread function (PSF). This paper addresses the question of what is the θ that maximises the probability of detection for a given PSF width and background event density. In the high count number limit and assuming a Gaussian PSF profile, the optimum is found to be at ζ"2_∞∼2.51 times the squared PSF width σ"2_P_S_F_3_9. While this number is shown to be a good choice in many cases, a dynamic formula for cases of lower count numbers, which favour larger on-source regions, is given. The recipe to get to this parametrisation can also be applied to cases with a non-Gaussian PSF. This result can standardise and simplify analysis procedures, reduce trials and eliminate the need for experience-based ad hoc cut definitions or expensive case-by-case Monte Carlo simulations.

  5. THE EARLY DETECTION OF THE EMERALD ASH BORER (EAB USING MULTI-SOURCE REMOTELY SENSED DATA

    Directory of Open Access Journals (Sweden)

    B. Hu

    2018-04-01

    Full Text Available The objectives of this study were to exploit the synergy of hyperspectral imagery, Light Detection And Ranging (LiDAR and high spatial resolution data and their synergy in the early detection of the EAB (Emerald Ash Borer presence in trees within urban areas and to develop a framework to combine information extracted from multiple data sources. To achieve these, an object-oriented framework was developed to combine information derived from available data sets to characterize ash trees. Within this framework, an advanced individual tree delineation method was developed to delineate individual trees using the combined high-spatial resolution worldview-3 imagery was used together with LiDAR data. Individual trees were then classified to ash and non-ash trees using spectral and spatial information. In order to characterize the health state of individual ash trees, leaves from ash trees with various health states were sampled and measured using a field spectrometer. Based on the field measurements, the best indices that sensitive to leaf chlorophyll content were selected. The developed framework and methods were tested using worldview-3, airborne LiDAR data over the Keele campus of York University Toronto Canada. Satisfactory results in terms of individual tree crown delineation, ash tree identification and characterization of the health state of individual ash trees. Quantitative evaluations is being carried out.

  6. The Early Detection of the Emerald Ash Borer (eab) Using Multi-Source Remotely Sensed Data

    Science.gov (United States)

    Hu, B.; Naveed, F.; Tasneem, F.; Xing, C.

    2018-04-01

    The objectives of this study were to exploit the synergy of hyperspectral imagery, Light Detection And Ranging (LiDAR) and high spatial resolution data and their synergy in the early detection of the EAB (Emerald Ash Borer) presence in trees within urban areas and to develop a framework to combine information extracted from multiple data sources. To achieve these, an object-oriented framework was developed to combine information derived from available data sets to characterize ash trees. Within this framework, an advanced individual tree delineation method was developed to delineate individual trees using the combined high-spatial resolution worldview-3 imagery was used together with LiDAR data. Individual trees were then classified to ash and non-ash trees using spectral and spatial information. In order to characterize the health state of individual ash trees, leaves from ash trees with various health states were sampled and measured using a field spectrometer. Based on the field measurements, the best indices that sensitive to leaf chlorophyll content were selected. The developed framework and methods were tested using worldview-3, airborne LiDAR data over the Keele campus of York University Toronto Canada. Satisfactory results in terms of individual tree crown delineation, ash tree identification and characterization of the health state of individual ash trees. Quantitative evaluations is being carried out.

  7. Application of random-point processes to the detection of radiation sources

    International Nuclear Information System (INIS)

    Woods, J.W.

    1978-01-01

    In this report the mathematical theory of random-point processes is reviewed and it is shown how use of the theory can obtain optimal solutions to the problem of detecting radiation sources. As noted, the theory also applies to image processing in low-light-level or low-count-rate situations. Paralleling Snyder's work, the theory is extended to the multichannel case of a continuous, two-dimensional (2-D), energy-time space. This extension essentially involves showing that the data are doubly stochastic Poisson (DSP) point processes in energy as well as time. Further, a new 2-D recursive formulation is presented for the radiation-detection problem with large computational savings over nonrecursive techniques when the number of channels is large (greater than or equal to 30). Finally, some adaptive strategies for on-line ''learning'' of unknown, time-varying signal and background-intensity parameters and statistics are present and discussed. These adaptive procedures apply when a complete statistical description is not available a priori

  8. Bayesian analysis of energy and count rate data for detection of low count rate radioactive sources

    Energy Technology Data Exchange (ETDEWEB)

    Klumpp, John [Colorado State University, Department of Environmental and Radiological Health Sciences, Molecular and Radiological Biosciences Building, Colorado State University, Fort Collins, Colorado, 80523 (United States)

    2013-07-01

    We propose a radiation detection system which generates its own discrete sampling distribution based on past measurements of background. The advantage to this approach is that it can take into account variations in background with respect to time, location, energy spectra, detector-specific characteristics (i.e. different efficiencies at different count rates and energies), etc. This would therefore be a 'machine learning' approach, in which the algorithm updates and improves its characterization of background over time. The system would have a 'learning mode,' in which it measures and analyzes background count rates, and a 'detection mode,' in which it compares measurements from an unknown source against its unique background distribution. By characterizing and accounting for variations in the background, general purpose radiation detectors can be improved with little or no increase in cost. The statistical and computational techniques to perform this kind of analysis have already been developed. The necessary signal analysis can be accomplished using existing Bayesian algorithms which account for multiple channels, multiple detectors, and multiple time intervals. Furthermore, Bayesian machine-learning techniques have already been developed which, with trivial modifications, can generate appropriate decision thresholds based on the comparison of new measurements against a nonparametric sampling distribution. (authors)

  9. sources

    Directory of Open Access Journals (Sweden)

    Shu-Yin Chiang

    2002-01-01

    Full Text Available In this paper, we study the simplified models of the ATM (Asynchronous Transfer Mode multiplexer network with Bernoulli random traffic sources. Based on the model, the performance measures are analyzed by the different output service schemes.

  10. Open-source web-enabled data management, analyses, and visualization of very large data in geosciences using Jupyter, Apache Spark, and community tools

    Science.gov (United States)

    Chaudhary, A.

    2017-12-01

    Current simulation models and sensors are producing high-resolution, high-velocity data in geosciences domain. Knowledge discovery from these complex and large size datasets require tools that are capable of handling very large data and providing interactive data analytics features to researchers. To this end, Kitware and its collaborators are producing open-source tools GeoNotebook, GeoJS, Gaia, and Minerva for geosciences that are using hardware accelerated graphics and advancements in parallel and distributed processing (Celery and Apache Spark) and can be loosely coupled to solve real-world use-cases. GeoNotebook (https://github.com/OpenGeoscience/geonotebook) is co-developed by Kitware and NASA-Ames and is an extension to the Jupyter Notebook. It provides interactive visualization and python-based analysis of geospatial data and depending the backend (KTile or GeoPySpark) can handle data sizes of Hundreds of Gigabytes to Terabytes. GeoNotebook uses GeoJS (https://github.com/OpenGeoscience/geojs) to render very large geospatial data on the map using WebGL and Canvas2D API. GeoJS is more than just a GIS library as users can create scientific plots such as vector and contour and can embed InfoVis plots using D3.js. GeoJS aims for high-performance visualization and interactive data exploration of scientific and geospatial location aware datasets and supports features such as Point, Line, Polygon, and advanced features such as Pixelmap, Contour, Heatmap, and Choropleth. Our another open-source tool Minerva ((https://github.com/kitware/minerva) is a geospatial application that is built on top of open-source web-based data management system Girder (https://github.com/girder/girder) which provides an ability to access data from HDFS or Amazon S3 buckets and provides capabilities to perform visualization and analyses on geosciences data in a web environment using GDAL and GeoPandas wrapped in a unified API provided by Gaia (https

  11. Multi-element sewer slime impact pattern - a quantitative characteristic enabling identification of the source of heavy metal discharges into sewer systems

    Energy Technology Data Exchange (ETDEWEB)

    Kintrup, J. [Chemistry Lab., Wessling GmbH, Hannover (Germany); Wuensch, G. [Lehrgebiet Analytische Chemie, Univ. Hannover (Germany)

    2001-11-01

    The capability of sewer slime to accumulate heavy metals from municipal wastewater can be exploited to identify the sources of sewage sludge pollution. Former investigations of sewer slime looked for a few elements only and could, therefore, not account for deviations of the enrichment efficiency of the slime or for irregularities from sampling. Results of ICP-MS multi element determinations were analyzed by multivariate statistical methods. A new dimensionless characteristic ''sewer slime impact'' is proposed, which is zero for unloaded samples. Patterns expressed in this data format specifically extract the information required to identify the type of pollution and polluter quicker and with less effort and cost than hitherto. (orig.)

  12. Flash-sourcing or the rapid detection and characterisation of earthquake effects through clickstream data analysis

    Science.gov (United States)

    Bossu, R.; Mazet-Roux, G.; Roussel, F.; Frobert, L.

    2011-12-01

    crowd-to-agency system, but unlike them it is not based on declarative information (e.g. answers to a questionnaire) but on implicit data, clickstream observed on our website. We present first the main improvements of the method, improved detection of traffic surges, and a way to instantly map areas affected by severe damage or network disruptions. The second part describes how the derived information improves and fastens public earthquake information and, beyond seismology, what it can teach us on public behaviour when facing an earthquake. Finally, the discussion will focus on the future evolutions and how flash-sourcing could ultimately improve earthquake response.

  13. Rockfall hazard assessment integrating probabilistic physically based rockfall source detection (Norddal municipality, Norway).

    Science.gov (United States)

    Yugsi Molina, F. X.; Oppikofer, T.; Fischer, L.; Hermanns, R. L.; Taurisano, A.

    2012-04-01

    Traditional techniques to assess rockfall hazard are partially based on probabilistic analysis. Stochastic methods has been used for run-out analysis of rock blocks to estimate the trajectories that a detached block will follow during its fall until it stops due to kinetic energy loss. However, the selection of rockfall source areas is usually defined either by multivariate analysis or by field observations. For either case, a physically based approach is not used for the source area detection. We present an example of rockfall hazard assessment that integrates a probabilistic rockfall run-out analysis with a stochastic assessment of the rockfall source areas using kinematic stability analysis in a GIS environment. The method has been tested for a steep more than 200 m high rock wall, located in the municipality of Norddal (Møre og Romsdal county, Norway), where a large number of people are either exposed to snow avalanches, rockfalls, or debris flows. The area was selected following the recently published hazard mapping plan of Norway. The cliff is formed by medium to coarse-grained quartz-dioritic to granitic gneisses of Proterozoic age. Scree deposits product of recent rockfall activity are found at the bottom of the rock wall. Large blocks can be found several tens of meters away from the cliff in Sylte, the main locality in the Norddal municipality. Structural characterization of the rock wall was done using terrestrial laser scanning (TLS) point clouds in the software Coltop3D (www.terranum.ch), and results were validated with field data. Orientation data sets from the structural characterization were analyzed separately to assess best-fit probability density functions (PDF) for both dip angle and dip direction angle of each discontinuity set. A GIS-based stochastic kinematic analysis was then carried out using the discontinuity set orientations and the friction angle as random variables. An airborne laser scanning digital elevation model (ALS-DEM) with 1 m

  14. Laser Scribed Graphene Biosensor for Detection of Biogenic Amines in Food Samples Using Locally Sourced Materials

    Directory of Open Access Journals (Sweden)

    Diana C. Vanegas

    2018-04-01

    Full Text Available In foods, high levels of biogenic amines (BA are the result of microbial metabolism that could be affected by temperatures and storage conditions. Thus, the level of BA is commonly used as an indicator of food safety and quality. This manuscript outlines the development of laser scribed graphene electrodes, with locally sourced materials, for reagent-free food safety biosensing. To fabricate the biosensors, the graphene surface was functionalized with copper microparticles and diamine oxidase, purchased from a local supermarket; and then compared to biosensors fabricated with analytical grade materials. The amperometric biosensor exhibits good electrochemical performance, with an average histamine sensitivity of 23.3 µA/mM, a lower detection limit of 11.6 µM, and a response time of 7.3 s, showing similar performance to biosensors constructed from analytical grade materials. We demonstrated the application of the biosensor by testing total BA concentration in fish paste samples subjected to fermentation with lactic acid bacteria. Biogenic amines concentrations prior to lactic acid fermentation were below the detection limit of the biosensor, while concentration after fermentation was 19.24 ± 8.21 mg histamine/kg, confirming that the sensor was selective in a complex food matrix. The low-cost, rapid, and accurate device is a promising tool for biogenic amine estimation in food samples, particularly in situations where standard laboratory techniques are unavailable, or are cost prohibitive. This biosensor can be used for screening food samples, potentially limiting food waste, while reducing chances of foodborne outbreaks.

  15. Using Deep Learning for Gamma Ray Source Detection at the First G-APD Cherenkov Telescope (FACT)

    Science.gov (United States)

    Bieker, Jacob

    2018-06-01

    Finding gamma-ray sources is of paramount importance for Imaging Air Cherenkov Telescopes (IACT). This study looks at using deep neural networks on data from the First G-APD Cherenkov Telescope (FACT) as a proof-of-concept of finding gamma-ray sources with deep learning for the upcoming Cherenkov Telescope Array (CTA). In this study, FACT’s individual photon level observation data from the last 5 years was used with convolutional neural networks to determine if one or more sources were present. The neural networks used various architectures to determine which architectures were most successful in finding sources. Neural networks offer a promising method for finding faint and extended gamma-ray sources for IACTs. With further improvement and modifications, they offer a compelling method for source detection for the next generation of IACTs.

  16. Point source detection using the Spherical Mexican Hat Wavelet on simulated all-sky Planck maps

    Science.gov (United States)

    Vielva, P.; Martínez-González, E.; Gallegos, J. E.; Toffolatti, L.; Sanz, J. L.

    2003-09-01

    We present an estimation of the point source (PS) catalogue that could be extracted from the forthcoming ESA Planck mission data. We have applied the Spherical Mexican Hat Wavelet (SMHW) to simulated all-sky maps that include cosmic microwave background (CMB), Galactic emission (thermal dust, free-free and synchrotron), thermal Sunyaev-Zel'dovich effect and PS emission, as well as instrumental white noise. This work is an extension of the one presented in Vielva et al. We have developed an algorithm focused on a fast local optimal scale determination, that is crucial to achieve a PS catalogue with a large number of detections and a low flux limit. An important effort has been also done to reduce the CPU time processor for spherical harmonic transformation, in order to perform the PS detection in a reasonable time. The presented algorithm is able to provide a PS catalogue above fluxes: 0.48 Jy (857 GHz), 0.49 Jy (545 GHz), 0.18 Jy (353 GHz), 0.12 Jy (217 GHz), 0.13 Jy (143 GHz), 0.16 Jy (100 GHz HFI), 0.19 Jy (100 GHz LFI), 0.24 Jy (70 GHz), 0.25 Jy (44 GHz) and 0.23 Jy (30 GHz). We detect around 27 700 PS at the highest frequency Planck channel and 2900 at the 30-GHz one. The completeness level are: 70 per cent (857 GHz), 75 per cent (545 GHz), 70 per cent (353 GHz), 80 per cent (217 GHz), 90 per cent (143 GHz), 85 per cent (100 GHz HFI), 80 per cent (100 GHz LFI), 80 per cent (70 GHz), 85 per cent (44 GHz) and 80 per cent (30 GHz). In addition, we can find several PS at different channels, allowing the study of the spectral behaviour and the physical processes acting on them. We also present the basic procedure to apply the method in maps convolved with asymmetric beams. The algorithm takes ~72 h for the most CPU time-demanding channel (857 GHz) in a Compaq HPC320 (Alpha EV68 1-GHz processor) and requires 4 GB of RAM memory; the CPU time goes as O[NRoN3/2pix log(Npix)], where Npix is the number of pixels in the map and NRo is the number of optimal scales needed.

  17. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  18. Detection and identification of enteroviruses from various drinking water sources in Taiwan

    Science.gov (United States)

    Hsu, Bing-Mu; Chen, Chien-Hsien; Wan, Min-Tao; Chang, Po-Jen; Fan, Cheng-Wei

    2009-02-01

    SummaryTwenty-three water samples, including seventeen from surface water reservoirs, three from the raw water of groundwater treatment plants, and three from small water systems, were collected in Taiwan and investigated for the presence of, as well as the species of enteroviruses. RT-PCR was used for the detection of enteroviruses. Results revealed that 23.5% of raw water samples from reservoirs were positive for enteroviruses. In addition, one of the three groundwater samples and two of the three small system water samples were positive for enteroviruses. Water samples that were positive for enteroviruses subsequently were evaluated by real-time PCR. The results indicated that enterovirus concentration in groundwater was lower than that in samples obtained from surface water sources. Enteroviruses were identified by nucleic acid sequencing in the 5'-untranslated regions. Three clusters of enteroviruses were identified as coxsackievirus A2, coxsackievirus A6, and enterovirus 71. The presence of enteroviruses indicates the possibility of waterborne transmission of enteroviruses in Taiwan, if water is not adequately treated.

  19. YAP scintillators for resonant detection of epithermal neutrons at pulsed neutron sources

    International Nuclear Information System (INIS)

    Tardocchi, M.; Gorini, G.; Pietropaolo, A.; Andreani, C.; Senesi, R.; Rhodes, N.; Schooneveld, E. M.

    2004-01-01

    Recent studies indicate the resonance detector (RD) technique as an interesting approach for neutron spectroscopy in the electron volt energy region. This work summarizes the results of a series of experiments where RD consisting of YAlO 3 (YAP) scintillators were used to detect scattered neutrons with energy in the range 1-200 eV. The response of YAP scintillators to radiative capture γ emission from a 238 U analyzer foil was characterized in a series of experiments performed on the VESUVIO spectrometer at the ISIS pulsed neutron source. In these experiments a biparametric data acquisition allowed the simultaneous measurements of both neutron time-of-flight and γ pulse height (energy) spectra. The analysis of the γ pulse height and neutron time of flight spectra permitted to identify and distinguish the signal and background components. These measurements showed that a significant improvement in the signal-to-background ratio can be achieved by setting a lower level discrimination on the pulse height at about 600 keV equivalent photon energy. Present results strongly indicate YAP scintillators as the ideal candidate for neutron scattering studies with epithermal neutrons at both very low (<5 deg.) and intermediate scattering angles

  20. Early Detection of Apathetic Phenotypes in Huntington's Disease Knock-in Mice Using Open Source Tools.

    Science.gov (United States)

    Minnig, Shawn; Bragg, Robert M; Tiwana, Hardeep S; Solem, Wes T; Hovander, William S; Vik, Eva-Mari S; Hamilton, Madeline; Legg, Samuel R W; Shuttleworth, Dominic D; Coffey, Sydney R; Cantle, Jeffrey P; Carroll, Jeffrey B

    2018-02-02

    Apathy is one of the most prevalent and progressive psychiatric symptoms in Huntington's disease (HD) patients. However, preclinical work in HD mouse models tends to focus on molecular and motor, rather than affective, phenotypes. Measuring behavior in mice often produces noisy data and requires large cohorts to detect phenotypic rescue with appropriate power. The operant equipment necessary for measuring affective phenotypes is typically expensive, proprietary to commercial entities, and bulky which can render adequately sized mouse cohorts as cost-prohibitive. Thus, we describe here a home-built, open-source alternative to commercial hardware that is reliable, scalable, and reproducible. Using off-the-shelf hardware, we adapted and built several of the rodent operant buckets (ROBucket) to test Htt Q111/+ mice for attention deficits in fixed ratio (FR) and progressive ratio (PR) tasks. We find that, despite normal performance in reward attainment in the FR task, Htt Q111/+ mice exhibit reduced PR performance at 9-11 months of age, suggesting motivational deficits. We replicated this in two independent cohorts, demonstrating the reliability and utility of both the apathetic phenotype, and these ROBuckets, for preclinical HD studies.

  1. Beamspace dual signal space projection (bDSSP): a method for selective detection of deep sources in MEG measurements

    Science.gov (United States)

    Sekihara, Kensuke; Adachi, Yoshiaki; Kubota, Hiroshi K.; Cai, Chang; Nagarajan, Srikantan S.

    2018-06-01

    Objective. Magnetoencephalography (MEG) has a well-recognized weakness at detecting deeper brain activities. This paper proposes a novel algorithm for selective detection of deep sources by suppressing interference signals from superficial sources in MEG measurements. Approach. The proposed algorithm combines the beamspace preprocessing method with the dual signal space projection (DSSP) interference suppression method. A prerequisite of the proposed algorithm is prior knowledge of the location of the deep sources. The proposed algorithm first derives the basis vectors that span a local region just covering the locations of the deep sources. It then estimates the time-domain signal subspace of the superficial sources by using the projector composed of these basis vectors. Signals from the deep sources are extracted by projecting the row space of the data matrix onto the direction orthogonal to the signal subspace of the superficial sources. Main results. Compared with the previously proposed beamspace signal space separation (SSS) method, the proposed algorithm is capable of suppressing much stronger interference from superficial sources. This capability is demonstrated in our computer simulation as well as experiments using phantom data. Significance. The proposed bDSSP algorithm can be a powerful tool in studies of physiological functions of midbrain and deep brain structures.

  2. Realization of rapid debugging for detection circuit of optical fiber gas sensor: Using an analog signal source

    Science.gov (United States)

    Tian, Changbin; Chang, Jun; Wang, Qiang; Wei, Wei; Zhu, Cunguang

    2015-03-01

    An optical fiber gas sensor mainly consists of two parts: optical part and detection circuit. In the debugging for the detection circuit, the optical part usually serves as a signal source. However, in the debugging condition, the optical part can be easily influenced by many factors, such as the fluctuation of ambient temperature or driving current resulting in instability of the wavelength and intensity for the laser; for dual-beam sensor, the different bends and stresses of the optical fiber will lead to the fluctuation of the intensity and phase; the intensity noise from the collimator, coupler, and other optical devices in the system will also result in the impurity of the optical part based signal source. In order to dramatically improve the debugging efficiency of the detection circuit and shorten the period of research and development, this paper describes an analog signal source, consisting of a single chip microcomputer (SCM), an amplifier circuit, and a voltage-to-current conversion circuit. It can be used to realize the rapid debugging detection circuit of the optical fiber gas sensor instead of optical part based signal source. This analog signal source performs well with many other advantages, such as the simple operation, small size, and light weight.

  3. Optimal Matched Filter in the Low-number Count Poisson Noise Regime and Implications for X-Ray Source Detection

    Science.gov (United States)

    Ofek, Eran O.; Zackay, Barak

    2018-04-01

    Detection of templates (e.g., sources) embedded in low-number count Poisson noise is a common problem in astrophysics. Examples include source detection in X-ray images, γ-rays, UV, neutrinos, and search for clusters of galaxies and stellar streams. However, the solutions in the X-ray-related literature are sub-optimal in some cases by considerable factors. Using the lemma of Neyman–Pearson, we derive the optimal statistics for template detection in the presence of Poisson noise. We demonstrate that, for known template shape (e.g., point sources), this method provides higher completeness, for a fixed false-alarm probability value, compared with filtering the image with the point-spread function (PSF). In turn, we find that filtering by the PSF is better than filtering the image using the Mexican-hat wavelet (used by wavdetect). For some background levels, our method improves the sensitivity of source detection by more than a factor of two over the popular Mexican-hat wavelet filtering. This filtering technique can also be used for fast PSF photometry and flare detection; it is efficient and straightforward to implement. We provide an implementation in MATLAB. The development of a complete code that works on real data, including the complexities of background subtraction and PSF variations, is deferred for future publication.

  4. Limited copy number-high resolution melting (LCN-HRM) enables the detection and identification by sequencing of low level mutations in cancer biopsies.

    Science.gov (United States)

    Do, Hongdo; Dobrovic, Alexander

    2009-10-08

    Mutation detection in clinical tumour samples is challenging when the proportion of tumour cells, and thus mutant alleles, is low. The limited sensitivity of conventional sequencing necessitates the adoption of more sensitive approaches. High resolution melting (HRM) is more sensitive than sequencing but identification of the mutation is desirable, particularly when it is important to discriminate false positives due to PCR errors or template degradation from true mutations.We thus developed limited copy number - high resolution melting (LCN-HRM) which applies limiting dilution to HRM. Multiple replicate reactions with a limited number of target sequences per reaction allow low level mutations to be detected. The dilutions used (based on Ct values) are chosen such that mutations, if present, can be detected by the direct sequencing of amplicons with aberrant melting patterns. Using cell lines heterozygous for mutations, we found that the mutations were not readily detected when they comprised 10% of total alleles (20% tumour cells) by sequencing, whereas they were readily detectable at 5% total alleles by standard HRM. LCN-HRM allowed these mutations to be identified by direct sequencing of those positive reactions.LCN-HRM was then used to review formalin-fixed paraffin-embedded (FFPE) clinical samples showing discordant findings between sequencing and HRM for KRAS exon 2 and EGFR exons 19 and 21. Both true mutations present at low levels and sequence changes due to artefacts were detected by LCN-HRM. The use of high fidelity polymerases showed that the majority of the artefacts were derived from the damaged template rather than replication errors during amplification. LCN-HRM bridges the sensitivity gap between HRM and sequencing and is effective in distinguishing between artefacts and true mutations.

  5. Herschel-ATLAS: Dust Temperature and Redshift Distribution of SPIRE and PACS Detected Sources Using Submillimetre Colours

    Science.gov (United States)

    Amblard, A.; Cooray, Asantha; Serra, P.; Temi, P.; Barton, E.; Negrello, M.; Auld, R.; Baes, M.; Baldry, I. K.; Bamford, S.; hide

    2010-01-01

    We present colour-colour diagrams of detected sources in the Herschel-ATLAS Science Demonstration Field from 100 to 500/microns using both PACS and SPIRE. We fit isothermal modified-blackbody spectral energy distribution (SED) models in order to extract the dust temperature of sources with counterparts in GAMA or SDSS with either a spectroscopic or a photometric redshift. For a subsample of 331 sources detected in at least three FIR bands with significance greater than 30 sigma, we find an average dust temperature of (28 plus or minus 8)K. For sources with no known redshifts, we populate the colour-colour diagram with a large number of SEDs generated with a broad range of dust temperatures and emissivity parameters and compare to colours of observed sources to establish the redshift distribution of those samples. For another subsample of 1686 sources with fluxes above 35 mJy at 350 microns and detected at 250 and 500 microns with a significance greater than 3sigma, we find an average redshift of 2.2 plus or minus 0.6.

  6. Tracking the MSL-SAM methane detection source location Through Mars Regional Atmospheric Modeling System (MRAMS)

    Science.gov (United States)

    Pla-García, Jorge

    2016-04-01

    1. Introduction: The putative in situ detection of methane by Sample Analysis at Mars (SAM) instrument suite on Curiosi-ty at Gale crater has garnered significant attention because of the potential implications for the presence of geological methane sources or indigenous Martian organisms [1, 2]. SAM reported detection of back-ground levels of atmospheric methane of mean value 0.69±0.25 parts per billion by volume (ppbv) at the 95% confidence interval (CI). Additionally, in four sequential measurements spanning a 60-sol period, SAM observed elevated levels of methane of 7.2±2.1 ppbv (95% CI), implying that Mars is episodically producing methane from an additional unknown source. There are many major unresolved questions regard-ing this detection: 1) What are the potential sources of the methane release? 2) What causes the rapid decrease in concentration? and 3) Where is the re-lease location? 4) How spatially extensive is the re-lease? 5) For how long is CH4 released? Regarding the first question, the source of methane, is so far not identified. It could be related with geo-logical process like methane release from clathrates [3], serpentinisation [4] and volcanism [5]; or due to biological activity from methanogenesis [6]. To answer the second question, the rapid decrease in concentration, it is important to note that the photo-chemical lifetime of methane is of order 100 years, much longer than the atmospheric mixing time scale, and thus the gas should tend to be well mixed except near a source or shortly after an episodic release. The observed spike of 7 ppb from the background of System (MRAMS). The model was focused on rover locations using nested grids with a spacing of 330 meters on the in-nermost grid that is centered over the landing [8, 9]. MRAMS is ideally suited for this investigation; the model is explicitly designed to simulate Mars' at-mospheric circulations at the mesoscale and smaller with realistic, high-resolution surface properties [10, 11

  7. Silicon photonic integrated circuit swept-source optical coherence tomography receiver with dual polarization, dual balanced, in-phase and quadrature detection.

    Science.gov (United States)

    Wang, Zhao; Lee, Hsiang-Chieh; Vermeulen, Diedrik; Chen, Long; Nielsen, Torben; Park, Seo Yeon; Ghaemi, Allan; Swanson, Eric; Doerr, Chris; Fujimoto, James

    2015-07-01

    Optical coherence tomography (OCT) is a widely used three-dimensional (3D) optical imaging method with many biomedical and non-medical applications. Miniaturization, cost reduction, and increased functionality of OCT systems will be critical for future emerging clinical applications. We present a silicon photonic integrated circuit swept-source OCT (SS-OCT) coherent receiver with dual polarization, dual balanced, in-phase and quadrature (IQ) detection. We demonstrate multiple functional capabilities of IQ polarization resolved detection including: complex-conjugate suppressed full-range OCT, polarization diversity detection, and polarization-sensitive OCT. To our knowledge, this is the first demonstration of a silicon photonic integrated receiver for OCT. The integrated coherent receiver provides a miniaturized, low-cost solution for SS-OCT, and is also a key step towards a fully integrated high speed SS-OCT system with good performance and multi-functional capabilities. With further performance improvement and cost reduction, photonic integrated technology promises to greatly increase penetration of OCT systems in existing applications and enable new applications.

  8. Observations of the Hubble Deep Field with the Infrared Space Observatory .2. Source detection and photometry

    DEFF Research Database (Denmark)

    Goldschmidt, P.; Oliver, S.J.; Serjeant, S.B.G.

    1997-01-01

    We present positions and fluxes of point sources found in the Infrared Space Observatory (ISO) images of the Hubble Deep Field (HDF) at 6.7 and 15 mu m. We have constructed algorithmically selected 'complete' flux-limited samples of 19 sources in the 15-mu m image, and seven sources in the 6.7-mu m...

  9. Measuring temporal summation in visual detection with a single-photon source.

    Science.gov (United States)

    Holmes, Rebecca; Victora, Michelle; Wang, Ranxiao Frances; Kwiat, Paul G

    2017-11-01

    Temporal summation is an important feature of the visual system which combines visual signals that arrive at different times. Previous research estimated complete summation to last for 100ms for stimuli judged "just detectable." We measured the full range of temporal summation for much weaker stimuli using a new paradigm and a novel light source, developed in the field of quantum optics for generating small numbers of photons with precise timing characteristics and reduced variance in photon number. Dark-adapted participants judged whether a light was presented to the left or right of their fixation in each trial. In Experiment 1, stimuli contained a stream of photons delivered at a constant rate while the duration was systematically varied. Accuracy should increase with duration as long as the later photons can be integrated with the proceeding ones into a single signal. The temporal integration window was estimated as the point that performance no longer improved, and was found to be 650ms on average. In Experiment 2, the duration of the visual stimuli was kept short (100ms or photons was varied to explore the efficiency of summation over the integration window compared to Experiment 1. There was some indication that temporal summation remains efficient over the integration window, although there is variation between individuals. The relatively long integration window measured in this study may be relevant to studies of the absolute visual threshold, i.e., tests of single-photon vision, where "single" photons should be separated by greater than the integration window to avoid summation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Real-Time N2O Gas Detection System for Agricultural Production Using a 4.6-µm-Band Laser Source Based on a Periodically Poled LiNbO3 Ridge Waveguide

    Directory of Open Access Journals (Sweden)

    Toshihiro Yoshihara

    2013-08-01

    Full Text Available This article describes a gas monitoring system for detecting nitrous oxide (N2O gas using a compact mid-infrared laser source based on difference-frequency generation in a quasi-phase-matched LiNbO3 waveguide. We obtained a stable output power of 0.62 mW from a 4.6-μm-band continuous-wave laser source operating at room temperature. This laser source enabled us to detect atmospheric N2O gas at a concentration as low as 35 parts per billion. Using this laser source, we constructed a new real-time in-situ monitoring system for detecting N2O gas emitted from potted plants. A few weeks of monitoring with the developed detection system revealed a strong relationship between nitrogen fertilization and N2O emission. This system is promising for the in-situ long-term monitoring of N2O in agricultural production, and it is also applicable to the detection of other greenhouse gases.

  11. Real-time N2O gas detection system for agricultural production using a 4.6-µm-band laser source based on a periodically poled LiNbO3 ridge waveguide.

    Science.gov (United States)

    Tokura, Akio; Asobe, Masaki; Enbutsu, Koji; Yoshihara, Toshihiro; Hashida, Shin-nosuke; Takenouchi, Hirokazu

    2013-08-05

    This article describes a gas monitoring system for detecting nitrous oxide (N2O) gas using a compact mid-infrared laser source based on difference-frequency generation in a quasi-phase-matched LiNbO3 waveguide. We obtained a stable output power of 0.62 mW from a 4.6-μm-band continuous-wave laser source operating at room temperature. This laser source enabled us to detect atmospheric N2O gas at a concentration as low as 35 parts per billion. Using this laser source, we constructed a new real-time in-situ monitoring system for detecting N2O gas emitted from potted plants. A few weeks of monitoring with the developed detection system revealed a strong relationship between nitrogen fertilization and N2O emission. This system is promising for the in-situ long-term monitoring of N2O in agricultural production, and it is also applicable to the detection of other greenhouse gases.

  12. Screening for abnormal vaginal microflora by self-assessed vaginal pH does not enable detection of sexually transmitted infections in Ugandan women.

    Science.gov (United States)

    Donders, Gilbert G G; Donders, Francesca; Bellen, Gert; Depuydt, Christophe; Eggermont, Natalie; Michiels, Thirsa; Lule, John; Byamughisa, Jacobat

    2016-06-01

    Is self-assessed vaginal pH measurement to detect abnormal vaginal bacterial microflora (AVF) an adequate prescreening method for detection of genital sexually transmitted infections (STIs)? A total of 360 Ugandan women tested themselves with a gloved finger and a pH color strip. PCR for bacterial vaginosis (BV)-associated bacteria was tested by PCR for Mycoplasma hominis, Ureaplasma urealyticum, and/or Atopobium vaginae, while the STIs were diagnosed by positive PCR for Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, and/or Trichomonas vaginalis. A strong correlation was found between self-assessed pH values and BV-associated bacteria (Pvaginal pH correlated well with markers of high-risk microflora types such as BV or aerobic vaginitis, but not with STIs. Hence, in a screening program addressing AVF in low-resource countries, extra specific tests are required to exclude STIs. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Two-photon excitation in chip electrophoresis enabling label-free fluorescence detection in non-UV transparent full-body polymer chips.

    Science.gov (United States)

    Geissler, David; Belder, Detlev

    2015-12-01

    One of the most commonly employed detection methods in microfluidic research is fluorescence detection, due to its ease of integration and excellent sensitivity. Many analytes though do not show luminescence when excited in the visible light spectrum, require suitable dyes. Deep-ultraviolet (UV) excitation (electrophoresis of small aromatic compounds. Various polymers, such as poly(methyl methacrylate), cyclic olefin polymer, and copolymer as well as poly(dimethylsiloxane) were investigated and compared with respect to achievable LOD and ruggedness against photodamage. To demonstrate the applicability of the technique, the method was also applied to the determination of serotonin and tryptamine in fruit samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Detecting Source Code Plagiarism on .NET Programming Languages using Low-level Representation and Adaptive Local Alignment

    Directory of Open Access Journals (Sweden)

    Oscar Karnalim

    2017-01-01

    Full Text Available Even though there are various source code plagiarism detection approaches, only a few works which are focused on low-level representation for deducting similarity. Most of them are only focused on lexical token sequence extracted from source code. In our point of view, low-level representation is more beneficial than lexical token since its form is more compact than the source code itself. It only considers semantic-preserving instructions and ignores many source code delimiter tokens. This paper proposes a source code plagiarism detection which rely on low-level representation. For a case study, we focus our work on .NET programming languages with Common Intermediate Language as its low-level representation. In addition, we also incorporate Adaptive Local Alignment for detecting similarity. According to Lim et al, this algorithm outperforms code similarity state-of-the-art algorithm (i.e. Greedy String Tiling in term of effectiveness. According to our evaluation which involves various plagiarism attacks, our approach is more effective and efficient when compared with standard lexical-token approach.

  15. Detection of a compact radio source near the center of a gravitational lens: quasar image or galactic core

    International Nuclear Information System (INIS)

    Gorenstein, M.V.; Shapiro, I.I.; Cohen, N.L.

    1983-01-01

    By use of a new, very sensitive interferometric system, a faint, compact radio source has been detected near the center of the galaxy that acts as the main part of a gravitational lens. This lens forms two previously discovered images of the quasar Q0957 + 561, which lies in the direction of the constellation Ursa Major. The newly detected source has a core smaller than 0.002 arc second in diameter with a flux density of 0.6 +- 0.1 millijansky at the 13-centimeter wavelength of the radio observations. This source could be the predicted third image of the transparent gravitational lens, the central core of the galaxy, or some combination of the two. It is not yet possible to choose reliably between these alternatives

  16. Practical Application of Aptamer-Based Biosensors in Detection of Low Molecular Weight Pollutants in Water Sources

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2018-02-01

    Full Text Available Water pollution has become one of the leading causes of human health problems. Low molecular weight pollutants, even at trace concentrations in water sources, have aroused global attention due to their toxicity after long-time exposure. There is an increased demand for appropriate methods to detect these pollutants in aquatic systems. Aptamers, single-stranded DNA or RNA, have high affinity and specificity to each of their target molecule, similar to antigen-antibody interaction. Aptamers can be selected using a method called Systematic Evolution of Ligands by EXponential enrichment (SELEX. Recent years we have witnessed great progress in developing aptamer selection and aptamer-based sensors for low molecular weight pollutants in water sources, such as tap water, seawater, lake water, river water, as well as wastewater and its effluents. This review provides an overview of aptamer-based methods as a novel approach for detecting low molecular weight pollutants in water sources.

  17. Change Detection for Remote Monitoring of Underground Nuclear Testing: Comparison with Seismic and Associated Explosion Source Phenomenological Data

    DEFF Research Database (Denmark)

    Canty, M.; Jahnke, G.; Nielsen, Allan Aasbjerg

    2005-01-01

    The analysis of open-source satellite imagery is in process of establishing itself as an important tool for monitoring nuclear activities throughout the world which are relevant to disarmament treaties, like e. g. the Comprehensive Nuclear-Test-Ban Treaty (CTBT). However, the detection of anthrop......The analysis of open-source satellite imagery is in process of establishing itself as an important tool for monitoring nuclear activities throughout the world which are relevant to disarmament treaties, like e. g. the Comprehensive Nuclear-Test-Ban Treaty (CTBT). However, the detection...... of conventional multispectral satellite platforms with moderate ground resolution (Landsat TM, ASTER) to detect changes over wide areas.We chose the Nevada Test Site (NTS), USA, for a case study because of the large amount of available ground truth information. The analysis is based on the multivariate alteration...

  18. Slantingly cross loading sample system enables simultaneous performance of separation and mixture to detect molecular interactions on thin-layer chromatography.

    Science.gov (United States)

    Shimizu-Yumoto, Hiroko; Hayashi, Nobuyuki; Ichimura, Kazuo; Nakayama, Masayoshi

    2012-07-06

    Anthocyanins are major flower pigments that can be affected by copigments, colorless compounds that can modify anthocyanin coloration to more intense and bluer. Thin-layer chromatography (TLC) is an available technique to separate and analyze anthocyanins and copigments. To easily and comprehensively detect copigments, we added function of mixture of compounds to TLC; by slantingly cross loading samples on TLC, compounds are symmetrically developed at various angle lines from the upper origin to individual R(f) values and cross each other in an orderly fashion, where mixture is simultaneously performed with separation. Occurrence of copigments can be detected as a coloration change on the developed line of anthocyanin. Pink sweet pea (Lathyrus odoratus L.) petals were analyzed by the cross-TLC and a more intense spot and a paler spot on the anthocyanin line were detected. As each spot overlapped with an ultraviolet absorbance line, each of these ultraviolet absorption compounds was purified and identified as kaempferol 3-rhamnoside and 2-cyanoethyl-isoxazolin-5-one, respectively. Whereas kaempferol 3-rhamnoside is a flavonoid and had a general copigment effect of more intense and bluer coloration change, 2-cyanoethyl-isoxazolin-5-one is a compound whose structure is outside of conventional categories of copigments and had a novel effect to change anthocyanin coloration paler while maintaining color tone. We determined that the search for copigments should be carried out without pre-existing prediction of structures and effects. We have shown that slantingly cross loading samples system on plate-type chromatography is an effective technique for such comprehensive analysis of molecular interaction. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  19. Modifying a standard method allows simultaneous extraction of RNA and protein, enabling detection of enzymes in the rat retina with low expressions and protein levels.

    Science.gov (United States)

    Agardh, Elisabet; Gustavsson, Carin; Hagert, Per; Nilsson, Marie; Agardh, Carl-David

    2006-02-01

    The aim of the study was to evaluate messenger RNA and protein expression in limited amounts of tissue with low protein content. The Chomczynski method was used for simultaneous extraction of RNA, and protein was modified in the protein isolation step. Template mass and cycling time for the complementary DNA synthesis step of real-time reverse transcription-polymerase chain reaction (RT-PCR) for analysis of catalase, copper/zinc superoxide dismutase, manganese superoxide dismutase, the catalytic subunit of glutamylcysteine ligase, glutathione peroxidase 1, and the endogenous control cyclophilin B (CypB) were optimized before PCR. Polymerase chain reaction accuracy and efficacy were demonstrated by calculating the regression (R2) values of the separate amplification curves. Appropriate antibodies, blocking buffers, and running conditions were established for Western blot, and protein detection and multiplex assays with CypB were performed for each target. During the extraction procedure, the protein phase was dissolved in a modified washing buffer containing 0.1% sodium dodecyl sulfate, followed by ultrafiltration. Enzyme expression on real-time RT-PCR was accomplished with high reliability and reproducibility (R2, 0.990-0.999), and all enzymes except for glutathione peroxidase 1 were detectable in individual retinas on Western blot. Western blot multiplexing with CypB was possible for all targets. In conclusion, connecting gene expression directly to protein levels in the individual rat retina was possible by simultaneous extraction of RNA and protein. Real-time RT-PCR and Western blot allowed accurate detection of retinal protein expressions and levels.

  20. Applications of Monte Carlo technique in the detection of explosives, narcotics and fissile material using neutron sources

    International Nuclear Information System (INIS)

    Sinha, Amar; Kashyap, Yogesh; Roy, Tushar; Agrawal, Ashish; Sarkar, P.S.; Shukla, Mayank

    2009-01-01

    The problem of illicit trafficking of explosives, narcotics or fissile materials represents a real challenge to civil security. Neutron based detection systems are being actively explored worldwide as a confirmatory tool for applications in the detection of explosives either hidden inside a vehicle or a cargo container or buried inside soil. The development of a system and its experimental testing is a tedious process and to develop such a system each experimental condition needs to be theoretically simulated. Monte Carlo based methods are used to find an optimized design for such detection system. In order to design such systems, it is necessary to optimize source and detector system for each specific application. The present paper deals with such optimization studies using Monte Carlo technique for tagged neutron based system for explosives and narcotics detection hidden in a cargo and landmine detection using backscatter neutrons. We will also discuss some simulation studies on detection of fissile material and photo-neutron source design for applications on cargo scanning. (author)

  1. Detection of hidden sources. Prompt reports by airborne teams in Resume95

    International Nuclear Information System (INIS)

    Toivonen, H.

    1997-01-01

    An exercise to locate and identify lost radioactive sources was arranged near Padasjoki Auttoinen village. Ten sources, consisting of caesium, cobolt, iridium and technetium, were hidden. The teams (10) were asked to report their findings immediately after the landing and 24 h later. The teams that had a large NaI detector at their disposal could locate more sources than the teams with HPGe detectors. However, for source identification and activity calculation and HPGe detector is superior. Thus, it is highly recommended for operational purposes that both measuring systems are used simultaneously. The best location results were provided by the Danish Emergency Management Agency; the team reported four sources at landing and two other sources were found in prompt data processing after the landing. (au)

  2. Detection of hidden sources. Prompt reports by airborne teams in Resume95

    Energy Technology Data Exchange (ETDEWEB)

    Toivonen, H. [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)

    1997-12-31

    An exercise to locate and identify lost radioactive sources was arranged near Padasjoki Auttoinen village. Ten sources, consisting of caesium, cobolt, iridium and technetium, were hidden. The teams (10) were asked to report their findings immediately after the landing and 24 h later. The teams that had a large NaI detector at their disposal could locate more sources than the teams with HPGe detectors. However, for source identification and activity calculation and HPGe detector is superior. Thus, it is highly recommended for operational purposes that both measuring systems are used simultaneously. The best location results were provided by the Danish Emergency Management Agency; the team reported four sources at landing and two other sources were found in prompt data processing after the landing. (au).

  3. Detection of hidden sources. Prompt reports by airborne teams in Resume95

    Energy Technology Data Exchange (ETDEWEB)

    Toivonen, H [Finnish Centre for Radiation and Nuclear Safety, Helsinki (Finland)

    1998-12-31

    An exercise to locate and identify lost radioactive sources was arranged near Padasjoki Auttoinen village. Ten sources, consisting of caesium, cobolt, iridium and technetium, were hidden. The teams (10) were asked to report their findings immediately after the landing and 24 h later. The teams that had a large NaI detector at their disposal could locate more sources than the teams with HPGe detectors. However, for source identification and activity calculation and HPGe detector is superior. Thus, it is highly recommended for operational purposes that both measuring systems are used simultaneously. The best location results were provided by the Danish Emergency Management Agency; the team reported four sources at landing and two other sources were found in prompt data processing after the landing. (au).

  4. Flexible Polydimethylsiloxane Foams Decorated with Multiwalled Carbon Nanotubes Enable Unprecedented Detection of Ultralow Strain and Pressure Coupled with a Large Working Range.

    Science.gov (United States)

    Iglio, Rossella; Mariani, Stefano; Robbiano, Valentina; Strambini, Lucanos; Barillaro, Giuseppe

    2018-04-25

    Low-cost piezoresistive strain/pressure sensors with large working range, at the same time able to reliably detect ultralow strain (≤0.1%) and pressure (≤1 Pa), are one of the challenges that have still to be overcome for flexible piezoresistive materials toward personalized health-monitoring applications. In this work, we report on unprecedented, simultaneous detection of ultrasmall strain (0.1%, i.e., 10 μm displacement over 10 mm) and subtle pressure (20 Pa, i.e., a force of only 2 mN over an area of 1 cm 2 ) in compression mode, coupled with a large working range (i.e., up to 60% for strain-6 mm in displacement-and 50 kPa for pressure) using piezoresistive, flexible three-dimensional (3D) macroporous polydimethylsiloxane (pPDMS) foams decorated with pristine multiwalled carbon nanotubes (CNTs). pPDMS/CNT foams with pore size up to 500 μm (i.e., twice the size of those of commonly used foams, at least) and porosity of 77%, decorated with a nanostructured surface network of CNTs at densities ranging from 7.5 to 37 mg/cm 3 are prepared using a low-cost and scalable process, through replica molding of sacrificial sugar templates and subsequent drop-casting of CNT ink. A thorough characterization shows that piezoresistive properties of the foams can be finely tuned by controlling the CNT density and reach an optimum at a CNT density of 25 mg/cm 3 , for which a maximum change of the material resistivity (e.g., ρ 0 /ρ 50 = 4 at 50% strain) is achieved under compression. Further static and dynamic characterization of the pPDMS/CNT foams with 25 mg/cm 3 of CNTs highlights that detection limits for strain and pressure are 0.03% (3 μm displacement over 10 mm) and 6 Pa (0.6 mN over an area of 1 cm 2 ), respectively; moreover, good stability and limited hysteresis are apparent by cycling the foams with 255 compression-release cycles over the strain range of 0-60%, at different strain rates up to 10 mm/min. Our results on piezoresistive, flexible pPDMS/CNT foams

  5. Swept-source optical coherence tomography powered by a 1.3-μm vertical cavity surface emitting laser enables 2.3-mm-deep brain imaging in mice in vivo

    Science.gov (United States)

    Choi, Woo June; Wang, Ruikang K.

    2015-10-01

    We report noninvasive, in vivo optical imaging deep within a mouse brain by swept-source optical coherence tomography (SS-OCT), enabled by a 1.3-μm vertical cavity surface emitting laser (VCSEL). VCSEL SS-OCT offers a constant signal sensitivity of 105 dB throughout an entire depth of 4.25 mm in air, ensuring an extended usable imaging depth range of more than 2 mm in turbid biological tissue. Using this approach, we show deep brain imaging in mice with an open-skull cranial window preparation, revealing intact mouse brain anatomy from the superficial cerebral cortex to the deep hippocampus. VCSEL SS-OCT would be applicable to small animal studies for the investigation of deep tissue compartments in living brains where diseases such as dementia and tumor can take their toll.

  6. Photonics-on-a-chip: recent advances in integrated waveguides as enabling detection elements for real-world, lab-on-a-chip biosensing applications.

    Science.gov (United States)

    Washburn, Adam L; Bailey, Ryan C

    2011-01-21

    By leveraging advances in semiconductor microfabrication technologies, chip-integrated optical biosensors are poised to make an impact as scalable and multiplexable bioanalytical measurement tools for lab-on-a-chip applications. In particular, waveguide-based optical sensing technology appears to be exceptionally amenable to chip integration and miniaturization, and, as a result, the recent literature is replete with examples of chip-integrated waveguide sensing platforms developed to address a wide range of contemporary analytical challenges. As an overview of the most recent advances within this dynamic field, this review highlights work from the last 2-3 years in the areas of grating-coupled, interferometric, photonic crystal, and microresonator waveguide sensors. With a focus towards device integration, particular emphasis is placed on demonstrations of biosensing using these technologies within microfluidically controlled environments. In addition, examples of multiplexed detection and sensing within complex matrices--important features for real-world applicability--are given special attention.

  7. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  8. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  9. Rapid detection of illegal colorants on traditional Chinese pastries through mass spectrometry with an interchangeable thermal desorption electrospray ionization source.

    Science.gov (United States)

    Chao, Yu-Ying; Chen, Yen-Ling; Chen, Wei-Chu; Chen, Bai-Hsiun; Huang, Yeou-Lih

    2018-06-30

    Ambient mass spectrometry using an interchangeable thermal desorption/electrospray ionization source (TD-ESI) is a relatively new technique that has had only a limited number of applications to date. Nevertheless, this direct-analysis technique has potential for wider use in analytical chemistry (e.g., in the rapid direct detection of contaminants, residues, and adulterants on and in food) when operated in dual-working mode (pretreatment-free qualitative screening and conventional quantitative confirmation) after switching to a TD-ESI source from a conventional ESI source. Herein, we describe the benefits and challenges associated with the use of a TD-ESI source to detect adulterants on traditional Chinese pastries (TCPs), as a proof-of-concept for the detection of illegal colorants. While TD-ESI can offer direct (i.e., without any sample preparation) qualitative screening analyses for TCPs with adequate sensitivity within 30 s, the use of TD-ESI for semi-quantification is applicable only for homogeneous matrices (e.g., tang yuan). Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  11. Improved Point-source Detection in Crowded Fields Using Probabilistic Cataloging

    Science.gov (United States)

    Portillo, Stephen K. N.; Lee, Benjamin C. G.; Daylan, Tansu; Finkbeiner, Douglas P.

    2017-10-01

    Cataloging is challenging in crowded fields because sources are extremely covariant with their neighbors and blending makes even the number of sources ambiguous. We present the first optical probabilistic catalog, cataloging a crowded (˜0.1 sources per pixel brighter than 22nd mag in F606W) Sloan Digital Sky Survey r-band image from M2. Probabilistic cataloging returns an ensemble of catalogs inferred from the image and thus can capture source-source covariance and deblending ambiguities. By comparing to a traditional catalog of the same image and a Hubble Space Telescope catalog of the same region, we show that our catalog ensemble better recovers sources from the image. It goes more than a magnitude deeper than the traditional catalog while having a lower false-discovery rate brighter than 20th mag. We also present an algorithm for reducing this catalog ensemble to a condensed catalog that is similar to a traditional catalog, except that it explicitly marginalizes over source-source covariances and nuisance parameters. We show that this condensed catalog has a similar completeness and false-discovery rate to the catalog ensemble. Future telescopes will be more sensitive, and thus more of their images will be crowded. Probabilistic cataloging performs better than existing software in crowded fields and so should be considered when creating photometric pipelines in the Large Synoptic Survey Telescope era.

  12. Protection and fault detection for Lawrence Berkeley Laboratory neutral beam sources

    International Nuclear Information System (INIS)

    Hopkins, D.B.; Baker, W.R.; Berkner, K.H.; Ehlers, K.W.; Honey, V.J.; Lietzke, A.F.; Milnes, K.A.; Owren, H.M.

    1979-11-01

    Testing of TFTR neutral beam (NB) sources has begun at the LBL Neutral Beam System Test Facility (NBSTF). Operation at 120 kV, 65 A, 0.5 sec should be achieved soon. Because NB sources spark down frequently during conditioning, the main accelerating (accel) power supply must be interrupted within a few microseconds to avoid degrading the voltage holding capability, or even the damaging, of the NB source. A variety of improper magnitudes and/or ratios of voltages, currents, and times can occur and must be recognized as fault conditions in order to initiate a prompt interruption of the accel power supply. This paper discusses in detail the key signals which must be monitored and the manner in which they are processed in fault detector circuitry for safe operation of LBL NB sources. The paper also reviews the more standard interlocks and protective features recommended for these sources

  13. THE SOURCE STRUCTURE OF 0642+449 DETECTED FROM THE CONT14 OBSERVATIONS

    International Nuclear Information System (INIS)

    Xu, Ming H.; Wang, Guang L.; Heinkelmann, Robert; Anderson, James M.; Mora-Diaz, Julian; Schuh, Harald

    2016-01-01

    The CONT14 campaign with state-of-the-art very long baseline interferometry (VLBI) data has observed the source 0642+449 with about 1000 observables each day during a continuous observing period of 15 days, providing tens of thousands of closure delays—the sum of the delays around a closed loop of baselines. The closure delay is independent of the instrumental and propagation delays and provides valuable additional information about the source structure. We demonstrate the use of this new “observable” for the determination of the structure in the radio source 0642+449. This source, as one of the defining sources in the second realization of the International Celestial Reference Frame, is found to have two point-like components with a relative position offset of −426 microarcseconds ( μ as) in R.A. and −66 μ as in decl. The two components are almost equally bright, with a flux-density ratio of 0.92. The standard deviation of closure delays for source 0642+449 was reduced from 139 to 90 ps by using this two-component model. Closure delays larger than 1 ns are found to be related to the source structure, demonstrating that structure effects for a source with this simple structure could be up to tens of nanoseconds. The method described in this paper does not rely on a priori source structure information, such as knowledge of source structure determined from direct (Fourier) imaging of the same observations or observations at other epochs. We anticipate our study to be a starting point for more effective determination of the structure effect in VLBI observations.

  14. THE SOURCE STRUCTURE OF 0642+449 DETECTED FROM THE CONT14 OBSERVATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ming H.; Wang, Guang L. [Shanghai Astronomical Observatory, Chinese Academy of Sciences, No. 80 Nandan Raod, 200030, Shanghai (China); Heinkelmann, Robert; Anderson, James M.; Mora-Diaz, Julian; Schuh, Harald, E-mail: mhxu@shao.ac.cn [DeutschesGeoForschungsZentrum (GFZ), Potsdam, Telegrafenberg, D-14473 Potsdam (Germany)

    2016-11-01

    The CONT14 campaign with state-of-the-art very long baseline interferometry (VLBI) data has observed the source 0642+449 with about 1000 observables each day during a continuous observing period of 15 days, providing tens of thousands of closure delays—the sum of the delays around a closed loop of baselines. The closure delay is independent of the instrumental and propagation delays and provides valuable additional information about the source structure. We demonstrate the use of this new “observable” for the determination of the structure in the radio source 0642+449. This source, as one of the defining sources in the second realization of the International Celestial Reference Frame, is found to have two point-like components with a relative position offset of −426 microarcseconds ( μ as) in R.A. and −66 μ as in decl. The two components are almost equally bright, with a flux-density ratio of 0.92. The standard deviation of closure delays for source 0642+449 was reduced from 139 to 90 ps by using this two-component model. Closure delays larger than 1 ns are found to be related to the source structure, demonstrating that structure effects for a source with this simple structure could be up to tens of nanoseconds. The method described in this paper does not rely on a priori source structure information, such as knowledge of source structure determined from direct (Fourier) imaging of the same observations or observations at other epochs. We anticipate our study to be a starting point for more effective determination of the structure effect in VLBI observations.

  15. The detection of orphan radioactive sources and the regulatory attitude; La deteccion de fuentes radiactivas huerfanas y la actitud regulatoria

    Energy Technology Data Exchange (ETDEWEB)

    Truppa, W.; Amodei, A.; Castro, L.; Rojas, C. [Autoridad Regulatoria Nuclear, Subgerencia Control de Instalaciones Radiactivas Clase ll y III, Av. Del Libertador 8250 Ciudad de Buenos Aires (C1429BNP) (Argentina)]. e-mail: wtruppa@sede.arn.gov.ar

    2006-07-01

    In the last decade, the appearance of orphan control radioactive sources has been one constant restlessness in the environment of the regulatory control. Of the well-known cases in the world the more common have been the appearance of type sources or industrial use, which by control lack, by negligence or abandonment were without the due protection and receipt. It is presented in this work the detection of a radioactive source of Cs-137 pickup among the scrap that entered to an important steelworks of the country, by a detector of portal type. Starting from there, Ia Nuclear Regulatory Authority (ARN) it carried out a deep investigation to determine the origin of the radioactive source, which drove to detect and to put low control to other three radioactive sources of the same type used in level measurement, originally housed in a tank of daily consumption of gas-oil, inside a craft that it was broken up for it sale like scrap. During the execution of these tasks they took the regulatory collection, chord to what indicates the normative of the Argentine Republic, harmonized by the international requirements as for the control of radioactive material. (Author)

  16. A study on multi-data source fusion method for petroleum pipeline leak detection

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Wei; Zhang, Laibin [Research Center of Oil and Gas Safety Engineering Technology, China University of Petroleum, Beijing, (China)

    2010-07-01

    The detection of leaks on petroleum pipeline is a very important safety issue. Several studies were commissioned to develop new monitoring procedures for leakage detection. This paper sets out a new leak detection process. The approach developed took into consideration steady and transient states. The study investigated leak diagnosis problems in product pipelines using multi-sensor measurements (pressure, flux, density and temperature). The information collected from each sensor was considered as pieces of evidence that describe the operational conditions of the pipeline. The Dempster-Shafer (D-S) theory is used to associate multi-sensor data to pipe health indices. Experimental pressure and flow rate data were recorded using a Pipeline Leak Detection System (PLDS) acquisition card and used to verify the accuracy and reliability of this new detection method. The results showed that the degree of credibility was a high as 0.877. It was also found that multi-feature information fusion improves recognition of pipeline conditions.

  17. Influence of multi-microphone signal enhancement algorithms on the acoustics and detectability of angular and radial source movements

    DEFF Research Database (Denmark)

    Lundbeck, Micha; Hartog, Laura; Grimm, Giso

    2018-01-01

    Hearing-impaired listeners are known to have difficulties not only with understanding speech in noise, but also with judging source distance and movement, and these deficits are related to perceived handicap. It is possible that the perception of spatially dynamic sounds can be improved...... with hearing aids (HAs), but so far this has not been investigated. In a previous study, older hearing-impaired (OHI) listeners showed poorer detectability for virtual left-right (angular) and near-far (radial) source movements due to lateral interfering sounds and reverberation, respectively (Lundbeck, Grimm...

  18. Semi-empirical Determination of Detection Efficiency for Voluminous Source by Effective Solid Angle Method

    Energy Technology Data Exchange (ETDEWEB)

    Kang, M. Y.; Kim, J. H.; Choi, H. D. [Seoul National Univ., Seoul (Korea, Republic of); Sun, G. M. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-05-15

    In the field of γ-ray measurements, the determination of full energy (FE) absorption peak efficiency for a voluminous sample is difficult, because the preparation of the certified radiation source with the same chemical composition and geometry for the original voluminous sample is not easy. In order to solve this inconvenience, simulation or semi-empirical methods are preferred in many cases. Effective Solid Angle (ESA) Code which includes semi-empirical approach has been developed by the Applied Nuclear Physics Group in Seoul National University. In this study, we validated ESA code by using Marinelli type voluminous KRISS (Korea Research Institute of Standards and Science) CRM (Certified Reference Materials) sources and IAEA standard γ-ray point sources. And semi-empirically determined efficiency curve for voluminous source by using the ESA code is compared with the experimental value. We calculated the efficiency curve of voluminous source from the measured efficiency of standard point source by using the ESA code. We will carry out the ESA code validation by measurement of various CRM volume sources with detector of different efficiency.

  19. Interface-Targeting Strategy Enables Two-Photon Fluorescent Lipid Droplet Probes for High-Fidelity Imaging of Turbid Tissues and Detecting Fatty Liver.

    Science.gov (United States)

    Guo, Lifang; Tian, Minggang; Feng, Ruiqing; Zhang, Ge; Zhang, Ruoyao; Li, Xuechen; Liu, Zhiqiang; He, Xiuquan; Sun, Jing Zhi; Yu, Xiaoqiang

    2018-04-04

    Lipid droplets (LDs) with unique interfacial architecture not only play crucial roles in protecting a cell from lipotoxicity and lipoapoptosis but also closely relate with many diseases such as fatty liver and diabetes. Thus, as one of the important applied biomaterials, fluorescent probes with ultrahigh selectivity for in situ and high-fidelity imaging of LDs in living cells and tissues are critical to elucidate relevant physiological and pathological events as well as detect related diseases. However, available probes only utilizing LDs' waterless neutral cores but ignoring the unique phospholipid monolayer interfaces exhibit low selectivity. They cannot differentiate neutral cores of LDs from intracellular other lipophilic microenvironments, which results in extensively cloud-like background noise and severely limited their bioapplications. Herein, to design LD probes with ultrahigh selectivity, the exceptional interfacial architecture of LDs is considered adequately and thus an interface-targeting strategy is proposed for the first time. According to the novel strategy, we have developed two amphipathic fluorescent probes (N-Cy and N-Py) by introducing different cations into a lipophilic fluorophore (nitrobenzoxadiazole (NBD)). Consequently, their cationic moiety precisely locates the interfaces through electrostatic interaction and simultaneously NBD entirely embeds into the waterless core via hydrophobic interaction. Thus, high-fidelity and background-free fluorescence imaging of LDs are expectably realized in living cells in situ. Moreover, LDs in turbid tissues like skeletal muscle slices have been clearly imaged (up to 82 μm depth) by a two-photon microscope. Importantly, using N-Cy, we not only intuitively monitored the variations of LDs in number, size, and morphology but also clearly revealed their abnormity in hepatic tissues resulting from fatty liver. Therefore, these unique probes provide excellent imaging tools for elucidating LD

  20. Archival Legacy Investigations of Circumstellar Environments (ALICE): Statistical assessment of point source detections

    Science.gov (United States)

    Choquet, Élodie; Pueyo, Laurent; Soummer, Rémi; Perrin, Marshall D.; Hagan, J. Brendan; Gofas-Salas, Elena; Rajan, Abhijith; Aguilar, Jonathan

    2015-09-01

    The ALICE program, for Archival Legacy Investigation of Circumstellar Environment, is currently conducting a virtual survey of about 400 stars, by re-analyzing the HST-NICMOS coronagraphic archive with advanced post-processing techniques. We present here the strategy that we adopted to identify detections and potential candidates for follow-up observations, and we give a preliminary overview of our detections. We present a statistical analysis conducted to evaluate the confidence level on these detection and the completeness of our candidate search.

  1. Nuclear Material Detection by One-Short-Pulse-Laser-Driven Neutron Source

    International Nuclear Information System (INIS)

    Favalli, Andrea; Aymond, F.; Bridgewater, Jon S.; Croft, Stephen; Deppert, O.; Devlin, Matthew James; Falk, Katerina; Fernandez, Juan Carlos; Gautier, Donald Cort; Gonzales, Manuel A.; Goodsell, Alison Victoria; Guler, Nevzat; Hamilton, Christopher Eric; Hegelich, Bjorn Manuel; Henzlova, Daniela; Ianakiev, Kiril Dimitrov; Iliev, Metodi; Johnson, Randall Philip; Jung, Daniel; Kleinschmidt, Annika; Koehler, Katrina Elizabeth; Pomerantz, Ishay; Roth, Markus; Santi, Peter Angelo; Shimada, Tsutomu; Swinhoe, Martyn Thomas; Taddeucci, Terry Nicholas; Wurden, Glen Anthony; Palaniyappan, Sasikumar; McCary, E.

    2015-01-01

    Covered in the PowerPoint presentation are the following areas: Motivation and requirements for active interrogation of nuclear material; laser-driven neutron source; neutron diagnostics; active interrogation of nuclear material; and, conclusions, remarks, and future works.

  2. Multi-Sensor Integration to Map Odor Distribution for the Detection of Chemical Sources

    Directory of Open Access Journals (Sweden)

    Xiang Gao

    2016-07-01

    Full Text Available This paper addresses the problem of mapping odor distribution derived from a chemical source using multi-sensor integration and reasoning system design. Odor localization is the problem of finding the source of an odor or other volatile chemical. Most localization methods require a mobile vehicle to follow an odor plume along its entire path, which is time consuming and may be especially difficult in a cluttered environment. To solve both of the above challenges, this paper proposes a novel algorithm that combines data from odor and anemometer sensors, and combine sensors’ data at different positions. Initially, a multi-sensor integration method, together with the path of airflow was used to map the pattern of odor particle movement. Then, more sensors are introduced at specific regions to determine the probable location of the odor source. Finally, the results of odor source location simulation and a real experiment are presented.

  3. Locating sensors for detecting source-to-target patterns of special nuclear material smuggling: a spatial information theoretic approach.

    Science.gov (United States)

    Przybyla, Jay; Taylor, Jeffrey; Zhou, Xuesong

    2010-01-01

    In this paper, a spatial information-theoretic model is proposed to locate sensors for detecting source-to-target patterns of special nuclear material (SNM) smuggling. In order to ship the nuclear materials from a source location with SNM production to a target city, the smugglers must employ global and domestic logistics systems. This paper focuses on locating a limited set of fixed and mobile radiation sensors in a transportation network, with the intent to maximize the expected information gain and minimize the estimation error for the subsequent nuclear material detection stage. A Kalman filtering-based framework is adapted to assist the decision-maker in quantifying the network-wide information gain and SNM flow estimation accuracy.

  4. Locating Sensors for Detecting Source-to-Target Patterns of Special Nuclear Material Smuggling: A Spatial Information Theoretic Approach

    Directory of Open Access Journals (Sweden)

    Xuesong Zhou

    2010-08-01

    Full Text Available In this paper, a spatial information-theoretic model is proposed to locate sensors for detecting source-to-target patterns of special nuclear material (SNM smuggling. In order to ship the nuclear materials from a source location with SNM production to a target city, the smugglers must employ global and domestic logistics systems. This paper focuses on locating a limited set of fixed and mobile radiation sensors in a transportation network, with the intent to maximize the expected information gain and minimize the estimation error for the subsequent nuclear material detection stage. A Kalman filtering-based framework is adapted to assist the decision-maker in quantifying the network-wide information gain and SNM flow estimation accuracy.

  5. Improvement of bunch-by-bunch beam current detection system in Hefei light source

    International Nuclear Information System (INIS)

    Zheng Kai; Wang Junhua; Liu Zuping; Li Weimin; Zhou Zeran; Yang Yongliang; Huang Longjun; Chen Yuanbo

    2006-01-01

    Bunch-by-bunch beam current detection system is an important facility in the multibunch storage ring. In this paper, the established bunch-by-bunch beam current detection systems for the accelerator such as Cornell, SLAC and KEKB were compared and studied. The design of the bunch-by-bunch beam current detection system for HLS, which was based on the bunch-by-bunch tracing measurement system in HLS was given. Both demodulation by sine wave and square were applied in this paper, the deviation of the detect system was determined by the longitudinal oscillation. Compared the data acquired from ADC with the data from DCCT, the ADC data was scaled by the bunch current. The standard deviations of linear fit were about 1%, and the standard deviations of polynomial fit were less than 0.5% in both sine wave and square wave demodulation. Some analysis of the measurement results also had been shown in this paper. (authors)

  6. Sensitivities and detection limits of X-ray fluorescence analysis with a 10 mCi241Am source

    International Nuclear Information System (INIS)

    Wundt, K.; Janghorbani, M.; Starke, K.

    1976-01-01

    Seven trace elements ranging from chromium to barium were preconcentrated on Amberlite IR-120 cation exchange paper and determined in an energy dispersive X-ray fluorescence system using a 10 mCi 241 Am source. Sensitivities were experimentally determined and checked with theoretically calculated values. The detection limits are compared with elemental levels present in typical surface waters and those allowed in drinking water. Appropriate conclusions as to feasibility of such a system for environmental monitoring are drawn. (orig.) [de

  7. Multi-Source Fusion for Explosive Hazard Detection in Forward Looking Sensors

    Science.gov (United States)

    2016-12-01

    California, United States Paper Title: Voxel-space radar signal processing for side attack explosive ballistic detection Publication Status: 1-Published...documentation. 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS (ES) U.S. Army Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211...R-0012. The aim of this research is to improve the U.S. Army’s ability to detect landmines and explosive hazards in different scenarios using

  8. Enabling immersive simulation.

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Josh (University of California Santa Cruz, Santa Cruz, CA); Mateas, Michael (University of California Santa Cruz, Santa Cruz, CA); Hart, Derek H.; Whetzel, Jonathan; Basilico, Justin Derrick; Glickman, Matthew R.; Abbott, Robert G.

    2009-02-01

    The object of the 'Enabling Immersive Simulation for Complex Systems Analysis and Training' LDRD has been to research, design, and engineer a capability to develop simulations which (1) provide a rich, immersive interface for participation by real humans (exploiting existing high-performance game-engine technology wherever possible), and (2) can leverage Sandia's substantial investment in high-fidelity physical and cognitive models implemented in the Umbra simulation framework. We report here on these efforts. First, we describe the integration of Sandia's Umbra modular simulation framework with the open-source Delta3D game engine. Next, we report on Umbra's integration with Sandia's Cognitive Foundry, specifically to provide for learning behaviors for 'virtual teammates' directly from observed human behavior. Finally, we describe the integration of Delta3D with the ABL behavior engine, and report on research into establishing the theoretical framework that will be required to make use of tools like ABL to scale up to increasingly rich and realistic virtual characters.

  9. Compact quasi-monoenergetic photon sources from laser-plasma accelerators for nuclear detection and characterization

    Energy Technology Data Exchange (ETDEWEB)

    Geddes, Cameron G.R., E-mail: cgrgeddes@lbl.gov; Rykovanov, Sergey; Matlis, Nicholas H.; Steinke, Sven; Vay, Jean-Luc; Esarey, Eric H.; Ludewigt, Bernhard; Nakamura, Kei; Quiter, Brian J.; Schroeder, Carl B.; Toth, Csaba; Leemans, Wim P.

    2015-05-01

    Near-monoenergetic photon sources at MeV energies offer improved sensitivity at greatly reduced dose for active interrogation, and new capabilities in treaty verification, nondestructive assay of spent nuclear fuel and emergency response. Thomson (also referred to as Compton) scattering sources are an established method to produce appropriate photon beams. Applications are however restricted by the size of the required high-energy electron linac, scattering (photon production) system, and shielding for disposal of the high energy electron beam. Laser-plasma accelerators (LPAs) produce GeV electron beams in centimeters, using the plasma wave driven by the radiation pressure of an intense laser. Recent LPA experiments are presented which have greatly improved beam quality and efficiency, rendering them appropriate for compact high-quality photon sources based on Thomson scattering. Designs for MeV photon sources utilizing the unique properties of LPAs are presented. It is shown that control of the scattering laser, including plasma guiding, can increase photon production efficiency. This reduces scattering laser size and/or electron beam current requirements to scale compatible with the LPA. Lastly, the plasma structure can decelerate the electron beam after photon production, reducing the size of shielding required for beam disposal. Together, these techniques provide a path to a compact photon source system.

  10. Enabling distributed petascale science

    International Nuclear Information System (INIS)

    Baranovski, Andrew; Bharathi, Shishir; Bresnahan, John

    2007-01-01

    Petascale science is an end-to-end endeavour, involving not only the creation of massive datasets at supercomputers or experimental facilities, but the subsequent analysis of that data by a user community that may be distributed across many laboratories and universities. The new SciDAC Center for Enabling Distributed Petascale Science (CEDPS) is developing tools to support this end-to-end process. These tools include data placement services for the reliable, high-performance, secure, and policy-driven placement of data within a distributed science environment; tools and techniques for the construction, operation, and provisioning of scalable science services; and tools for the detection and diagnosis of failures in end-to-end data placement and distributed application hosting configurations. In each area, we build on a strong base of existing technology and have made useful progress in the first year of the project. For example, we have recently achieved order-of-magnitude improvements in transfer times (for lots of small files) and implemented asynchronous data staging capabilities; demonstrated dynamic deployment of complex application stacks for the STAR experiment; and designed and deployed end-to-end troubleshooting services. We look forward to working with SciDAC application and technology projects to realize the promise of petascale science

  11. Self-assembled films containing crude extract of avocado as a source of tyrosinase for monophenol detection

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, Nirton C.S., E-mail: nirtoncristi@gmail.com [Instituto de Física de São Carlos/Universidade de São Paulo, CP 369, 13560-970 São Carlos, SP (Brazil); Ferreira, Reginaldo A. [Centro de Estudos e Inovação em Materiais Biofuncionais Avançados/Universidade Federal de Itajubá, CP 50, 37500-903 Itajubá, MG (Brazil); Cruz Rodrigues, Valquiria da; Guimarães, Francisco E.G. [Instituto de Física de São Carlos/Universidade de São Paulo, CP 369, 13560-970 São Carlos, SP (Brazil); Queiroz, Alvaro A.A. de [Centro de Estudos e Inovação em Materiais Biofuncionais Avançados/Universidade Federal de Itajubá, CP 50, 37500-903 Itajubá, MG (Brazil)

    2013-10-15

    This paper reports on the use of the crude extract of avocado (CEA) fruit (Persea americana) as a source of tyrosinase enzyme. CEA was immobilized via layer by layer (LbL) technique onto indium tin oxide (ITO) substrates and applied in the detection of monophenol using a potentiometric biosensor. Poly(propylene imine) dendrimer of generation 3 (PPI-G3) was used as a counter ion in the layer by layer process due to its highly porous structure and functional groups suitable for enzyme linkage. After the immobilization of the crude CEA as multilayered films, standard samples of monophenol were detected in the 0.25–4.00 mM linear range with approximately 28 mV mM{sup −1} of sensitivity. This sensitivity is 14 times higher than the values found in the literature for a similar system. The results show that it is possible to obtain efficient and low-cost biosensors for monophenol detection using potentiometric transducers and alternative sources of enzymes without purification. - Highlights: • ITO films were functionalized with multilayers of PPI dendrimer and crude extract of avocado. • The films were applied as potentiometric biosensor for the detection of monophenol. • The proposed system presented an excellent sensitivity to monophenol (27 mV mM{sup −1})

  12. Self-assembled films containing crude extract of avocado as a source of tyrosinase for monophenol detection

    International Nuclear Information System (INIS)

    Vieira, Nirton C.S.; Ferreira, Reginaldo A.; Cruz Rodrigues, Valquiria da; Guimarães, Francisco E.G.; Queiroz, Alvaro A.A. de

    2013-01-01

    This paper reports on the use of the crude extract of avocado (CEA) fruit (Persea americana) as a source of tyrosinase enzyme. CEA was immobilized via layer by layer (LbL) technique onto indium tin oxide (ITO) substrates and applied in the detection of monophenol using a potentiometric biosensor. Poly(propylene imine) dendrimer of generation 3 (PPI-G3) was used as a counter ion in the layer by layer process due to its highly porous structure and functional groups suitable for enzyme linkage. After the immobilization of the crude CEA as multilayered films, standard samples of monophenol were detected in the 0.25–4.00 mM linear range with approximately 28 mV mM −1 of sensitivity. This sensitivity is 14 times higher than the values found in the literature for a similar system. The results show that it is possible to obtain efficient and low-cost biosensors for monophenol detection using potentiometric transducers and alternative sources of enzymes without purification. - Highlights: • ITO films were functionalized with multilayers of PPI dendrimer and crude extract of avocado. • The films were applied as potentiometric biosensor for the detection of monophenol. • The proposed system presented an excellent sensitivity to monophenol (27 mV mM −1 )

  13. Evaluation of different analysis and identification methods for Salmonella detection in surface drinking water sources

    International Nuclear Information System (INIS)

    Hsu, Bing-Mu; Huang, Kuan-Hao; Huang, Shih-Wei; Tseng, Kuo-Chih; Su, Ming-Jen; Lin, Wei-Chen; Ji, Dar-Der; Shih, Feng-Cheng; Chen, Jyh-Larng; Kao, Po-Min

    2011-01-01

    The standard method for detecting Salmonella generally analyzes food or fecal samples. Salmonella often occur in relatively low concentrations in environmental waters. Therefore, some form of concentration and proliferation may be needed. This study compares three Salmonella analysis methods and develops a new Salmonella detection procedure for use in environmental water samples. The new procedure for Salmonella detection include water concentration, nutrient broth enrichment, selection of Salmonella containing broth by PCR, isolation of Salmonella strains by selective culture plates, detection of possible Salmonella isolate by PCR, and biochemical testing. Serological assay and pulsed-field gel electrophoresis (PFGE) can be used to identify Salmonella serotype and genotype, respectively. This study analyzed 116 raw water samples taken from 18 water plants and belonging to 5 watersheds. Of these 116, 10 water samples (8.6%) taken from 7 water plants and belonging to 4 watersheds were positive for a Salmonella-specific polymerase chain reaction targeting the invA gene. Guided by serological assay results, this study identified 7 cultured Salmonella isolates as Salmonella enterica serovar: Alnaby, Enteritidis, Houten, Montevideo, Newport, Paratyphi B var. Java, and Victoria. These seven Salmonella serovars were identified in clinical cases for the same geographical areas, but only one of them was 100% homologous with clinical cases in the PFGE pattern. - Research highlights: → A new Salmonella detecting procedure for environmental water is developed. → Salmonella isolates are identified by serological assay and PFGE. → A total of seven Salmonella serovars is isolated from environmental water.

  14. Evaluation of different analysis and identification methods for Salmonella detection in surface drinking water sources

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Bing-Mu, E-mail: bmhsu@ccu.edu.tw [Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC (China); Huang, Kuan-Hao; Huang, Shih-Wei [Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC (China); Tseng, Kuo-Chih [Department of Internal Medicine, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan, ROC (China); Su, Ming-Jen [Department of Clinical Pathology, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan, ROC (China); Lin, Wei-Chen; Ji, Dar-Der [Research and Diagnostic Center, Centers for Disease Control, Taipei, Taiwan, ROC (China); Shih, Feng-Cheng; Chen, Jyh-Larng [Department of Environmental Engineering and Health, Yuanpei University of Science and Technology, HsinChu, Taiwan, ROC (China); Kao, Po-Min [Department of Earth and Environmental Sciences, National Chung Cheng University, Chiayi, Taiwan, ROC (China)

    2011-09-15

    The standard method for detecting Salmonella generally analyzes food or fecal samples. Salmonella often occur in relatively low concentrations in environmental waters. Therefore, some form of concentration and proliferation may be needed. This study compares three Salmonella analysis methods and develops a new Salmonella detection procedure for use in environmental water samples. The new procedure for Salmonella detection include water concentration, nutrient broth enrichment, selection of Salmonella containing broth by PCR, isolation of Salmonella strains by selective culture plates, detection of possible Salmonella isolate by PCR, and biochemical testing. Serological assay and pulsed-field gel electrophoresis (PFGE) can be used to identify Salmonella serotype and genotype, respectively. This study analyzed 116 raw water samples taken from 18 water plants and belonging to 5 watersheds. Of these 116, 10 water samples (8.6%) taken from 7 water plants and belonging to 4 watersheds were positive for a Salmonella-specific polymerase chain reaction targeting the invA gene. Guided by serological assay results, this study identified 7 cultured Salmonella isolates as Salmonella enterica serovar: Alnaby, Enteritidis, Houten, Montevideo, Newport, Paratyphi B var. Java, and Victoria. These seven Salmonella serovars were identified in clinical cases for the same geographical areas, but only one of them was 100% homologous with clinical cases in the PFGE pattern. - Research highlights: {yields} A new Salmonella detecting procedure for environmental water is developed. {yields} Salmonella isolates are identified by serological assay and PFGE. {yields} A total of seven Salmonella serovars is isolated from environmental water.

  15. Semi-empirical Calculation of Detection Efficiency for Voluminous Source Based on Effective Solid Angle Concept

    Energy Technology Data Exchange (ETDEWEB)

    Kang, M. Y.; Kim, J. H.; Choi, H. D.; Sun, G. M. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-10-15

    To calculate the full energy (FE) absorption peak efficiency for arbitrary volume sample, we developed and verified the Effective Solid Angle (ESA) Code. The procedure for semi-empirical determination of the FE efficiency for the arbitrary volume sources and the calculation principles and processes about ESA code is referred to, and the code was validated with a HPGe detector (relative efficiency 32%, n-type) in previous studies. In this study, we use different type and efficiency of HPGe detectors, in order to verify the performance of the ESA code for the various detectors. We calculated the efficiency curve of voluminous source and compared with experimental data. We will carry out additional validation by measurement of various medium, volume and shape of CRM volume sources with detector of different efficiency and type. And we will reflect the effect of the dead layer of p-type HPGe detector and coincidence summing correction technique in near future.

  16. Developing laser ablation in an electron cyclotron resonance ion source for actinide detection with AMS

    Energy Technology Data Exchange (ETDEWEB)

    Bauder, W. [Argonne National Laboratory, Physics Division, 9600 S. Cass Ave, Lemont, IL 60439 (United States); University of Notre Dame, Nuclear Science Laboratory, 124 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Pardo, R.C.; Kondev, F.G.; Kondrashev, S.; Nair, C.; Nusair, O. [Argonne National Laboratory, Physics Division, 9600 S. Cass Ave, Lemont, IL 60439 (United States); Palchan, T. [Hebrew University, Racah Institute of Physics, Jerusalem 91904 (Israel); Scott, R.; Seweryniak, D.; Vondrasek, R. [Argonne National Laboratory, Physics Division, 9600 S. Cass Ave, Lemont, IL 60439 (United States); Collon, P. [University of Notre Dame, Nuclear Science Laboratory, 124 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Paul, M. [Hebrew University, Racah Institute of Physics, Jerusalem 91904 (Israel)

    2015-10-15

    A laser ablation material injection system has been developed at the ATLAS electron cyclotron resonance (ECR) ion source for use in accelerator mass spectrometry experiments. Beam production with laser ablation initially suffered from instabilities due to fluctuations in laser energy and cratering on the sample surface by the laser. However, these instabilities were rectified by applying feedback correction for the laser energy and rastering the laser across the sample surface. An initial experiment successfully produced and accelerated low intensity actinide beams with up to 1000 counts per second. With continued development, laser ablation shows promise as an alternative material injection scheme for ECR ion sources and may help substantially reduce cross talk in the source.

  17. Combined sensors for the detection, identification and monitoring of radiation sources

    International Nuclear Information System (INIS)

    Yaar, I.

    2006-01-01

    Radiation sources widely used in industry, medicine, agriculture. Research and education are the most dangerous from the viewpoint of their widespread and easy access.The probability that these sources will be stolen and used to assemble a radiological dispersive (RDD) is nor negligible. Such a device can be used by terrorist groups for the purpose of contamination of industrial centers, airports, seaports and residential areas, which can affect a large sector of the economy of a country. Detonation of a RDD can lead to death and exposure of the population to radiation, but, as a whole, the use of the bomb is aimed at creating panic among population, causing economic damage and social shock to the society. In this work, ways to reduce the threat of radiation sources obtained outside and within a country will be discussed

  18. Control of emissions from stationary combustion sources: Pollutant detection and behavior in the atmosphere

    International Nuclear Information System (INIS)

    Licht, W.; Engel, A.J.; Slater, S.M.

    1979-01-01

    Stationary combustion resources continue to be significant sources of NOx and SOx pollutants in the ambient atmosphere. This volume considers four problem areas: (1) control of emissions from stationary combustion sources, particularly SOx and NOx (2) pollutant behavior in the atmosphere (3) advances in air pollution analysis and (4) air quality management. Topics of interest include carbon slurries for sulfur dioxide abatement, mass transfer in the Kellogg-Weir air quality control system, oxidation/inhibition of sulfite ion in aqueous solution, some micrometeorological methods of measuring dry deposition rates, Spanish moss as an indicator of airborne metal contamination, and air quality impacts from future electric power generation in Texas

  19. Non-Darwinian evolution for the source detection of atmospheric releases

    Science.gov (United States)

    Cervone, Guido; Franzese, Pasquale

    2011-08-01

    A non-Darwinian evolutionary algorithm is presented as search engine to identify the characteristics of a source of atmospheric pollutants, given a set of concentration measurements. The algorithm drives iteratively a forward dispersion model from tentative sources toward the real source. The solutions of non-Darwinian evolution processes are not generated through pseudo-random operators, unlike traditional evolutionary algorithms, but through a reasoning process based on machine learning rule generation and instantiation. The new algorithm is tested with both a synthetic case and with the Prairie Grass field experiment. To further test the capabilities of the algorithm to work in real-world scenarios, the source identification of all Prairie Grass releases was performed with a decreasing number of sensor measurements, and a relationship is found between the precision of the solution, the number of sensors available, and the levels of concentration measured by the sensors. The proposed methodology can be used for a variety of optimization problems, and is particularly suited for problems where the operations needed for evaluating new candidate solutions are computationally expensive.

  20. A systems approach for detecting sources of Phytophthora contamination in nurseries

    Science.gov (United States)

    Jennifer L. Parke; Niklaus Grünwald; Carrie Lewis; Val Fieland

    2010-01-01

    Nursery plants are also important long-distance vectors of non-indigenous pathogens such as P. ramorum and P. kernoviae. Pre-shipment inspections have not been adequate to ensure that shipped plants are free from Phytophthora, nor has this method informed growers about sources of contamination in their...

  1. Bootstrap inversion technique for atmospheric trace gas source detection and quantification using long open-path laser measurements

    Directory of Open Access Journals (Sweden)

    C. B. Alden

    2018-03-01

    Full Text Available Advances in natural gas extraction technology have led to increased activity in the production and transport sectors in the United States and, as a consequence, an increased need for reliable monitoring of methane leaks to the atmosphere. We present a statistical methodology in combination with an observing system for the detection and attribution of fugitive emissions of methane from distributed potential source location landscapes such as natural gas production sites. We measure long (> 500 m, integrated open-path concentrations of atmospheric methane using a dual frequency comb spectrometer and combine measurements with an atmospheric transport model to infer leak locations and strengths using a novel statistical method, the non-zero minimum bootstrap (NZMB. The new statistical method allows us to determine whether the empirical distribution of possible source strengths for a given location excludes zero. Using this information, we identify leaking source locations (i.e., natural gas wells through rejection of the null hypothesis that the source is not leaking. The method is tested with a series of synthetic data inversions with varying measurement density and varying levels of model–data mismatch. It is also tested with field observations of (1 a non-leaking source location and (2 a source location where a controlled emission of 3.1  ×  10−5 kg s−1 of methane gas is released over a period of several hours. This series of synthetic data tests and outdoor field observations using a controlled methane release demonstrates the viability of the approach for the detection and sizing of very small leaks of methane across large distances (4+ km2 in synthetic tests. The field tests demonstrate the ability to attribute small atmospheric enhancements of 17 ppb to the emitting source location against a background of combined atmospheric (e.g., background methane variability and measurement uncertainty of 5 ppb (1σ, when

  2. Bootstrap inversion technique for atmospheric trace gas source detection and quantification using long open-path laser measurements

    Science.gov (United States)

    Alden, Caroline B.; Ghosh, Subhomoy; Coburn, Sean; Sweeney, Colm; Karion, Anna; Wright, Robert; Coddington, Ian; Rieker, Gregory B.; Prasad, Kuldeep

    2018-03-01

    Advances in natural gas extraction technology have led to increased activity in the production and transport sectors in the United States and, as a consequence, an increased need for reliable monitoring of methane leaks to the atmosphere. We present a statistical methodology in combination with an observing system for the detection and attribution of fugitive emissions of methane from distributed potential source location landscapes such as natural gas production sites. We measure long (> 500 m), integrated open-path concentrations of atmospheric methane using a dual frequency comb spectrometer and combine measurements with an atmospheric transport model to infer leak locations and strengths using a novel statistical method, the non-zero minimum bootstrap (NZMB). The new statistical method allows us to determine whether the empirical distribution of possible source strengths for a given location excludes zero. Using this information, we identify leaking source locations (i.e., natural gas wells) through rejection of the null hypothesis that the source is not leaking. The method is tested with a series of synthetic data inversions with varying measurement density and varying levels of model-data mismatch. It is also tested with field observations of (1) a non-leaking source location and (2) a source location where a controlled emission of 3.1 × 10-5 kg s-1 of methane gas is released over a period of several hours. This series of synthetic data tests and outdoor field observations using a controlled methane release demonstrates the viability of the approach for the detection and sizing of very small leaks of methane across large distances (4+ km2 in synthetic tests). The field tests demonstrate the ability to attribute small atmospheric enhancements of 17 ppb to the emitting source location against a background of combined atmospheric (e.g., background methane variability) and measurement uncertainty of 5 ppb (1σ), when measurements are averaged over 2 min. The

  3. Theory of the detection of the field surrounding half-dressed sources

    International Nuclear Information System (INIS)

    Compagno, G.; Passante, R.; Persico, F.

    1988-01-01

    Half-dressed sources are defined as sources deprived partially or totally of the cloud of virtual quanta which surrounds them in the ground state of the total system. Two models of a half-dressed point source S are considered, the first in the framework of the theory of massive scalar fields and the second in quantum electrodynamics (QED). In both cases the detector is modeled by a second fully dressed source T of the same field, which is also bound to an oscillation center by harmonic forces. It is shown that when S at time t = 0 is suddenly coupled to or decoupled from the field, the detector T, which is initially at rest, is set in motion after a time t = R 0 /c, where R 0 is the S-T distance. Neglecting the reaction back on the field due to the oscillatory motion of T, the amplitude of oscillation for t = ∞ is obtained as a function of R 0 . Thus the time-varying virtual field of S is shown to be capable of exerting a force which excites the model detector. For the QED case, this force is related to the properties of the energy density of the virtual field. This energy density displays a singularity at r = ct, and the mathematical nature of this singularity is studied in detail. In this way it is shown that the energy density of the time-dependent virtual field is rather different from that of a pulse of radiation emitted by a source during energy-conserving processes. The differences are discussed in detail, as well as the limitations of the model

  4. Pulsed Operation of a Compact Fusion Neutron Source Using a High-Voltage Pulse Generator Developed for Landmine Detection

    International Nuclear Information System (INIS)

    Yamauchi, Kunihito; Watanabe, Masato; Okino, Akitoshi; Kohno, Toshiyuki; Hotta, Eiki; Yuura, Morimasa

    2005-01-01

    Preliminary experimental results of pulsed neutron source based on a discharge-type beam fusion called Inertial Electrostatic Confinement Fusion (IECF) for landmine detection are presented. In Japan, a research and development project for constructing an advanced anti-personnel landmine detection system by using IECF, which is effective not only for metal landmines but also for plastic ones, is now in progress. This project consists of some R and D topics, and one of them is R and D of a high-voltage pulse generator system specialized for landmine detection, which can be used in the severe environment such as that in the field in Afghanistan. Thus a prototype of the system for landmine detection was designed and fabricated in consideration of compactness, lightness, cooling performance, dustproof and robustness. By using this prototype pulse generator system, a conventional IECF device was operated as a preliminary experiment. As a result, it was confirmed that the suggested pulse generator system is suitable for landmine detection system, and the results follow the empirical law obtained by the previous experiments. The maximum neutron production rate of 2.0x10 8 n/s was obtained at a pulsed discharge of -51 kV, 7.3 A

  5. Robust fault detection for the dynamics of high-speed train with multi-source finite frequency interference.

    Science.gov (United States)

    Bai, Weiqi; Dong, Hairong; Yao, Xiuming; Ning, Bin

    2018-04-01

    This paper proposes a composite fault detection scheme for the dynamics of high-speed train (HST), using an unknown input observer-like (UIO-like) fault detection filter, in the presence of wind gust and operating noises which are modeled as disturbance generated by exogenous system and unknown multi-source disturbance within finite frequency domain. Using system input and system output measurements, the fault detection filter is designed to generate the needed residual signals. In order to decouple disturbance from residual signals without truncating the influence of faults, this paper proposes a method to partition the disturbance into two parts. One subset of the disturbance does not appear in residual dynamics, and the influence of the other subset is constrained by H ∞ performance index in a finite frequency domain. A set of detection subspaces are defined, and every different fault is assigned to its own detection subspace to guarantee the residual signals are diagonally affected promptly by the faults. Simulations are conducted to demonstrate the effectiveness and merits of the proposed method. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  6. Use of an external source (60Co) for 32P detection efficiency determination by the Cerenkov effect, in soil extracts

    International Nuclear Information System (INIS)

    Nascimento Filho, V.F. do.

    1975-03-01

    The detection of 32 P in aqueous extracts is usually made with the aid of a Geiger-Muller detector, with thin window and sample on a planchet. Presently the technique is being developed of detection of high energy beta particles emitters ( 32 P, 42 K, 86 Rb) through the Cerenkov effect, using a commercial liquid scintillation system. This technique, despite being approximately 30 times more sensitive, has the inconvenience of varying the detection efficiency, mainly for color samples (soil extracts, for instance). From this stems the need for determining the detection efficiency for each sample. The internal standardization and channels ratio methods show a series of drawbacks, mainly the non-reutilization of the samples (1st method) and statistical uncertainty for low activity samples (2nd method). The elimination of these dreawbacks can be achieved through the utilization of the external standardization method. A 60 Co source with 1,4 μCi activity has been adapted to the sample elevator of the detector system, and a comparison was made with the channels ratio method to evaluate the efficiency of 32 P detection in soil extracts (P extraction and fractionation). The external standardization method showed to be more accurate, besides being influenced to a lesser degree by high voltage variation, sample volume and vial types. In the case of large samples, it is advisable to carry out detection in vials filled up to their full capacity; in the case of small samples, the whole volume should be transferred to the vials and completed up to 9 ml for nylon vials,10 ml for glass vials and 11 to 14 ml for polyethilene vials. On the other hand, plastic vials showed higher detection efficiency than ones. As to background radiation, the lowest rates were given by nylon vials and the highest by Beckman glass vials [pt

  7. Fast and accurate detection of spread source in large complex networks.

    Science.gov (United States)

    Paluch, Robert; Lu, Xiaoyan; Suchecki, Krzysztof; Szymański, Bolesław K; Hołyst, Janusz A

    2018-02-06

    Spread over complex networks is a ubiquitous process with increasingly wide applications. Locating spread sources is often important, e.g. finding the patient one in epidemics, or source of rumor spreading in social network. Pinto, Thiran and Vetterli introduced an algorithm (PTVA) to solve the important case of this problem in which a limited set of nodes act as observers and report times at which the spread reached them. PTVA uses all observers to find a solution. Here we propose a new approach in which observers with low quality information (i.e. with large spread encounter times) are ignored and potential sources are selected based on the likelihood gradient from high quality observers. The original complexity of PTVA is O(N α ), where α ∈ (3,4) depends on the network topology and number of observers (N denotes the number of nodes in the network). Our Gradient Maximum Likelihood Algorithm (GMLA) reduces this complexity to O (N 2 log (N)). Extensive numerical tests performed on synthetic networks and real Gnutella network with limitation that id's of spreaders are unknown to observers demonstrate that for scale-free networks with such limitation GMLA yields higher quality localization results than PTVA does.

  8. Detection of anomalies in radio tomography of asteroids: Source count and forward errors

    Science.gov (United States)

    Pursiainen, S.; Kaasalainen, M.

    2014-09-01

    The purpose of this study was to advance numerical methods for radio tomography in which asteroid's internal electric permittivity distribution is to be recovered from radio frequency data gathered by an orbiter. The focus was on signal generation via multiple sources (transponders) providing one potential, or even essential, scenario to be implemented in a challenging in situ measurement environment and within tight payload limits. As a novel feature, the effects of forward errors including noise and a priori uncertainty of the forward (data) simulation were examined through a combination of the iterative alternating sequential (IAS) inverse algorithm and finite-difference time-domain (FDTD) simulation of time evolution data. Single and multiple source scenarios were compared in two-dimensional localization of permittivity anomalies. Three different anomaly strengths and four levels of total noise were tested. Results suggest, among other things, that multiple sources can be necessary to obtain appropriate results, for example, to distinguish three separate anomalies with permittivity less or equal than half of the background value, relevant in recovery of internal cavities.

  9. Characterization of sealed radioactive sources. Uncertainty analysis to improve detection methods

    International Nuclear Information System (INIS)

    Cummings, D.G.; Sommers, J.D.; Adamic, M.L.; Jimenez, M.; Giglio, J.J.; Carney, K.P.

    2009-01-01

    A radioactive 137 Cs source has been analyzed for the radioactive parent 137 Cs and stable decay daughter 137 Ba. The ratio of the daughter to parent atoms is used to estimate the date when Cs was purified prior to source encapsulation (an 'age' since purification). The isotopes were analyzed by inductively coupled plasma mass spectrometry (ICP-MS) after chemical separation. In addition, Ba was analyzed by isotope dilution ICP-MS (ID-ICP-MS). A detailed error analysis of the mass spectrometric work has been undertaken to identify areas of improvement, as well as quantifying the effect the errors have on the 'age' determined. This paper reports an uncertainty analysis to identifying areas of improvement and alternative techniques that may reduce the uncertainties. In particular, work on isotope dilution using ICP-MS for the 'age' determination of sealed sources is presented. The results will be compared to the original work done using external standards to calibrate the ICP-MS instrument. (author)

  10. Intrusion Detection in Bluetooth Enabled Mobile Phones

    CSIR Research Space (South Africa)

    Nair, Kishor Krishnan

    2015-11-23

    Full Text Available . Bluetooth Logging Agent (BLA) is a mechanism that has been developed for this purpose. It alleviates the current security issues by making the users aware of their incoming Bluetooth connections and gives them an option to either accept or reject...

  11. Stories about breast cancer in Australian women's magazines: information sources for risk, early detection and treatment.

    Science.gov (United States)

    Wilkes, L; Withnall, J; Harris, R; White, K; Beale, B; Hobson, J; Durham, M; Kristjanson, L

    2001-06-01

    Sixty articles in five Australian women's magazines were analyzed for journalistic qualities, metaphors, narrative features and accuracy of clinical facts related to risk, early detection and treatment of breast cancer. The stories were features, news features or soft news stories. The stories reflected the 'good news' editorial style of women's magazines. A dominant theme in the stories was that early detection of breast cancer is crucial and equals survival. While there were few inaccuracies in the stories, there was little detail of treatment modalities, an emphasis on lifestyle as a risk factor and a prevailing message that a genetic history of breast cancer means you will get it. A major implication of the findings is that nurses, who provide information to women, must be aware of the goals of journalists and the educational power of narrative logic of stories in women's magazines.

  12. Study on development and actual application of scientific crime detection technique using small scale neutron radiation source

    International Nuclear Information System (INIS)

    Suzuki, Yasuhiro; Kishi, Toru; Tachikawa, Noboru; Ishikawa, Isamu.

    1997-01-01

    PGA (Prompt γ-ray Analysis) is an analytic method of γ-ray generated from atomic nuclei of elements in the specimen just after irradiation (within 10(exp-14)sec.) of neutron to it. As using neutron with excellent transmission for an exciting source, this method can be used for inspecting the matters in closed containers non-destructively, and can also detect non-destructively light elements such as boron, nitrogen and others difficult by other non-destructive analysis. Especially, it is found that this method can detect such high concentration of nitrogen, chlorine and others which are characteristic elements for the explosives. However, as there are a number of limitations at the nuclear reactor site, development of an analytical apparatus for small scale neutron radiation source was begun, at first. In this fiscal year, analysis of the light elements such as nitrogen, chlorine and others using PGA was attempted by using 252-Cf as the simplest neutron source in its operation. As the 252-Cf neutron flux was considerably lower than that of nuclear reactor, its analytical sensitivity was also investigated. (G.K.)

  13. Developing an Open Source, Reusable Platform for Distributed Collaborative Information Management in the Early Detection Research Network

    Science.gov (United States)

    Hart, Andrew F.; Verma, Rishi; Mattmann, Chris A.; Crichton, Daniel J.; Kelly, Sean; Kincaid, Heather; Hughes, Steven; Ramirez, Paul; Goodale, Cameron; Anton, Kristen; hide

    2012-01-01

    For the past decade, the NASA Jet Propulsion Laboratory, in collaboration with Dartmouth University has served as the center for informatics for the Early Detection Research Network (EDRN). The EDRN is a multi-institution research effort funded by the U.S. National Cancer Institute (NCI) and tasked with identifying and validating biomarkers for the early detection of cancer. As the distributed network has grown, increasingly formal processes have been developed for the acquisition, curation, storage, and dissemination of heterogeneous research information assets, and an informatics infrastructure has emerged. In this paper we discuss the evolution of EDRN informatics, its success as a mechanism for distributed information integration, and the potential sustainability and reuse benefits of emerging efforts to make the platform components themselves open source. We describe our experience transitioning a large closed-source software system to a community driven, open source project at the Apache Software Foundation, and point to lessons learned that will guide our present efforts to promote the reuse of the EDRN informatics infrastructure by a broader community.

  14. Detecting Large-Scale Brain Networks Using EEG: Impact of Electrode Density, Head Modeling and Source Localization

    Science.gov (United States)

    Liu, Quanying; Ganzetti, Marco; Wenderoth, Nicole; Mantini, Dante

    2018-01-01

    Resting state networks (RSNs) in the human brain were recently detected using high-density electroencephalography (hdEEG). This was done by using an advanced analysis workflow to estimate neural signals in the cortex and to assess functional connectivity (FC) between distant cortical regions. FC analyses were conducted either using temporal (tICA) or spatial independent component analysis (sICA). Notably, EEG-RSNs obtained with sICA were very similar to RSNs retrieved with sICA from functional magnetic resonance imaging data. It still remains to be clarified, however, what technological aspects of hdEEG acquisition and analysis primarily influence this correspondence. Here we examined to what extent the detection of EEG-RSN maps by sICA depends on the electrode density, the accuracy of the head model, and the source localization algorithm employed. Our analyses revealed that the collection of EEG data using a high-density montage is crucial for RSN detection by sICA, but also the use of appropriate methods for head modeling and source localization have a substantial effect on RSN reconstruction. Overall, our results confirm the potential of hdEEG for mapping the functional architecture of the human brain, and highlight at the same time the interplay between acquisition technology and innovative solutions in data analysis. PMID:29551969

  15. Novel human-associated Lachnospiraceae genetic markers improve detection of fecal pollution sources in urban waters.

    Science.gov (United States)

    Feng, Shuchen; Bootsma, Melinda; McLellan, Sandra L

    2018-05-04

    The human microbiome contains many organisms that could potentially be used as indicators of human fecal pollution. Here we report the development of two novel human-associated genetic marker assays that target organisms within the family Lachnospiraceae Next-generation sequencing of the V6 region of the 16S rRNA gene from sewage and animal stool samples identified 40 human-associated marker candidates with a robust signal in sewage and low or no occurrence in nonhuman hosts. Two were chosen for quantitative PCR (qPCR) assay development using longer sequences (V2 to V9 regions) generated from clone libraries. Validation of these assays, designated Lachno3 and Lachno12, was performed using fecal samples (n=55) from cat, dog, pig, cow, deer, and gull sources, and compared with established host-associated assays (Lachno2, and two Human Bacteroides assays; HB and HF183/BacR287). Each of the established assays cross-reacted with at least one other animal, including animals common in urban areas. Lachno3 and Lachno12 were primarily human-associated; however, Lachno12 demonstrated low levels of cross-reactivity with select cows, and non-specific amplification in pigs. This limitation may not be problematic when testing urban waters. These novel markers resolved ambiguous results from previous investigations in stormwater-impacted waters, demonstrating their utility. The complexity of the microbiome in humans and animals suggests no single organism is strictly specific to humans, and multiple complementary markers used in combination will provide the highest resolution and specificity for assessing fecal pollution sources. IMPORTANCE Traditional fecal indicator bacteria do not distinguish animal from human fecal pollution, which is necessary to evaluate health risks and mitigate pollution sources. Assessing urban areas is challenging since water can be impacted by sewage, which has a high likelihood of carrying human pathogens, as well as pet waste and urban wildlife. We

  16. Radioactive sources and contaminated materials in scrap: monitoring, detection and remedial actions

    International Nuclear Information System (INIS)

    Gallini, R.; Berna, V.; Bonora, A.; Santini, M.

    1999-01-01

    The scrap recycling in steel and other metal mills represents one of the most relevant activities in the Province of Brescia (Lombardy, Italy). In our Province more than 20 million tonnes of metal scrap are recycled every year by a melting process. Since 1990, many accidents which took place were caused by the unwanted melting of radioactive sources, that were probably hidden in metal scrap. In 1993, the Italian Government stated directives to monitor metal scrap imported from non-EC countries because of the suspicion of the illegal traffic of radioactive materials. In 1996, a law imposed the control of all metal scrap, regardless of their origins. Since 1993, our staff have controlled thousands of railway wagons and trucks. Approximately a hundred steel mills and foundries of aluminium, cooper, brass, etc. have also been controlled and many samples have been collected (flue dust, slag, finished products). During these controls, contaminated areas have been brought to light in two warehouses (Cs 137), in 6 companies (Cs 137 and Am 241), in two landfills of industrial waste (Cs 137) and in a quarry (Cs 137). Up to now the contaminated areas have been cleaned, except for the last one. About 150 radioactive sources on contaminated materials have been found in metal scrap. We found radioactive sources of Co 60, Ra 226, Ir 192, Kr 85, Am 241, while the contamination of metals was mainly due to Ra 226. The situation described above justifies an accurate control of the amount of scrap to reduce the risk of contamination of the workers in the working areas, in the environment and in the general public. (author)

  17. On the Nature of Off-limb Flare Continuum Sources Detected by SDO /HMI

    Energy Technology Data Exchange (ETDEWEB)

    Heinzel, P.; Kašparová, J. [Astronomical Institute, Czech Academy of Sciences, 25165 Ondřejov (Czech Republic); Kleint, L.; Krucker, S., E-mail: pheinzel@asu.cas.cz [University of Applied Sciences and Arts Northwestern Switzerland, Bahnhofstrasse 6, 5210 Windisch (Switzerland)

    2017-09-20

    The Helioseismic and Magnetic Imager on board the Solar Dynamics Observatory has provided unique observations of off-limb flare emission. White-light continuum enhancements were detected in the “continuum” channel of the Fe 6173 Å line during the impulsive phase of the observed flares. In this paper we aim to determine which radiation mechanism is responsible for such enhancement being seen above the limb, at chromospheric heights around or below 1000 km. Using a simple analytical approach, we compare two candidate mechanisms, the hydrogen recombination continuum (Paschen) and the Thomson continuum due to scattering of disk radiation on flare electrons. Both mechanisms depend on the electron density, which is typically enhanced during the impulsive phase of a flare as the result of collisional ionization (both thermal and also non-thermal due to electron beams). We conclude that for electron densities higher than 10{sup 12} cm{sup −3}, the Paschen recombination continuum significantly dominates the Thomson scattering continuum and there is some contribution from the hydrogen free–free emission. This is further supported by detailed radiation-hydrodynamical (RHD) simulations of the flare chromosphere heated by the electron beams. We use the RHD code FLARIX to compute the temporal evolution of the flare-heating in a semi-circular loop. The synthesized continuum structure above the limb resembles the off-limb flare structures detected by HMI, namely their height above the limb, as well as the radiation intensity. These results are consistent with recent findings related to hydrogen Balmer continuum enhancements, which were clearly detected in disk flares by the IRIS near-ultraviolet spectrometer.

  18. Design of equipment for the detection of nickel-63 source of the gc-2010 electron capture detector

    International Nuclear Information System (INIS)

    Lopez O, A.

    2016-01-01

    It is necessary to design a system that is able to detect the presence of the radioactive source nickel-63, located within the electron capture detector gc- 2010 through the use of Arduino technology, presence sensors and motion This in turn It must be interfaced with a system of tracking and tracing , so collectively be mounted inside the mobile laboratory for research and technological development of systems and equipment for measuring radiation , gases and particles. The program has a structure reading sensors, processing the acquired data and execution of an action if necessary. The system does this by receiving data autonomously, the data is processed and at the end, determines whether the source is in normal operating conditions, if subjected to movements that may cause undesired operation if being handled, or has it has been extracted. (Author)

  19. Search Strategy of Detector Position For Neutron Source Multiplication Method by Using Detected-Neutron Multiplication Factor

    International Nuclear Information System (INIS)

    Endo, Tomohiro

    2011-01-01

    In this paper, an alternative definition of a neutron multiplication factor, detected-neutron multiplication factor kdet, is produced for the neutron source multiplication method..(NSM). By using kdet, a search strategy of appropriate detector position for NSM is also proposed. The NSM is one of the practical subcritical measurement techniques, i.e., the NSM does not require any special equipment other than a stationary external neutron source and an ordinary neutron detector. Additionally, the NSM method is based on steady-state analysis, so that this technique is very suitable for quasi real-time measurement. It is noted that the correction factors play important roles in order to accurately estimate subcriticality from the measured neutron count rates. The present paper aims to clarify how to correct the subcriticality measured by the NSM method, the physical meaning of the correction factors, and how to reduce the impact of correction factors by setting a neutron detector at an appropriate detector position

  20. Prospects of detection of the first sources with SKA using matched filters

    Science.gov (United States)

    Ghara, Raghunath; Choudhury, T. Roy; Datta, Kanan K.; Mellema, Garrelt; Choudhuri, Samir; Majumdar, Suman; Giri, Sambit K.

    2018-05-01

    The matched filtering technique is an efficient method to detect H ii bubbles and absorption regions in radio interferometric observations of the redshifted 21-cm signal from the epoch of reionization and the Cosmic Dawn. Here, we present an implementation of this technique to the upcoming observations such as the SKA1-low for a blind search of absorption regions at the Cosmic Dawn. The pipeline explores four dimensional parameter space on the simulated mock visibilities using a MCMC algorithm. The framework is able to efficiently determine the positions and sizes of the absorption/H ii regions in the field of view.

  1. Use of FDG-PET to detect a chronic odontogenic infection as a possible source of the brain abscess.

    Science.gov (United States)

    Sato, Jun; Kuroshima, Takeshi; Wada, Mayumi; Satoh, Akira; Watanabe, Shiro; Okamoto, Shozo; Shiga, Tohru; Tamaki, Nagara; Kitagawa, Yoshimasa

    2016-05-01

    This study describes the use of (18)F-fluoro-2-deoxyglucose positron emission tomography (FDG-PET) to detect a chronic odontogenic infection as the possible origin of a brain abscess (BA). A 74-year-old man with esophageal carcinoma was referred to our department to determine the origin of a BA in his oral cavity. He had no acute odontogenic infections. The BA was drained, and bacteria of the Staphylococcus milleri group were detected. Whole body FDG-PET revealed that the only sites of definite uptake of FDG were the esophageal carcinoma and the left upper maxillary region (SUVmax: 4.5). These findings suggested that the BA may have originated from a chronic periodontal infection. Six teeth with progressive chronic periodontal disease were extracted to remove the possible source of BA. These findings excluded the possibility of direct spread of bacteria from the odontogenic infectious lesion to the intracranial cavity. After extraction, there was no relapse of BA.

  2. Experimental optimisation of a moderated sup 2 sup 5 sup 2 Cf source for land mine detection

    CERN Document Server

    Zuin, L; Fabris, D; Lunardon, M; Nebbia, G; Viesti, G; Cinausero, M; Fioretto, E; Prete, G; Palomba, M; Pantaleo, A

    2000-01-01

    A moderated sup 2 sup 5 sup 2 Cf source to be used for the detection of buried land mines has been experimentally characterised. The moderating structure was obtained by using an inner sphere of Pb embedded in a high-density polyethylene (HDPe) brick assembly. The number of capture events in a Cd sample placed outside the structure was used, by varying the dimensions of the brick assembly, to determine the best moderator geometry. Furthermore, the detection of land mines by neutron capture reaction on nitrogen nuclei contained in the explosive was simulated by in field measurements placing the Cd sample at different depths in the soil. The obtained results are compared with predictions from Monte Carlo calculations.

  3. Tianma 65-m telescope detection of new OH maser features towards the water fountain source IRAS 18286-0959

    Science.gov (United States)

    Chen, Xi; Shen, Zhi-Qiang; Li, Xiao-Qiong; Yang, Kai; Nakashima, Jun-ichi; Wu, Ya-Jun; Zhao, Rong-Bin; Li, Juan; Wang, Jun-Zhi; Jiang, Dong-Rong; Wang, Jin-Qing; Li, Bin; Zhong, Wei-Ye; Yung, Bosco H. K.

    2017-07-01

    We report the results of the OH maser observation towards the water fountain source IRAS 18286-0959 using the newly built Shanghai Tianma 65-m Radio Telescope. We observed the three OH ground state transition lines at frequencies of 1612, 1665 and 1667 MHz. Comparing with the spectra of previous observations, we find new maser spectral components at velocity channels largely shifted from the systemic velocity: the velocity offsets of the newly found components lie in the range 20-40 km s-1 with respect to the systemic velocity. Besides maser variability, another possible interpretation for the newly detected maser features is that part of the molecular gas in the circumstellar envelope is accelerated. The acceleration is probably caused by the passage of a high-velocity molecular jet, which has been detected in previous Very Long Baseline Interferometry observations in the H2O maser line.

  4. Flash sourcing, or rapid detection and characterization of earthquake effects through website traffic analysis

    Directory of Open Access Journals (Sweden)

    Laurent Frobert

    2011-06-01

    Full Text Available

    This study presents the latest developments of an approach called ‘flash sourcing’, which provides information on the effects of an earthquake within minutes of its occurrence. Information is derived from an analysis of the website traffic surges of the European–Mediterranean Seismological Centre website after felt earthquakes. These surges are caused by eyewitnesses to a felt earthquake, who are the first who are informed of, and hence the first concerned by, an earthquake occurrence. Flash sourcing maps the felt area, and at least in some circumstances, the regions affected by severe damage or network disruption. We illustrate how the flash-sourced information improves and speeds up the delivery of public earthquake information, and beyond seismology, we consider what it can teach us about public responses when experiencing an earthquake. Future developments should improve the description of the earthquake effects and potentially contribute to the improvement of the efficiency of earthquake responses by filling the information gap after the occurrence of an earthquake.

  5. Open-source algorithm for detecting sea ice surface features in high-resolution optical imagery

    Directory of Open Access Journals (Sweden)

    N. C. Wright

    2018-04-01

    Full Text Available Snow, ice, and melt ponds cover the surface of the Arctic Ocean in fractions that change throughout the seasons. These surfaces control albedo and exert tremendous influence over the energy balance in the Arctic. Increasingly available meter- to decimeter-scale resolution optical imagery captures the evolution of the ice and ocean surface state visually, but methods for quantifying coverage of key surface types from raw imagery are not yet well established. Here we present an open-source system designed to provide a standardized, automated, and reproducible technique for processing optical imagery of sea ice. The method classifies surface coverage into three main categories: snow and bare ice, melt ponds and submerged ice, and open water. The method is demonstrated on imagery from four sensor platforms and on imagery spanning from spring thaw to fall freeze-up. Tests show the classification accuracy of this method typically exceeds 96 %. To facilitate scientific use, we evaluate the minimum observation area required for reporting a representative sample of surface coverage. We provide an open-source distribution of this algorithm and associated training datasets and suggest the community consider this a step towards standardizing optical sea ice imagery processing. We hope to encourage future collaborative efforts to improve the code base and to analyze large datasets of optical sea ice imagery.

  6. Lead chromate detected as a source of atmospheric Pb and Cr (VI) pollution

    Science.gov (United States)

    Lee, Pyeong-Koo; Yu, Soonyoung; Chang, Hye Jung; Cho, Hye Young; Kang, Min-Ju; Chae, Byung-Gon

    2016-10-01

    Spherical black carbon aggregates were frequently observed in dust dry deposition in Daejeon, Korea. They were tens of micrometers in diameter and presented a mixture of black carbon and several mineral phases. Transmission electron microscopy (TEM) observations with energy-dispersive X-ray spectroscopy (EDS) and selected area diffraction pattern (SADP) analyses confirmed that the aggregates were compact and included significant amounts of lead chromate (PbCrO4). The compositions and morphologies of the nanosized lead chromate particles suggest that they probably originated from traffic paint used in roads and were combined as discrete minerals with black carbon. Based on Pb isotope analysis and air-mass backward trajectories, the dust in Daejeon received a considerable input of anthropogenic pollutants from heavily industrialized Chinese cities, which implies that long-range transported aerosols containing PbCrO4 were a possible source of the lead and hexavalent chromium levels in East Asia. Lead chromate should be considered to be a source of global atmospheric Pb and Cr(VI) pollution, especially given its toxicity.

  7. Lead chromate detected as a source of atmospheric Pb and Cr (VI) pollution.

    Science.gov (United States)

    Lee, Pyeong-Koo; Yu, Soonyoung; Chang, Hye Jung; Cho, Hye Young; Kang, Min-Ju; Chae, Byung-Gon

    2016-10-25

    Spherical black carbon aggregates were frequently observed in dust dry deposition in Daejeon, Korea. They were tens of micrometers in diameter and presented a mixture of black carbon and several mineral phases. Transmission electron microscopy (TEM) observations with energy-dispersive X-ray spectroscopy (EDS) and selected area diffraction pattern (SADP) analyses confirmed that the aggregates were compact and included significant amounts of lead chromate (PbCrO 4 ). The compositions and morphologies of the nanosized lead chromate particles suggest that they probably originated from traffic paint used in roads and were combined as discrete minerals with black carbon. Based on Pb isotope analysis and air-mass backward trajectories, the dust in Daejeon received a considerable input of anthropogenic pollutants from heavily industrialized Chinese cities, which implies that long-range transported aerosols containing PbCrO 4 were a possible source of the lead and hexavalent chromium levels in East Asia. Lead chromate should be considered to be a source of global atmospheric Pb and Cr(VI) pollution, especially given its toxicity.

  8. Open-source algorithm for detecting sea ice surface features in high-resolution optical imagery

    Science.gov (United States)

    Wright, Nicholas C.; Polashenski, Chris M.

    2018-04-01

    Snow, ice, and melt ponds cover the surface of the Arctic Ocean in fractions that change throughout the seasons. These surfaces control albedo and exert tremendous influence over the energy balance in the Arctic. Increasingly available meter- to decimeter-scale resolution optical imagery captures the evolution of the ice and ocean surface state visually, but methods for quantifying coverage of key surface types from raw imagery are not yet well established. Here we present an open-source system designed to provide a standardized, automated, and reproducible technique for processing optical imagery of sea ice. The method classifies surface coverage into three main categories: snow and bare ice, melt ponds and submerged ice, and open water. The method is demonstrated on imagery from four sensor platforms and on imagery spanning from spring thaw to fall freeze-up. Tests show the classification accuracy of this method typically exceeds 96 %. To facilitate scientific use, we evaluate the minimum observation area required for reporting a representative sample of surface coverage. We provide an open-source distribution of this algorithm and associated training datasets and suggest the community consider this a step towards standardizing optical sea ice imagery processing. We hope to encourage future collaborative efforts to improve the code base and to analyze large datasets of optical sea ice imagery.

  9. Detection and Characterization of Ground Displacement Sources from Variational Bayesian Independent Component Analysis of GPS Time Series

    Science.gov (United States)

    Gualandi, A.; Serpelloni, E.; Belardinelli, M. E.

    2014-12-01

    A critical point in the analysis of ground displacements time series is the development of data driven methods that allow to discern and characterize the different sources that generate the observed displacements. A widely used multivariate statistical technique is the Principal Component Analysis (PCA), which allows to reduce the dimensionality of the data space maintaining most of the variance of the dataset explained. It reproduces the original data using a limited number of Principal Components, but it also shows some deficiencies. Indeed, PCA does not perform well in finding the solution to the so-called Blind Source Separation (BSS) problem, i.e. in recovering and separating the original sources that generated the observed data. This is mainly due to the assumptions on which PCA relies: it looks for a new Euclidean space where the projected data are uncorrelated. Usually, the uncorrelation condition is not strong enough and it has been proven that the BSS problem can be tackled imposing on the components to be independent. The Independent Component Analysis (ICA) is, in fact, another popular technique adopted to approach this problem, and it can be used in all those fields where PCA is also applied. An ICA approach enables us to explain the time series imposing a fewer number of constraints on the model, and to reveal anomalies in the data such as transient signals. However, the independence condition is not easy to impose, and it is often necessary to introduce some approximations. To work around this problem, we use a variational bayesian ICA (vbICA) method, which models the probability density function (pdf) of each source signal using a mix of Gaussian distributions. This technique allows for more flexibility in the description of the pdf of the sources, giving a more reliable estimate of them. Here we present the application of the vbICA technique to GPS position time series. First, we use vbICA on synthetic data that simulate a seismic cycle

  10. Detection of Traveling Ionospheric Disturbances (TIDs) from various man-made sources using Global Navigation Satellite System (GNSS)

    Science.gov (United States)

    Helmboldt, J.; Park, J.; von Frese, R. R. B.; Grejner-Brzezinska, D. A.

    2016-12-01

    Traveling ionospheric disturbance (TID) is generated by various sources and detectable by observing the spatial and temporal change of electron contents in the ionosphere. This study focused on detecting and analyzing TIDs generated by acoustic-gravity waves from man-made events including underground nuclear explosions (UNEs), mine collapses, mine blasts, and large chemical explosions (LCEs) using Global Navigation Satellite System (GNSS). In this study we selected different types of events for case study which covers two US and three North Korean UNEs, two large US mine collapses, three large US mine blasts, and a LCE in northern China and a second LCE at the Nevada Test Site. In most cases, we successfully detected the TIDs as array signatures from the multiple nearby GNSS stations. The array-based TID signatures from these studies were found to yield event-appropriate TID propagation speeds ranging from about a few hundred m/s to roughly a km/s. In addition, the event TID waveforms, and propagation angles and directions were established. The TID waveforms and the maximum angle between each event and the IPP of its TID with the longest travel distance from the source may help differentiate UNEs and LCEs, but the uneven distributions of the observing GNSS stations complicates these results. Thus, further analysis is required of the utility of the apertures of event signatures in the ionosphere for discriminating these events. In general, the results of this study show the potential utility of GNSS observations for detecting and mapping the ionospheric signatures of large-energy anthropological explosions and subsurface collapses.

  11. Integrated Photonics Enabled by Slow Light

    DEFF Research Database (Denmark)

    Mørk, Jesper; Chen, Yuntian; Ek, Sara

    2012-01-01

    In this talk we will discuss the physics of slow light in semiconductor materials and in particular the possibilities offered for integrated photonics. This includes ultra-compact slow light enabled optical amplifiers, lasers and pulse sources.......In this talk we will discuss the physics of slow light in semiconductor materials and in particular the possibilities offered for integrated photonics. This includes ultra-compact slow light enabled optical amplifiers, lasers and pulse sources....

  12. Detection of interferon alpha protein reveals differential levels and cellular sources in disease.

    Science.gov (United States)

    Rodero, Mathieu P; Decalf, Jérémie; Bondet, Vincent; Hunt, David; Rice, Gillian I; Werneke, Scott; McGlasson, Sarah L; Alyanakian, Marie-Alexandra; Bader-Meunier, Brigitte; Barnerias, Christine; Bellon, Nathalia; Belot, Alexandre; Bodemer, Christine; Briggs, Tracy A; Desguerre, Isabelle; Frémond, Marie-Louise; Hully, Marie; van den Maagdenberg, Arn M J M; Melki, Isabelle; Meyts, Isabelle; Musset, Lucile; Pelzer, Nadine; Quartier, Pierre; Terwindt, Gisela M; Wardlaw, Joanna; Wiseman, Stewart; Rieux-Laucat, Frédéric; Rose, Yoann; Neven, Bénédicte; Hertel, Christina; Hayday, Adrian; Albert, Matthew L; Rozenberg, Flore; Crow, Yanick J; Duffy, Darragh

    2017-05-01

    Type I interferons (IFNs) are essential mediators of antiviral responses. These cytokines have been implicated in the pathogenesis of autoimmunity, most notably systemic lupus erythematosus (SLE), diabetes mellitus, and dermatomyositis, as well as monogenic type I interferonopathies. Despite a fundamental role in health and disease, the direct quantification of type I IFNs has been challenging. Using single-molecule array (Simoa) digital ELISA technology, we recorded attomolar concentrations of IFNα in healthy donors, viral infection, and complex and monogenic interferonopathies. IFNα protein correlated well with functional activity and IFN-stimulated gene expression. High circulating IFNα levels were associated with increased clinical severity in SLE patients, and a study of the cellular source of IFNα protein indicated disease-specific mechanisms. Measurement of IFNα attomolar concentrations by digital ELISA will enhance our understanding of IFN biology and potentially improve the diagnosis and stratification of pathologies associated with IFN dysregulation. © 2017 Rodero et al.

  13. Detection of a very bright source close to the LMC supernova SN 1987A

    Science.gov (United States)

    Nisenson, P.; Papaliolios, C.; Karovska, M.; Noyes, R.

    1987-01-01

    High angular resolution observations of the supernova in the Large Magellanic Cloud, SN 1987A, have revealed a bright source separated from the SN by approximately 60 mas with a magnitude difference of 2.7 at 656 nm (H-alpha). Speckle imaging techniques were applied to data recorded with the CfA two-dimensional photon counting detector on the CTIO 4 m telescope on March 25 and April 2 to allow measurements in H-alpha on both nights and at 533 nm and 450 nm on the second night. The nature of this object is as yet unknown, though it is almost certainly a phenomenon related to the SN.

  14. Multichannel deconvolution and source detection using sparse representations: application to Fermi project

    International Nuclear Information System (INIS)

    Schmitt, Jeremy

    2011-01-01

    This thesis presents new methods for spherical Poisson data analysis for the Fermi mission. Fermi main scientific objectives, the study of diffuse galactic background et the building of the source catalog, are complicated by the weakness of photon flux and the point spread function of the instrument. This thesis proposes a new multi-scale representation for Poisson data on the sphere, the Multi-Scale Variance Stabilizing Transform on the Sphere (MS-VSTS), consisting in the combination of a spherical multi-scale transform (wavelets, curvelets) with a variance stabilizing transform (VST). This method is applied to mono- and multichannel Poisson noise removal, missing data interpolation, background extraction and multichannel deconvolution. Finally, this thesis deals with the problem of component separation using sparse representations (template fitting). (author) [fr

  15. Radial Photonic Crystal for detection of frequency and position of radiation sources.

    Science.gov (United States)

    Carbonell, J; Díaz-Rubio, A; Torrent, D; Cervera, F; Kirleis, M A; Piqué, A; Sánchez-Dehesa, J

    2012-01-01

    Based on the concepts of artificially microstructured materials, i.e. metamaterials, we present here the first practical realization of a radial wave crystal. This type of device was introduced as a theoretical proposal in the field of acoustics, and can be briefly defined as a structured medium with radial symmetry, where the constitutive parameters are invariant under radial geometrical translations. Our practical demonstration is realized in the electromagnetic microwave spectrum, because of the equivalence between the wave problems in both fields. A device has been designed, fabricated and experimentally characterized. It is able to perform beam shaping of punctual wave sources, and also to sense position and frequency of external radiators. Owing to the flexibility offered by the design concept, other possible applications are discussed.

  16. Detection of new southern SiO maser sources associated with Mira and symbiotic stars

    International Nuclear Information System (INIS)

    Allen, D.A.; Hall, P.J.; Norris, R.P.; Troup, E.R.; Wark, R.M.; Wright, A.E.

    1989-01-01

    In 1987 July the Parkes radio telescope was used to search for 43.12 GHz SiO maser emission from southern late-type stars. We report the discovery of such emission from 12 Mira-like systems, including the symbiotic star H1-36, and discuss the implications of our data for the symbiotic stars. We identify several M-type Mira variables with unusually low SiO/infrared flux ratios, but with present data are not able to discredit the correlation between the two parameters. In addition, we present line profiles for the only other known symbiotic maser, R Aqr, at unprecedented signal-to-noise ratio; these profiles show linearly polarized emission from several components of the source. (author)

  17. Metamaterials-based sensor to detect and locate nonlinear elastic sources

    Energy Technology Data Exchange (ETDEWEB)

    Gliozzi, Antonio S.; Scalerandi, Marco [Department of Applied Science and Technology, Politecnico di Torino, Corso Duca degli Abruzzi 24, 10129 Torino (Italy); Miniaci, Marco; Bosia, Federico [Department of Physics, University of Torino, Via Pietro Giuria 1, 10125 Torino (Italy); Pugno, Nicola M. [Laboratory of Bio-Inspired and Graphene Nanomechanics, Department of Civil, Environmental and Mechanical Engineering, University of Trento, Via Mesiano 77, 38123 Trento (Italy); Center for Materials and Microsystems, Fondazione Bruno Kessler, Via Sommarive 18, 38123 Povo (Trento) (Italy); School of Engineering and Materials Science, Queen Mary University of London, Mile End Road, London E1 4NS (United Kingdom)

    2015-10-19

    In recent years, acoustic metamaterials have attracted increasing scientific interest for very diverse technological applications ranging from sound abatement to ultrasonic imaging, mainly due to their ability to act as band-stop filters. At the same time, the concept of chaotic cavities has been recently proposed as an efficient tool to enhance the quality of nonlinear signal analysis, particularly in the ultrasonic/acoustic case. The goal of the present paper is to merge the two concepts in order to propose a metamaterial-based device that can be used as a natural and selective linear filter for the detection of signals resulting from the propagation of elastic waves in nonlinear materials, e.g., in the presence of damage, and as a detector for the damage itself in time reversal experiments. Numerical simulations demonstrate the feasibility of the approach and the potential of the device in providing improved signal-to-noise ratios and enhanced focusing on the defect locations.

  18. Metamaterials-based sensor to detect and locate nonlinear elastic sources

    International Nuclear Information System (INIS)

    Gliozzi, Antonio S.; Scalerandi, Marco; Miniaci, Marco; Bosia, Federico; Pugno, Nicola M.

    2015-01-01

    In recent years, acoustic metamaterials have attracted increasing scientific interest for very diverse technological applications ranging from sound abatement to ultrasonic imaging, mainly due to their ability to act as band-stop filters. At the same time, the concept of chaotic cavities has been recently proposed as an efficient tool to enhance the quality of nonlinear signal analysis, particularly in the ultrasonic/acoustic case. The goal of the present paper is to merge the two concepts in order to propose a metamaterial-based device that can be used as a natural and selective linear filter for the detection of signals resulting from the propagation of elastic waves in nonlinear materials, e.g., in the presence of damage, and as a detector for the damage itself in time reversal experiments. Numerical simulations demonstrate the feasibility of the approach and the potential of the device in providing improved signal-to-noise ratios and enhanced focusing on the defect locations

  19. High-power, photofission-inducing bremsstrahlung source for intense pulsed active detection of fissile material

    Directory of Open Access Journals (Sweden)

    J. C. Zier

    2014-06-01

    Full Text Available Intense pulsed active detection (IPAD is a promising technique for detecting fissile material to prevent the proliferation of special nuclear materials. With IPAD, fissions are induced in a brief, intense radiation burst and the resulting gamma ray or neutron signals are acquired during a short period of elevated signal-to-noise ratio. The 8 MV, 200 kA Mercury pulsed-power generator at the Naval Research Laboratory coupled to a high-power vacuum diode produces an intense 30 ns bremsstrahlung beam to study this approach. The work presented here reports on Mercury experiments designed to maximize the photofission yield in a depleted-uranium (DU object in the bremsstrahlung far field by varying the anode-cathode (AK diode gap spacing and by adding an inner-diameter-reducing insert in the outer conductor wall. An extensive suite of diagnostics was fielded to measure the bremsstrahlung beam and DU fission yield as functions of diode geometry. Delayed fission neutrons from the DU proved to be a valuable diagnostic for measuring bremsstrahlung photons above 5 MeV. The measurements are in broad agreement with particle-in-cell and Monte Carlo simulations of electron dynamics and radiation transport. These show that with increasing AK gap, electron losses to the insert and outer conductor wall increase and that the electron angles impacting the bremsstrahlung converter approach normal incidence. The diode conditions for maximum fission yield occur when the gap is large enough to produce electron angles close to normal, yet small enough to limit electron losses.

  20. High-power, photofission-inducing bremsstrahlung source for intense pulsed active detection of fissile material

    Science.gov (United States)

    Zier, J. C.; Mosher, D.; Allen, R. J.; Commisso, R. J.; Cooperstein, G.; Hinshelwood, D. D.; Jackson, S. L.; Murphy, D. P.; Ottinger, P. F.; Richardson, A. S.; Schumer, J. W.; Swanekamp, S. B.; Weber, B. V.

    2014-06-01

    Intense pulsed active detection (IPAD) is a promising technique for detecting fissile material to prevent the proliferation of special nuclear materials. With IPAD, fissions are induced in a brief, intense radiation burst and the resulting gamma ray or neutron signals are acquired during a short period of elevated signal-to-noise ratio. The 8 MV, 200 kA Mercury pulsed-power generator at the Naval Research Laboratory coupled to a high-power vacuum diode produces an intense 30 ns bremsstrahlung beam to study this approach. The work presented here reports on Mercury experiments designed to maximize the photofission yield in a depleted-uranium (DU) object in the bremsstrahlung far field by varying the anode-cathode (AK) diode gap spacing and by adding an inner-diameter-reducing insert in the outer conductor wall. An extensive suite of diagnostics was fielded to measure the bremsstrahlung beam and DU fission yield as functions of diode geometry. Delayed fission neutrons from the DU proved to be a valuable diagnostic for measuring bremsstrahlung photons above 5 MeV. The measurements are in broad agreement with particle-in-cell and Monte Carlo simulations of electron dynamics and radiation transport. These show that with increasing AK gap, electron losses to the insert and outer conductor wall increase and that the electron angles impacting the bremsstrahlung converter approach normal incidence. The diode conditions for maximum fission yield occur when the gap is large enough to produce electron angles close to normal, yet small enough to limit electron losses.

  1. Organising to Enable Innovation

    DEFF Research Database (Denmark)

    Brink, Tove

    2016-01-01

    The purpose of this conceptual paper is to reveal how organising can enable innovation across organisational layers and organisational units. This approach calls for a cross-disciplinary literature review. The aim is to provide an integrated understanding of innovation in an organisational approach....... The findings reveal a continous organising process between individual/ team creativity and organisational structures/control to enable innovation at firm level. Organising provides a dynamic approach and contains the integrated reconstruction of creativity, structures and boundaries for enhanced balance...... of explorative and exploitative learning in uncertain environments. Shedding light on the cross-disciplinary theories to organise innovation provides a contribution at the firm level to enable innovation....

  2. A robust physiology-based source separation method for QRS detection in low amplitude fetal ECG recordings

    International Nuclear Information System (INIS)

    Vullings, R; Bergmans, J W M; Peters, C H L; Hermans, M J M; Wijn, P F F; Oei, S G

    2010-01-01

    The use of the non-invasively obtained fetal electrocardiogram (ECG) in fetal monitoring is complicated by the low signal-to-noise ratio (SNR) of ECG signals. Even after removal of the predominant interference (i.e. the maternal ECG), the SNR is generally too low for medical diagnostics, and hence additional signal processing is still required. To this end, several methods for exploiting the spatial correlation of multi-channel fetal ECG recordings from the maternal abdomen have been proposed in the literature, of which principal component analysis (PCA) and independent component analysis (ICA) are the most prominent. Both PCA and ICA, however, suffer from the drawback that they are blind source separation (BSS) techniques and as such suboptimum in that they do not consider a priori knowledge on the abdominal electrode configuration and fetal heart activity. In this paper we propose a source separation technique that is based on the physiology of the fetal heart and on the knowledge of the electrode configuration. This technique operates by calculating the spatial fetal vectorcardiogram (VCG) and approximating the VCG for several overlayed heartbeats by an ellipse. By subsequently projecting the VCG onto the long axis of this ellipse, a source signal of the fetal ECG can be obtained. To evaluate the developed technique, its performance is compared to that of both PCA and ICA and to that of augmented versions of these techniques (aPCA and aICA; PCA and ICA applied on preprocessed signals) in generating a fetal ECG source signal with enhanced SNR that can be used to detect fetal QRS complexes. The evaluation shows that the developed source separation technique performs slightly better than aPCA and aICA and outperforms PCA and ICA and has the main advantage that, with respect to aPCA/PCA and aICA/ICA, it performs more robustly. This advantage renders it favorable for employment in automated, real-time fetal monitoring applications

  3. Energy based source location by using acoustic emission for damage detection in steel and composite CNG tank

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Il Sik; Han, Byeong Hee; Park, Choon Su; Yoon, Dong Jin [Center for Safety Measurements, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2015-10-15

    Acoustic emission (AE) is an effective nondestructive test that uses transient elastic wave generated by the rapid release of energy within a material to detect any further growth or expansion of existing defects. Over the past decades, because of environmental issues, the use of compressed natural gas (CNG) as an alternative fuel for vehicles is increasing because of environmental issues. For this reason, the importance and necessity of detecting defects on a CNG fuel tank has also come to the fore. The conventional AE method used for source location is highly affected by the wave speed on the structure, and this creates problems in inspecting a composite CNG fuel tank. Because the speed and dispersion characteristics of the wave are different according to direction of structure and laminated layers. In this study, both the conventional AE method and the energy based contour map method were used for source location. This new method based on pre-acquired D/B was used for overcoming the limitation of damage localization in a composite CNG fuel tank specimen which consists of a steel liner cylinder overwrapped by GFRP. From the experimental results, it is observed that the damage localization is determined with a small error at all tested points by using the energy based contour map method, while there were a number of mis-locations or large errors at many tested points by using the conventional AE method. Therefore, the energy based contour map method used in this work is more suitable technology for inspecting composite structures.

  4. Marine controlled source electromagnetic (mCSEM) detects hydrocarbon reservoirs in the Santos Basin - Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Buonora, Marco Polo Pereira; Rodrigues, Luiz Felipe [PETROBRAS, Rio de Janeiro, RJ (Brazil); Zerilli, Andrea; Labruzzo, Tiziano [WesternGeco, Houston, TX (United States)

    2008-07-01

    In recent years marine Controlled Source Electromagnetic (mCSEM) has driven the attention of an increasing number of operators due to its sensitivity to map resistive structures, such as hydrocarbon reservoirs beneath the ocean floor and successful case histories have been reported. The Santos basin mCSEM survey was performed as part of a technical co-operation project between PETROBRAS and Schlumberger to assess the integration of selected deep reading electromagnetic technologies into the full cycle of oil field exploration and development. The survey design was based on an in-depth sensitivity study, built on known reservoirs parameters, such as thickness, lateral extent, overburden and resistivities derived from seismic and well data. In this context, the mCSEM data were acquired to calibrate the technology over the area's known reservoirs, quantify the resistivity anomalies associated with those reservoirs, with the expectation that new prospective locations could be found. We show that the mCSEM response of the known reservoirs yields signatures that can be clearly imaged and accurately quantified and there are evident correlations between the mCSEM anomalies and the reservoirs. (author)

  5. Portable gamma-ray detection system for location of radioactive sources

    International Nuclear Information System (INIS)

    Worth, G.M.; Henery, C.N.; Hastings, R.D.; France, S.W.

    1976-01-01

    A portable, battery-powered gamma radiation detection system, the RBM 1100 Road Block Monitor, is described. The detector is a 12.7-cm diameter by 2.54-cm thick NaI(Tl) integral assembly, housed in a weatherproof, insulated case with high and low voltage batteries, amplifier, lower level discriminator, low power CMOS logic electronics, and a VHF FM transmitter. Alarms indicating the presence of radioactive material are generated by a logic system that periodically stores a trip level based on an average background plus an internally calculated standard deviation. The operator may select the optimum counting time, the trip level in numbers of standard deviations above the average background, the background updating mode, and the method of alarm annunciation. Alarms may be indicated locally by panel indication and/or audible tone, or remotely via a VHF FM transmitter with a maximum range of 1.6-km line-of-sight to a suitable receiver. Count rate may be read on a top panel meter or recorded on a chart recorder. A single frame camera may be attached to provide a photographic record. Battery lifetime is 100 to 300 hours, depending on alarm rate and use of the transmitter

  6. Initial study with Tc99m antigranulocyte antibody (MAK-47) in detection sources of infection

    International Nuclear Information System (INIS)

    Cwikla, J.B.; Buscombe, J.R.; Hilson, A.J.; Janoki, G.A.

    1997-01-01

    Antigranulocytes antibodies (AGAB) are antibodies directed against glycoprotein on the surface of granulocytes and as such provides in vivo cell labelling. They are easily labelled with Tc99m and comes a one step labelling technique. 20 patients have been studied 1 h and 4-6 hours after administration of 200 MBq of Tc99m AGAB (MAK-47). Less then 0.5 mg of antibody was given to each patients. Sites of uptake and outside of the reticular-endothelial system were reported as showing positive accumulation. Clinical results were confirmed by microbiological, pathological examinations, clinical follow-up and autopsy. There were 8 patients who had sites of infection confirmed by additional examination. All patients were visualized by Tc99m AGAB (MAK-47). There were 4 cases of osteomyelitis and septic arthritis and 4 cases of focal intra-abdominal infection. Two patients had uptake in non-infected/inflammatory arthritis, both in the knee. The remaining patients had true negative studies. The diagnostic accuracy of this study was as follows: sensitivity 100%, specificity 83%, positive predictive value (PPV) was 80% and negative predictive value (NPV) was 100%. Antigranulocyte antibody (MAK-47) seems to by promising tool in detecting focal infection in bone and soft tissue, except physiological accumulation in some parts of the body. It should be considered that antibodies can have non-specific uptake in non-infected, inflammation sites. It is easy to use and no had allergic reaction and HAMA antibody (human antimouse antibody). (author)

  7. Detection of the Diversity of Cytoplasmic Male Sterility Sources in Broccoli (Brassica Oleracea var. Italica) Using Mitochondrial Markers.

    Science.gov (United States)

    Shu, Jinshuai; Liu, Yumei; Li, Zhansheng; Zhang, Lili; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2016-01-01

    Broccoli (Brassica oleracea var. italica) is an important commercial vegetable crop. As part of an efficient pollination system, cytoplasmic male sterility (CMS) has been widely used for broccoli hybrid production. Identifying the original sources of CMS in broccoli accessions has become an important part of broccoli breeding. In this study, the diversity of the CMS sources of 39 broccoli accessions, including 19 CMS lines and 20 hybrids, were analyzed using mitochondrial markers. All CMS accessions contained the ogu orf138-related DNA fragment and the key genes of nap CMS, pol CMS, and tour CMS were not detected. The 39 CMS accessions were divided into five groups using six orf138-related and two simple sequence repeat markers. We observed that ogu CMS R3 constituted 79.49% of the CMS sources. CMS6 and CMS26 were differentiated from the other accessions using a specific primer. CMS32 was distinguished from the other accessions based on a 78-nucleotide deletion at the same locus as the orf138-related sequence. When the coefficient was about 0.90, five CMS accessions (13CMS6, 13CMS23, 13CMS24, 13CMS37, and 13CMS39) exhibiting abnormal floral organs with poor seed setting were grouped together. The polymerase chain reaction amplification profiles for these five accessions differed from those of the other accessions. We identified eight useful molecular markers that can be used to detect CMS types during broccoli breeding. Our data also provide important information relevant to future studies on the possible origins and molecular mechanisms of CMS in broccoli.

  8. Greenhouse Gas Source Detection and Attribution in the San Francisco Bay Area of California Using a Mobile Measurement Platform

    Science.gov (United States)

    Martien, P. T.; Guha, A.; Newman, S.; Young, A.; Bower, J.; Perkins, I.; Randall, S.; Stevenson, E.; Hilken, H.

    2017-12-01

    The Bay Area Air Quality Management District, the San Francisco Bay Area's air quality regulatory agency, has set a goal to reduce the region's greenhouse gas (GHG) emissions 80% below 1990 levels by 2050, consistent with the State of California's climate goals. Recently, the Air District's governing board adopted a 2017 Clean Air Plan advancing the agency's vision and including actions to put the region on a path to achieving the 2050 goal while also reducing air pollution and related health impacts. The Plan includes GHG rule-making efforts, policy initiatives, local government partnerships, outreach, grants and incentives, encompassing over 250 specific implementation actions across all economic sectors to effect ambitious emission reductions in the region. To support the 2017 Plan, the Air District has built a mobile measurement platform (GHG research van) to perform targeted CH4 emissions hotspot detection and source attribution. Instruments in the van measure CH4, CO2 and N2O in ambient plumes. Coincident measurements of source tracers like isotopic methane (13C - CH4), CO and ethane (C2H6) provide the capability to distinguish between biogenic, combustion-based and fossil-based fugitive methane sources. We report observations of CH4 plumes from source-specific measurements in and around facilities including a wastewater treatment plant, a composting operation, a waste-to-energy anaerobic digestion plant and a few refineries. We performed leak surveys inside several electric utility-operated facilities including a power plant and an underground natural gas storage facility. We sampled exhaust from a roadway tunnel and computed fleet-averaged automobile-related CH4 and N2O emission factors. We used tracer-to-tracer emission ratios to create chemical signatures of emissions from each sampled source category. We compare measurement-based ratios with those used to derive the regional GHG inventory. Data from these and other sources will lead to an improved

  9. Detection and characterization of lightning-based sources using continuous wavelet transform: application to audio-magnetotellurics

    Science.gov (United States)

    Larnier, H.; Sailhac, P.; Chambodut, A.

    2018-01-01

    Atmospheric electromagnetic waves created by global lightning activity contain information about electrical processes of the inner and the outer Earth. Large signal-to-noise ratio events are particularly interesting because they convey information about electromagnetic properties along their path. We introduce a new methodology to automatically detect and characterize lightning-based waves using a time-frequency decomposition obtained through the application of continuous wavelet transform. We focus specifically on three types of sources, namely, atmospherics, slow tails and whistlers, that cover the frequency range 10 Hz to 10 kHz. Each wave has distinguishable characteristics in the time-frequency domain due to source shape and dispersion processes. Our methodology allows automatic detection of each type of event in the time-frequency decomposition thanks to their specific signature. Horizontal polarization attributes are also recovered in the time-frequency domain. This procedure is first applied to synthetic extremely low frequency time-series with different signal-to-noise ratios to test for robustness. We then apply it on real data: three stations of audio-magnetotelluric data acquired in Guadeloupe, oversea French territories. Most of analysed atmospherics and slow tails display linear polarization, whereas analysed whistlers are elliptically polarized. The diversity of lightning activity is finally analysed in an audio-magnetotelluric data processing framework, as used in subsurface prospecting, through estimation of the impedance response functions. We show that audio-magnetotelluric processing results depend mainly on the frequency content of electromagnetic waves observed in processed time-series, with an emphasis on the difference between morning and afternoon acquisition. Our new methodology based on the time-frequency signature of lightning-induced electromagnetic waves allows automatic detection and characterization of events in audio

  10. FijiWingsPolarity: An open source toolkit for semi-automated detection of cell polarity.

    Science.gov (United States)

    Dobens, Leonard L; Shipman, Anna; Axelrod, Jeffrey D

    2018-01-02

    Epithelial cells are defined by apical-basal and planar cell polarity (PCP) signaling, the latter of which establishes an orthogonal plane of polarity in the epithelial sheet. PCP signaling is required for normal cell migration, differentiation, stem cell generation and tissue repair, and defects in PCP have been associated with developmental abnormalities, neuropathologies and cancers. While the molecular mechanism of PCP is incompletely understood, the deepest insights have come from Drosophila, where PCP is manifest in hairs and bristles across the adult cuticle and organization of the ommatidia in the eye. Fly wing cells are marked by actin-rich trichome structures produced at the distal edge of each cell in the developing wing epithelium and in a mature wing the trichomes orient collectively in the distal direction. Genetic screens have identified key PCP signaling pathway components that disrupt trichome orientation, which has been measured manually in a tedious and error prone process. Here we describe a set of image processing and pattern-recognition macros that can quantify trichome arrangements in micrographs and mark these directly by color, arrow or colored arrow to indicate trichome location, length and orientation. Nearest neighbor calculations are made to exploit local differences in orientation to better and more reliably detect and highlight local defects in trichome polarity. We demonstrate the use of these tools on trichomes in adult wing preps and on actin-rich developing trichomes in pupal wing epithelia stained with phalloidin. FijiWingsPolarity is freely available and will be of interest to a broad community of fly geneticists studying the effect of gene function on PCP.

  11. Source-specific sewage pollution detection in urban river waters using pharmaceuticals and personal care products as molecular indicators.

    Science.gov (United States)

    Kiguchi, Osamu; Sato, Go; Kobayashi, Takashi

    2016-11-01

    Source-specific elucidation of domestic sewage pollution caused by various effluent sources in an urban river water, as conducted for this study, demands knowledge of the relation between concentrations of pharmaceuticals and personal care products (PPCPs) as molecular indicators (caffeine, carbamazepine, triclosan) and water quality concentrations of total nitrogen (T-N) and total phosphorous (T-P). River water and wastewater samples from the Asahikawa River Basin in northern Japan were analyzed using derivatization-gas chromatography/mass spectrometry. Caffeine, used as an indicator of domestic sewage in the Asahikawa River Basin, was more ubiquitous than either carbamazepine or triclosan (92-100 %). Its concentration was higher than any target compound used to assess the basin: caffeine, caffeine concentrations detected in wastewater effluents and the strongly positive mutual linear correlation between caffeine and T-N or T-P (R 2  > 0.759) reflect the contribution of septic tank system effluents to the lower Asahikawa River Basin. Results of relative molecular indicators in combination with different molecular indicators (caffeine/carbamazepine and triclosan/carbamazepine) and cluster analysis better reflect the contribution of sewage than results obtained using concentrations of respective molecular indicators and cluster analysis. Relative molecular indicators used with water quality parameters (e.g., caffeine/T-N ratio) in this study provide results more clearly, relatively, and quantitatively than results obtained using molecular indicators alone. Moreover, the caffeine/T-N ratio reflects variations of caffeine flux from effluent sources. These results suggest strongly relative molecular indicators are also useful indicators, reflecting differences in spatial contributions of domestic sources for PPCPs in urban areas.

  12. Upgrade for detection system of JARREL ASH 70-000 atomic emission spectrography with source of arc - spark

    International Nuclear Information System (INIS)

    Santa Cruz D E; Grau F N; Bellavigna H J; Garavaglia R N; Fernandez R O; Servant R

    2012-01-01

    Methodologies used in spectrochemical analysis have showed breakthroughs in last decades due to the newest digital technologies. The simultaneous determination of multiple elements in a short time has been allowed by the development of solid state multichannel detectors. Since its beginning CNEA has developed several spectroscopic methodologies that have been applied to the area of fuels and specific materials of the nuclear activity. The Analytical Chemistry Department has an atomic emission spectrograph with a source of arc/spark whose focal length is 3.4 meters and a spectral dispersion from 2.5 to 5 A/mm. This equipment was originally equipped with photographic detection. This feature although allowed the simultaneous detection of multiple elements, their response (photographic plate) has been not linear and their data's treatment has been very complex. Two alternatives of digital detection have been examined: CCD2 and CMOS3 according to the progress achieved in the instrumentation that is applied to similar techniques. After exhaustive evaluation an arrangement of 9 linear CCD detectors located in the focal plane originally occupied by 2 x10 inch photographic plates was chosen. The software provided by the manufacturer has been insufficient for cover our analytical necessities due to the requirements of our instrumental application. This led to develop an own program for our applications. Today, our detection system includes an assembly of 7 detectors and an acquisition program with basic control that has been developed in-house. Calibration curves for some chemical elements have shown very promising results, the sensitivity has increased at least 10 times and an important improvement of accuracy of the measurements has also been achieved thanks to our modification. An upgrade with an associated database that will allow obtaining spectra in 3D configuration and extend the instrumental capabilities to second order is being prepared (author)

  13. Recognition Memory zROC Slopes for Items with Correct versus Incorrect Source Decisions Discriminate the Dual Process and Unequal Variance Signal Detection Models

    Science.gov (United States)

    Starns, Jeffrey J.; Rotello, Caren M.; Hautus, Michael J.

    2014-01-01

    We tested the dual process and unequal variance signal detection models by jointly modeling recognition and source confidence ratings. The 2 approaches make unique predictions for the slope of the recognition memory zROC function for items with correct versus incorrect source decisions. The standard bivariate Gaussian version of the unequal…

  14. The Nordic Housing Enabler

    DEFF Research Database (Denmark)

    Helle, Tina; Slaug, Bjørn; Brandt, Åse

    2010-01-01

    This study addresses development of a content valid cross-Nordic version of the Housing Enabler and investigation of its inter-rater reliability when used in occupational therapy rating situations, involving occupational therapists, clients and their home environments. The instrument was translated...... from the original Swedish version of the Housing Enabler, and adapted according to accessibility norms and guidelines for housing design in Sweden, Denmark, Finland and Iceland. This iterative process involved occupational therapists, architects, building engineers and professional translators......, resulting in the Nordic Housing Enabler. For reliability testing, the sampling strategy and data collection procedures used were the same in all countries. Twenty voluntary occupational therapists, pair-wise but independently from each other, collected data from 106 cases by means of the Nordic Housing...

  15. Pilot project as enabler?

    DEFF Research Database (Denmark)

    Neisig, Margit; Glimø, Helle; Holm, Catrine Granzow

    This article deals with a systemic perspective on transition. The field of study addressed is a pilot project as enabler of transition in a highly complex polycentric context. From a Luhmannian systemic approach, a framework is created to understand and address barriers of change occurred using...... pilot projects as enabler of transition. Aspects of how to create trust and deal with distrust during a transition are addressed. The transition in focus is the concept of New Public Management and how it is applied in the management of the Employment Service in Denmark. The transition regards...

  16. Methane Flux Estimation from Point Sources using GOSAT Target Observation: Detection Limit and Improvements with Next Generation Instruments

    Science.gov (United States)

    Kuze, A.; Suto, H.; Kataoka, F.; Shiomi, K.; Kondo, Y.; Crisp, D.; Butz, A.

    2017-12-01

    Atmospheric methane (CH4) has an important role in global radiative forcing of climate but its emission estimates have larger uncertainties than carbon dioxide (CO2). The area of anthropogenic emission sources is usually much smaller than 100 km2. The Thermal And Near infrared Sensor for carbon Observation Fourier-Transform Spectrometer (TANSO-FTS) onboard the Greenhouse gases Observing SATellite (GOSAT) has measured CO2 and CH4 column density using sun light reflected from the earth's surface. It has an agile pointing system and its footprint can cover 87-km2 with a single detector. By specifying pointing angles and observation time for every orbit, TANSO-FTS can target various CH4 point sources together with reference points every 3 day over years. We selected a reference point that represents CH4 background density before or after targeting a point source. By combining satellite-measured enhancement of the CH4 column density and surface measured wind data or estimates from the Weather Research and Forecasting (WRF) model, we estimated CH4emission amounts. Here, we picked up two sites in the US West Coast, where clear sky frequency is high and a series of data are available. The natural gas leak at Aliso Canyon showed a large enhancement and its decrease with time since the initial blowout. We present time series of flux estimation assuming the source is single point without influx. The observation of the cattle feedlot in Chino, California has weather station within the TANSO-FTS footprint. The wind speed is monitored continuously and the wind direction is stable at the time of GOSAT overpass. The large TANSO-FTS footprint and strong wind decreases enhancement below noise level. Weak wind shows enhancements in CH4, but the velocity data have large uncertainties. We show the detection limit of single samples and how to reduce uncertainty using time series of satellite data. We will propose that the next generation instruments for accurate anthropogenic CO2 and CH

  17. Enabling distributed collaborative science

    DEFF Research Database (Denmark)

    Hudson, T.; Sonnenwald, Diane H.; Maglaughlin, K.

    2000-01-01

    To enable collaboration over distance, a collaborative environment that uses a specialized scientific instrument called a nanoManipulator is evaluated. The nanoManipulator incorporates visualization and force feedback technology to allow scientists to see, feel, and modify biological samples bein...

  18. The Nordic Housing Enabler

    DEFF Research Database (Denmark)

    Helle, T.; Nygren, C.; Slaug, B.

    2014-01-01

    This study addresses development of a content-valid cross-Nordic version of the Housing Enabler and investigation of its inter-rater reliability when used in occupational therapy rating situations, involving occupational therapists, clients, and their home environments. The instrument was transla......This study addresses development of a content-valid cross-Nordic version of the Housing Enabler and investigation of its inter-rater reliability when used in occupational therapy rating situations, involving occupational therapists, clients, and their home environments. The instrument...... was translated from the original Swedish version of the Housing Enabler, and adapted according to accessibility norms and guidelines for housing design in Sweden, Denmark, Finland, and Iceland. This iterative process involved occupational therapists, architects, building engineers, and professional translators......, resulting in the Nordic Housing Enabler. For reliability testing, the sampling strategy and data collection procedures used were the same in all countries. Twenty voluntary occupational therapists, pair-wise but independently of each other, collected data from 106 cases by means of the Nordic Housing...

  19. Image change detection systems, methods, and articles of manufacture

    Science.gov (United States)

    Jones, James L.; Lassahn, Gordon D.; Lancaster, Gregory D.

    2010-01-05

    Aspects of the invention relate to image change detection systems, methods, and articles of manufacture. According to one aspect, a method of identifying differences between a plurality of images is described. The method includes loading a source image and a target image into memory of a computer, constructing source and target edge images from the source and target images to enable processing of multiband images, displaying the source and target images on a display device of the computer, aligning the source and target edge images, switching displaying of the source image and the target image on the display device, to enable identification of differences between the source image and the target image.

  20. Detection and dosimetry studies on the response of silicon diodes to an 241Am-Be source

    International Nuclear Information System (INIS)

    Lotfi, Y; Dizaji, H Zaki; Davani, F Abbasi

    2014-01-01

    Silicon diode detectors show potential for the development of an active personal dosimeter for neutron and photon radiation. Photons interact with the constituents of the diode detector and produce electrons. Fast neutrons interact with the constituents of the diode detector and converter, producing recoil nuclei and causing (n,α) and (n,p) reactions. These photon- and neutron-induced charged particles contribute to the response of diode detectors. In this work, a silicon pin diode was used as a detector to produce pulses created by photon and neutron. A polyethylene fast neutron converter was used as a recoil proton source in front of the detector. The total registered photon and neutron efficiency and the partial contributions of the efficiency, due to interactions with the diode and converter, were calculated. The results show that the efficiency of the converter-diode is a function of the incident photon and neutron energy. The optimized thicknesses of the converter for neutron detection and neutron dosimetry were found to be 1 mm and 0.1 mm respectively. The neutron records caused by the (n,α) and (n,p) reactions were negligible. The photon records were strongly dependent upon the energy and the depletion layer of the diode. The photons and neutrons efficiency of the diode-based dosimeter was calculated by the MCNPX code, and the results were in good agreement with experimental results for photons and neutrons from an 241 Am-Be source

  1. Detection of special nuclear material from delayed neutron emission induced by a dual-particle monoenergetic source

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, M. [Department of Mechanical and Nuclear Engineering, The Pennsylvania State University, University Park, Pennsylvania 16802 (United States); Nattress, J.; Jovanovic, I., E-mail: ijov@umich.edu [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, Michigan 48109 (United States)

    2016-06-27

    Detection of unique signatures of special nuclear materials is critical for their interdiction in a variety of nuclear security and nonproliferation scenarios. We report on the observation of delayed neutrons from fission of uranium induced in dual-particle active interrogation based on the {sup 11}B(d,n γ){sup 12}C nuclear reaction. Majority of the fissions are attributed to fast fission induced by the incident quasi-monoenergetic neutrons. A Li-doped glass–polymer composite scintillation neutron detector, which displays excellent neutron/γ discrimination at low energies, was used in the measurements, along with a recoil-based liquid scintillation detector. Time-dependent buildup and decay of delayed neutron emission from {sup 238}U were measured between the interrogating beam pulses and after the interrogating beam was turned off, respectively. Characteristic buildup and decay time profiles were compared to the common parametrization into six delayed neutron groups, finding a good agreement between the measurement and nuclear data. This method is promising for detecting fissile and fissionable materials in cargo scanning applications and can be readily integrated with transmission radiography using low-energy nuclear reaction sources.

  2. Study on the performance of infrared thermal imaging light source for detection of impact defects in CFRP composite sandwich panels

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hee Sang [R and D, Korea Research Institute of Smart Material and Structures System Association, Daejeon (Korea, Republic of); Choi, Man Yong; Kwon, Koo Ahn; Park, Jeong Hak; Choi, Won Jae [Safety measurement center, Korea research Institute of Standards and Science, Daejeon (Korea, Republic of); Jung, Hyun Chul [Dept. of Mechanical Engineering Chosun University, Gwangju (Korea, Republic of)

    2017-04-15

    Recently, composite materials have been mainly used in the main wings, ailerons, and fuselages of aircraft and rotor blades of helicopters. Composite materials used in rapid moving structures are subject to impact by hail, lightning, and bird strike. Such an impact can destroy fiber tissues in the composite materials as well as deform the composite materials, resulting in various problems such as weakened rigidity of the composite structure and penetration of water into tiny cracks. In this study, experiments were conducted using a 2 kW halogen lamp which is most frequently used as a light source, a 2 kW near-infrared lamp, which is used for heating to a high temperature, and a 6 kW xenon flash lamp which emits a large amount of energy for a moment. CFRP composite sandwich panels using Nomex honeycomb core were used as the specimens. Experiments were carried out under impact damages of 1, 4 and 8 J. It was found that the detection of defects was fast when the xenon flash lamp was used. The detection of damaged regions was excellent when the halogen lamp was used. Furthermore, the near-infrared lamp is an effective technology for showing the surface of a test object.

  3. MRI-detection rate and incidence of lumbar bleeding sources in 190 patients with non-aneurysmal SAH.

    Directory of Open Access Journals (Sweden)

    Sepide Kashefiolasl

    Full Text Available Up to 15% of all spontaneous subarachnoid hemorrhages (SAH have a non-aneurysmal SAH (NASAH. The evaluation of SAH patients with negative digital subtraction angiography (DSA is sometimes a diagnostic challenge. Our goal in this study was to reassess the yield of standard MR-imaging of the complete spinal axis to rule out spinal bleeding sources in patients with NASAH.We retrospectively analyzed the spinal MRI findings in 190 patients with spontaneous NASAH, containing perimesencephalic (PM and non-perimesencephalic (NPM SAH, diagnosed by computer tomography (CT and/or lumbar puncture (LP, and negative 2nd DSA.190 NASAH patients were included in the study, divided into PM-SAH (n = 87; 46% and NPM-SAH (n = 103; 54%. Overall, 23 (22% patients had a CT negative SAH, diagnosed by positive LP. MR-imaging of the spinal axis detected two patients with lumbar ependymoma (n = 2; 1,05%. Both patients complained of radicular sciatic pain. The detection rate raised up to 25%, if only patients with radicular sciatic pain received an MRI.Routine radiological investigation of the complete spinal axis in NASAH patients is expensive and can not be recommended for standard procedure. However, patients with clinical signs of low-back/sciatic pain should be worked up for a spinal pathology.

  4. Effects of Active and Passive Hearing Protection Devices on Sound Source Localization, Speech Recognition, and Tone Detection.

    Directory of Open Access Journals (Sweden)

    Andrew D Brown

    Full Text Available Hearing protection devices (HPDs such as earplugs offer to mitigate noise exposure and reduce the incidence of hearing loss among persons frequently exposed to intense sound. However, distortions of spatial acoustic information and reduced audibility of low-intensity sounds caused by many existing HPDs can make their use untenable in high-risk (e.g., military or law enforcement environments where auditory situational awareness is imperative. Here we assessed (1 sound source localization accuracy using a head-turning paradigm, (2 speech-in-noise recognition using a modified version of the QuickSIN test, and (3 tone detection thresholds using a two-alternative forced-choice task. Subjects were 10 young normal-hearing males. Four different HPDs were tested (two active, two passive, including two new and previously untested devices. Relative to unoccluded (control performance, all tested HPDs significantly degraded performance across tasks, although one active HPD slightly improved high-frequency tone detection thresholds and did not degrade speech recognition. Behavioral data were examined with respect to head-related transfer functions measured using a binaural manikin with and without tested HPDs in place. Data reinforce previous reports that HPDs significantly compromise a variety of auditory perceptual facilities, particularly sound localization due to distortions of high-frequency spectral cues that are important for the avoidance of front-back confusions.

  5. Study on the performance of infrared thermal imaging light source for detection of impact defects in CFRP composite sandwich panels

    International Nuclear Information System (INIS)

    Park, Hee Sang; Choi, Man Yong; Kwon, Koo Ahn; Park, Jeong Hak; Choi, Won Jae; Jung, Hyun Chul

    2017-01-01

    Recently, composite materials have been mainly used in the main wings, ailerons, and fuselages of aircraft and rotor blades of helicopters. Composite materials used in rapid moving structures are subject to impact by hail, lightning, and bird strike. Such an impact can destroy fiber tissues in the composite materials as well as deform the composite materials, resulting in various problems such as weakened rigidity of the composite structure and penetration of water into tiny cracks. In this study, experiments were conducted using a 2 kW halogen lamp which is most frequently used as a light source, a 2 kW near-infrared lamp, which is used for heating to a high temperature, and a 6 kW xenon flash lamp which emits a large amount of energy for a moment. CFRP composite sandwich panels using Nomex honeycomb core were used as the specimens. Experiments were carried out under impact damages of 1, 4 and 8 J. It was found that the detection of defects was fast when the xenon flash lamp was used. The detection of damaged regions was excellent when the halogen lamp was used. Furthermore, the near-infrared lamp is an effective technology for showing the surface of a test object

  6. Detection of the source of hemorrhage using postmortem computerized tomographic angiography in a case of a giant juvenile nasopharyngeal angiofibroma after surgical treatment.

    Science.gov (United States)

    do Nascimento, Felipe Barjud Pereira; dos Santos, Glaucia Aparecida Bento; Melo, Nelson Almeida d'Ávila; Damasceno, Eduarda Bittencourt; Mauad, Thais

    2015-09-01

    Postmortem computerized tomographic angiography (PMCTA) has been increasingly used in forensic medicine to detect and locate the source of bleeding in cases of fatal acute hemorrhage. In this paper, we report a case of postoperative complication in a patient with a giant juvenile nasopharyngeal angiofibroma in which the source of bleeding was detected by PMCTA. A case description and evaluations of the pre- and postoperative exams, postmortem CT angiogram, and conventional autopsy results are provided. The source of bleeding was identified by postmortem CT angiography but not by conventional autopsy. The established protocol, injecting contrast medium into the femoral artery, was effective in identifying the source of bleeding. Postoperative bleeding is a rare and frequently fatal complication of juvenile nasopharyngeal angiofibroma. As a complement to conventional autopsy, postmortem angiography is a valuable tool for the detection of lethal acute hemorrhagic foci, and establishing a routine procedure for PMCTA may improve its efficiency.

  7. Using additional external inputs to forecast water quality with an artificial neural network for contamination event detection in source water

    Science.gov (United States)

    Schmidt, F.; Liu, S.

    2016-12-01

    Source water quality plays an important role for the safety of drinking water and early detection of its contamination is vital to taking appropriate countermeasures. However, compared to drinking water, it is more difficult to detect contamination events because its environment is less controlled and numerous natural causes contribute to a high variability of the background values. In this project, Artificial Neural Networks (ANNs) and a Contamination Event Detection Process (CED Process) were used to identify events in river water. The ANN models the response of basic water quality sensors obtained in laboratory experiments in an off-line learning stage and continuously forecasts future values of the time line in an on-line forecasting step. During this second stage, the CED Process compares the forecast to the measured value and classifies it as regular background or event value, which modifies the ANN's continuous learning and influences its forecasts. In addition to this basic setup, external information is fed to the CED Process: A so-called Operator Input (OI) is provided to inform about unusual water quality levels that are unrelated to the presence of contamination, for example due to cooling water discharge from a nearby power plant. This study's primary goal is to evaluate how well the OI fits into the design of the combined forecasting ANN and CED Process and to understand its effects on the online forecasting stage. To test this, data from laboratory experiments conducted previously at the School of Environment, Tsinghua University, have been used to perform simulations highlighting features and drawbacks of this method. Applying the OI has been shown to have a positive influence on the ANN's ability to handle a sudden change in background values, which is unrelated to contamination. However, it might also mask the presence of an event, an issue that underlines the necessity to have several instances of the algorithm run in parallel. Other difficulties

  8. The German system to prevent, detect and respond to illicit uses of nuclear materials and radioactive sources

    International Nuclear Information System (INIS)

    Fechner, J.B.

    2001-01-01

    The German system to prevent, detect and respond to illicit uses of nuclear materials and radioactive sources consists of a variety of different elements: International and national laws and regulations covering safeguards, physical protection, and import/export control; Licensing and regulatory supervision of all activities related to nuclear materials and radioactive sources, including import and export; Responsibility of the licensee to ensure compliance with licensing conditions; sanctions; Law enforcement by police, security and customs authorities; prosecution and penalties; Detection of illicitly trafficked radioactive materials through intelligence and technical means; analysis capabilities; Response arrangements for normal and for severe cases of illicit use of nuclear materials; Participation in international programmes and POC-systems. Safeguards measures have been implemented in Germany in accordance with the Non- Proliferation Treaty and with safeguards agreements based on INFCIRC/153. As Germany is a member of the European Union, the Euratom Treaty and the Euratom-Ordinance Nr. 3227/76 together with the Verification Agreement between the IAEA, the European Commission and the European Member States have led to safeguards measures jointly implemented by the IAEA and by Euratom. The relevant international law for the physical protection of nuclear material in force in Germany is the Convention on the Physical Protection of Nuclear Material. The recommendations on physical protection objectives and fundamentals and on physical protection measures specified in INFCIRC/225/Rev. 4 have been taken into account in various national regulations pertaining to the national design basis threat, the physical protection of LWR nuclear power plants, of interim spent fuel storage facilities, of facilities containing category III material, of nuclear material and radioactive waste transports by road or railway vehicles, aircraft or sea vessels; additional guidelines

  9. Spatially enabled land administration

    DEFF Research Database (Denmark)

    Enemark, Stig

    2006-01-01

    enabling of land administration systems managing tenure, valuation, planning, and development will allow the information generated by these activities to be much more useful. Also, the services available to private and public sectors and to community organisations should commensurably improve. Knowledge....... In other words: Good governance and sustainable development is not attainable without sound land administration or - more broadly – sound land management. The paper presents a land management vision that incorporates the benefits of ICT enabled land administration functions. The idea is that spatial...... the communication between administrative systems and also establish more reliable data due to the use the original data instead of copies. In Denmark, such governmental guidelines for a service-oriented ITarchitecture in support of e-government are recently adopted. Finally, the paper presents the role of FIG...

  10. Nordic Housing Enabler

    DEFF Research Database (Denmark)

    Helle, Tina; Brandt, Åse

    Development and reliability testing of the Nordic Housing Enabler – an instrument for accessibility assessment of the physical housing. Tina Helle & Åse Brandt University of Lund, Health Sciences, Faculty of Medicine (SE) and University College Northern Jutland, Occupational Therapy department (DK......). Danish Centre for Assistive Technology. Abstract. For decades, accessibility to the physical housing environment for people with functional limitations has been of interest politically, professionally and for the users. Guidelines and norms on accessible housing design have gradually been developed......, however, the built environment shows serious deficits when it comes to accessibility. This study addresses development of a content valid cross-Nordic version of the Housing Enabler and investigation of inter-rater reliability, when used in occupational therapy practice. The instrument was translated from...

  11. Enabling Wind Power Nationwide

    Energy Technology Data Exchange (ETDEWEB)

    Jose Zayas, Michael Derby, Patrick Gilman and Shreyas Ananthan,

    2015-05-01

    Leveraging this experience, the U.S. Department of Energy’s (DOE’s) Wind and Water Power Technologies Office has evaluated the potential for wind power to generate electricity in all 50 states. This report analyzes and quantifies the geographic expansion that could be enabled by accessing higher above ground heights for wind turbines and considers the means by which this new potential could be responsibly developed.

  12. Seminal plasma as a source of prostate cancer peptide biomarker candidates for detection of indolent and advanced disease.

    Directory of Open Access Journals (Sweden)

    Jochen Neuhaus

    Full Text Available BACKGROUND: Extensive prostate specific antigen screening for prostate cancer generates a high number of unnecessary biopsies and over-treatment due to insufficient differentiation between indolent and aggressive tumours. We hypothesized that seminal plasma is a robust source of novel prostate cancer (PCa biomarkers with the potential to improve primary diagnosis of and to distinguish advanced from indolent disease. METHODOLOGY/PRINCIPAL FINDINGS: In an open-label case/control study 125 patients (70 PCa, 21 benign prostate hyperplasia, 25 chronic prostatitis, 9 healthy controls were enrolled in 3 centres. Biomarker panels a for PCa diagnosis (comparison of PCa patients versus benign controls and b for advanced disease (comparison of patients with post surgery Gleason score 7 were sought. Independent cohorts were used for proteomic biomarker discovery and testing the performance of the identified biomarker profiles. Seminal plasma was profiled using capillary electrophoresis mass spectrometry. Pre-analytical stability and analytical precision of the proteome analysis were determined. Support vector machine learning was used for classification. Stepwise application of two biomarker signatures with 21 and 5 biomarkers provided 83% sensitivity and 67% specificity for PCa detection in a test set of samples. A panel of 11 biomarkers for advanced disease discriminated between patients with Gleason score 7 and organ-confined (source of potential peptide makers

  13. Detection of Intrinsic Source Structure at ∼3 Schwarzschild Radii with Millimeter-VLBI Observations of SAGITTARIUS A*

    Science.gov (United States)

    Lu, Ru-Sen; Krichbaum, Thomas P.; Roy, Alan L.; Fish, Vincent L.; Doeleman, Sheperd S.; Johnson, Michael D.; Akiyama, Kazunori; Psaltis, Dimitrios; Alef, Walter; Asada, Keiichi; Beaudoin, Christopher; Bertarini, Alessandra; Blackburn, Lindy; Blundell, Ray; Bower, Geoffrey C.; Brinkerink, Christiaan; Broderick, Avery E.; Cappallo, Roger; Crew, Geoffrey B.; Dexter, Jason; Dexter, Matt; Falcke, Heino; Freund, Robert; Friberg, Per; Greer, Christopher H.; Gurwell, Mark A.; Ho, Paul T. P.; Honma, Mareki; Inoue, Makoto; Kim, Junhan; Lamb, James; Lindqvist, Michael; Macmahon, David; Marrone, Daniel P.; Martí-Vidal, Ivan; Menten, Karl M.; Moran, James M.; Nagar, Neil M.; Plambeck, Richard L.; Primiani, Rurik A.; Rogers, Alan E. E.; Ros, Eduardo; Rottmann, Helge; SooHoo, Jason; Spilker, Justin; Stone, Jordan; Strittmatter, Peter; Tilanus, Remo P. J.; Titus, Michael; Vertatschitsch, Laura; Wagner, Jan; Weintroub, Jonathan; Wright, Melvyn; Young, Ken H.; Zensus, J. Anton; Ziurys, Lucy M.

    2018-05-01

    We report results from very long baseline interferometric (VLBI) observations of the supermassive black hole in the Galactic center, Sgr A*, at 1.3 mm (230 GHz). The observations were performed in 2013 March using six VLBI stations in Hawaii, California, Arizona, and Chile. Compared to earlier observations, the addition of the APEX telescope in Chile almost doubles the longest baseline length in the array, provides additional uv coverage in the N–S direction, and leads to a spatial resolution of ∼30 μas (∼3 Schwarzschild radii) for Sgr A*. The source is detected even at the longest baselines with visibility amplitudes of ∼4%–13% of the total flux density. We argue that such flux densities cannot result from interstellar refractive scattering alone, but indicate the presence of compact intrinsic source structure on scales of ∼3 Schwarzschild radii. The measured nonzero closure phases rule out point-symmetric emission. We discuss our results in the context of simple geometric models that capture the basic characteristics and brightness distributions of disk- and jet-dominated models and show that both can reproduce the observed data. Common to these models are the brightness asymmetry, the orientation, and characteristic sizes, which are comparable to the expected size of the black hole shadow. Future 1.3 mm VLBI observations with an expanded array and better sensitivity will allow more detailed imaging of the horizon-scale structure and bear the potential for a deep insight into the physical processes at the black hole boundary.

  14. Fatty acids oxidation and alternative energy sources detected in Taenia crassiceps cysticerci after host treatment with antihelminthic drugs.

    Science.gov (United States)

    Fraga, Carolina Miguel; Costa, Tatiane Luiza; Bezerra, José Clecildo Barreto; de Souza Lino Junior, Ruy; Vinaud, Marina Clare

    2012-05-01

    Human cysticercosis caused by Taenia crassiceps is rare however it is considered of zoonotic risk. The treatment of the infected patients was successful when using albendazole or praziquantel. The active forms of albendazole inhibit the glucose uptake and the active forms of praziquantel alter glycogen levels and nutrients absorption. The aim of this study was to analyze the production of organic acids that indicate the oxidation of fatty acids and the use of alternative energy sources from T. crassiceps cysticerci removed from the peritoneal cavity of mice treated with low dosages of albendazole (5.75 and 11.5mg/kg) or praziquantel (3.83 and 7.67 mg/kg). The beta-hydroxibutyrate production was higher by the larval stage cysticerci in all treated groups and the propionate production was higher in final stage cysticerci treated with 11.5mg/kg of albendazole when compared to the control group. The larval stages of cysticerci from the groups treated with 5.75 mg/kg of albendazole and 3.83 mg/kg of praziquantel produced more urea than the initial and final stages which indicate amino acids breakdown. We conclude that it was possible to detect the fatty acid oxidation and amino acids breakdown which indicate the use of alternative energy production sources as the used dosages only cause a partial blockage of the glucose uptake and leads to metabolic alterations in the cysticerci. The metabolic behavior observed after host treatment was different from former descriptions of the in vitro one which indicates great host-parasite interaction. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Convection Weather Detection by General Aviation Pilots with Convectional and Data-Linked Graphical Weather Information Sources

    Science.gov (United States)

    Chamberlain, James P.; Latorella, Kara A.

    2001-01-01

    This study compares how well general aviation (GA) pilots detect convective weather in flight with different weather information sources. A flight test was conducted in which GA pilot test subjects were given different in-flight weather information cues and flown toward convective weather of moderate or greater intensity. The test subjects were not actually flying the aircraft, but were given pilot tasks representative of the workload and position awareness requirements of the en route portion of a cross country GA flight. On each flight, one test subject received weather cues typical of a flight in visual meteorological conditions (VMC), another received cues typical of flight in instrument meteorological conditions (IMC), and a third received cues typical of flight in IMC but augmented with a graphical weather information system (GWIS). The GWIS provided the subject with near real time data-linked weather products, including a weather radar mosaic superimposed on a moving map with a symbol depicting the aircraft's present position and direction of track. At several points during each flight, the test subjects completed short questionnaires which included items addressing their weather situation awareness and flight decisions. In particular, test subjects were asked to identify the location of the nearest convective cells. After the point of nearest approach to convective weather, the test subjects were asked to draw the location of convective weather on an aeronautical chart, along with the aircraft's present position. This paper reports preliminary results on how accurately test subjects provided with these different weather sources could identify the nearest cell of moderate or greater intensity along their route of flight. Additional flight tests are currently being conducted to complete the data set.

  16. Biomarkers of Atrial Cardiopathy and Atrial Fibrillation Detection on Mobile Outpatient Continuous Telemetry After Embolic Stroke of Undetermined Source.

    Science.gov (United States)

    Sebasigari, Denise; Merkler, Alexander; Guo, Yang; Gialdini, Gino; Kummer, Benjamin; Hemendinger, Morgan; Song, Christopher; Chu, Antony; Cutting, Shawna; Silver, Brian; Elkind, Mitchell S V; Kamel, Hooman; Furie, Karen L; Yaghi, Shadi

    2017-06-01

    Biomarkers of atrial dysfunction or "cardiopathy" are associated with embolic stroke risk. However, it is unclear if this risk is mediated by undiagnosed paroxysmal atrial fibrillation or flutter (AF). We aim to determine whether atrial cardiopathy biomarkers predict AF on continuous heart-rhythm monitoring after embolic stroke of undetermined source (ESUS). This was a single-center retrospective study including all patients with ESUS undergoing 30 days of ambulatory heart-rhythm monitoring to look for AF between January 1, 2013 and December 31, 2015. We reviewed medical records for clinical, radiographic, and cardiac variables. The primary outcome was a new diagnosis of AF detected during heart-rhythm monitoring. The primary predictors were atrial biomarkers: left atrial diameter on echocardiography, P-wave terminal force in electrocardiogram (ECG) lead V1, and P wave - R wave (PR) interval on ECG. A multiple logistic regression model was used to assess the relationship between atrial biomarkers and AF detection. Among 196 eligible patients, 23 (11.7%) were diagnosed with AF. In unadjusted analyses, patients with AF were older (72.4 years versus 61.4 years, P atrial diameter (39.2 mm versus 35.7 mm, P = .03). In a multivariable model, the only predictor of AF was age ≥ 60 years (odds ratio, 3.0; 95% CI, 1.06-8.5; P = .04). Atrial biomarkers were weakly associated with AF after ESUS. This suggests that previously reported associations between these markers and stroke may reflect independent cardiac pathways leading to stroke. Prospective studies are needed to investigate these mechanisms. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  17. Distributed Denial of Service Attack Source Detection Using Efficient Traceback Technique (ETT) in Cloud-Assisted Healthcare Environment.

    Science.gov (United States)

    Latif, Rabia; Abbas, Haider; Latif, Seemab; Masood, Ashraf

    2016-07-01

    Security and privacy are the first and foremost concerns that should be given special attention when dealing with Wireless Body Area Networks (WBANs). As WBAN sensors operate in an unattended environment and carry critical patient health information, Distributed Denial of Service (DDoS) attack is one of the major attacks in WBAN environment that not only exhausts the available resources but also influence the reliability of information being transmitted. This research work is an extension of our previous work in which a machine learning based attack detection algorithm is proposed to detect DDoS attack in WBAN environment. However, in order to avoid complexity, no consideration was given to the traceback mechanism. During traceback, the challenge lies in reconstructing the attack path leading to identify the attack source. Among existing traceback techniques, Probabilistic Packet Marking (PPM) approach is the most commonly used technique in conventional IP- based networks. However, since marking probability assignment has significant effect on both the convergence time and performance of a scheme, it is not directly applicable in WBAN environment due to high convergence time and overhead on intermediate nodes. Therefore, in this paper we have proposed a new scheme called Efficient Traceback Technique (ETT) based on Dynamic Probability Packet Marking (DPPM) approach and uses MAC header in place of IP header. Instead of using fixed marking probability, the proposed scheme uses variable marking probability based on the number of hops travelled by a packet to reach the target node. Finally, path reconstruction algorithms are proposed to traceback an attacker. Evaluation and simulation results indicate that the proposed solution outperforms fixed PPM in terms of convergence time and computational overhead on nodes.

  18. EnableATIS strategy assessment.

    Science.gov (United States)

    2014-02-01

    Enabling Advanced Traveler Information Systems (EnableATIS) is the traveler information component of the Dynamic Mobility Application (DMA) program. The objective of : the EnableATIS effort is to foster transformative traveler information application...

  19. Enabling Digital Literacy

    DEFF Research Database (Denmark)

    Ryberg, Thomas; Georgsen, Marianne

    2010-01-01

    There are some tensions between high-level policy definitions of “digital literacy” and actual teaching practice. We need to find workable definitions of digital literacy; obtain a better understanding of what digital literacy might look like in practice; and identify pedagogical approaches, which...... support teachers in designing digital literacy learning. We suggest that frameworks such as Problem Based Learning (PBL) are approaches that enable digital literacy learning because they provide good settings for engaging with digital literacy. We illustrate this through analysis of a case. Furthermore......, these operate on a meso-level mediating between high-level concepts of digital literacy and classroom practice....

  20. CtOS Enabler

    OpenAIRE

    Crespo Cepeda, Rodrigo; El Yamri El Khatibi, Meriem; Carrera García, Juan Manuel

    2015-01-01

    Las Smart Cities son, indudablemente, el futuro próximo de la tecnología al que nos acercamos cada día, lo que se puede observar en la abundancia de dispositivos móviles entre la población, que informatizan la vida cotidiana mediante el uso de la geolocalización y la información. Pretendemos unir estos dos ámbitos con CtOS Enabler para crear un estándar de uso que englobe todos los sistemas de Smart Cities y facilite a los desarrolladores de dicho software la creación de nuevas herramientas. ...

  1. A Soft Computing Approach to Crack Detection and Impact Source Identification with Field-Programmable Gate Array Implementation

    Directory of Open Access Journals (Sweden)

    Arati M. Dixit

    2013-01-01

    Full Text Available The real-time nondestructive testing (NDT for crack detection and impact source identification (CDISI has attracted the researchers from diverse areas. This is apparent from the current work in the literature. CDISI has usually been performed by visual assessment of waveforms generated by a standard data acquisition system. In this paper we suggest an automation of CDISI for metal armor plates using a soft computing approach by developing a fuzzy inference system to effectively deal with this problem. It is also advantageous to develop a chip that can contribute towards real time CDISI. The objective of this paper is to report on efforts to develop an automated CDISI procedure and to formulate a technique such that the proposed method can be easily implemented on a chip. The CDISI fuzzy inference system is developed using MATLAB’s fuzzy logic toolbox. A VLSI circuit for CDISI is developed on basis of fuzzy logic model using Verilog, a hardware description language (HDL. The Xilinx ISE WebPACK9.1i is used for design, synthesis, implementation, and verification. The CDISI field-programmable gate array (FPGA implementation is done using Xilinx’s Spartan 3 FPGA. SynaptiCAD’s Verilog Simulators—VeriLogger PRO and ModelSim—are used as the software simulation and debug environment.

  2. Detection of silver nanoparticles in parsley by solid sampling high-resolution-continuum source atomic absorption spectrometry.

    Science.gov (United States)

    Feichtmeier, Nadine S; Leopold, Kerstin

    2014-06-01

    In this work, we present a fast and simple approach for detection of silver nanoparticles (AgNPs) in biological material (parsley) by solid sampling high-resolution-continuum source atomic absorption spectrometry (HR-CS AAS). A novel evaluation strategy was developed in order to distinguish AgNPs from ionic silver and for sizing of AgNPs. For this purpose, atomisation delay was introduced as significant indication of AgNPs, whereas atomisation rates allow distinction of 20-, 60-, and 80-nm AgNPs. Atomisation delays were found to be higher for samples containing silver ions than for samples containing silver nanoparticles. A maximum difference in atomisation delay normalised by the sample weight of 6.27 ± 0.96 s mg(-1) was obtained after optimisation of the furnace program of the AAS. For this purpose, a multivariate experimental design was used varying atomisation temperature, atomisation heating rate and pyrolysis temperature. Atomisation rates were calculated as the slope of the first inflection point of the absorbance signals and correlated with the size of the AgNPs in the biological sample. Hence, solid sampling HR-CS AAS was proved to be a promising tool for identifying and distinguishing silver nanoparticles from ionic silver directly in solid biological samples.

  3. The development of a XEOL and TR XEOL detection system for the I18 microfocus beamline Diamond light source

    International Nuclear Information System (INIS)

    Taylor, R.P.; Finch, A.A.; Mosselmans, J.F.W.; Quinn, P.D.

    2013-01-01

    We describe the design and capabilities of a new Continuous Wave X-ray Excited Optical Luminescence (CW-XEOL) and Time Resolved X-ray Excited Optical Luminescence (TR-XEOL) facility on the I18 beamline at the DIAMOND light source, the UK national synchrotron facility. Experimental data from a suite of framework silicates are presented to illustrate the capabilities of the system. Experiments studied include simple (CW-XEOL) spectroscopy, (TR XEOL) lifetime experiments dose and dose rate dependence (CW-XEOL) experiments, spatial (TR XEOL) on heterogeneous sample, wavelength resolved (TR XEOL), Optically Derived X-ray Absorption Spectroscopy, (OD XAS). - Highlights: ► We describe the capabilities of a new CW-XEOL and TR-XEOL detection system for a hard X-ray beamline. ► We model TR XEOL with luminescence lifetimes from ∼25 ps to ∼400 ps from framework silicates. ► CW XEOL, 200–900 nm with a resolution of ∼0.9 nm is used to complete dose and dose rate experiments. ► Micro-beam high spatial resolution XEOL within X-ray excitation energies 2–20 keV.

  4. Smart Grid Enabled EVSE

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2015-01-12

    The combined team of GE Global Research, Federal Express, National Renewable Energy Laboratory, and Consolidated Edison has successfully achieved the established goals contained within the Department of Energy’s Smart Grid Capable Electric Vehicle Supply Equipment funding opportunity. The final program product, shown charging two vehicles in Figure 1, reduces by nearly 50% the total installed system cost of the electric vehicle supply equipment (EVSE) as well as enabling a host of new Smart Grid enabled features. These include bi-directional communications, load control, utility message exchange and transaction management information. Using the new charging system, Utilities or energy service providers will now be able to monitor transportation related electrical loads on their distribution networks, send load control commands or preferences to individual systems, and then see measured responses. Installation owners will be able to authorize usage of the stations, monitor operations, and optimally control their electricity consumption. These features and cost reductions have been developed through a total system design solution.

  5. Using areas of known occupancy to identify sources of variation in detection probability of raptors: taking time lowers replication effort for surveys.

    Science.gov (United States)

    Murn, Campbell; Holloway, Graham J

    2016-10-01

    Species occurring at low density can be difficult to detect and if not properly accounted for, imperfect detection will lead to inaccurate estimates of occupancy. Understanding sources of variation in detection probability and how they can be managed is a key part of monitoring. We used sightings data of a low-density and elusive raptor (white-headed vulture Trigonoceps occipitalis ) in areas of known occupancy (breeding territories) in a likelihood-based modelling approach to calculate detection probability and the factors affecting it. Because occupancy was known a priori to be 100%, we fixed the model occupancy parameter to 1.0 and focused on identifying sources of variation in detection probability. Using detection histories from 359 territory visits, we assessed nine covariates in 29 candidate models. The model with the highest support indicated that observer speed during a survey, combined with temporal covariates such as time of year and length of time within a territory, had the highest influence on the detection probability. Averaged detection probability was 0.207 (s.e. 0.033) and based on this the mean number of visits required to determine within 95% confidence that white-headed vultures are absent from a breeding area is 13 (95% CI: 9-20). Topographical and habitat covariates contributed little to the best models and had little effect on detection probability. We highlight that low detection probabilities of some species means that emphasizing habitat covariates could lead to spurious results in occupancy models that do not also incorporate temporal components. While variation in detection probability is complex and influenced by effects at both temporal and spatial scales, temporal covariates can and should be controlled as part of robust survey methods. Our results emphasize the importance of accounting for detection probability in occupancy studies, particularly during presence/absence studies for species such as raptors that are widespread and

  6. Integrated site-specific quantification of faecal bacteria and detection of DNA markers in faecal contamination source tracking as a microbial risk tracking tool in urban Lake ecosystems

    Science.gov (United States)

    Donde, Oscar Omondi; Tian, Cuicui; Xiao, Bangding

    2017-11-01

    The presence of feacal-derived pathogens in water is responsible for several infectious diseases and deaths worldwide. As a solution, sources of fecal pollution in waters must be accurately assessed, properly determined and strictly controlled. However, the exercise has remained challenging due to the existing overlapping characteristics by different members of faecal coliform bacteria and the inadequacy of information pertaining to the contribution of seasonality and weather condition on tracking the possible sources of pollution. There are continued efforts to improve the Faecal Contamination Source Tracking (FCST) techniques such as Microbial Source Tracking (MST). This study aimed to make contribution to MST by evaluating the efficacy of combining site specific quantification of faecal contamination indicator bacteria and detection of DNA markers while accounting for seasonality and weather conditions' effects in tracking the major sources of faecal contamination in a freshwater system (Donghu Lake, China). The results showed that the use of cyd gene in addition to lacZ and uidA genes differentiates E. coli from other closely related faecal bacteria. The use of selective media increases the pollution source tracking accuracy. BSA addition boosts PCR detection and increases FCST efficiency. Seasonality and weather variability also influence the detection limit for DNA markers.

  7. Enabling graphene nanoelectronics.

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Wei; Ohta, Taisuke; Biedermann, Laura Butler; Gutierrez, Carlos; Nolen, C. M.; Howell, Stephen Wayne; Beechem Iii, Thomas Edwin; McCarty, Kevin F.; Ross, Anthony Joseph, III

    2011-09-01

    Recent work has shown that graphene, a 2D electronic material amenable to the planar semiconductor fabrication processing, possesses tunable electronic material properties potentially far superior to metals and other standard semiconductors. Despite its phenomenal electronic properties, focused research is still required to develop techniques for depositing and synthesizing graphene over large areas, thereby enabling the reproducible mass-fabrication of graphene-based devices. To address these issues, we combined an array of growth approaches and characterization resources to investigate several innovative and synergistic approaches for the synthesis of high quality graphene films on technologically relevant substrate (SiC and metals). Our work focused on developing the fundamental scientific understanding necessary to generate large-area graphene films that exhibit highly uniform electronic properties and record carrier mobility, as well as developing techniques to transfer graphene onto other substrates.

  8. Detection of Materials Used for Improvised Explosive Devices Employing D-T (14 MeV) Neutron Source

    International Nuclear Information System (INIS)

    Shyam, Anurag; Sharma, Surender Kumar; Das, Basanta

    2010-01-01

    There is an increased use of improvised explosive devices (IED), especially for human targets. One of the substances used in these devices is ammonium nitrate. Since this IED substance also contains elements - hydrogen (H), carbon (C), nitrogen (N), oxygen (O). The elemental density (of H, C, O, and N) and elemental density ratio (C/O, N/O, H/N etc) can be used to differentiate it from other substances. Neutrons based techniques are one of the methods for non-destructive these elemental characterization. For our experiments we are using two sealed neutron tubes. First tubes can produce 10 8 (maximum) D-T neutrons in ∼0.8 μs pulse and 100 (maximum) pulses can be generated per second. Second tube can produce (maximum) 10 10 D-T neutrons/s. The neutron output can be pulsed. Pulses of 1.5 μs duration and pulse repetition rate of 10 Hz to 10 kHz can be obtained. D-T neutrons pulses are impinged on ammonium nitrate samples (0.5 to 1.5 kg) and resultant gamma rays (prompt and due to activation) are recorded using sodium iodide (NaI) and bismuth germanium orthosilicate (BGO) scintillation detectors. To facilitate recording of high count rate a 2 GS/s high speed digitizer with large on board memory and high transfer rate has been used (instead of conventional multi channel analyzer). Preliminary results and analysis will be presented at the conference. To further refine the technique we are also developing a D-T neutron generator with associated particle detection facility. For this system we have already developed a penning ion source and a 140 kV battery operated SMPS. (author)

  9. [Application of second generation dual-source computed tomography dual-energy scan mode in detecting pancreatic adenocarcinoma].

    Science.gov (United States)

    Xue, Hua-dan; Liu, Wei; Sun, Hao; Wang, Xuan; Chen, Yu; Su, Bai-yan; Sun, Zhao-yong; Chen, Fang; Jin, Zheng-yu

    2010-12-01

    To analyze the clinical value of multiple sequences derived from dual-source computed tomography (DSCT) dual-energy scan mode in detecting pancreatic adenocarcinoma. Totally 23 patients with clinically or pathologically diagnosed pancreatic cancer were enrolled in this retrospective study. DSCT (Definition Flash) was used and dual-energy scan mode was used in their pancreatic parenchyma phase scan (100kVp/230mAs and Sn140kVp/178mAs) . Mono-energetic 60kev, mono-energetic 80kev, mono-energetic 100kev, mono-energetic 120kev, linear blend image, non-linear blend image, and iodine map were acquired. pancreatic parenchyma-tumor CT value difference, ratio of tumor to pancreatic parenchyma, and pancreatic parenchyma-tumor contrast to noise ratio were calculated. One-way ANOVA was used for the comparison of diagnostic values of the above eight different dual-energy derived sequences for pancreatic cancer. The pancreatic parenchyma-tumor CT value difference, ratio of tumor to pancreatic parenchyma, and pancreatic parenchyma-tumor contrast to noise ratio were significantly different among eight sequences (P<0.05) . Mono-energetic 60kev image showed the largest parenchyma-tumor CT value [ (77.53 ± 23.42) HU] , and iodine map showed the lowest tumor/parenchyma enhancement ratio (0.39?0.12) and the largest contrast to noise ratio (4.08 ± 1.46) . Multiple sequences can be derived from dual-energy scan mode with DSCT via multiple post-processing methods. Integration of these sequences may further improve the sensitivity of the multislice spiral CT in the diagnosis of pancreatic cancer.

  10. Grid-Enabled Measures

    Science.gov (United States)

    Moser, Richard P.; Hesse, Bradford W.; Shaikh, Abdul R.; Courtney, Paul; Morgan, Glen; Augustson, Erik; Kobrin, Sarah; Levin, Kerry; Helba, Cynthia; Garner, David; Dunn, Marsha; Coa, Kisha

    2011-01-01

    Scientists are taking advantage of the Internet and collaborative web technology to accelerate discovery in a massively connected, participative environment —a phenomenon referred to by some as Science 2.0. As a new way of doing science, this phenomenon has the potential to push science forward in a more efficient manner than was previously possible. The Grid-Enabled Measures (GEM) database has been conceptualized as an instantiation of Science 2.0 principles by the National Cancer Institute with two overarching goals: (1) Promote the use of standardized measures, which are tied to theoretically based constructs; and (2) Facilitate the ability to share harmonized data resulting from the use of standardized measures. This is done by creating an online venue connected to the Cancer Biomedical Informatics Grid (caBIG®) where a virtual community of researchers can collaborate together and come to consensus on measures by rating, commenting and viewing meta-data about the measures and associated constructs. This paper will describe the web 2.0 principles on which the GEM database is based, describe its functionality, and discuss some of the important issues involved with creating the GEM database, such as the role of mutually agreed-on ontologies (i.e., knowledge categories and the relationships among these categories— for data sharing). PMID:21521586

  11. Displays enabling mobile multimedia

    Science.gov (United States)

    Kimmel, Jyrki

    2007-02-01

    With the rapid advances in telecommunications networks, mobile multimedia delivery to handsets is now a reality. While a truly immersive multimedia experience is still far ahead in the mobile world, significant advances have been made in the constituent audio-visual technologies to make this become possible. One of the critical components in multimedia delivery is the mobile handset display. While such alternatives as headset-style near-to-eye displays, autostereoscopic displays, mini-projectors, and roll-out flexible displays can deliver either a larger virtual screen size than the pocketable dimensions of the mobile device can offer, or an added degree of immersion by adding the illusion of the third dimension in the viewing experience, there are still challenges in the full deployment of such displays in real-life mobile communication terminals. Meanwhile, direct-view display technologies have developed steadily, and can provide a development platform for an even better viewing experience for multimedia in the near future. The paper presents an overview of the mobile display technology space with an emphasis on the advances and potential in developing direct-view displays further to meet the goal of enabling multimedia in the mobile domain.

  12. Enabling cleanup technology transfer

    International Nuclear Information System (INIS)

    Ditmars, J. D.

    2002-01-01

    Technology transfer in the environmental restoration, or cleanup, area has been challenging. While there is little doubt that innovative technologies are needed to reduce the times, risks, and costs associated with the cleanup of federal sites, particularly those of the Departments of Energy (DOE) and Defense, the use of such technologies in actual cleanups has been relatively limited. There are, of course, many reasons why technologies do not reach the implementation phase or do not get transferred from developing entities to the user community. For example, many past cleanup contracts provided few incentives for performance that would compel a contractor to seek improvement via technology applications. While performance-based contracts are becoming more common, they alone will not drive increased technology applications. This paper focuses on some applications of cleanup methodologies and technologies that have been successful and are illustrative of a more general principle. The principle is at once obvious and not widely practiced. It is that, with few exceptions, innovative cleanup technologies are rarely implemented successfully alone but rather are implemented in the context of enabling processes and methodologies. And, since cleanup is conducted in a regulatory environment, the stage is better set for technology transfer when the context includes substantive interactions with the relevant stakeholders. Examples of this principle are drawn from Argonne National Laboratory's experiences in Adaptive Sampling and Analysis Programs (ASAPs), Precise Excavation, and the DOE Technology Connection (TechCon) Program. The lessons learned may be applicable to the continuing challenges posed by the cleanup and long-term stewardship of radioactive contaminants and unexploded ordnance (UXO) at federal sites

  13. FOILFEST :community enabled security.

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Judy Hennessey; Johnson, Curtis Martin; Whitley, John B.; Drayer, Darryl Donald; Cummings, John C., Jr. (.,; .)

    2005-09-01

    The Advanced Concepts Group of Sandia National Laboratories hosted a workshop, ''FOILFest: Community Enabled Security'', on July 18-21, 2005, in Albuquerque, NM. This was a far-reaching look into the future of physical protection consisting of a series of structured brainstorming sessions focused on preventing and foiling attacks on public places and soft targets such as airports, shopping malls, hotels, and public events. These facilities are difficult to protect using traditional security devices since they could easily be pushed out of business through the addition of arduous and expensive security measures. The idea behind this Fest was to explore how the public, which is vital to the function of these institutions, can be leveraged as part of a physical protection system. The workshop considered procedures, space design, and approaches for building community through technology. The workshop explored ways to make the ''good guys'' in public places feel safe and be vigilant while making potential perpetrators of harm feel exposed and convinced that they will not succeed. Participants in the Fest included operators of public places, social scientists, technology experts, representatives of government agencies including DHS and the intelligence community, writers and media experts. Many innovative ideas were explored during the fest with most of the time spent on airports, including consideration of the local airport, the Albuquerque Sunport. Some provocative ideas included: (1) sniffers installed in passage areas like revolving door, escalators, (2) a ''jumbotron'' showing current camera shots in the public space, (3) transparent portal screeners allowing viewing of the screening, (4) a layered open/funnel/open/funnel design where open spaces are used to encourage a sense of ''communitas'' and take advantage of citizen ''sensing'' and funnels are technological

  14. The Investigation of Chlorates as a Possible Source of Oxygen and Chlorine Detected by the Sample Analysis at Mars (SAM) Instrument in Gale Crater, Mars

    Science.gov (United States)

    Sutter, B.; Archer, D. P.; Ming, D. W.; Niles, P. B.; Eigenbrode, J. L.; Franz, H.; Glavin, D. P.; McAdam, A. C.; Mahaffy, P; Stern, J. C.; hide

    2014-01-01

    The Sample Analysis at Mars (SAM) instrument onboard the Curiosity rover detect-ed O2 and HCl gas releases from the Rocknest (RN) eolian bedform and the John Klein (JK) and Cumberland (CB) drill hole materials in Gale Crater. Chlorinated hydrocarbons have also been detected by the SAM quadrupole mass spectrometer (QMS) and gas chromatography/mass spectrometer (GCMS). These detections along with the detection of perchlorate (ClO4-) by the Mars Phoenix Lander’s Wet Chemistry Laboratory (WCL) suggesting perchlorate is a possible candidate for evolved O2 and chlorine species. Laboratory thermal analysis of perchlorates has yet to provide an unequivocal temperature match to the SAM O2 and HCl release data. Iron mineralogy found in the Rocknest materials when mixed with Ca-perchlorate does cause O2 release temperatures to be closer match to the SAM O2 release data but more work is required in evaluating the catalytic effects of Fe mineralogy on perchlorate decomposition. Chlorates (ClO3-) are relevant Mars materials and potential O2 and Cl sources. The objective of this work is to evaluate the thermal decomposition of select chlorate (ClO3-) salts as possible sources of the O2 and HCl releases in the Gale Crater materials.

  15. Development and small-scale validation of a novel pigeon-associated mitochondrial DNA source tracking marker for the detection of fecal contamination in harvested rainwater.

    Science.gov (United States)

    Waso, M; Khan, S; Khan, W

    2018-02-15

    The current study was aimed at designing and validating (on a small-scale) a novel pigeon mitochondrial DNA (mtDNA) microbial source tracking (MST) marker for the detection of pigeon fecal matter in harvested rainwater. The pigeon mtDNA MST marker was designed to target the mtDNA Cytochrome b gene by employing mismatch amplification mutation assay kinetics. The pigeon marker was validated by screening 69 non-pigeon and 9 pigeon fecal samples. The host-sensitivity of the assay was determined as 1.00 while the host-specificity of the assay was 0.96. Harvested rainwater samples (n=60) were screened for the prevalence of the marker with the mtDNA Cytochrome b marker detected in 78% of the samples. Bayes' theorem was applied to calculate the conditional probability of the marker detecting true pigeon contamination and the marker subsequently displayed a 99% probability of detecting true pigeon contamination in the harvested rainwater samples. In addition, the mtDNA Cytochrome b marker displayed high concurrence frequencies versus heterotrophic bacteria (78.3%), E. coli (73.3%), total coliforms (71.1%) and fecal coliforms (66.7%). This study thus validates that targeting mtDNA for the design of source tracking markers may be a valuable tool to detect avian fecal contamination in environmental waters. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Statistical Techniques For Real-time Anomaly Detection Using Spark Over Multi-source VMware Performance Data

    Energy Technology Data Exchange (ETDEWEB)

    Solaimani, Mohiuddin [Univ. of Texas-Dallas, Richardson, TX (United States); Iftekhar, Mohammed [Univ. of Texas-Dallas, Richardson, TX (United States); Khan, Latifur [Univ. of Texas-Dallas, Richardson, TX (United States); Thuraisingham, Bhavani [Univ. of Texas-Dallas, Richardson, TX (United States); Ingram, Joey Burton [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-09-01

    Anomaly detection refers to the identi cation of an irregular or unusual pat- tern which deviates from what is standard, normal, or expected. Such deviated patterns typically correspond to samples of interest and are assigned different labels in different domains, such as outliers, anomalies, exceptions, or malware. Detecting anomalies in fast, voluminous streams of data is a formidable chal- lenge. This paper presents a novel, generic, real-time distributed anomaly detection framework for heterogeneous streaming data where anomalies appear as a group. We have developed a distributed statistical approach to build a model and later use it to detect anomaly. As a case study, we investigate group anomaly de- tection for a VMware-based cloud data center, which maintains a large number of virtual machines (VMs). We have built our framework using Apache Spark to get higher throughput and lower data processing time on streaming data. We have developed a window-based statistical anomaly detection technique to detect anomalies that appear sporadically. We then relaxed this constraint with higher accuracy by implementing a cluster-based technique to detect sporadic and continuous anomalies. We conclude that our cluster-based technique out- performs other statistical techniques with higher accuracy and lower processing time.

  17. Expert and crowd-sourced validation of an individualized sleep spindle detection method employing complex demodulation and individualized normalization

    Directory of Open Access Journals (Sweden)

    Laura eRay

    2015-09-01

    Full Text Available A spindle detection method was developed that: 1 extracts the signal of interest (i.e., spindle-related phasic changes in sigma relative to ongoing background sigma activity using complex demodulation, 2 accounts for variations of spindle characteristics across the night, scalp derivations and between individuals, and 3 employs a minimum number of sometimes arbitrary, user-defined parameters. Complex demodulation was used to extract instantaneous power in the spindle band. To account for intra- and inter-individual differences, the signal was z-score transformed using a 60s sliding window, per channel, over the course of the recording. Spindle events were detected with a z-score threshold corresponding to a low probability (e.g., 99th percentile. Spindle characteristics, such as amplitude, duration and oscillatory frequency, were derived for each individual spindle following detection, which permits spindles to be subsequently and flexibly categorized as slow or fast spindles from a single detection pass. Spindles were automatically detected in 15 young healthy subjects. Two experts manually identified spindles from C3 during Stage 2 sleep, from each recording; one employing conventional guidelines, and the other, identifying spindles with the aid of a sigma (11-16 Hz filtered channel. These spindles were then compared between raters and to the automated detection to identify the presence of true positives, true negatives, false positives and false negatives. This method of automated spindle detection resolves or avoids many of the limitations that complicate automated spindle detection, and performs well compared to a group of non-experts, and importantly, has good external validity with respect to the extant literature in terms of the characteristics of automatically detected spindles.

  18. Detection of Airway Anomalies in?Pediatric?Patients with Cardiovascular Anomalies with Low Dose Prospective ECG-Gated Dual-Source CT

    OpenAIRE

    Jiao, Hui; Xu, Zhuodong; Wu, Lebin; Cheng, Zhaoping; Ji, Xiaopeng; Zhong, Hai; Meng, Chen

    2013-01-01

    OBJECTIVES: To assess the feasibility of low-dose prospective ECG-gated dual-source CT (DSCT) in detecting airway anomalies in pediatric patients with cardiovascular anomalies compared with flexible tracheobronchoscopy (FTB). METHODS: 33 pediatrics with respiratory symptoms who had been revealed cardiovascular anomalies by transthoracic echocardiography underwent FTB and contrast material-enhanced prospective ECG-triggering CT were enrolled. The study was approved by our institution review bo...

  19. Study allowing a decision-making from the activity calculation of a iodine 131 source detected in a dump at the incineration facility

    International Nuclear Information System (INIS)

    Houy, J.C.; Laugle, S.

    2000-01-01

    This study is divided in six parts: the first one details the determination of the different threshold in order to make the decision; the second part is the description of the gantry placed at the incineration factory; the third part is devoted to the gantry calibration by detector; the fourth part concerns the theoretical determination of the rates ratio in function of the source position in the truck; the fifth part makes the concordance between the theoretical calculations and the practice measures; the sixth part expresses the source activity and position determination in the truck with the decision-making. To conclude, the alarm threshold adjustment of the Rennes incineration factory is set to twice the background noise without taking into account of the source position in the domestic wastes truck. The alarm setting off can be carried out for a low activity source situated close to the truck wall and conversely, do not detect a MBq source situated in the middle of the truck. This alarm should be set off from a calculation program, taking into account the detectors report, in order to estimate the activity and the position of the source in the truck and to determine the decision making for the management of these wastes. (N.C.)

  20. CpG Oligonucleotide and Interleukin 2 stimulation enables higher cytogenetic abnormality detection rates than 12-o-tetradecanolyphorbol-13-acetate in Asian patients with B-cell chronic lymphocytic leukemia (B-CLL).

    Science.gov (United States)

    Liaw, Fiona Pui San; Lau, Lai Ching; Lim, Alvin Soon Tiong; Lim, Tse Hui; Lee, Geok Yee; Tien, Sim Leng

    2014-12-01

    The present study was designed to compare abnormality detection rates using DSP30 + IL2 and 12-O-Tetradecanoylphorbol-13-acetate (TPA) in Asian patients with B-CLL. Hematological specimens from 47 patients (29 newly diagnosed, 18 relapsed) were established as 72 h-DSP30 + IL2 and TPA cultures. Standard methods were employed to identify clonal aberrations by conventional cytogenetics (CC). The B-CLL fluorescence in situ hybridization (FISH) panel comprised ATM, CEP12, D13S25, and TP53 probes. DSP30 + IL2 cultures had a higher chromosomal abnormality detection rate (67 %) compared to TPA (44 %, p 0.05). Thirteen cases with abnormalities were found exclusively in DSP30 + IL2 cultures compared to one found solely in TPA cultures. DSP30 + IL2 cultures were comparable to the FISH panel in detecting 11q-, +12 and 17p- but not 13q-. It also has a predilection for 11q- bearing leukemic cells compared to TPA. FISH had a higher abnormality detection rate (84.1 %) compared to CC (66.0 %) with borderline significance (p = 0.051), albeit limited by its coverage. In conclusion, DSP30 + IL2 showed a higher abnormality detection rate. However, FISH is indispensable to circumvent low mitotic indices and detect subtle abnormalities.

  1. The use of cluster analysis method for the localization of acoustic emission sources detected during the hydrotest of PWR pressure vessels

    International Nuclear Information System (INIS)

    Liska, J.; Svetlik, M.; Slama, K.

    1982-01-01

    The acoustic emission method is a promising tool for checking reactor pressure vessel integrity. Localization of emission sources is the first and the most important step in processing emission signals. The paper describes the emission sources localization method which is based on cluster analysis of a set of points depicting the emission events in the plane of coordinates of their occurrence. The method is based on using this set of points for constructing the minimum spanning tree and its partition into fragments corresponding to point clusters. Furthermore, the laws are considered of probability distribution of the minimum spanning tree edge length for one and several clusters with the aim of finding the optimum length of the critical edge for the partition of the tree. Practical application of the method is demonstrated on localizing the emission sources detected during a hydrotest of a pressure vessel used for testing the reactor pressure vessel covers. (author)

  2. The nuclear reaction analysis (NRA) as a means for detecting carbon in GaAs and in source materials and additives

    International Nuclear Information System (INIS)

    Bethge, K.; Mader, A.; Michelmann, R.; Krauskopf, J.; Thee, P.; Meyer, J.D.

    1991-01-01

    The nuclear reaction ananlysis (NRA) on the basis of the reaction 12 C (d,p) 13 C is a method allowing the detection and description of both lateral and depth profiles of the presence of carbon in GaAs and in the source materials and additives. The NRA is an absolute method with a detection limit for C of approx. 4x10 15 cm 3 . The achievable detection range in depth under the experimental conditions goes from the surface down to 6 μm. Combined with channeling measurements, NRA is capable of identifying the position of carbon in the GaAs crystal lattice, and thus permits to examine the mobility of C in GaAs. (BBR) With 11 refs [de

  3. The comparison of four neutron sources for Prompt Gamma Neutron Activation Analysis (PGNAA) in vivo detections of boron.

    Science.gov (United States)

    Fantidis, J G; Nicolaou, G E; Potolias, C; Vordos, N; Bandekas, D V

    A Prompt Gamma Ray Neutron Activation Analysis (PGNAA) system, incorporating an isotopic neutron source has been simulated using the MCNPX Monte Carlo code. In order to improve the signal to noise ratio different collimators and a filter were placed between the neutron source and the object. The effect of the positioning of the neutron beam and the detector relative to the object has been studied. In this work the optimisation procedure is demonstrated for boron. Monte Carlo calculations were carried out to compare the performance of the proposed PGNAA system using four different neutron sources ( 241 Am/Be, 252 Cf, 241 Am/B, and DT neutron generator). Among the different systems the 252 Cf neutron based PGNAA system has the best performance.

  4. Neuroscience imaging enabled by new highly tunable and high peak power femtosecond lasers

    Science.gov (United States)

    Hakulinen, T.; Klein, J.

    2017-02-01

    Neuroscience applications benefit from recent developments in industrial femtosecond laser technology. New laser sources provide several megawatts of peak power at wavelength of 1040 nm, which enables simultaneous optogenetics photoactivation of tens or even hundreds of neurons using red shifted opsins. Another recent imaging trend is to move towards longer wavelengths, which would enable access to deeper layers of tissue due to lower scattering and lower absorption in the tissue. Femtosecond lasers pumping a non-collinear optical parametric amplifier (NOPA) enable the access to longer wavelengths with high peak powers. High peak powers of >10 MW at 1300 nm and 1700 nm allow effective 3-photon excitation of green and red shifted calcium indicators respectively and access to deeper, sub-cortex layers of the brain. Early results include in vivo detection of spontaneous activity in hippocampus within an intact mouse brain, where neurons express GCaMP6 activated in a 3-photon process at 1320 nm.

  5. Highways Disturbance Detection with the Use of Open Source Code Geographic Information Systems, Mobile and Web Applications

    Science.gov (United States)

    Sabah, L.; Şimşek, M.

    2017-11-01

    Road disturbances are occurring in our country due to the highway-weighted transportation. These disturbances are caused by human and natural causes. Disturbances in the roads have a negative effect on human life as well as damage to the vehicles. Regardless of how it occurs, it is important to quickly detect and eliminate roadside disturbances. The use of mobile devices has become widespread with developing technologies. Today, many sensors such as GPS and accelerometer are used to detect road disturbances on mobile devices. In this context, it is important to use mobile applications for fast and in-situ detection. In this study, it is investigated the use of mobile devices' location data received from GPS sensors with special mobile interfaces in gathering road data for road disturbances.

  6. Enhancing the performance of a tensioned metastable fluid detector based active interrogation system for the detection of SNM in interrogation source in moderated/reflected geometries

    Science.gov (United States)

    Grimes, T. F.; Hagen, A. R.; Archambault, B. C.; Taleyarkhan, R. P.

    2018-03-01

    This paper describes the development of a SNM detection system for interrogating 1m3 cargos via the combination of a D-D neutron interrogation source (with and without reflectors) and tensioned metastable fluid detectors (TMFDs). TMFDs have been previously shown (Taleyarkhan et al., 2008; Grimes et al., 2015; Grimes and Taleyarkhan, 2016; Archambault et al., 2017; Hagen et al., 2016) to be capable of using Threshold Energy Neutron Analysis (TENA) techniques to reject the ∼2.45 MeV D-D interrogating neutrons while still remaining sensitive to >2.45 MeV neutrons resulting from fission in the target (HEU) material. In order to enhance the performance, a paraffin reflector was included around the accelerator head. This reflector was used to direct neutrons into the package to increase the fission signal, lower the energy of the interrogating neutrons to increase the fission cross-section with HEU, and, also to direct interrogating neutrons away from the detectors in order to enhance the required discrimination between interrogating and fission neutrons. Experiments performed with a 239 Pu-Be neutron source and MnO2 indicated that impressive performance gains could be made by placing a parabolic paraffin moderator between the interrogation source and an air-filled cargo container with HEU placed at the center. However, experiments with other cargo fillers (as specified in the well-known ANSI N42.41-2007 report), and with HEU placed in locations other than the center of the package indicated that other reflector geometries might be superior due to over-"focusing" and the increased solid angle effects due to the accommodation of the moderator geometry. The best performance for the worst case of source location and box fill was obtained by placing the reflector only behind the D-D neutron source rather than in front of it. Finally, it was shown that there could be significant gains in the ability to detect concealed SNM by operating the system in multiple geometric

  7. On the early detection of threats in the real world based on open-source information on the internet

    NARCIS (Netherlands)

    Bouma, H.; Rajadell Rojas, O.; Worm, D.T.H.; Versloot, C.A.; Wedemeijer, H.

    2012-01-01

    Many threats in the real world can be related to activities of persons on the internet. Internet surveillance aims to detect threats in an early stage and to assist in finding suspects based on information from the web. However, the amount of data on the internet rapidly increases and it is time

  8. Automatic landslide detection from LiDAR DTM derivatives by geographic-object-based image analysis based on open-source software

    Science.gov (United States)

    Knevels, Raphael; Leopold, Philip; Petschko, Helene

    2017-04-01

    With high-resolution airborne Light Detection and Ranging (LiDAR) data more commonly available, many studies have been performed to facilitate the detailed information on the earth surface and to analyse its limitation. Specifically in the field of natural hazards, digital terrain models (DTM) have been used to map hazardous processes such as landslides mainly by visual interpretation of LiDAR DTM derivatives. However, new approaches are striving towards automatic detection of landslides to speed up the process of generating landslide inventories. These studies usually use a combination of optical imagery and terrain data, and are designed in commercial software packages such as ESRI ArcGIS, Definiens eCognition, or MathWorks MATLAB. The objective of this study was to investigate the potential of open-source software for automatic landslide detection based only on high-resolution LiDAR DTM derivatives in a study area within the federal state of Burgenland, Austria. The study area is very prone to landslides which have been mapped with different methodologies in recent years. The free development environment R was used to integrate open-source geographic information system (GIS) software, such as SAGA (System for Automated Geoscientific Analyses), GRASS (Geographic Resources Analysis Support System), or TauDEM (Terrain Analysis Using Digital Elevation Models). The implemented geographic-object-based image analysis (GEOBIA) consisted of (1) derivation of land surface parameters, such as slope, surface roughness, curvature, or flow direction, (2) finding optimal scale parameter by the use of an objective function, (3) multi-scale segmentation, (4) classification of landslide parts (main scarp, body, flanks) by k-mean thresholding, (5) assessment of the classification performance using a pre-existing landslide inventory, and (6) post-processing analysis for the further use in landslide inventories. The results of the developed open-source approach demonstrated good

  9. Dissolved organic matter fluorescence at wavelength 275/342 nm as a key indicator for detection of point-source contamination in a large Chinese drinking water lake.

    Science.gov (United States)

    Zhou, Yongqiang; Jeppesen, Erik; Zhang, Yunlin; Shi, Kun; Liu, Xiaohan; Zhu, Guangwei

    2016-02-01

    Surface drinking water sources have been threatened globally and there have been few attempts to detect point-source contamination in these waters using chromophoric dissolved organic matter (CDOM) fluorescence. To determine the optimal wavelength derived from CDOM fluorescence as an indicator of point-source contamination in drinking waters, a combination of field campaigns in Lake Qiandao and a laboratory wastewater addition experiment was used. Parallel factor (PARAFAC) analysis identified six components, including three humic-like, two tryptophan-like, and one tyrosine-like component. All metrics showed strong correlation with wastewater addition (r(2) > 0.90, p CDOM fluorescence at 275/342 nm was the most responsive wavelength to the point-source contamination in the lake. Our results suggest that pollutants in Lake Qiandao had the highest concentrations in the river mouths of upstream inflow tributaries and the single wavelength at 275/342 nm may be adapted for online or in situ fluorescence measurements as an early warning of contamination events. This study demonstrates the potential utility of CDOM fluorescence to monitor water quality in surface drinking water sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Geo-Enabled, Mobile Services

    DEFF Research Database (Denmark)

    Jensen, Christian Søndergaard

    2006-01-01

    We are witnessing the emergence of a global infrastructure that enables the widespread deployment of geo-enabled, mobile services in practice. At the same time, the research community has also paid increasing attention to data management aspects of mobile services. This paper offers me...

  11. Toward genome-enabled mycology.

    Science.gov (United States)

    Hibbett, David S; Stajich, Jason E; Spatafora, Joseph W

    2013-01-01

    Genome-enabled mycology is a rapidly expanding field that is characterized by the pervasive use of genome-scale data and associated computational tools in all aspects of fungal biology. Genome-enabled mycology is integrative and often requires teams of researchers with diverse skills in organismal mycology, bioinformatics and molecular biology. This issue of Mycologia presents the first complete fungal genomes in the history of the journal, reflecting the ongoing transformation of mycology into a genome-enabled science. Here, we consider the prospects for genome-enabled mycology and the technical and social challenges that will need to be overcome to grow the database of complete fungal genomes and enable all fungal biologists to make use of the new data.

  12. Olfaction-based Detection Distance: A Quantitative Analysis of How Far Away Dogs Recognize Tortoise Odor and Follow It to Source

    Directory of Open Access Journals (Sweden)

    Cindee Valentin

    2008-03-01

    Full Text Available The use of detector dogs has been demonstrated to be effective and safe for finding Mojave desert tortoises and provides certain advantages over humans in field surveys. Unlike humans who rely on visual cues for target identification, dogs use primarily olfactory cues and can therefore locate targets that are not visually obvious. One of the key benefits of surveying with dogs is their efficiency at covering ground and their ability to detect targets from long distances. Dogs may investigate potential targets using visual cues but confirm the presence of a target based on scent. Everything that emits odor does so via vapor-phase molecules and the components comprising a particular scent are carried primarily though bulk movement of the atmosphere. It is the ability to search for target odor and then go to its source that makes dogs ideal for rapid target recognition in the field setting. Using tortoises as targets, we quantified distances that dogs detected tortoise scent, followed it to source, and correctly identified tortoises as targets. Detection distance data were collected during experimental trials with advanced global positioning system (GPS technology and then analyzed using geographic information system (GIS modeling techniques. Detection distances ranged from 0.5 m to 62.8 m for tortoises on the surface. We did not observe bias with tortoise size, age class, sex or the degree to which tortoises were handled prior to being found by the dogs. The methodology we developed to quantify olfaction-based detection distance using dogs can be applied to other targets that dogs are trained to find.

  13. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system.

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  14. Source coherence impairments in a direct detection direct sequence optical code-division multiple-access system

    Science.gov (United States)

    Fsaifes, Ihsan; Lepers, Catherine; Lourdiane, Mounia; Gallion, Philippe; Beugin, Vincent; Guignard, Philippe

    2007-02-01

    We demonstrate that direct sequence optical code- division multiple-access (DS-OCDMA) encoders and decoders using sampled fiber Bragg gratings (S-FBGs) behave as multipath interferometers. In that case, chip pulses of the prime sequence codes generated by spreading in time-coherent data pulses can result from multiple reflections in the interferometers that can superimpose within a chip time duration. We show that the autocorrelation function has to be considered as the sum of complex amplitudes of the combined chip as the laser source coherence time is much greater than the integration time of the photodetector. To reduce the sensitivity of the DS-OCDMA system to the coherence time of the laser source, we analyze the use of sparse and nonperiodic quadratic congruence and extended quadratic congruence codes.

  15. DETECTION OF THE NITRATE POLLUTION SOURCES IN SHALLOW AQUIFER, USING INTEGRATION OF RS&GIS WITH STABLE ISOTOPES TECHNOLOGIES

    Directory of Open Access Journals (Sweden)

    N. B. I. Shakak

    2018-04-01

    Full Text Available Geographical information system (GIS and remote sensing technique is a tool which is used for acquiring data from space, storing, analyzing and displaying spatial data, also can use for investigating source of environmental pollution which is affect health. Sudan landsat mosaic image which acquired in 2013 was used in this study to develop land use and land cover maps for tow selected study area, Khartoum urban area, and Bara locality in North kordofan state western Sudan. The main objective to assess the source of Nitrate pollution in shallow aquifer. ERDAS software was used to create land cover-land use maps for the study areas. For Khartoum town we used land sat mosaic image which acquire in 2013, and used supervised classification which more closely controlled than unsupervised. In this process, we select pixel that represent patterns you recognized or can identify with help from knowledge of the data, the classes desired, and the algorithm to be used is required. In this paper we integrated the (GIS&RS, and stable isotopes methods for fingerprinting Nitrate sources in shallow boreholes. The global positioning system (GPS, used in the field to identify the shallow boreholes location in a three dimensional coordinate (Latitude, longitude, and altitude, Water samples were collected from 19 shallow boreholes in the study areas according to the standard sampling method send to laboratory to measure stable nitrogen (δ15Nnitrate, and Nitrate-oxygen (δ18Onitrate isotopes. Analysis were conducted by using isotope ratio mass spectrometry (IRMS. We can conclude that, special distribution and integration of GIs & RS help to identify the source of nitrate pollution.

  16. Detection of the Nitrate Pollution Sources in Shallow Aquifer, Using Integration of RS&GIS with Stable Isotopes Technologies

    Science.gov (United States)

    Shakak, N. B. I.

    2018-04-01

    Geographical information system (GIS) and remote sensing technique is a tool which is used for acquiring data from space, storing, analyzing and displaying spatial data, also can use for investigating source of environmental pollution which is affect health. Sudan landsat mosaic image which acquired in 2013 was used in this study to develop land use and land cover maps for tow selected study area, Khartoum urban area, and Bara locality in North kordofan state western Sudan. The main objective to assess the source of Nitrate pollution in shallow aquifer. ERDAS software was used to create land cover-land use maps for the study areas. For Khartoum town we used land sat mosaic image which acquire in 2013, and used supervised classification which more closely controlled than unsupervised. In this process, we select pixel that represent patterns you recognized or can identify with help from knowledge of the data, the classes desired, and the algorithm to be used is required. In this paper we integrated the (GIS&RS), and stable isotopes methods for fingerprinting Nitrate sources in shallow boreholes. The global positioning system (GPS), used in the field to identify the shallow boreholes location in a three dimensional coordinate (Latitude, longitude, and altitude), Water samples were collected from 19 shallow boreholes in the study areas according to the standard sampling method send to laboratory to measure stable nitrogen (δ15Nnitrate), and Nitrate-oxygen (δ18Onitrate) isotopes. Analysis were conducted by using isotope ratio mass spectrometry (IRMS). We can conclude that, special distribution and integration of GIs & RS help to identify the source of nitrate pollution.

  17. The onset of the Little Ice Age in Andalusia (southern Spain: detection and characterization from documentary sources

    Directory of Open Access Journals (Sweden)

    F. S. Rodrigo

    1995-03-01

    Full Text Available In this work the onset of the "Little Ice Age" period in Andalusia (southern Spain is analysed from documentary data, focusing attention on the evolution of the climate during the 16th and 17th centuries. It is shown that changes in the rainfall regime have been more important than those in the temperature in studying the Andalusian climate change. Analysis of the total annual precipitation is carried out by codifying the documentary data and establishing an ordinal index. Several statistical methods are used to detect and characterize climate changes in the region. The results suggest a fluctuating evolution, without trends or abrupt changes, with a prevailing wet period from 1550 to 1650 AD. Cycles of ~17, 3.5 and 2.1 years are detected. Some possible causal mechanisms are suggested.

  18. The onset of the Little Ice Age in Andalusia (southern Spain: detection and characterization from documentary sources

    Directory of Open Access Journals (Sweden)

    F. S. Rodrigo

    Full Text Available In this work the onset of the "Little Ice Age" period in Andalusia (southern Spain is analysed from documentary data, focusing attention on the evolution of the climate during the 16th and 17th centuries. It is shown that changes in the rainfall regime have been more important than those in the temperature in studying the Andalusian climate change. Analysis of the total annual precipitation is carried out by codifying the documentary data and establishing an ordinal index. Several statistical methods are used to detect and characterize climate changes in the region. The results suggest a fluctuating evolution, without trends or abrupt changes, with a prevailing wet period from 1550 to 1650 AD. Cycles of ~17, 3.5 and 2.1 years are detected. Some possible causal mechanisms are suggested.

  19. Detecting the sensitivity of magnetic response on different pollution sources--A case study from typical mining cities in northwestern China.

    Science.gov (United States)

    Wang, Bo; Xia, Dunsheng; Yu, Ye; Jia, Jia; Nie, Yan; Wang, Xin

    2015-12-01

    Rapid monitoring and discriminating different anthropogenic pollution is a key scientific issue. To detect the applicability and sensitivity of magnetic measurements for evaluating different industrial pollution in urban environment, characteristics of topsoil from three typical fast developing industrial cities (Jinchang, Baiyin and Jiayuguan in Gansu province, northwestern China) were studied by magnetic and geochemical analyses. The results showed that magnetic susceptibility was enhanced near industrial areas, and PSD-MD magnetite dominated the magnetic properties. Magnetic concentration parameters (χlf, SIRM, and χARM) showed different correlations with heavy metals and PLI in the three cities, indicating significantly different magnetic response to different pollution sources. Principal component analysis showed that ferrimagnetic minerals coexist with heavy metals of Fe, As, Cu, Pb, and Zn in Baiyin and Fe, V, Cu, Mn, Pb, and Cr in Jiayuguan. Fuzzy cluster analysis and regression analysis further indicated that the sensitivity of magnetic monitoring to fuel dust is higher than that to mineral dust near non-ferrous metal smelters, and fossil fuel consumption is an important factor for increasing magnetite content. In all the three cities, the sensitivity of magnetic monitoring to pollutants from steel plants is much higher than that from non-ferrous metal plants. Therefore, magnetic proxies provide a rapid means for detecting heavy metal contamination caused by multi-anthropogenic pollution sources in a large scale area, however, the sensitivity was controlled by pollution sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Detecting new γ-ray sources based on multi-frequency data the case of 1WHSPJ031423.9+061956

    Science.gov (United States)

    Arsioli, Bruno; Chang, Yu Ling

    2015-12-01

    We use the Fermi Science Tools in an attempt to unveil faint γ-ray blazars that may be above the threshold for detectability with Fermi-LAT and are not identified by automated methods. Our search for new sources in the 100MeV-300GeV band is mainly driven by the 1/2WHSP catalogs, which list high synchrotron peaked blazars expected to be emitters of VHE photons. Here we present the γ-ray detection of 1WHSP J031423.9+061956, modelling its high energy spectrum as a power law. We describe an example where multi-frequency selection, performed at much lower energies (from radio to X-ray), helps to pin-point a high energy source. The 1/2WHSP catalogs are built with the aim of providing a list of TeV targets for the VHE arrays of Cherenkov telescopes. Moreover, these catalogs provide useful seeds for identifying new high energy sources within the raw-data from Fermi. With the aid of multi-frequency data, we can explore the very high energy domain in greater details, improving the description of the γ-ray sky.

  1. Development of three-dimensional trajectory model for detecting source region of the radioactive materials released into the atmosphere

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Kyung Suk; Park, Ki Hyun; Min, Byung Il; Kim, Sora; Yang, Byung Mo [Nuclear Environmental Safety Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2016-05-15

    It is necessary to consider the overall countermeasure for analysis of nuclear activities according to the increase of the nuclear facilities like nuclear power and reprocessing plants in the neighboring countries including China, Taiwan, North Korea, Japan and South Korea. South Korea and comprehensive nuclear-test-ban treaty organization (CTBTO) are now operating the monitoring instruments to detect radionuclides released into the air. It is important to estimate the origin of radionuclides measured using the detection technology as well as the monitoring analysis in aspects of investigation and security of the nuclear activities in neighboring countries. A three-dimensional forward/backward trajectory model has been developed to estimate the origin of radionuclides for a covert nuclear activity. The developed trajectory model was composed of forward and backward modules to track the particle positions using finite difference method. A three-dimensional trajectory model was validated using the measured data at Chernobyl accident. The calculated results showed a good agreement by using the high concentration measurements and the locations where was near a release point. The three-dimensional trajectory model had some uncertainty according to the release time, release height and time interval of the trajectory at each release points. An atmospheric dispersion model called long-range accident dose assessment system (LADAS), based on the fields of regards (FOR) technique, was applied to reduce the uncertainties of the trajectory model and to improve the detective technology for estimating the radioisotopes emission area. The detective technology developed in this study can evaluate in release area and origin for covert nuclear activities based on measured radioisotopes at monitoring stations, and it might play critical tool to improve the ability of the nuclear safety field.

  2. Mobile, hybrid Compton/coded aperture imaging for detection, identification and localization of gamma-ray sources at stand-off distances

    Science.gov (United States)

    Tornga, Shawn R.

    The Stand-off Radiation Detection System (SORDS) program is an Advanced Technology Demonstration (ATD) project through the Department of Homeland Security's Domestic Nuclear Detection Office (DNDO) with the goal of detection, identification and localization of weak radiological sources in the presence of large dynamic backgrounds. The Raytheon-SORDS Tri-Modal Imager (TMI) is a mobile truck-based, hybrid gamma-ray imaging system able to quickly detect, identify and localize, radiation sources at standoff distances through improved sensitivity while minimizing the false alarm rate. Reconstruction of gamma-ray sources is performed using a combination of two imaging modalities; coded aperture and Compton scatter imaging. The TMI consists of 35 sodium iodide (NaI) crystals 5x5x2 in3 each, arranged in a random coded aperture mask array (CA), followed by 30 position sensitive NaI bars each 24x2.5x3 in3 called the detection array (DA). The CA array acts as both a coded aperture mask and scattering detector for Compton events. The large-area DA array acts as a collection detector for both Compton scattered events and coded aperture events. In this thesis, developed coded aperture, Compton and hybrid imaging algorithms will be described along with their performance. It will be shown that multiple imaging modalities can be fused to improve detection sensitivity over a broader energy range than either alone. Since the TMI is a moving system, peripheral data, such as a Global Positioning System (GPS) and Inertial Navigation System (INS) must also be incorporated. A method of adapting static imaging algorithms to a moving platform has been developed. Also, algorithms were developed in parallel with detector hardware, through the use of extensive simulations performed with the Geometry and Tracking Toolkit v4 (GEANT4). Simulations have been well validated against measured data. Results of image reconstruction algorithms at various speeds and distances will be presented as well as

  3. Detection of aerosol pollution sources during sandstorms in Northwestern China using remote sensed and model simulated data

    Science.gov (United States)

    Filonchyk, Mikalai; Yan, Haowen; Yang, Shuwen; Lu, Xiaomin

    2018-02-01

    The present paper has used a comprehensive approach to study atmosphere pollution sources including the study of vertical distribution characteristics, the epicenters of occurrence and transport of atmospheric aerosol in North-West China under intensive dust storm registered in all cities of the region in April 2014. To achieve this goal, the remote sensing data using Moderate Resolution Imaging Spectroradiometer satellite (MODIS) as well as model-simulated data, were used, which facilitate tracking the sources, routes, and spatial extent of dust storms. The results of the study have shown strong territory pollution with aerosol during sandstorm. According to ground-based air quality monitoring stations data, concentrations of PM10 and PM2.5 exceeded 400 μg/m3 and 150 μg/m3, respectively, the ratio PM2.5/PM10 being within the range of 0.123-0.661. According to MODIS/Terra Collection 6 Level-2 aerosol products data and the Deep Blue algorithm data, the aerosol optical depth (AOD) at 550 nm in the pollution epicenter was within 0.75-1. The vertical distribution of aerosols indicates that the Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observations (CALIPSO) 532 nm total attenuates backscatter coefficient ranges from 0.01 to 0.0001 km-1 × sr-1 with the distribution of the main types of aerosols in the troposphere of the region within 0-12.5 km, where the most severe aerosol contamination is observed in the lower troposphere (at 3-6 km). According to satellite sounding and model-simulated data, the sources of pollution are the deserted regions of Northern and Northwestern China.

  4. Investigation of physical detection markers in irradiated foods under different radiation sources and post-irradiation storage conditions

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Joong Ho; Kim, Gui Ran; Ahn, Jae Jun; Kim, Dong Gil; Jin, Qiong Wen; Park, Ju Hwan; Lee, Ji Hyun [Kyungpook National University, Daegu (Korea, Republic of)

    2010-04-15

    In PSL analysis, all unirradiated samples showed less than 700 (negative) photon counts (PCs). At 5 kGy, spice samples showed PCs in range of 700-5,000 (intermediate), while grains, legumes, root-crops, and seasonings samples showed PCs over 5,000 (positive). This PSL based-detection of radiation treatment was possible even after 24 months of storage. In TL analysis, TL glow curve was characteristically different between unirradiated and irradiated samples. Glow curves were observed in temperature ranges of 150-250 .deg. C for irradiated and over 300 .deg. C for unirradiated samples. TL ratio (TL{sub 1}/TL{sub 2}) provided valuable additional confirmations as unirradiated sample showed values less than 0.1, while irradiated sample showed more than 0.1. However, with storage time, TL intensity and TL ratio decreased but discrimination was still possible even after storage of 24 months. Samples stored at room temperature with exposure to direct or indirect light enhanced the mentioned decrease of TL intensity and TL ratio as compared to low temperature storage in dark room. In ESR analysis, legumes and spices showed radiation-induced cellulose radicals, while seasonings showed multi-component signals of radiation-induced crystalline sugar radical. These radiation-induced radicals could be potential markers for the detection of radiation treatments in subjected samples. The decreasing trend was also found for radiation-specific ESR signals of cellulose and crystalline sugar radicals during storage. However, radiation-induced radicals in legumes, powdered pepper and seasonings were detectable even after 6 months of storage

  5. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  6. Pulsed lasers versus continuous light sources in capillary electrophoresis and fluorescence detection studies: Photodegradation pathways and models

    International Nuclear Information System (INIS)

    Boutonnet, Audrey; Morin, Arnaud; Petit, Pierre; Vicendo, Patricia; Poinsot, Véréna; Couderc, François

    2016-01-01

    Pulsed lasers are widely used in capillary electrophoresis (CE) studies to provide laser induced fluorescence (LIF) detection. Unfortunately pulsed lasers do not give linear calibration curves over a wide range of concentrations. While this does not prevent their use in CE/LIF studies, the non-linear behavior must be understood. Using 7-hydroxycoumarin (7-HC) (10–5000 nM), Tamra (10–5000 nM) and tryptophan (1–200 μM) as dyes, we observe that continuous lasers and LEDs result in linear calibration curves, while pulsed lasers give polynomial ones. The effect is seen with both visible light (530 nm) and with UV light (355 nm, 266 nm). In this work we point out the formation of byproducts induced by pulsed laser upon irradiation of 7-HC. Their separation by CE using two Zeta LIF detectors clearly shows that this process is related to the first laser detection. All of these photodegradation products can be identified by an ESI-/MS investigation and correspond to at least two 7HC dimers. By using the photodegradation model proposed by Heywood and Farnsworth (2010) and by taking into account the 7-HC results and the fact that in our system we do not have a constant concentration of fluorophore, it is possible to propose a new photochemical model of fluorescence in LIF detection. The model, like the experiment, shows that it is difficult to obtain linear quantitation curves with pulsed lasers while UV-LEDs used in continuous mode have this advantage. They are a good alternative to UV pulsed lasers. An application involving the separation and linear quantification of oligosaccharides labeled with 2-aminobezoic acid is presented using HILIC and LED (365 nm) induced fluorescence. - Highlights: • No linear calibration curves are obtained in CE/Pulsed-LIF detection. • Photodegradation and photodimerisation are responsible of this non linearity. • A mathematical model of this phenomenon is presented. • 7 hydroxycoumarin in CE/LIF is used to verify the

  7. Atmospheric boundary layer CO2 remote sensing with a direct detection LIDAR instrument based on a widely tunable optical parametric source.

    Science.gov (United States)

    Cadiou, Erwan; Mammez, Dominique; Dherbecourt, Jean-Baptiste; Gorju, Guillaume; Pelon, Jacques; Melkonian, Jean-Michel; Godard, Antoine; Raybaut, Myriam

    2017-10-15

    We report on the capability of a direct detection differential absorption lidar (DIAL) for range resolved and integrated path (IPDIAL) remote sensing of CO 2 in the atmospheric boundary layer (ABL). The laser source is an amplified nested cavity optical parametric oscillator (NesCOPO) emitting approximately 8 mJ at the two measurement wavelengths selected near 2050 nm. Direct detection atmospheric measurements are taken from the ground using a 30 Hz frequency switching between emitted wavelengths. Results show that comparable precision measurements are achieved in DIAL and IPDIAL modes (not better than a few ppm) on high SNR targets such as near range ABL aerosol and clouds, respectively. Instrumental limitations are analyzed and degradation due to cloud scattering variability is discussed to explain observed DIAL and IPDIAL limitations.

  8. Rapid detection and E-test antimicrobial susceptibility testing of Vibrio parahaemolyticus isolated from seafood and environmental sources in Malaysia.

    Science.gov (United States)

    Al-Othrubi, Saleh M; Hanafiah, Alfizah; Radu, Son; Neoh, Humin; Jamal, Rahaman

    2011-04-01

    To find out the prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus in seafoods and environmental sources. The study was carried out at the Center of Excellence for Food Safety Research, University Putra Malaysia; Universiti Kebangsaan Malaysia; Medical Molecular Biology Institute; and University Kebansaan Malaysia Hospital, Malaysia between January 2006 and August 2008. One hundred and forty-four isolates from 400 samples of seafood (122 isolates) and seawater sources (22 isolates) were investigated for the presence of thermostable direct hemolysin (tdh+) and TDH-related hemolysin (trh+) genes using the standard methods. The E-test method was used to test the antimicrobial susceptibility. The study indicates low occurrence of tdh+ (0.69%) and trh+ isolates (8.3%). None of the isolates tested posses both virulence genes. High sensitivity was observed against tetracycline (98%). The mean minimum inhibitory concentration (MIC) of the isolates toward ampicillin increased from 4 ug/ml in 2004 to 24 ug/ml in 2007. The current study demonstrates a low occurrence of pathogenic Vibrio parahaemolyticus in the marine environment and seafood. Nonetheless, the potential risk of vibrio infection due to consumption of Vibrio parahaemolyticus contaminated seafood in Malaysia should not be neglected.

  9. A Simple Analytical Model for Predicting the Detectable Ion Current in Ion Mobility Spectrometry Using Corona Discharge Ionization Sources

    Science.gov (United States)

    Kirk, Ansgar Thomas; Kobelt, Tim; Spehlbrink, Hauke; Zimmermann, Stefan

    2018-05-01

    Corona discharge ionization sources are often used in ion mobility spectrometers (IMS) when a non-radioactive ion source with high ion currents is required. Typically, the corona discharge is followed by a reaction region where analyte ions are formed from the reactant ions. In this work, we present a simple yet sufficiently accurate model for predicting the ion current available at the end of this reaction region when operating at reduced pressure as in High Kinetic Energy Ion Mobility Spectrometers (HiKE-IMS) or most IMS-MS instruments. It yields excellent qualitative agreement with measurement results and is even able to calculate the ion current within an error of 15%. Additional interesting findings of this model are the ion current at the end of the reaction region being independent from the ion current generated by the corona discharge and the ion current in High Kinetic Energy Ion Mobility Spectrometers (HiKE-IMS) growing quadratically when scaling down the length of the reaction region. [Figure not available: see fulltext.

  10. Detection of anti-dsDNA by IgG ELISA test using two different sources of antigens: calf thymus versus E.coli

    Directory of Open Access Journals (Sweden)

    Mohammadi M

    2009-04-01

    Full Text Available "nBackground: Anti-dsDNA antibodies frequently found in the sera Systemic Lupus Erythematosus patients, particularly in active disease stage. Nowadays exploit different eukaryotic and prokaryotic dsDNA as antigen source and different reagents as binder. The aim of this study to compared two dsDNA different sources and tow different kinds of reagents for binder in ELISA test. "nMethods: In this study bacterial genomic DNA from E.coli (ATCC 25922 and genomic DNA from calf thymus extracted with high purity and were used as antigens for IgG anti-dsDNA detection by ELISA. To coat dsDNA in microtiter wells, tow different kinds of reagents including methylated -BSA and poly-l-lysine (for pre-coating are used. Sera from systemic lupus erythematosus patients and from normal blood donors are used to assess sensitivity and specificity of our ELISA test in compared with IF test and commercial kits. "nResults: Our results displayed pre-coating of microtiter plates with methylated -BSA reduce nonspecific binding reaction and the relative sensitivity and specificity of ELISA increased when calf thymus DNA is employed as antigenic source in compared with IF test and commercial kits 80%, 88% and 100%, 98% respectively, but when E.coli DNA is used 73%, 69% and 85%, 79%, respectively. "nConclusion: The genomic DNA from calf thymus is a potentially useful source of antigen for detection of anti-dsDNA by ELISA. Also the use of methylatted- BSA could have an effective role in reducing of nonspecific binding reactions.

  11. Detection of Entamoeba sp. and Helmith Eggs From Water Sources in Urban Slum Area in Bandung Municipality

    Directory of Open Access Journals (Sweden)

    Sri Yusnita Irda Sari

    2017-09-01

    Full Text Available Diarrhea is a waterborne disease due to consumption of contaminated food/water. People in urban slum area have highest risk to get diarrhea because of poor hygiene and sanitation as well as limited access to uncontaminated water. This study aimed to identify conta­mination in watersources by Entamoeba Sp and helmint eggs (Anchylostoma duodenale, Ascaris lumbricoides, Trichuris trichuria in one of urban slum area in Bandung municipality. Samples were taken from 123 watersources (74 tap water, 21 borehole, 22 dugwell and 6 spring water which was randomly selected in 10 RW along the Cikapundung river basin in Tamansari subdistrict during period of July-September 2015. Water samples were examined by PCR to detect Entamoeba Sp and microscopic identification for helminth eggs. 90 out of 123 samples were positive for Entamoeba Sp (59 tap water, 16 dugwell, 11 borehole and 4 spring water. Helminth egg of Ascaris lumbricoides was detected from unimproved common dugwell which had very high risk of contamination. Appropriate of water treatment prior to consumption is vastly important. Physical improvement to construct improved dugwell should be done to prevent contamination from helminth eggs in watersources.

  12. Paramecium caudatum as a source of nitric oxide: Chemiluminescent detection based on Bluestar® Forensic reagent connected with microdialysis.

    Science.gov (United States)

    Bancirova, Martina

    2017-11-01

    Nitric oxide (NO) chemistry inside the body is the most interesting part of its behavior. NO is involved in controlling blood pressure, and in transmitting nerve signals and a variety of other signaling processes. To explain the behavior of NO, it is necessary to determine its immediate concentration or observe time-dependent changes in its concentration. In Paramecium caudatum, NO is formed by calcium-dependent nNOS (NOS1)-like protein, which is distributed in the cytoplasm. NO synthesis affects the ciliary beat and consequent motility of cells and blocked NO synthesis reduces the ability of cells to move. The possibility of online coupling of microdialysis (of P. caudatum solution) with NO detection is demonstrated. Direct measurement of NO is carried out using dilute Bluestar ® Forensic reagent (luminol-H 2 O 2 system; one of the NO detections is based upon the chemiluminescent reaction between NO and the luminol-H 2 O 2 system, which is specifically reactive to NO). The effect of a nitric oxide synthase inhibitor, NG-nitro-l-arginine methyl ester was observed. NO production was inhibited and the movement of P. caudatum was restricted. These effects were time dependent and after a specific time were reversed. Copyright © 2017 John Wiley & Sons, Ltd.

  13. Computer Security Systems Enable Access.

    Science.gov (United States)

    Riggen, Gary

    1989-01-01

    A good security system enables access and protects information from damage or tampering, but the most important aspects of a security system aren't technical. A security procedures manual addresses the human element of computer security. (MLW)

  14. How GNSS Enables Precision Farming

    Science.gov (United States)

    2014-12-01

    Precision farming: Feeding a Growing Population Enables Those Who Feed the World. Immediate and Ongoing Needs - population growth (more to feed) - urbanization (decrease in arable land) Double food production by 2050 to meet world demand. To meet thi...

  15. Deep neural networks to enable real-time multimessenger astrophysics

    Science.gov (United States)

    George, Daniel; Huerta, E. A.

    2018-02-01

    Gravitational wave astronomy has set in motion a scientific revolution. To further enhance the science reach of this emergent field of research, there is a pressing need to increase the depth and speed of the algorithms used to enable these ground-breaking discoveries. We introduce Deep Filtering—a new scalable machine learning method for end-to-end time-series signal processing. Deep Filtering is based on deep learning with two deep convolutional neural networks, which are designed for classification and regression, to detect gravitational wave signals in highly noisy time-series data streams and also estimate the parameters of their sources in real time. Acknowledging that some of the most sensitive algorithms for the detection of gravitational waves are based on implementations of matched filtering, and that a matched filter is the optimal linear filter in Gaussian noise, the application of Deep Filtering using whitened signals in Gaussian noise is investigated in this foundational article. The results indicate that Deep Filtering outperforms conventional machine learning techniques, achieves similar performance compared to matched filtering, while being several orders of magnitude faster, allowing real-time signal processing with minimal resources. Furthermore, we demonstrate that Deep Filtering can detect and characterize waveform signals emitted from new classes of eccentric or spin-precessing binary black holes, even when trained with data sets of only quasicircular binary black hole waveforms. The results presented in this article, and the recent use of deep neural networks for the identification of optical transients in telescope data, suggests that deep learning can facilitate real-time searches of gravitational wave sources and their electromagnetic and astroparticle counterparts. In the subsequent article, the framework introduced herein is directly applied to identify and characterize gravitational wave events in real LIGO data.

  16. L-Arginine ethylester enhances in vitro amplification of PrP(Sc) in macaques with atypical L-type bovine spongiform encephalopathy and enables presymptomatic detection of PrP(Sc) in the bodily fluids.

    Science.gov (United States)

    Murayama, Y; Ono, F; Shimozaki, N; Shibata, H

    2016-02-12

    Protease-resistant, misfolded isoforms (PrP(Sc)) of a normal cellular prion protein (PrP(C)) in the bodily fluids, including blood, urine, and saliva, are expected to be useful diagnostic markers of prion diseases, and nonhuman primate models are suited for performing valid diagnostic tests for human Creutzfeldt-Jakob disease (CJD). We developed an effective amplification method for PrP(Sc) derived from macaques infected with the atypical L-type bovine spongiform encephalopathy (L-BSE) prion by using mouse brain homogenate as a substrate in the presence of polyanions and L-arginine ethylester. This method was highly sensitive and detected PrP(Sc) in infected brain homogenate diluted up to 10(10) by sequential amplification. This method in combination with PrP(Sc) precipitation by sodium phosphotungstic acid is capable of amplifying very small amounts of PrP(Sc) contained in the cerebrospinal fluid (CSF), saliva, urine, and plasma of macaques that have been intracerebrally inoculated with the L-BSE prion. Furthermore, PrP(Sc) was detectable in the saliva or urine samples as well as CSF samples obtained at the preclinical phases of the disease. Thus, our novel method may be useful for furthering the understanding of bodily fluid leakage of PrP(Sc) in nonhuman primate models. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Detecting and accounting for multiple sources of positional variance in peak list registration analysis and spin system grouping.

    Science.gov (United States)

    Smelter, Andrey; Rouchka, Eric C; Moseley, Hunter N B

    2017-08-01

    Peak lists derived from nuclear magnetic resonance (NMR) spectra are commonly used as input data for a variety of computer assisted and automated analyses. These include automated protein resonance assignment and protein structure calculation software tools. Prior to these analyses, peak lists must be aligned to each other and sets of related peaks must be grouped based on common chemical shift dimensions. Even when programs can perform peak grouping, they require the user to provide uniform match tolerances or use default values. However, peak grouping is further complicated by multiple sources of variance in peak position limiting the effectiveness of grouping methods that utilize uniform match tolerances. In addition, no method currently exists for deriving peak positional variances from single peak lists for grouping peaks into spin systems, i.e. spin system grouping within a single peak list. Therefore, we developed a complementary pair of peak list registration analysis and spin system grouping algorithms designed to overcome these limitations. We have implemented these algorithms into an approach that can identify multiple dimension-specific positional variances that exist in a single peak list and group peaks from a single peak list into spin systems. The resulting software tools generate a variety of useful statistics on both a single peak list and pairwise peak list alignment, especially for quality assessment of peak list datasets. We used a range of low and high quality experimental solution NMR and solid-state NMR peak lists to assess performance of our registration analysis and grouping algorithms. Analyses show that an algorithm using a single iteration and uniform match tolerances approach is only able to recover from 50 to 80% of the spin systems due to the presence of multiple sources of variance. Our algorithm recovers additional spin systems by reevaluating match tolerances in multiple iterations. To facilitate evaluation of the

  18. Improved dark energy detection through the polarization-assisted cross correlation of the cosmic microwave background with radio sources

    International Nuclear Information System (INIS)

    Liu, Guo-Chin; Ng, Kin-Wang; Pen, Ue-Li

    2011-01-01

    Integrated Sachs-Wolfe (ISW) effect can be estimated by cross-correlating the cosmic microwave background (CMB) sky with tracers of the local matter distribution. At late cosmic time, the dark energy-induced decay of gravitation potential generates a cross correlation signal on large angular scales. The dominant noise is the intrinsic CMB anisotropies from the inflationary epoch. In this paper we use CMB polarization to reduce this intrinsic noise. We cross-correlate the microwave sky observed by Wilkinson Microwave Anisotropy Probe (WMAP) with the radio source catalog compiled by NRAO VLA Sky Survey (NVSS) to study the efficiency of the noise suppression. We find that the error bars are reduced by about 4 to 14% and the statistical power in the signal is improved.

  19. Piezoelectric-nanowire-enabled power source for driving wireless microelectronics.

    Science.gov (United States)

    Xu, Sheng; Hansen, Benjamin J; Wang, Zhong Lin

    2010-10-19

    Harvesting energy from irregular/random mechanical actions in variable and uncontrollable environments is an effective approach for powering wireless mobile electronics to meet a wide range of applications in our daily life. Piezoelectric nanowires are robust and can be stimulated by tiny physical motions/disturbances over a range of frequencies. Here, we demonstrate the first chemical epitaxial growth of PbZr(x)Ti(1-x)O(3) (PZT) nanowire arrays at 230 °C and their application as high-output energy converters. The nanogenerators fabricated using a single array of PZT nanowires produce a peak output voltage of ~0.7 V, current density of 4 μA cm(-2) and an average power density of 2.8 mW cm(-3). The alternating current output of the nanogenerator is rectified, and the harvested energy is stored and later used to light up a commercial laser diode. This work demonstrates the feasibility of using nanogenerators for powering mobile and even personal microelectronics.

  20. Application of new radiation detection techniques at the Paul Scherrer Institut, especially at the spallation neutron source

    CERN Document Server

    Lehmann, E; Williams, T; Pralong, C

    1999-01-01

    The demands on modern irradiation detection systems are diverse, encompassing spatial resolution, dynamic range, sensitivity and reproducibility. Nevertheless, there are two important new methods which can satisfy most of these demands in several applications: camera based systems and imaging plates. Imaging plates have primarily been used as gamma- and beta-sensitive detectors in biology and medicine, but are now available also as neutron sensitive systems. These methods are ideally suited for applications in neutron radiography because of their high sensitivity, linearity and digital output. Image processing, quantification of the image data and automated pattern recognition can easily be performed using modern software tools. The imaging plate system at PSI is shared between groups in reactor physics, radiation protection, biology, proton therapy and nuclear medicine. The collected experience from these different interests establishes the basis for a most effective application of this technique. The utilis...

  1. Detecting the permafrost carbon feedback: talik formation and increased cold-season respiration as precursors to sink-to-source transitions

    Science.gov (United States)

    Parazoo, Nicholas C.; Koven, Charles D.; Lawrence, David M.; Romanovsky, Vladimir; Miller, Charles E.

    2018-01-01

    Thaw and release of permafrost carbon (C) due to climate change is likely to offset increased vegetation C uptake in northern high-latitude (NHL) terrestrial ecosystems. Models project that this permafrost C feedback may act as a slow leak, in which case detection and attribution of the feedback may be difficult. The formation of talik, a subsurface layer of perennially thawed soil, can accelerate permafrost degradation and soil respiration, ultimately shifting the C balance of permafrost-affected ecosystems from long-term C sinks to long-term C sources. It is imperative to understand and characterize mechanistic links between talik, permafrost thaw, and respiration of deep soil C to detect and quantify the permafrost C feedback. Here, we use the Community Land Model (CLM) version 4.5, a permafrost and biogeochemistry model, in comparison to long-term deep borehole data along North American and Siberian transects, to investigate thaw-driven C sources in NHL ( > 55° N) from 2000 to 2300. Widespread talik at depth is projected across most of the NHL permafrost region (14 million km2) by 2300, 6.2 million km2 of which is projected to become a long-term C source, emitting 10 Pg C by 2100, 50 Pg C by 2200, and 120 Pg C by 2300, with few signs of slowing. Roughly half of the projected C source region is in predominantly warm sub-Arctic permafrost following talik onset. This region emits only 20 Pg C by 2300, but the CLM4.5 estimate may be biased low by not accounting for deep C in yedoma. Accelerated decomposition of deep soil C following talik onset shifts the ecosystem C balance away from surface dominant processes (photosynthesis and litter respiration), but sink-to-source transition dates are delayed by 20-200 years by high ecosystem productivity, such that talik peaks early ( ˜ 2050s, although borehole data suggest sooner) and C source transition peaks late ( ˜ 2150-2200). The remaining C source region in cold northern Arctic permafrost, which shifts to a net

  2. Detecting the permafrost carbon feedback: talik formation and increased cold-season respiration as precursors to sink-to-source transitions

    Directory of Open Access Journals (Sweden)

    N. C. Parazoo

    2018-01-01

    Full Text Available Thaw and release of permafrost carbon (C due to climate change is likely to offset increased vegetation C uptake in northern high-latitude (NHL terrestrial ecosystems. Models project that this permafrost C feedback may act as a slow leak, in which case detection and attribution of the feedback may be difficult. The formation of talik, a subsurface layer of perennially thawed soil, can accelerate permafrost degradation and soil respiration, ultimately shifting the C balance of permafrost-affected ecosystems from long-term C sinks to long-term C sources. It is imperative to understand and characterize mechanistic links between talik, permafrost thaw, and respiration of deep soil C to detect and quantify the permafrost C feedback. Here, we use the Community Land Model (CLM version 4.5, a permafrost and biogeochemistry model, in comparison to long-term deep borehole data along North American and Siberian transects, to investigate thaw-driven C sources in NHL ( >  55° N from 2000 to 2300. Widespread talik at depth is projected across most of the NHL permafrost region (14 million km2 by 2300, 6.2 million km2 of which is projected to become a long-term C source, emitting 10 Pg C by 2100, 50 Pg C by 2200, and 120 Pg C by 2300, with few signs of slowing. Roughly half of the projected C source region is in predominantly warm sub-Arctic permafrost following talik onset. This region emits only 20 Pg C by 2300, but the CLM4.5 estimate may be biased low by not accounting for deep C in yedoma. Accelerated decomposition of deep soil C following talik onset shifts the ecosystem C balance away from surface dominant processes (photosynthesis and litter respiration, but sink-to-source transition dates are delayed by 20–200 years by high ecosystem productivity, such that talik peaks early ( ∼  2050s, although borehole data suggest sooner and C source transition peaks late ( ∼  2150–2200. The

  3. Comparison of diagnostic accuracy of dual-source CT and conventional angiography in detecting congenital heart diseases

    International Nuclear Information System (INIS)

    Sedaghat, Fariborz; Pouraliakbar, Hamidreza; Motevalli, Marzieh; Karimi, Mohammad Ali; Armand, Sandbad

    2014-01-01

    Cardiac dual-source computed tomography (DSCT) is primarily used for coronary arteries. There are limited studies about the application of DSCT for congenital heart diseases. The aim of this study was to determine the diagnostic value of DSCT in the cardiac anomalies. The images of DSCTs and conventional angiographies of 36 patients (21 male; mean age: 8.5 month) with congenital heart diseases were reviewed and the parameters of diagnostic value of these methods were compared. Cardiac surgery was the gold standard. A total of 105 cardiac anomalies were diagnosed at surgery. Sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of DSCT were 98.25%, 97.9%, 98.1%, 99.07%, and 98.2%, respectively. The corresponding values of angiography were 95.04%, 98.7%, 97.8%, 98.1%, and 98%, respectively. Only one atrial septal defect (ASD) and two patent ductus arteriosus (PDA) were missed by DSCT. Angiography missed two ASD and two PDA. DSCT also provided important additional findings (n=35) about the intrathoracic or intraabdominal organs. DSCT is a highly accurate diagnostic modality for congenital heart diseases, obviating the need for invasive modalities. Beside its noninvasive nature, the advantage of DSCT over the angiography is its ability to provide detailed anatomical information about the heart, vessels, lungs and intraabdominal organs

  4. Use of media and public-domain Internet sources for detection and assessment of plant health threats.

    Science.gov (United States)

    Thomas, Carla S; Nelson, Noele P; Jahn, Gary C; Niu, Tianchan; Hartley, David M

    2011-09-05

    Event-based biosurveillance is a recognized approach to early warning and situational awareness of emerging health threats. In this study, we build upon previous human and animal health work to develop a new approach to plant pest and pathogen surveillance. We show that monitoring public domain electronic media for indications and warning of epidemics and associated social disruption can provide information about the emergence and progression of plant pest infestation or disease outbreak. The approach is illustrated using a case study, which describes a plant pest and pathogen epidemic in China and Vietnam from February 2006 to December 2007, and the role of ducks in contributing to zoonotic virus spread in birds and humans. This approach could be used as a complementary method to traditional plant pest and pathogen surveillance to aid global and national plant protection officials and political leaders in early detection and timely response to significant biological threats to plant health, economic vitality, and social stability. This study documents the inter-relatedness of health in human, animal, and plant populations and emphasizes the importance of plant health surveillance.

  5. SEROPOSITIVITY TO LEPTOSPIROSIS IN DOMESTIC RESERVOIRS AND DETECTION OF Leptospira spp. IN WATER SOURCES, IN FARMS OF YUCATAN, MEXICO.

    Directory of Open Access Journals (Sweden)

    Maria Fidelia Cardenas-Marrufo

    2010-11-01

    Full Text Available Leptospirosis is a zoonotic infectious disease with a worldwide distribution. WHO classifies this disease as reemergent and it represents risk to human health with economical repercussion to animal reproduction. Leptospirosis occurs with higher frequency in countries with tropical weather. A transversal study was conducted to determine the frequency of infection of L. interrogans in 476 reservoir animals -212 bovines, 203 pigs, and 61 dogs in 34 animal production units. Positivity frequency the reservoirs was 30.5%. 31 out of 34 animal units had positive reservoirs. The most frequent serovars were tarassovi (53.6%, and hardjo (31.6% in cattle; bratislava (66% and icterohaemorragiae (18.7% in pigs; and canicola (79.8% and icterohaemorragiae (9.8% in dogs. 68 pools of water samples from water tanks were analyzed by DNA amplification of a 16S rRNA fragment for L. interrogans detection using Lepat1-Lepat2 primers. It is recommended to use preventive measures such as vaccination to domestic animals to reduce the risk of transmission to the human population.

  6. Time-dependent exchange and tunneling: detection at the same place of two electrons emitted simultaneously from different sources

    International Nuclear Information System (INIS)

    Marian, D; Colomés, E; Oriols, X

    2015-01-01

    Two-particle scattering probabilities in tunneling scenarios with exchange interaction are analyzed with quasi-particle wave packets. Two initial one-particle wave packets (with opposite central momentums) are spatially localized at each side of a barrier. After impinging upon a tunneling barrier, each wave packet splits into transmitted and reflected components. When the initial two-particle anti-symmetrical state is defined as a Slater determinant of any type of (normalizable) one-particle wave packet, it is shown that the probability of detecting two (identically injected) electrons at the same side of the barrier is different from zero in very common (single or double barrier) scenarios. In some particular scenarios, the transmitted and reflected components become orthogonal and the mentioned probabilities reproduce those values associated to distinguishable particles. These unexpected non-zero probabilities are still present when non-separable Coulomb interaction or non-symmetrical potentials are considered. On the other hand, for initial wave packets close to Hamiltonian eigenstates, the usual zero two-particle probability for electrons at the same side of the barrier found in the literature is recovered. The generalization to many-particle scattering probabilities with quasi-particle wave packets for low and high phase-space density are also analyzed. The far-reaching consequences of these non-zero probabilities in the accurate evaluation of quantum noise in mesoscopic systems are briefly indicated. (paper)

  7. A satellite view of the sources and interannual variability of free tropospheric PAN over the eastern Pacific Ocean during summer and its timeline for trend detection

    Science.gov (United States)

    Zhu, L.; Fischer, E. V.; Payne, V.; Walker, T. W.; Worden, J. R.; Jiang, Z.; Kulawik, S. S.

    2016-12-01

    Peroxyacetyl nitrate (PAN) is the most important reservoir for nitrogen oxide radicals (NOx = NO + NO2) in the troposphere and plays a significant role in the redistribution of NOx to remote regions. There is strong evidence that PAN decomposition in specific plumes of Asian origin subsiding over the eastern Pacific Ocean can lead to significant ozone (O3) enhancements in the troposphere. Thus quantifying the spatial and temporal variability of PAN over the eastern Pacific Ocean is an important part of understanding the O3 budget upwind of the North American airshed. Here we present observations of PAN from the Tropospheric Emission Spectrometer (TES) over the eastern Pacific for July 2006-2010. We focus our analysis on July because prior work based on in situ observations has primarily addressed the transpacific transport of PAN in spring. Plumes containing elevated PAN are present almost every day in the month of July, and we show that elevated PAN observed in July has multiple sources, including fires in Siberia, anthropogenic and lightning sources in eastern China, and re-circulated pollution from the continental U.S. We provide examples of each type of source using both HYPLIT trajectories and a GEOS-Chem adjoint sensitivity analysis. Based on the variability observed in the TES PAN retrievals over this region, we predict it would be faster to detect a trend of a given magnitude in PAN using satellite observations over the eastern Pacific Ocean region rather than surface in situ observations at one site, and that a trend of a given magnitude would be more quickly detected in summer than spring.

  8. Using non-invasive molecular spectroscopic techniques to detect unique aspects of protein Amide functional groups and chemical properties of modeled forage from different sourced-origins.

    Science.gov (United States)

    Ji, Cuiying; Zhang, Xuewei; Yu, Peiqiang

    2016-03-05

    The non-invasive molecular spectroscopic technique-FT/IR is capable to detect the molecular structure spectral features that are associated with biological, nutritional and biodegradation functions. However, to date, few researches have been conducted to use these non-invasive molecular spectroscopic techniques to study forage internal protein structures associated with biodegradation and biological functions. The objectives of this study were to detect unique aspects and association of protein Amide functional groups in terms of protein Amide I and II spectral profiles and chemical properties in the alfalfa forage (Medicago sativa L.) from different sourced-origins. In this study, alfalfa hay with two different origins was used as modeled forage for molecular structure and chemical property study. In each forage origin, five to seven sources were analyzed. The molecular spectral profiles were determined using FT/IR non-invasive molecular spectroscopy. The parameters of protein spectral profiles included functional groups of Amide I, Amide II and Amide I to II ratio. The results show that the modeled forage Amide I and Amide II were centered at 1653 cm(-1) and 1545 cm(-1), respectively. The Amide I spectral height and area intensities were from 0.02 to 0.03 and 2.67 to 3.36 AI, respectively. The Amide II spectral height and area intensities were from 0.01 to 0.02 and 0.71 to 0.93 AI, respectively. The Amide I to II spectral peak height and area ratios were from 1.86 to 1.88 and 3.68 to 3.79, respectively. Our results show that the non-invasive molecular spectroscopic techniques are capable to detect forage internal protein structure features which are associated with forage chemical properties. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The Isolation and Detection of Staphylococcus aureus Enterotoxins A-E and TSST-1 Genes from Different Sources by PCR Method

    Directory of Open Access Journals (Sweden)

    Norouzi J

    2012-09-01

    Full Text Available Background and Objectives: Enterotoxins and toxic shock syndrome toxin–1 (TSST-1 are an important virulence factor of S. aureus. The purpose of this study was to analyze the presence of S. aureus enterotoxin (sea-see and tst genes in the samples that collected from different sources with PCR method. Methods: During 5 months from 150 collected samples, 80 strains were identified as S. aureus. PCR reaction was used for investigation on the presence of genes for staphylococcal enterotoxins (A-E and toxic shock syndrome toxin-1 (TSST-1. Results: Fifty three samples (66.25% out of 80 samples were positive for one or more ETs and TSST-1 genes. of these positive strains, 17 (32.07% were positive for sea 39 (73.58% for seb, 30 (56.6% for sec, 2 (3.7% for sed, 21 (39.62% for see, and 14 (26.41% for tst. Enterotoxins and tst in 40 samples (75.47% observed.Conclusion: In this study, high prevalence of S. aureus, its enterotoxin, and tst genes were observed in clinical samples, food samples, and healthy people. This fact emphasizes on the role of human as original source and carrier of S. aureus. Also, use of PCR reaction for detection of these genes in S. aureus that isolated from various sources is recommended.

  10. Detection and Estimation of 2-D Distributions of Greenhouse Gas Source Concentrations and Emissions over Complex Urban Environments and Industrial Sites

    Science.gov (United States)

    Zaccheo, T. S.; Pernini, T.; Dobler, J. T.; Blume, N.; Braun, M.

    2017-12-01

    This work highlights the use of the greenhouse-gas laser imaging tomography experiment (GreenLITETM) data in conjunction with a sparse tomography approach to identify and quantify both urban and industrial sources of CO2 and CH4. The GreenLITETM system provides a user-defined set of time-sequenced intersecting chords or integrated column measurements at a fixed height through a quasi-horizontal plane of interest. This plane, with unobstructed views along the lines of sight, may range from complex industrial facilities to a small city scale or urban sector. The continuous time phased absorption measurements are converted to column concentrations and combined with a plume based model to estimate the 2-D distribution of gas concentration over extended areas ranging from 0.04-25 km2. Finally, these 2-D maps of concentration are combined with ancillary meteorological and atmospheric data to identify potential emission sources and provide first order estimates of their associated fluxes. In this presentation, we will provide a brief overview of the systems and results from both controlled release experiments and a long-term system deployment in Paris, FR. These results provide a quantitative assessment of the system's ability to detect and estimate CO2 and CH4 sources, and demonstrate its ability to perform long-term autonomous monitoring and quantification of either persistent or sporadic emissions that may have both health and safety as well as environmental impacts.

  11. OGC® Sensor Web Enablement Standards

    Directory of Open Access Journals (Sweden)

    George Percivall

    2006-09-01

    Full Text Available This article provides a high-level overview of and architecture for the Open Geospatial Consortium (OGC standards activities that focus on sensors, sensor networks, and a concept called the “Sensor Web”. This OGC work area is known as Sensor Web Enablement (SWE. This article has been condensed from "OGC® Sensor Web Enablement: Overview And High Level Architecture," an OGC White Paper by Mike Botts, PhD, George Percivall, Carl Reed, PhD, and John Davidson which can be downloaded from http://www.opengeospatial.org/pt/15540. Readers interested in greater technical and architecture detail can download and read the OGC SWE Architecture Discussion Paper titled “The OGC Sensor Web Enablement Architecture” (OGC document 06-021r1, http://www.opengeospatial.org/pt/14140.

  12. 18F-fluorodeoxyglucose positron emission tomography/computed tomography enables the detection of recurrent same-site deep vein thrombosis by illuminating recently formed, neutrophil-rich thrombus.

    Science.gov (United States)

    Hara, Tetsuya; Truelove, Jessica; Tawakol, Ahmed; Wojtkiewicz, Gregory R; Hucker, William J; MacNabb, Megan H; Brownell, Anna-Liisa; Jokivarsi, Kimmo; Kessinger, Chase W; Jaff, Michael R; Henke, Peter K; Weissleder, Ralph; Jaffer, Farouc A

    2014-09-23

    Accurate detection of recurrent same-site deep vein thrombosis (DVT) is a challenging clinical problem. Because DVT formation and resolution are associated with a preponderance of inflammatory cells, we investigated whether noninvasive (18)F-fluorodeoxyglucose (FDG)-positron emission tomography (PET) imaging could identify inflamed, recently formed thrombi and thereby improve the diagnosis of recurrent DVT. We established a stasis-induced DVT model in murine jugular veins and also a novel model of recurrent stasis DVT in mice. C57BL/6 mice (n=35) underwent ligation of the jugular vein to induce stasis DVT. FDG-PET/computed tomography (CT) was performed at DVT time points of day 2, 4, 7, 14, or 2+16 (same-site recurrent DVT at day 2 overlying a primary DVT at day 16). Antibody-based neutrophil depletion was performed in a subset of mice before DVT formation and FDG-PET/CT. In a clinical study, 38 patients with lower extremity DVT or controls undergoing FDG-PET were analyzed. Stasis DVT demonstrated that the highest FDG signal occurred at day 2, followed by a time-dependent decrease (Pthrombus neutrophils (Pthrombus PET signal intensity. Neutrophil depletion decreased FDG signals in day 2 DVT in comparison with controls (P=0.03). Recurrent DVT demonstrated significantly higher FDG uptake than organized day 14 DVT (P=0.03). The FDG DVT signal in patients also exhibited a time-dependent decrease (Pthrombus inflammation in murine DVT, and demonstrates a time-dependent signal decrease in both murine and clinical DVT. FDG-PET/CT may offer a molecular imaging strategy to accurately diagnose recurrent DVT. © 2014 American Heart Association, Inc.

  13. Particle detection systems and methods

    Science.gov (United States)

    Morris, Christopher L.; Makela, Mark F.

    2010-05-11

    Techniques, apparatus and systems for detecting particles such as muons and neutrons. In one implementation, a particle detection system employs a plurality of drift cells, which can be for example sealed gas-filled drift tubes, arranged on sides of a volume to be scanned to track incoming and outgoing charged particles, such as cosmic ray-produced muons. The drift cells can include a neutron sensitive medium to enable concurrent counting of neutrons. The system can selectively detect devices or materials, such as iron, lead, gold, uranium, plutonium, and/or tungsten, occupying the volume from multiple scattering of the charged particles passing through the volume and can concurrently detect any unshielded neutron sources occupying the volume from neutrons emitted therefrom. If necessary, the drift cells can be used to also detect gamma rays. The system can be employed to inspect occupied vehicles at border crossings for nuclear threat objects.

  14. Social Network Change Detection

    National Research Council Canada - National Science Library

    McCulloh, Ian A; Carley, Kathleen M

    2008-01-01

    ... between group members. The ability to systematically, statistically, effectively and efficiently detect these changes has the potential to enable the anticipation of change, provide early warning of change, and enable...

  15. Flexibility-enabling Contracts in Electricity Markets

    DEFF Research Database (Denmark)

    Boscan, Luis; Poudineh, Rahmatallah

    As the share of intermittent renewable energy increases in the generation mix, power systems are exposed to greater levels of uncertainty and risk, which requires planners, policy and business decision makers to incentivise flexibility, that is: their adaptability to unforeseen variations....... Additionally, along with traditional sources, which already enable flexibility, a number of business models, such as thermostat-based demand response, aggregators and small storage providers, are emerging in electricity markets and expected to constitute important sources of flexibility in future decentralised...... power systems. However, due to presence of high transaction costs, relative to the size of resource, the emerging small resources cannot directly participate in an organised electricity market and/or compete. This paper asks the fundamental question of how should the provision of flexibility, as a multi...

  16. Development of a Rigid One-Meter-Side and Cooled Coil Sensor at 77 K for Magnetic Resonance Sounding to Detect Subsurface Water Sources.

    Science.gov (United States)

    Lin, Jun; Du, Guanfeng; Zhang, Jian; Yi, Xiaofeng; Jiang, Chuandong; Lin, Tingting

    2017-06-12

    Magnetic resonance sounding (MRS) using the Earth's magnetic field is a noninvasive and on-site geophysical technique providing quantitative characteristics of aquifers in the subsurface. When the MRS technology is applied in a mine or tunnel for advance detecting the source of water that may cause disastrous accident, spatial constraints limit the size of coil sensor and thus lower the detection capability. In this paper, a coil sensor for detecting the weak MRS signal is designed and the signal to noise (SNR) for the coil sensor is analyzed and optimized. The coil sensor has a rigid structure and square size of 1 m for deploying in a narrow underground space and is cooled at a low temperature of 77 K for improving the SNR. A theoretical calculation and an experimental test in an electromagnetically shielded room (EMSR) show that the optimal design of coil sensor consists of an 80-turn coil and a low-current-noise preamplifier AD745. It has a field sensitivity of 0.17 fT / Hz in the EMSR at 77 K, which is superior to the low temperature Superconducting Quantum Interference Device (LT SQUID) that is the latest application in MRS and the cooled coil with a diameter of 9 cm when detecting the laboratory NMR signal in kHz range. In the field experiment above the Taipingchi Reservoir near Changchun in China, the cooled coil sensor (CCS) developed in this paper has successfully obtained a valid weak MRS signal in high noise environment. The field results showed that the quality of measured MRS signal at 77 K is significantly superior to that at 298 K and the SNR is improved up to three times. This property of CCS makes the MRS instrument more convenient and reliable in a constricted space underground engineering environment (e.g., a mine or a tunnel).

  17. Development of a Rigid One-Meter-Side and Cooled Coil Sensor at 77 K for Magnetic Resonance Sounding to Detect Subsurface Water Sources

    Directory of Open Access Journals (Sweden)

    Jun Lin

    2017-06-01

    Full Text Available Magnetic resonance sounding (MRS using the Earth’s magnetic field is a noninvasive and on-site geophysical technique providing quantitative characteristics of aquifers in the subsurface. When the MRS technology is applied in a mine or tunnel for advance detecting the source of water that may cause disastrous accident, spatial constraints limit the size of coil sensor and thus lower the detection capability. In this paper, a coil sensor for detecting the weak MRS signal is designed and the signal to noise (SNR for the coil sensor is analyzed and optimized. The coil sensor has a rigid structure and square size of 1 m for deploying in a narrow underground space and is cooled at a low temperature of 77 K for improving the SNR. A theoretical calculation and an experimental test in an electromagnetically shielded room (EMSR show that the optimal design of coil sensor consists of an 80-turn coil and a low-current-noise preamplifier AD745. It has a field sensitivity of 0.17 fT / Hz in the EMSR at 77 K, which is superior to the low temperature Superconducting Quantum Interference Device (LT SQUID that is the latest application in MRS and the cooled coil with a diameter of 9 cm when detecting the laboratory NMR signal in kHz range. In the field experiment above the Taipingchi Reservoir near Changchun in China, the cooled coil sensor (CCS developed in this paper has successfully obtained a valid weak MRS signal in high noise environment. The field results showed that the quality of measured MRS signal at 77 K is significantly superior to that at 298 K and the SNR is improved up to three times. This property of CCS makes the MRS instrument more convenient and reliable in a constricted space underground engineering environment (e.g., a mine or a tunnel.

  18. Detecting Intracranial Hemorrhage Using Automatic Tube Current Modulation With Advanced Modeled Iterative Reconstruction in Unenhanced Head Single- and Dual-Energy Dual-Source CT.

    Science.gov (United States)

    Scholtz, Jan-Erik; Wichmann, Julian L; Bennett, Dennis W; Leithner, Doris; Bauer, Ralf W; Vogl, Thomas J; Bodelle, Boris

    2017-05-01

    The purpose of our study was to determine diagnostic accuracy, image quality, and radiation dose of low-dose single- and dual-energy unenhanced third-generation dual-source head CT for detection of intracranial hemorrhage (ICH). A total of 123 patients with suspected ICH were examined using a dual-source 192-MDCT scanner. Standard-dose 120-kVp single-energy CT (SECT; n = 36) and 80-kVp and 150-kVp dual-energy CT (DECT; n = 30) images were compared with low-dose SECT (n = 32) and DECT (n = 25) images obtained using automated tube current modulation (ATCM). Advanced modeled iterative reconstruction (ADMIRE) was used for all protocols. Detection of ICH was performed by three readers who were blinded to the image acquisition parameters of each image series. Image quality was assessed both quantitatively and qualitatively. Interobserver agreement was calculated using the Fleiss kappa. Radiation dose was measured as dose-length product (DLP). Detection of ICH was excellent (sensitivity, 94.9-100%; specificity, 94.7-100%) in all protocols (p = 1.00) with perfect interobserver agreement (0.83-0.96). Qualitative ratings showed significantly better ratings for both standard-dose protocols regarding gray matter-to-white matter contrast (p ≤ 0.014), whereas highest gray matter-to-white matter contrast-to-noise ratio was observed with low-dose DECT images (p ≥ 0.057). The lowest posterior fossa artifact index was measured for standard-dose DECT, which showed significantly lower values compared with low-dose protocols (p ≤ 0.034). Delineation of ventricular margins and sharpness of subarachnoidal spaces were rated excellent in all protocols (p ≥ 0.096). Low-dose techniques lowered radiation dose by 26% for SECT images (DLP, 575.0 ± 72.3 mGy · cm vs 771.5 ± 146.8 mGy · cm; p dual-source CT while allowing significant radiation dose reduction.

  19. Highlight on the indigenous organic molecules detected on Mars by SAM and potential sources of artifacts and backgrounds generated by the sample preparation

    Science.gov (United States)

    Buch, A.; Belmahdi, I.; Szopa, C.; Freissinet, C.; Glavin, D. P.; Coll, P. J.; Cabane, M.; Millan, M.; Eigenbrode, J. L.; Navarro-Gonzalez, R.; Stern, J. C.; Pinnick, V. T.; Coscia, D.; Teinturier, S.; Stambouli, M.; Dequaire, T.; Mahaffy, P. R.

    2015-12-01

    Among the experiments which explore the martian soil aboard the Curiosity Rover, SAM experiment is mainly dedicated to the search for indigenous organic compounds. To reach its goals SAM can operate in different analysis modes: Pyrolysis-GC-MS and Pyrolysis-MS (EGA). In addition SAM includes wet chemistry experiments [1] to supports extraction of polar organic compounds from solid samples that improves their detection either by increasing the release of chemical species from solid sample matrices, or by changing their chemical structure to make compounds more amenable to gas chromatography mass spectrometry (GCMS). The two wet chemistry experimental capabilities of SAM provide alternatives to the nominal inert-thermal desorption/pyrolysis analytical protocol and are more aptly suited for polar components: MTBSTFA derivatization [2-3] and TMAH thermochemolysis [4-5]. Here we focus on the MTBSTFA derivatization experiment. In order to build a support used to help the interpretation of SAM results, we have investigated the artifacts and backgrounds sources generated by the all analysis process: Solid sample were heated up to approximately 840°C at a rate of 35°C/min under He flow. For GC analyses, the majority of the gas released was trapped on a hydrocarbon trap (Tenax®) over a specific temperature range. Adsorbed volatiles on the GC injection trap (IT) were then released into the GC column (CLP-MXT 30m x 0.25mm x 0.25μm) by rapidly heating the IT to 300°C. Then, in order better understand the part of compounds detected coming from internal reaction we have performed several lab experiments to mimic the SAM device: Among the sources of artifact, we test: (1) the thermal stability and the organic material released during the degradation of Tenax® and carbosieve, (2) the impact of MTBSTFA and a mixture of DMF and MTBSTFA on the adsorbent, (3) the reaction between the different adsorbents (Tenax® and Carbosieve) and calcium perchlorate and then (4) the sources

  20. The Chandra Source Catalog : Automated Source Correlation

    Science.gov (United States)

    Hain, Roger; Evans, I. N.; Evans, J. D.; Glotfelty, K. J.; Anderson, C. S.; Bonaventura, N. R.; Chen, J. C.; Davis, J. E.; Doe, S. M.; Fabbiano, G.; Galle, E.; Gibbs, D. G.; Grier, J. D.; Hall, D. M.; Harbo, P. N.; He, X.; Houck, J. C.; Karovska, M.; Lauer, J.; McCollough, M. L.; McDowell, J. C.; Miller, J. B.; Mitschang, A. W.; Morgan, D. L.; Nichols, J. S.; Nowak, M. A.; Plummer, D. A.; Primini, F. A.; Refsdal, B. L.; Rots, A. H.; Siemiginowska, A. L.; Sundheim, B. A.; Tibbetts, M. S.; Van Stone, D. W.; Winkelman, S. L.; Zografou, P.

    2009-01-01

    Chandra Source Catalog (CSC) master source pipeline processing seeks to automatically detect sources and compute their properties. Since Chandra is a pointed mission and not a sky survey, different sky regions are observed for a different number of times at varying orientations, resolutions, and other heterogeneous conditions. While this provides an opportunity to collect data from a potentially large number of observing passes, it also creates challenges in determining the best way to combine different detection results for the most accurate characterization of the detected sources. The CSC master source pipeline correlates data from multiple observations by updating existing cataloged source information with new data from the same sky region as they become available. This process sometimes leads to relatively straightforward conclusions, such as when single sources from two observations are similar in size and position. Other observation results require more logic to combine, such as one observation finding a single, large source and another identifying multiple, smaller sources at the same position. We present examples of different overlapping source detections processed in the current version of the CSC master source pipeline. We explain how they are resolved into entries in the master source database, and examine the challenges of computing source properties for the same source detected multiple times. Future enhancements are also discussed. This work is supported by NASA contract NAS8-03060 (CXC).

  1. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    DEFF Research Database (Denmark)

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  2. Survey of Enabling Technologies for CAPS

    Science.gov (United States)

    Antol, Jeffrey; Mazanek, Daniel D.; Koons, Robert H.

    2005-01-01

    The enabling technologies required for the development of a viable Comet/Asteroid Protection System (CAPS) can be divided into two principal areas: detection and deflection/orbit modification. With the proper funding levels, many of the technologies needed to support a CAPS architecture could be achievable within the next 15 to 20 years. In fact, many advanced detection technologies are currently in development for future in-space telescope systems such as the James Webb Space Telescope (JWST), formerly known as the Next Generation Space Telescope. It is anticipated that many of the JWST technologies would be available for application for CAPS detection concepts. Deflection/orbit modification technologies are also currently being studied as part of advanced power and propulsion research. However, many of these technologies, such as extremely high-output power systems, advanced propulsion, heat rejection, and directed energy systems, would likely be farther term in availability than many of the detection technologies. Discussed subsequently is a preliminary examination of the main technologies that have been identified as being essential to providing the element functionality defined during the CAPS conceptual study. The detailed requirements for many of the technology areas are still unknown, and many additional technologies will be identified as future in-depth studies are conducted in this area.

  3. Organizational Enablers for Project Governance

    DEFF Research Database (Denmark)

    Müller, Ralf; Shao, Jingting; Pemsel, Sofia

    and their relationships to organizational success. Based on these results, the authors discovered that organizational enablers (including key factors such as leadership, governance, and influence of project managers) have a critical impact on how organizations operate, adapt to market fluctuations and forces, and make......While corporate culture plays a significant role in the success of any corporation, governance and “governmentality” not only determine how business should be conducted, but also define the policies and procedures organizations follow to achieve business functions and goals. In their book......, Organizational Enablers for Project Governance, Ralf Müller, Jingting Shao, and Sofia Pemsel examine the interaction of governance and governmentality in various types of companies and demonstrate how these factors drive business success and influence project work, efficiency, and profitability. The data...

  4. 'Ethos' Enabling Organisational Knowledge Creation

    Science.gov (United States)

    Matsudaira, Yoshito

    This paper examines knowledge creation in relation to improvements on the production line in the manufacturing department of Nissan Motor Company and aims to clarify embodied knowledge observed in the actions of organisational members who enable knowledge creation will be clarified. For that purpose, this study adopts an approach that adds a first, second, and third-person's viewpoint to the theory of knowledge creation. Embodied knowledge, observed in the actions of organisational members who enable knowledge creation, is the continued practice of 'ethos' (in Greek) founded in Nissan Production Way as an ethical basis. Ethos is knowledge (intangible) assets for knowledge creating companies. Substantiated analysis classifies ethos into three categories: the individual, team and organisation. This indicates the precise actions of the organisational members in each category during the knowledge creation process. This research will be successful in its role of showing the indispensability of ethos - the new concept of knowledge assets, which enables knowledge creation -for future knowledge-based management in the knowledge society.

  5. Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

    Directory of Open Access Journals (Sweden)

    BK Jha

    2013-09-01

    Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8

  6. Smart Grid enabled heat pumps

    DEFF Research Database (Denmark)

    Carmo, Carolina; Detlefsen, Nina; Nielsen, Mads Pagh

    2014-01-01

    The transition towards a 100 % fossil-free energy system, while achieving extreme penetration levels of intermittent wind and solar power in electricity generation, requires demand-side technologies that are smart (intermittency-friendly) and efficient. The integration of Smart Grid enabling...... with an empirical study in order to achieve a number of recommendations with respect to technology concepts and control strategies that would allow residential vapor-compression heat pumps to support large-scale integration of intermittent renewables. The analysis is based on data gathered over a period of up to 3...

  7. Identifying enabling management practices for employee engagement

    Directory of Open Access Journals (Sweden)

    Marius Joubert

    2011-12-01

    Full Text Available Orientation: A currently emerging viewpoint is that today's management practices no longer add value to organisations. The focus of this article is to conduct a systematic review of the scholarly literature on management practices that could be related to employee engagement. Research purpose: This study searched for evidence in support of the notion of a management value chain, and enabling management practices within each value chain component that could relate to employee engagement. Motivation for the study: An alternative management value chain model could contribute towards a better understanding of which management practices may potentially impact employee engagement. Research design, approach, and method: This is a non-empirical (theoretical study, based on a systematic, in-depth literature review to identify the key management components and enabling practices within this proposed management value chain. Scholarly research databases were sourced for relevant peer reviewed research conducted since 1990, not excluding important contributions prior to 1990. The literature was systematically searched, selected, studied, and contextualized within this study. Main findings: Support was found for the notion of a management value chain, for enabling management practices within each proposed management value chain component, and it was also established these management practices indeed have an impact on employee engagement. Practical/managerial/implications: The possibility that management work can be presented as a generic management value chain allows managers to approach engaging management practices more systematically. Contribution/value-add: This study highlights the importance of some management practices that have never been seen as part of management work.

  8. A wireless sensor enabled by wireless power.

    Science.gov (United States)

    Lee, Da-Sheng; Liu, Yu-Hong; Lin, Chii-Ruey

    2012-11-22

    Through harvesting energy by wireless charging and delivering data by wireless communication, this study proposes the concept of a wireless sensor enabled by wireless power (WPWS) and reports the fabrication of a prototype for functional tests. One WPWS node consists of wireless power module and sensor module with different chip-type sensors. Its main feature is the dual antenna structure. Following RFID system architecture, a power harvesting antenna was designed to gather power from a standard reader working in the 915 MHz band. Referring to the Modbus protocol, the other wireless communication antenna was integrated on a node to send sensor data in parallel. The dual antenna structure integrates both the advantages of an RFID system and a wireless sensor. Using a standard UHF RFID reader, WPWS can be enabled in a distributed area with a diameter up to 4 m. Working status is similar to that of a passive tag, except that a tag can only be queried statically, while the WPWS can send dynamic data from the sensors. The function is the same as a wireless sensor node. Different WPWSs equipped with temperature and humidity, optical and airflow velocity sensors are tested in this study. All sensors can send back detection data within 8 s. The accuracy is within 8% deviation compared with laboratory equipment. A wireless sensor network enabled by wireless power should be a totally wireless sensor network using WPWS. However, distributed WPWSs only can form a star topology, the simplest topology for constructing a sensor network. Because of shielding effects, it is difficult to apply other complex topologies. Despite this limitation, WPWS still can be used to extend sensor network applications in hazardous environments. Further research is needed to improve WPWS to realize a totally wireless sensor network.

  9. Long Carbon Chains in the Warm Carbon-chain-chemistry Source L1527: First Detection of C7H in Molecular Clouds

    Science.gov (United States)

    Araki, Mitsunori; Takano, Shuro; Sakai, Nami; Yamamoto, Satoshi; Oyama, Takahiro; Kuze, Nobuhiko; Tsukiyama, Koichi

    2017-09-01

    Long carbon-chain molecules were searched for toward the low-mass star-forming region L1527, which is a prototypical source of warm carbon-chain chemistry (WCCC), using the 100 m Green Bank Telescope. Long carbon-chain molecules, C7H (2Π1/2), C6H (2Π3/2 and 2Π1/2), CH3C4H, and C6H2 (cumulene carbene, CCCCCCH2), and cyclic species of C3H and C3H2O were detected. In particular, C7H was detected for the first time in molecular clouds. The column density of C7H is determined to be 6 × 1010 cm-2. The column densities of the carbon-chain molecules including CH3C4H and C6H in L1527 relative to those in the starless dark cloud Taurus Molecular Cloud-1 Cyanopolyyne Peak (TMC-1 CP) tend to be systematically lower for long carbon-chain lengths. However, the column densities of C7H and C6H2 do not follow this trend and are found to be relatively abundant in L1527. This result implies that these long carbon-chain molecules are remnants of the cold starless phase. The results—that both the remnants and WCCC products are observed toward L1527—are consistent with the suggestion that the protostar can also be born in the parent core at a relatively early stage in the chemical evolution.

  10. Cyber-Enabled Scientific Discovery

    International Nuclear Information System (INIS)

    Chan, Tony; Jameson, Leland

    2007-01-01

    It is often said that numerical simulation is third in the group of three ways to explore modern science: theory, experiment and simulation. Carefully executed modern numerical simulations can, however, be considered at least as relevant as experiment and theory. In comparison to physical experimentation, with numerical simulation one has the numerically simulated values of every field variable at every grid point in space and time. In comparison to theory, with numerical simulation one can explore sets of very complex non-linear equations such as the Einstein equations that are very difficult to investigate theoretically. Cyber-enabled scientific discovery is not just about numerical simulation but about every possible issue related to scientific discovery by utilizing cyberinfrastructure such as the analysis and storage of large data sets, the creation of tools that can be used by broad classes of researchers and, above all, the education and training of a cyber-literate workforce

  11. Simulation enabled safeguards assessment methodology

    International Nuclear Information System (INIS)

    Bean, Robert; Bjornard, Trond; Larson, Tom

    2007-01-01

    It is expected that nuclear energy will be a significant component of future supplies. New facilities, operating under a strengthened international nonproliferation regime will be needed. There is good reason to believe virtual engineering applied to the facility design, as well as to the safeguards system design will reduce total project cost and improve efficiency in the design cycle. Simulation Enabled Safeguards Assessment MEthodology has been developed as a software package to provide this capability for nuclear reprocessing facilities. The software architecture is specifically designed for distributed computing, collaborative design efforts, and modular construction to allow step improvements in functionality. Drag and drop wire-frame construction allows the user to select the desired components from a component warehouse, render the system for 3D visualization, and, linked to a set of physics libraries and/or computational codes, conduct process evaluations of the system they have designed. (authors)

  12. Simulation Enabled Safeguards Assessment Methodology

    International Nuclear Information System (INIS)

    Robert Bean; Trond Bjornard; Thomas Larson

    2007-01-01

    It is expected that nuclear energy will be a significant component of future supplies. New facilities, operating under a strengthened international nonproliferation regime will be needed. There is good reason to believe virtual engineering applied to the facility design, as well as to the safeguards system design will reduce total project cost and improve efficiency in the design cycle. Simulation Enabled Safeguards Assessment Methodology (SESAME) has been developed as a software package to provide this capability for nuclear reprocessing facilities. The software architecture is specifically designed for distributed computing, collaborative design efforts, and modular construction to allow step improvements in functionality. Drag and drop wireframe construction allows the user to select the desired components from a component warehouse, render the system for 3D visualization, and, linked to a set of physics libraries and/or computational codes, conduct process evaluations of the system they have designed

  13. Context-Enabled Business Intelligence

    Energy Technology Data Exchange (ETDEWEB)

    Troy Hiltbrand

    2012-04-01

    To truly understand context and apply it in business intelligence, it is vital to understand what context is and how it can be applied in addressing organizational needs. Context describes the facets of the environment that impact the way that end users interact with the system. Context includes aspects of location, chronology, access method, demographics, social influence/ relationships, end-user attitude/ emotional state, behavior/ past behavior, and presence. To be successful in making Business Intelligence content enabled, it is important to be able to capture the context of use user. With advances in technology, there are a number of ways in which this user based information can be gathered and exposed to enhance the overall end user experience.

  14. Uncertainty enabled Sensor Observation Services

    Science.gov (United States)

    Cornford, Dan; Williams, Matthew; Bastin, Lucy

    2010-05-01

    Almost all observations of reality are contaminated with errors, which introduce uncertainties into the actual observation result. Such uncertainty is often held to be a data quality issue, and quantification of this uncertainty is essential for the principled exploitation of the observations. Many existing systems treat data quality in a relatively ad-hoc manner, however if the observation uncertainty is a reliable estimate of the error on the observation with respect to reality then knowledge of this uncertainty enables optimal exploitation of the observations in further processes, or decision making. We would argue that the most natural formalism for expressing uncertainty is Bayesian probability theory. In this work we show how the Open Geospatial Consortium Sensor Observation Service can be implemented to enable the support of explicit uncertainty about observations. We show how the UncertML candidate standard is used to provide a rich and flexible representation of uncertainty in this context. We illustrate this on a data set of user contributed weather data where the INTAMAP interpolation Web Processing Service is used to help estimate the uncertainty on the observations of unknown quality, using observations with known uncertainty properties. We then go on to discuss the implications of uncertainty for a range of existing Open Geospatial Consortium standards including SWE common and Observations and Measurements. We discuss the difficult decisions in the design of the UncertML schema and its relation and usage within existing standards and show various options. We conclude with some indications of the likely future directions for UncertML in the context of Open Geospatial Consortium services.

  15. The high throughput virtual slit enables compact, inexpensive Raman spectral imagers

    Science.gov (United States)

    Gooding, Edward; Deutsch, Erik R.; Huehnerhoff, Joseph; Hajian, Arsen R.

    2018-02-01

    Raman spectral imaging is increasingly becoming the tool of choice for field-based applications such as threat, narcotics and hazmat detection; air, soil and water quality monitoring; and material ID. Conventional fiber-coupled point source Raman spectrometers effectively interrogate a small sample area and identify bulk samples via spectral library matching. However, these devices are very slow at mapping over macroscopic areas. In addition, the spatial averaging performed by instruments that collect binned spectra, particularly when used in combination with orbital raster scanning, tends to dilute the spectra of trace particles in a mixture. Our design, employing free space line illumination combined with area imaging, reveals both the spectral and spatial content of heterogeneous mixtures. This approach is well suited to applications such as detecting explosives and narcotics trace particle detection in fingerprints. The patented High Throughput Virtual Slit1 is an innovative optical design that enables compact, inexpensive handheld Raman spectral imagers. HTVS-based instruments achieve significantly higher spectral resolution than can be obtained with conventional designs of the same size. Alternatively, they can be used to build instruments with comparable resolution to large spectrometers, but substantially smaller size, weight and unit cost, all while maintaining high sensitivity. When used in combination with laser line imaging, this design eliminates sample photobleaching and unwanted photochemistry while greatly enhancing mapping speed, all with high selectivity and sensitivity. We will present spectral image data and discuss applications that are made possible by low cost HTVS-enabled instruments.

  16. The effect of the polymerization initiator and light source on the elution of residual Bis-GMA and TEGDMA monomers: A study using liquid chromatography with UV detection.

    Science.gov (United States)

    Denis, Aline B; Diagone, Cristina A; Plepis, Ana M G; Viana, Rommel B

    2015-12-05

    A method for the extraction and quantification of two residual monomers, bisphenol glycidyl dimethacrylate (Bis-GMA) and triethylene glycol dimethacrylate (TEGDMA), that were evaluated using high efficiency liquid chromatography with UV detection was developed and validated in this study. Three types of solvents were applied in the extraction of the monomers (methanol, ethanol and acetonitrile), where the highest extraction efficiency was obtained using acetonitrile. The different resins were prepared by photoactivation of Bis-GMA and TEGDMA monomers. Additionally, the effects of the addition of two photoinitiators (camphorquinone (CQ) and phenyl propanodione (PPD) and that of a co-initiator (N,N-dimethyl-p-toluidine) were also analyzed. When only the CQ photoinitiator was used, a smaller amount of residual monomers was obtained, whereas a larger amount was obtained with PPD. When the two photoinitiators were used in the same matrix, however, no significant changes were observed in relation to the amount of residual TEGDMA monomers. For the addition of the co-initiator, there were no large changes in the extraction of residual monomers. The effect of the two photoactivation sources (halogen lamp and LED) led to small differences in the elution of the two monomers, although all of the resins differed significantly when photoactivated with a LED. Quantum chemical calculations using Density Functional Theory were carried out to characterize several molecular properties of each monomer. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Accuracy of Combined Computed Tomography Colonography and Dual Energy Iiodine Map Imaging for Detecting Colorectal masses using High-pitch Dual-source CT.

    Science.gov (United States)

    Sun, Kai; Han, Ruijuan; Han, Yang; Shi, Xuesen; Hu, Jiang; Lu, Bin

    2018-02-28

    To evaluate the diagnostic accuracy of combined computed tomography colonography (CTC) and dual-energy iodine map imaging for detecting colorectal masses using high-pitch dual-source CT, compared with optical colonography (OC) and histopathologic findings. Twenty-eight consecutive patients were prospectively enrolled in this study. All patients were underwent contrast-enhanced CTC acquisition using dual-energy mode and OC and pathologic examination. The size of the space-occupied mass, the CT value after contrast enhancement, and the iodine value were measured and statistically compared. The sensitivity, specificity, accuracy rate, and positive predictive and negative predictive values of dual-energy contrast-enhanced CTC were calculated and compared between conventional CTC and dual-energy iodine images. The iodine value of stool was significantly lower than the colonic neoplasia (P dual-energy iodine maps imaging was 95.6% (95% CI = 77.9%-99.2%). The specificity of the two methods was 42.8% (95% CI = 15.4%-93.5%) and 100% (95% CI = 47.9%-100%; P = 0.02), respectively. Compared with optical colonography and histopathology, combined CTC and dual-energy iodine maps imaging can distinguish stool and colonic neoplasia, distinguish between benign and malignant tumors initially and improve the diagnostic accuracy of CTC for colorectal cancer screening.

  18. THE CHANDRA SOURCE CATALOG

    International Nuclear Information System (INIS)

    Evans, Ian N.; Primini, Francis A.; Glotfelty, Kenny J.; Anderson, Craig S.; Bonaventura, Nina R.; Chen, Judy C.; Doe, Stephen M.; Evans, Janet D.; Fabbiano, Giuseppina; Galle, Elizabeth C.; Gibbs, Danny G.; Grier, John D.; Hain, Roger M.; Harbo, Peter N.; He Xiangqun; Karovska, Margarita; Kashyap, Vinay L.; Davis, John E.; Houck, John C.; Hall, Diane M.

    2010-01-01

    The Chandra Source Catalog (CSC) is a general purpose virtual X-ray astrophysics facility that provides access to a carefully selected set of generally useful quantities for individual X-ray sources, and is designed to satisfy the needs of a broad-based group of scientists, including those who may be less familiar with astronomical data analysis in the X-ray regime. The first release of the CSC includes information about 94,676 distinct X-ray sources detected in a subset of public Advanced CCD Imaging Spectrometer imaging observations from roughly the first eight years of the Chandra mission. This release of the catalog includes point and compact sources with observed spatial extents ∼<30''. The catalog (1) provides access to the best estimates of the X-ray source properties for detected sources, with good scientific fidelity, and directly supports scientific analysis using the individual source data; (2) facilitates analysis of a wide range of statistical properties for classes of X-ray sources; and (3) provides efficient access to calibrated observational data and ancillary data products for individual X-ray sources, so that users can perform detailed further analysis using existing tools. The catalog includes real X-ray sources detected with flux estimates that are at least 3 times their estimated 1σ uncertainties in at least one energy band, while maintaining the number of spurious sources at a level of ∼<1 false source per field for a 100 ks observation. For each detected source, the CSC provides commonly tabulated quantities, including source position, extent, multi-band fluxes, hardness ratios, and variability statistics, derived from the observations in which the source is detected. In addition to these traditional catalog elements, for each X-ray source the CSC includes an extensive set of file-based data products that can be manipulated interactively, including source images, event lists, light curves, and spectra from each observation in which a

  19. The Chandra Source Catalog

    Science.gov (United States)

    Evans, Ian N.; Primini, Francis A.; Glotfelty, Kenny J.; Anderson, Craig S.; Bonaventura, Nina R.; Chen, Judy C.; Davis, John E.; Doe, Stephen M.; Evans, Janet D.; Fabbiano, Giuseppina; Galle, Elizabeth C.; Gibbs, Danny G., II; Grier, John D.; Hain, Roger M.; Hall, Diane M.; Harbo, Peter N.; He, Xiangqun Helen; Houck, John C.; Karovska, Margarita; Kashyap, Vinay L.; Lauer, Jennifer; McCollough, Michael L.; McDowell, Jonathan C.; Miller, Joseph B.; Mitschang, Arik W.; Morgan, Douglas L.; Mossman, Amy E.; Nichols, Joy S.; Nowak, Michael A.; Plummer, David A.; Refsdal, Brian L.; Rots, Arnold H.; Siemiginowska, Aneta; Sundheim, Beth A.; Tibbetts, Michael S.; Van Stone, David W.; Winkelman, Sherry L.; Zografou, Panagoula

    2010-07-01

    The Chandra Source Catalog (CSC) is a general purpose virtual X-ray astrophysics facility that provides access to a carefully selected set of generally useful quantities for individual X-ray sources, and is designed to satisfy the needs of a broad-based group of scientists, including those who may be less familiar with astronomical data analysis in the X-ray regime. The first release of the CSC includes information about 94,676 distinct X-ray sources detected in a subset of public Advanced CCD Imaging Spectrometer imaging observations from roughly the first eight years of the Chandra mission. This release of the catalog includes point and compact sources with observed spatial extents lsim30''. The catalog (1) provides access to the best estimates of the X-ray source properties for detected sources, with good scientific fidelity, and directly supports scientific analysis using the individual source data; (2) facilitates analysis of a wide range of statistical properties for classes of X-ray sources; and (3) provides efficient access to calibrated observational data and ancillary data products for individual X-ray sources, so that users can perform detailed further analysis using existing tools. The catalog includes real X-ray sources