Perbandingan Kecepatan Gabungan Algoritma Quick Sort dan Merge Sort dengan Insertion Sort, Bubble Sort dan Selection Sort

OpenAIRE

Al Rivan, Muhammad Ezar

2017-01-01

Ordering is one of the process done before doing data processing. The sorting algorithm has its own strengths and weaknesses. By taking strengths of each algorithm then combined can be a better algorithm. Quick Sort and Merge Sort are algorithms that divide the data into parts and each part divide again into sub-section until one element. Usually one element join with others and then sorted by. In this experiment data divide into parts that have size not more than threshold. This part then so...

Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

Science.gov (United States)

Nelson, Gregory M; Huffman, Holly; Smith, David F

2003-01-01

Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in Lactobacillus brevis.

Science.gov (United States)

Schurr, Benjamin C; Hahne, Hannes; Kuster, Bernhard; Behr, Jürgen; Vogel, Rudi F

2015-04-01

The main bittering component in beer, hop iso-α-acids, have been characterised as weak acids, which act as ionophores impairing microbial cells' function under acidic conditions as present in beer. Besides medium pH, divalent cations play a central role regarding the efficacy of the antimicrobial effect. The iso-α-acids' non-bitter derivatives humulinic acids can be found in isomerised hop extracts and can be generated during hop storage. Therefore, they have been under investigation concerning their influence on beer sensory properties. This study sketches the molecular mechanism behind iso-α-acids' antimicrobial activity in Lactobacillus (L.) brevis regarding their ionophore activity versus the dependence of the inhibitory potential on manganese binding, and suggests humulinic acids as novel tasteless food preservatives. We designed and synthesised chemically modified iso-α-acids to enhance the basic understanding of the molecular mechanism of antimicrobial iso-α-acids. It could be observed that a manganese-binding dependent transmembrane redox reaction (oxidative stress) plays a crucial role in inhibition. Privation of an acidic hydroxyl group neither erased ionophore activity, nor did it entirely abolish antimicrobial activity. Humulinic acids proved to be highly inhibitory, even outperforming iso-α-acids. Copyright © 2014 Elsevier Ltd. All rights reserved.

Electronic transport of molecular nanowires by considering of electron hopping energy between the second neighbors

Directory of Open Access Journals (Sweden)

H Rabani

2015-07-01

Full Text Available In this paper, we study the electronic conductance of molecular nanowires by considering the electron hopping between the first and second neighbors with the help Green’s function method at the tight-binding approach. We investigate three types of structures including linear uniform and periodic chains as well as poly(p-phenylene molecule which are embedded between two semi-infinite metallic leads. The results show that in the second neighbor approximation, the resonance, anti-resonance and Fano phenomena occur in the conductance spectra of these structures. Moreover, a new gap is observed at edge of the lead energy band wich its width depends on the value of the electron hopping energy between the second neighbors. In the systems including intrinsic gap, this hopping energy shifts the gap in the energy spectra.

Binar Sort: A Linear Generalized Sorting Algorithm

OpenAIRE

Gilreath, William F.

2008-01-01

Sorting is a common and ubiquitous activity for computers. It is not surprising that there exist a plethora of sorting algorithms. For all the sorting algorithms, it is an accepted performance limit that sorting algorithms are linearithmic or O(N lg N). The linearithmic lower bound in performance stems from the fact that the sorting algorithms use the ordering property of the data. The sorting algorithm uses comparison by the ordering property to arrange the data elements from an initial perm...

LazySorted: A Lazily, Partially Sorted Python List

Directory of Open Access Journals (Sweden)

Naftali Harris

2015-06-01

Full Text Available LazySorted is a Python C extension implementing a partially and lazily sorted list data structure. It solves a common problem faced by programmers, in which they need just part of a sorted list, like its middle element (the median, but sort the entire list to get it. LazySorted presents them with the abstraction that they are working with a fully sorted list, while actually only sorting the list partially with quicksort partitions to return the requested sub-elements. This enables programmers to use naive "sort first" algorithms but nonetheless attain linear run-times when possible. LazySorted may serve as a drop-in replacement for the built-in sorted function in most cases, and can sometimes achieve run-times more than 7 times faster.

Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

Science.gov (United States)

Kruse, Adam J.

2016-01-01

This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

Hopping transport in solids

CERN Document Server

Pollak, M

1991-01-01

The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

Supercritical fluid extraction of hops

Directory of Open Access Journals (Sweden)

ZORAN ZEKOVIC

2007-01-01

Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

Hrs and SNX3 functions in sorting and membrane invagination within multivesicular bodies.

Directory of Open Access Journals (Sweden)

Véronique Pons

2008-09-01

Full Text Available After internalization, ubiquitinated signaling receptors are delivered to early endosomes. There, they are sorted and incorporated into the intralumenal invaginations of nascent multivesicular bodies, which function as transport intermediates to late endosomes. Receptor sorting is achieved by Hrs--an adaptor--like protein that binds membrane PtdIns3P via a FYVE motif-and then by ESCRT complexes, which presumably also mediate the invagination process. Eventually, intralumenal vesicles are delivered to lysosomes, leading to the notion that EGF receptor sorting into multivesicular bodies mediates lysosomal targeting. Here, we report that Hrs is essential for lysosomal targeting but dispensable for multivesicular body biogenesis and transport to late endosomes. By contrast, we find that the PtdIns3P-binding protein SNX3 is required for multivesicular body formation, but not for EGF receptor degradation. PtdIns3P thus controls the complementary functions of Hrs and SNX3 in sorting and multivesicular body biogenesis.

RAZVOJ OBLAČIL V HIP HOP KULTURI

OpenAIRE

Marić, Sanja

2010-01-01

V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

SHOP: scaffold hopping by GRID-based similarity searches

DEFF Research Database (Denmark)

Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

2007-01-01

A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...... scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...

Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA

NARCIS (Netherlands)

Sakamoto, K; Margolles, A; van Veen, HW; Konings, WN

Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino

The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

Science.gov (United States)

Soderman, Johan

2013-01-01

Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

KAUST Repository

Zafar, Ammar

2013-05-21

We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

Variable range hopping in ZnO films

Science.gov (United States)

Ali, Nasir; Ghosh, Subhasis

2018-04-01

We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

Evaluation of Estrogenic Activity of Licorice Species in Comparison with Hops Used in Botanicals for Menopausal Symptoms

Science.gov (United States)

Hajirahimkhan, Atieh; Simmler, Charlotte; Yuan, Yang; Anderson, Jeffrey R.; Chen, Shao-Nong; Nikolić, Dejan; Dietz, Birgit M.; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

2013-01-01

The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus) and licorice (Glycyrrhiza spec.) to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata) in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE)-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of botanical

Evaluation of estrogenic activity of licorice species in comparison with hops used in botanicals for menopausal symptoms.

Directory of Open Access Journals (Sweden)

Atieh Hajirahimkhan

Full Text Available The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus and licorice (Glycyrrhiza spec. to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of

Sorting Out Sorts

OpenAIRE

Jonathan B. Berk

1998-01-01

In this paper we analyze the theoretical implications of sorting data into groups and then running asset pricing tests within each group. We show that the way this procedure is implemented introduces a severe bias in favor of rejecting the model under consideration. By simply picking enough groups to sort into even the true asset pricing model can be shown to have no explanatory power within each group.

Hall effect in hopping regime

International Nuclear Information System (INIS)

Avdonin, A.; Skupiński, P.; Grasza, K.

2016-01-01

A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

Hall effect in hopping regime

Energy Technology Data Exchange (ETDEWEB)

Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

2016-02-15

A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

Hops

Science.gov (United States)

... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...

Supercritical carbon dioxide hop extraction

Directory of Open Access Journals (Sweden)

Pfaf-Šovljanski Ivana I.

2005-01-01

Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

Directory of Open Access Journals (Sweden)

Yoko Kawaguchi-Ito

Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

Hip-Hop Education Resources

Science.gov (United States)

Hall, Marcella Runell

2009-01-01

Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

Variational study of the pair hopping model

International Nuclear Information System (INIS)

Fazekas, P.

1990-01-01

We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

Verification of counting sort and radix sort

NARCIS (Netherlands)

C.P.T. de Gouw (Stijn); F.S. de Boer (Frank); J.C. Rot (Jurriaan)

2016-01-01

textabstractSorting is an important algorithmic task used in many applications. Two main aspects of sorting algorithms which have been studied extensively are complexity and correctness. [Foley and Hoare, 1971] published the first formal correctness proof of a sorting algorithm (Quicksort). While

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

Directory of Open Access Journals (Sweden)

Haejoon Jung

2018-01-01

Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

Science.gov (United States)

Jung, Haejoon; Lee, In-Ho

2018-01-12

As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

Beer spoilage bacteria and hop resistance.

Science.gov (United States)

Sakamoto, Kanta; Konings, Wil N

2003-12-31

For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

Hip-Hop and the Academic Canon

Science.gov (United States)

Abe, Daudi

2009-01-01

Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Fundamentals of beer and hop chemistry

Directory of Open Access Journals (Sweden)

Denis De Keukeleire

2000-02-01

Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

Fascin- and α-Actinin-Bundled Networks Contain Intrinsic Structural Features that Drive Protein Sorting.

Science.gov (United States)

Winkelman, Jonathan D; Suarez, Cristian; Hocky, Glen M; Harker, Alyssa J; Morganthaler, Alisha N; Christensen, Jenna R; Voth, Gregory A; Bartles, James R; Kovar, David R

2016-10-24

Cells assemble and maintain functionally distinct actin cytoskeleton networks with various actin filament organizations and dynamics through the coordinated action of different sets of actin-binding proteins. The biochemical and functional properties of diverse actin-binding proteins, both alone and in combination, have been increasingly well studied. Conversely, how different sets of actin-binding proteins properly sort to distinct actin filament networks in the first place is not nearly as well understood. Actin-binding protein sorting is critical for the self-organization of diverse dynamic actin cytoskeleton networks within a common cytoplasm. Using in vitro reconstitution techniques including biomimetic assays and single-molecule multi-color total internal reflection fluorescence microscopy, we discovered that sorting of the prominent actin-bundling proteins fascin and α-actinin to distinct networks is an intrinsic behavior, free of complicated cellular signaling cascades. When mixed, fascin and α-actinin mutually exclude each other by promoting their own recruitment and inhibiting recruitment of the other, resulting in the formation of distinct fascin- or α-actinin-bundled domains. Subdiffraction-resolution light microscopy and negative-staining electron microscopy revealed that fascin domains are densely packed, whereas α-actinin domains consist of widely spaced parallel actin filaments. Importantly, other actin-binding proteins such as fimbrin and espin show high specificity between these two bundle types within the same reaction. Here we directly observe that fascin and α-actinin intrinsically segregate to discrete bundled domains that are specifically recognized by other actin-binding proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

Pertunjukan Teater Karo Hip Hop Kontemporer KAI

Directory of Open Access Journals (Sweden)

Silvia Anggreni Purba

2013-11-01

Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

Hip-hop and urban studies

NARCIS (Netherlands)

Jaffe, R.

2014-01-01

How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

Directory of Open Access Journals (Sweden)

Nining W. Kusnanik

2015-05-01

Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

Perbandingan Bubble Sort dengan Insertion Sort pada Bahasa Pemrograman C dan Fortran

OpenAIRE

Reina, Reina; Gautama, Josef Bernadi

2013-01-01

Sorting is a basic algorithm studied by students of computer science major. Sorting algorithm is the basis of other algorithms such as searching algorithm, pattern matching algorithm. Bubble sort is a popular basic sorting algorithm due to its easiness to be implemented. Besides bubble sort, there is insertion sort. It is lesspopular than bubble sort because it has more difficult algorithm. This paper discusses about process time between insertion sort and bubble sort with two kinds of data. ...

EGFRvIII escapes down-regulation due to impaired internalization and sorting to lysosomes

DEFF Research Database (Denmark)

Grandal, Michael V; Zandi, Roza; Pedersen, Mikkel W

2007-01-01

. Moreover, internalized EGFRvIII is recycled rather than delivered to lysosomes. EGFRvIII binds the ubiquitin ligase c-Cbl via Grb2, whereas binding via phosphorylated tyrosine residue 1045 seems to be limited. Despite c-Cbl binding, the receptor fails to become effectively ubiquitinylated. Thus, our...... results suggest that the long lifetime of EGFRvIII is caused by inefficient internalization and impaired sorting to lysosomes due to lack of effective ubiquitinylation....

Perbandingan Bubble Sort dengan Insertion Sort pada Bahasa Pemrograman C dan Fortran

Directory of Open Access Journals (Sweden)

Reina Reina

2013-12-01

Full Text Available Sorting is a basic algorithm studied by students of computer science major. Sorting algorithm is the basis of other algorithms such as searching algorithm, pattern matching algorithm. Bubble sort is a popular basic sorting algorithm due to its easiness to be implemented. Besides bubble sort, there is insertion sort. It is lesspopular than bubble sort because it has more difficult algorithm. This paper discusses about process time between insertion sort and bubble sort with two kinds of data. First is randomized data, and the second is data of descending list. Comparison of process time has been done in two kinds of programming language that is C programming language and FORTRAN programming language. The result shows that bubble sort needs more time than insertion sort does.

Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

OpenAIRE

Yanuar, Sandy

2014-01-01

Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

Electronic and vibrational hopping transport in boron carbides

International Nuclear Information System (INIS)

Emin, D.

1991-01-01

General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

Science.gov (United States)

Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

2014-01-01

The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

Science.gov (United States)

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

Science.gov (United States)

Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

2007-01-01

Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

Revolutionizing Environmental Education through Indigenous Hip Hop Culture

Science.gov (United States)

Gorlewski, Julie; Porfilio, Brad J.

2012-01-01

Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

Performance analysis of multi-hop wireless packet networks

Directory of Open Access Journals (Sweden)

Lim J.-T.

1997-01-01

Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

Design and realization of sort manipulator of crystal-angle sort machine

Science.gov (United States)

Wang, Ming-shun; Chen, Shu-ping; Guan, Shou-ping; Zhang, Yao-wei

2005-12-01

It is a current tendency of development in automation technology to replace manpower with manipulators in working places where dangerous, harmful, heavy or repetitive work is involved. The sort manipulator is installed in a crystal-angle sort machine to take the place of manpower, and engaged in unloading and sorting work. It is the outcome of combing together mechanism, electric transmission, and pneumatic element and micro-controller control. The step motor makes the sort manipulator operate precisely. The pneumatic elements make the sort manipulator be cleverer. Micro-controller's software bestows some simple artificial intelligence on the sort manipulator, so that it can precisely repeat its unloading and sorting work. The combination of manipulator's zero position and step motor counting control puts an end to accumulating error in long time operation. A sort manipulator's design in the practice engineering has been proved to be correct and reliable.

Communication: Fully coherent quantum state hopping

Energy Technology Data Exchange (ETDEWEB)

Martens, Craig C., E-mail: cmartens@uci.edu [University of California, Irvine, California 92697-2025 (United States)

2015-10-14

In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

Wireless Multi Hop Access Networks and Protocols

OpenAIRE

Nilsson Plymoth, Anders

2007-01-01

As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

Science.gov (United States)

Horton, Akesha Monique

2013-01-01

Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

Science.gov (United States)

Moktan, Hem; Pezza, Roberto; Zhou, Donghua

2015-03-01

The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

Directory of Open Access Journals (Sweden)

María Pilar Castañeda-Ojeda

2017-05-01

Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

Science.gov (United States)

Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

2017-01-01

The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

Particle hopping vs. fluid-dynamical models for traffic flow

Energy Technology Data Exchange (ETDEWEB)

Nagel, K.

1995-12-31

Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

Hip-hop as a resource for understanding the urban context

Science.gov (United States)

Brown, Bryan

2010-06-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

Parallel sorting algorithms

CERN Document Server

Akl, Selim G

1985-01-01

Parallel Sorting Algorithms explains how to use parallel algorithms to sort a sequence of items on a variety of parallel computers. The book reviews the sorting problem, the parallel models of computation, parallel algorithms, and the lower bounds on the parallel sorting problems. The text also presents twenty different algorithms, such as linear arrays, mesh-connected computers, cube-connected computers. Another example where algorithm can be applied is on the shared-memory SIMD (single instruction stream multiple data stream) computers in which the whole sequence to be sorted can fit in the

High-Speed On-Board Data Processing for Science Instruments: HOPS

Science.gov (United States)

Beyon, Jeffrey

2015-01-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

Research on synchronization technology of frequency hopping communication system

Science.gov (United States)

Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

2018-05-01

Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

Scaffold hopping in drug discovery using inductive logic programming.

Science.gov (United States)

Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

2008-05-01

In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

Extreme Kinematics in Selected Hip Hop Dance Sequences.

Science.gov (United States)

Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

2015-09-01

Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

Hopping models for ion conduction in noncrystals

DEFF Research Database (Denmark)

Dyre, Jeppe; Schrøder, Thomas

2007-01-01

semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

How Does a Hopping Kangaroo Breathe?

Science.gov (United States)

Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

2010-01-01

We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

Science.gov (United States)

Woods, J L; Gent, D H

2014-04-01

The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

Science.gov (United States)

Dolberry, Maurice E.

Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

Hip-Hopping across China: Intercultural Formulations of Local Identities

Science.gov (United States)

Barrett, Catrice

2012-01-01

The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

Characterization of hop pectins shows the presence of an arabinogalactan-protein

NARCIS (Netherlands)

Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

2002-01-01

Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

Hopping Conductivity Enhanced by Microwave Radiation

International Nuclear Information System (INIS)

Ovadyahu, Z

2012-01-01

Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

What is a Sorting Function?

DEFF Research Database (Denmark)

Henglein, Fritz

2009-01-01

What is a sorting function—not a sorting function for a given ordering relation, but a sorting function with nothing given? Formulating four basic properties of sorting algorithms as defining requirements, we arrive at intrinsic notions of sorting and stable sorting: A function is a sorting...... are derivable without compromising data abstraction. Finally we point out that stable sorting functions as default representations of ordering relations have the advantage of permitting linear-time sorting algorithms; inequality tests forfeit this possibility....... function if and only it is an intrinsically parametric permutation function. It is a stable sorting function if and only if it is an intrinsically stable permutation function. We show that ordering relations can be represented isomorphically as inequality tests, comparators and stable sorting functions...

Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

Directory of Open Access Journals (Sweden)

Xiaowei Wang

2017-10-01

Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

Signaling induced by hop/STI-1 depends on endocytosis

International Nuclear Information System (INIS)

Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

2007-01-01

The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

Science.gov (United States)

Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

2008-01-01

Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

Science.gov (United States)

Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

2007-01-01

The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

Science.gov (United States)

Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

2009-05-01

The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

Toward Hip-Hop Pedagogies for Music Education

Science.gov (United States)

Kruse, Adam J.

2016-01-01

Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

Framing and Reviewing Hip-Hop Educational Research

Science.gov (United States)

Petchauer, Emery

2009-01-01

Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

Hip-Hop Guayaquil: culturas viajeras e identidades locales

Directory of Open Access Journals (Sweden)

1999-01-01

Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

Low Power Multi-Hop Networking Analysis in Intelligent Environments.

Science.gov (United States)

Etxaniz, Josu; Aranguren, Gerardo

2017-05-19

Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

Vortex variable range hopping in a conventional superconducting film

Science.gov (United States)

Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

2017-12-01

The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

Collective probabilities algorithm for surface hopping calculations

International Nuclear Information System (INIS)

Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

2003-01-01

General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

Sex-sorting sperm using flow cytometry/cell sorting.

Science.gov (United States)

Garner, Duane L; Evans, K Michael; Seidel, George E

2013-01-01

The sex of mammalian offspring can be predetermined by flow sorting relatively pure living populations of X- and Y-chromosome-bearing sperm. This method is based on precise staining of the DNA of sperm with the nucleic acid-specific fluorophore, Hoechst 33342, to differentiate between the subpopulations of X- and Y-sperm. The fluorescently stained sperm are then sex-sorted using a specialized high speed sorter, MoFlo(®) SX XDP, and collected into biologically supportive media prior to reconcentration and cryopreservation in numbers adequate for use with artificial insemination for some species or for in vitro fertilization. Sperm sorting can provide subpopulations of X- or Y-bearing bovine sperm at rates in the 8,000 sperm/s range while maintaining; a purity of 90% such that it has been applied to cattle on a commercial basis. The sex of offspring has been predetermined in a wide variety of mammalian species including cattle, swine, horses, sheep, goats, dogs, cats, deer, elk, dolphins, water buffalo as well as in humans using flow cytometric sorting of X- and Y-sperm.

Direct current hopping conductance in one-dimensional diagonal disordered systems

Institute of Scientific and Technical Information of China (English)

Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Xiao Jian-Rong

2006-01-01

Based on a tight-binding disordered model describing a single electron band, we establish a direct current (dc) electronic hopping transport conductance model of one-dimensional diagonal disordered systems, and also derive a dc conductance formula. By calculating the dc conductivity, the relationships between electric field and conductivity and between temperature and conductivity are analysed, and the role played by the degree of disorder in electronic transport is studied. The results indicate the conductivity of systems decreasing with the increase of the degree of disorder, characteristics of negative differential dependence of resistance on temperature at low temperatures in diagonal disordered systems, and the conductivity of systems decreasing with the increase of electric field, featuring the non-Ohm's law conductivity.

Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

Science.gov (United States)

Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

2012-01-01

Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

Mic Power? Connections and the hip hop nation in Kampala, Uganda

DEFF Research Database (Denmark)

Schneidermann, Nanna

2014-01-01

Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...... is less of an alternative public sphere and more a way of articulating and contextualizing the world in a specific locality, which produces connections and opportunities in the young rappers’ lives....

The Hip-Hop club scene: Gender, grinding and sex.

Science.gov (United States)

Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

2007-01-01

Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

Ready, steady, SORT!

CERN Document Server

Laëtitia Pedroso

2010-01-01

The selective or ecological sorting of waste is already second nature to many of us and concerns us all. As the GS Department's new awareness-raising campaign reminds us, everything we do to sort waste contributes to preserving the environment.    Placemats printed on recycled paper using vegetable-based ink will soon be distributed in Restaurant No.1.   Environmental protection is never far from the headlines, and CERN has a responsibility to ensure that the 3000 tonnes and more of waste it produces every year are correctly and selectively sorted. Materials can be given a second life through recycling and re-use, thereby avoiding pollution from landfill sites and incineration plants and saving on processing costs. The GS Department is launching a new poster campaign designed to raise awareness of the importance of waste sorting and recycling. "After conducting a survey to find out whether members of the personnel were prepared to make an effort to sort a...

Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

OpenAIRE

POSPÍŠIL, Jan

2008-01-01

This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

The content of vitamine E in hop cones of the Saaz variety

Directory of Open Access Journals (Sweden)

Helena Pluháčková

2013-01-01

Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

Axon-Axon Interactions Regulate Topographic Optic Tract Sorting via CYFIP2-Dependent WAVE Complex Function.

Science.gov (United States)

Cioni, Jean-Michel; Wong, Hovy Ho-Wai; Bressan, Dario; Kodama, Lay; Harris, William A; Holt, Christine E

2018-03-07

The axons of retinal ganglion cells (RGCs) are topographically sorted before they arrive at the optic tectum. This pre-target sorting, typical of axon tracts throughout the brain, is poorly understood. Here, we show that cytoplasmic FMR1-interacting proteins (CYFIPs) fulfill non-redundant functions in RGCs, with CYFIP1 mediating axon growth and CYFIP2 specifically involved in axon sorting. We find that CYFIP2 mediates homotypic and heterotypic contact-triggered fasciculation and repulsion responses between dorsal and ventral axons. CYFIP2 associates with transporting ribonucleoprotein particles in axons and regulates translation. Axon-axon contact stimulates CYFIP2 to move into growth cones where it joins the actin nucleating WAVE regulatory complex (WRC) in the periphery and regulates actin remodeling and filopodial dynamics. CYFIP2's function in axon sorting is mediated by its binding to the WRC but not its translational regulation. Together, these findings uncover CYFIP2 as a key regulatory link between axon-axon interactions, filopodial dynamics, and optic tract sorting. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Romani Music - Roma and the Hip-hop Culture

OpenAIRE

Dočkal, Tomáš

2007-01-01

This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

Being Hip-Hop: Beyond Skills and Songs

Science.gov (United States)

Kruse, Adam J.

2016-01-01

In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

Injury incidence in hip hop dance.

Science.gov (United States)

Ojofeitimi, S; Bronner, S; Woo, H

2012-06-01

Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

Sequence analyses reveal that a TPR–DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR–DP domains and prokaryotic GerD proteins

Science.gov (United States)

Papandreou, Nikolaos; Chomilier, Jacques

2008-01-01

The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR–DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR–DP domains. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0083-8) contains supplementary material, which is available to authorized users. PMID:18987995

Basin Hopping Graph

DEFF Research Database (Denmark)

Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

2014-01-01

of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

Directory of Open Access Journals (Sweden)

Chen Ying

2016-10-01

Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

Science.gov (United States)

Buchanan, Ian P.

2013-01-01

Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

Sorting by the cytoplasmic domain of the amyloid precursor protein binding receptor SorLA

DEFF Research Database (Denmark)

Nielsen, Morten S; Gustafsen, Camilla; Madsen, Peder

2007-01-01

-formation with the amyloid precursor protein it downregulates generation of Alzheimer's disease-associated Abeta-peptide. The receptor is mainly located in vesicles, suggesting a function in protein sorting and transport. Here we examined SorLA's trafficking using full-length and chimeric receptors and find that its...

Sorting a distribution theory

CERN Document Server

Mahmoud, Hosam M

2011-01-01

A cutting-edge look at the emerging distributional theory of sorting Research on distributions associated with sorting algorithms has grown dramatically over the last few decades, spawning many exact and limiting distributions of complexity measures for many sorting algorithms. Yet much of this information has been scattered in disparate and highly specialized sources throughout the literature. In Sorting: A Distribution Theory, leading authority Hosam Mahmoud compiles, consolidates, and clarifies the large volume of available research, providing a much-needed, comprehensive treatment of the

The Pch2 AAA+ ATPase promotes phosphorylation of the Hop1 meiotic checkpoint adaptor in response to synaptonemal complex defects.

Science.gov (United States)

Herruzo, Esther; Ontoso, David; González-Arranz, Sara; Cavero, Santiago; Lechuga, Ana; San-Segundo, Pedro A

2016-09-19

Meiotic cells possess surveillance mechanisms that monitor critical events such as recombination and chromosome synapsis. Meiotic defects resulting from the absence of the synaptonemal complex component Zip1 activate a meiosis-specific checkpoint network resulting in delayed or arrested meiotic progression. Pch2 is an evolutionarily conserved AAA+ ATPase required for the checkpoint-induced meiotic block in the zip1 mutant, where Pch2 is only detectable at the ribosomal DNA array (nucleolus). We describe here that high levels of the Hop1 protein, a checkpoint adaptor that localizes to chromosome axes, suppress the checkpoint defect of a zip1 pch2 mutant restoring Mek1 activity and meiotic cell cycle delay. We demonstrate that the critical role of Pch2 in this synapsis checkpoint is to sustain Mec1-dependent phosphorylation of Hop1 at threonine 318. We also show that the ATPase activity of Pch2 is essential for its checkpoint function and that ATP binding to Pch2 is required for its localization. Previous work has shown that Pch2 negatively regulates Hop1 chromosome abundance during unchallenged meiosis. Based on our results, we propose that, under checkpoint-inducing conditions, Pch2 also possesses a positive action on Hop1 promoting its phosphorylation and its proper distribution on unsynapsed chromosome axes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Energy management that generates terrain following versus apex-preserving hopping in man and machine.

Science.gov (United States)

Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

2012-01-01

While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

Science.gov (United States)

Tobias, Evan S.

2014-01-01

Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

Hip Hop Dance Experience Linked to Sociocognitive Ability.

Science.gov (United States)

Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

2017-01-01

Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

Hip Hop Dance Experience Linked to Sociocognitive Ability.

Directory of Open Access Journals (Sweden)

Justin W Bonny

Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

Directory of Open Access Journals (Sweden)

Steven Netcoh

2013-10-01

Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

Science.gov (United States)

Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

2018-04-01

Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p hop (417 ± 106 vs 519 ± 102% limb length, p hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the

Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

Science.gov (United States)

Adjapong, Edmund S.; Emdin, Christopher

2015-01-01

A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

Science.gov (United States)

Reeb-Whitaker, Carolyn K; Bonauto, David K

2014-11-01

There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

Science.gov (United States)

Lindsey, Treva B.

2015-01-01

This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

Hopping conductivity via deep impurity states in InP

International Nuclear Information System (INIS)

Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.

1984-01-01

Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

Framing Hip Hop: New Methodologies for New Times

Science.gov (United States)

Dimitriadis, Greg

2015-01-01

This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

Science.gov (United States)

Brown, Bryan

2010-01-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

Connectivity model for Inter-working multi-hop wireless networks

CSIR Research Space (South Africa)

Salami, O

2009-08-01

Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability of radio links and communication routes. This paper presents an analytical study of the link and route availability in inter-working multi-hop wireless networks....

Wage Sorting Trends

DEFF Research Database (Denmark)

Bagger, Jesper; Vejlin, Rune Majlund; Sørensen, Kenneth Lykke

Using a population-wide Danish Matched Employer-Employee panel from 1980-2006, we document a strong trend towards more positive assortative wage sorting. The correlation between worker and firm fixed effects estimated from a log wage regression increases from -0.07 in 1981 to .14 in 2001. The non......Using a population-wide Danish Matched Employer-Employee panel from 1980-2006, we document a strong trend towards more positive assortative wage sorting. The correlation between worker and firm fixed effects estimated from a log wage regression increases from -0.07 in 1981 to .14 in 2001....... The nonstationary wage sorting pattern is not due to compositional changes in the labor market, primarily occurs among high wage workers, and comprises 41 percent of the increase in the standard deviation of log real wages between 1980 and 2006. We show that the wage sorting trend is associated with worker...

Flow sorting in aquatic ecology

Directory of Open Access Journals (Sweden)

Marcus Reckermann

2000-06-01

Full Text Available Flow sorting can be a very helpful tool in revealing phytoplankton and bacterial community structure and elaborating specific physiological parameters of isolated species. Droplet sorting has been the most common technique. Despite the high optical and hydro-dynamic stress for the cells to be sorted, many species grow in culture subsequent to sorting. To date, flow sorting has been applied to post-incubation separation in natural water samples to account for group-specific physiological parameters (radiotracer-uptake rates, to the production of clonal or non-clonal cultures from mixtures, to the isolaton of cell groups from natural assemblages for molecular analyses, and for taxonomic identification of sorted cells by microscopy. The application of cell sorting from natural water samples from the Wadden Sea, including different cryptophytes, cyanobacteria and diatoms, is shown, as well as the establishment of laboratory cultures from field samples. The optional use of a red laser to account for phycocyanine-rich cells is also discussed.

Electrolytic conductivity-the hopping mechanism of the proton and beyond

International Nuclear Information System (INIS)

Gileadi, E.; Kirowa-Eisner, E.

2006-01-01

The hopping mechanism of electrolytic conductivity is analyzed, employing mixtures of two solvents: one that sustains the hopping mechanism and the other that does not inhibit it directly, but interferes with it by diluting the solvent that sustains hopping. Measurement of the equivalent conductivity shows that the excess proton conductivities of H 3 O + and OH - increases with increasing temperature, although the number of hydrogen bonds is known to decrease. In mixtures of acetonitrile with water, proton hopping does not start until a threshold concentration of about 20 vol.% water has been reached, while no such threshold concentration is observed upon addition of methanol to acetonitrile. It is concluded that in the former the proton is transferred to a cluster of water molecules, which can be formed only if there is enough water in the solvent mixture. This observation leads to the concept of mono-water, which is the state of water molecules when they constitute a small minority in the solvent mixtures, as opposed to bulk water, which consists of clusters of variable sizes. Systems in which a hopping mechanism of heavy ions has been observed include Br - /Br 2 and I - /I 2 . In these cases the triple ions Br 3 - and I 3 - , respectively are formed, and serve as the mediators for the transfer of the simple halogen ion. A very large increase of conductivity was observed upon solidification of the Br - /Br 3 - system, probably caused by favorable linear alignment of ions in the solid. The conductivity of acidified methanol decreases upon addition of water, because the affinity of the proton to water is higher than to methanol, thus water can act as a scavenger for protons. This behavior exemplifies a general observation, namely that conductivity by hopping can only occur when the Gibbs energy of the system does not change significantly following ion transfer; otherwise the ions would be trapped in the more stable state, hindering further propagation by hopping

Electron hopping through proteins

Czech Academy of Sciences Publication Activity Database

Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

2012-01-01

Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

Ore sorting

International Nuclear Information System (INIS)

Hawkins, A.P.; Richards, A.W.

1982-01-01

In an ore sorting apparatus, ore particles are bombarded with neutrons in a chamber and sorted by detecting radiation emitted by isotopes of elements, such as gold, forming or contained in the particles, using detectors and selectively controlling fluid jets. The isotopes can be selectively recognised by their radiation characteristics. In an alternative embodiment, shorter life isotopes are formed by neutron bombardment and detection of radiation takes place immediately adjacent the region of bombardment

External parallel sorting with multiprocessor computers

International Nuclear Information System (INIS)

Comanceau, S.I.

1984-01-01

This article describes methods of external sorting in which the entire main computer memory is used for the internal sorting of entries, forming out of them sorted segments of the greatest possible size, and outputting them to external memories. The obtained segments are merged into larger segments until all entries form one ordered segment. The described methods are suitable for sequential files stored on magnetic tape. The needs of the sorting algorithm can be met by using the relatively slow peripheral storage devices (e.g., tapes, disks, drums). The efficiency of the external sorting methods is determined by calculating the total sorting time as a function of the number of entries to be sorted and the number of parallel processors participating in the sorting process

Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

Directory of Open Access Journals (Sweden)

A. Lorenzana

2013-04-01

Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

Hop/STI1 modulates retinal proliferation and cell death independent of PrPC

International Nuclear Information System (INIS)

Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.; Linden, Rafael; Chiarini, Luciana B.

2007-01-01

Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP C ). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP C dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 (α-STI1) blocked both ganglion cell and NBL cell death independent of PrP C . cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while α-STI1 increased proliferation in the developing retina, both independent of PrP C . We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP C

Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

Science.gov (United States)

Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

2015-03-01

The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation

Hopping models and ac universality

DEFF Research Database (Denmark)

Dyre, Jeppe; Schrøder, Thomas

2002-01-01

Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

Understanding Mott's law from scaling of variable-range-hopping currents and intrinsic current fluctuations

NARCIS (Netherlands)

Pasveer, W.F.; Michels, M.A.J.

2006-01-01

We have used the master equation to simulate variable-range hopping (VRH) of charges in a strongly disordered d-dimensional energy landscape (d=1,2,3). The current distribution over hopping distances and hopping energies gives a clear insight into the difference between hops that occur most

Climate, weather, and hops

Science.gov (United States)

As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

Bicaudal-D1 regulates the intracellular sorting and signalling of neurotrophin receptors.

Science.gov (United States)

Terenzio, Marco; Golding, Matthew; Russell, Matthew R G; Wicher, Krzysztof B; Rosewell, Ian; Spencer-Dene, Bradley; Ish-Horowicz, David; Schiavo, Giampietro

2014-07-17

We have identified a new function for the dynein adaptor Bicaudal D homolog 1 (BICD1) by screening a siRNA library for genes affecting the dynamics of neurotrophin receptor-containing endosomes in motor neurons (MNs). Depleting BICD1 increased the intracellular accumulation of brain-derived neurotrophic factor (BDNF)-activated TrkB and p75 neurotrophin receptor (p75(NTR)) by disrupting the endosomal sorting, reducing lysosomal degradation and increasing the co-localisation of these neurotrophin receptors with retromer-associated sorting nexin 1. The resulting re-routing of active receptors increased their recycling to the plasma membrane and altered the repertoire of signalling-competent TrkB isoforms and p75(NTR) available for ligand binding on the neuronal surface. This resulted in attenuated, but more sustained, AKT activation in response to BDNF stimulation. These data, together with our observation that Bicd1 expression is restricted to the developing nervous system when neurotrophin receptor expression peaks, indicate that BICD1 regulates neurotrophin signalling by modulating the endosomal sorting of internalised ligand-activated receptors. © 2014 The Authors.

High Order Differential Frequency Hopping: Design and Analysis

Directory of Open Access Journals (Sweden)

Yong Li

2015-01-01

Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

Hopping system control with an approximated dynamics model and upper-body motion

Energy Technology Data Exchange (ETDEWEB)

Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

2015-11-15

A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

Science.gov (United States)

Beachum, Floyd D.

2013-01-01

Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

Degradation of hop bitter acids by fungi

International Nuclear Information System (INIS)

Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

2008-01-01

Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of β-glucuronidase

International Nuclear Information System (INIS)

Watanabe, H.; Grubb, J.H.; Sly, W.S.

1990-01-01

The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human β-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3% of the total functional receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of β-glucuronidase. At pH 7.5, the rate of endocytosis was only 14% the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized β-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized β-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor

Crossover in tunneling hops in systems of strongly localized electrons

International Nuclear Information System (INIS)

Lien Nguyen, V.; Gamietea, A.D.

1995-11-01

Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

Science.gov (United States)

Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

2015-01-01

The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

Switched diversity strategies for dual-hop relaying systems

KAUST Repository

Gaaloul, Fakhreddine

2011-04-29

This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

Surface hopping simulation of vibrational predissociation of methanol dimer

Science.gov (United States)

Jiang, Ruomu; Sibert, Edwin L.

2012-06-01

The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

Effects of powdery mildew fungicide programs on twospotted spider mite (Acari: Tetranychidae), hop aphid (Hemiptera: Aphididae), and their natural enemies in hop yards.

Science.gov (United States)

Gent, D H; James, D G; Wright, L C; Brooks, D J; Barbour, J D; Dreves, A J; Fisher, G C; Walton, V M

2009-02-01

Twospotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Hemiptera: Aphididae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological control strategies for spider mites and hop aphid is the extensive use of fungicides for management of hop powdery mildew, Podosphaera macularis (Wallr.:Fr.) U. Braun & S. Takamatsu. Field studies conducted in experimental plots in Oregon and Washington in 2005 and 2006 quantified the effects of powdery mildew fungicide programs (i.e., sulfur, paraffinic oil, and synthetic fungicides) on arthropod pests and natural enemies on hop. Fungicide treatment significantly affected spider mite populations in all four studies. Multiple applications of sulfur fungicides applied before burr development resulted in 1.4-3.3-fold greater spider mite populations during summer. Near the cessation of the sulfur applications, or after a lag of 20-30 d, spider mite populations increased significantly faster on sulfur treated plants compared with water-treated plants in three of four experiments. The effect of paraffinic oil on spider mites was varied, leading to exacerbation of spider mites in Oregon and Washington in 2005, suppression of mites in Oregon in 2006, and no significant effect compared with water in Washington in 2006. Significant relative treatment effects for cone damage due to spider mite feeding were detected in Oregon in 2005 in plots treated with sulfur and paraffinic oil compared with water and synthetic fungicides. Mean populations of hop aphids were similar among treatments in Oregon, although sulfur treatment suppressed hop aphid populations in Washington in 2005 and 2006. Populations of individual predacious insect species and cumulative abundance of macropredators were not consistently suppressed or stimulated by treatments in all trials. However, predatory mite

Backoff-stage synchronization in three-hop string-topology wireless networks with hidden nodes

Science.gov (United States)

Sanada, Kosuke; Sekiya, Hiroo; Komuro, Nobuyoshi; Sakata, Shiro

In IEEE 802.11 wireless multi-hop networks, each node works individually and their individual operations generate entire network dynamics. It is important to clarify the network dynamics in wireless multi-hop networks for designing and constructing multi-hop communication networks. This paper presents the network-dynamics investigations for three-hop string-topology wireless network in detail. From the investigations, a “backoff-stage synchronization” phenomenon, which is mutuality between hidden nodes, is found. The mechanism of the backoff-stage synchronization is expressed and the sufficient conditions for the synchronization occurrence are given. This phenomenon gives some impacts on the IEEE 802.11 multi-hop-network communications.

Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

Science.gov (United States)

Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

Simple sorting algorithm test based on CUDA

OpenAIRE

Meng, Hongyu; Guo, Fangjin

2015-01-01

With the development of computing technology, CUDA has become a very important tool. In computer programming, sorting algorithm is widely used. There are many simple sorting algorithms such as enumeration sort, bubble sort and merge sort. In this paper, we test some simple sorting algorithm based on CUDA and draw some useful conclusions.

Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

National Research Council Canada - National Science Library

Roberts, Christopher

2003-01-01

.... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

Actin-Sorting Nexin 27 (SNX27)-Retromer Complex Mediates Rapid Parathyroid Hormone Receptor Recycling*

Science.gov (United States)

McGarvey, Jennifer C.; Xiao, Kunhong; Bowman, Shanna L.; Mamonova, Tatyana; Zhang, Qiangmin; Bisello, Alessandro; Sneddon, W. Bruce; Ardura, Juan A.; Jean-Alphonse, Frederic; Vilardaga, Jean-Pierre; Puthenveedu, Manojkumar A.; Friedman, Peter A.

2016-01-01

The G protein-coupled parathyroid hormone receptor (PTHR) regulates mineral-ion homeostasis and bone remodeling. Upon parathyroid hormone (PTH) stimulation, the PTHR internalizes into early endosomes and subsequently traffics to the retromer complex, a sorting platform on early endosomes that promotes recycling of surface receptors. The C terminus of the PTHR contains a type I PDZ ligand that binds PDZ domain-containing proteins. Mass spectrometry identified sorting nexin 27 (SNX27) in isolated endosomes as a PTHR binding partner. PTH treatment enriched endosomal PTHR. SNX27 contains a PDZ domain and serves as a cargo selector for the retromer complex. VPS26, VPS29, and VPS35 retromer subunits were isolated with PTHR in endosomes from cells stimulated with PTH. Molecular dynamics and protein binding studies establish that PTHR and SNX27 interactions depend on the PDZ recognition motif in PTHR and the PDZ domain of SNX27. Depletion of either SNX27 or VPS35 or actin depolymerization decreased the rate of PTHR recycling following agonist stimulation. Mutating the PDZ ligand of PTHR abolished the interaction with SNX27 but did not affect the overall rate of recycling, suggesting that PTHR may directly engage the retromer complex. Coimmunoprecipitation and overlay experiments show that both intact and mutated PTHR bind retromer through the VPS26 protomer and sequentially assemble a ternary complex with PTHR and SNX27. SNX27-independent recycling may involve N-ethylmaleimide-sensitive factor, which binds both PDZ intact and mutant PTHRs. We conclude that PTHR recycles rapidly through at least two pathways, one involving the ASRT complex of actin, SNX27, and retromer and another possibly involving N-ethylmaleimide-sensitive factor. PMID:27008860

A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

Science.gov (United States)

Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

2018-05-08

With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

Layers in sorting practices: Sorting out patients with potential cancer

DEFF Research Database (Denmark)

Møller, Naja Holten; Bjørn, Pernille

2011-01-01

for a particular patient. Due to the limited resources within the Danish healthcare system, initiating cancer pathways for all patients with a remote suspicion of cancer would crash the system, as it would be impossible for healthcare professionals to commit to the prescribed schedules and times defined...... they show that sorting patients before initiating a standardized cancer pathway is not a simple process of deciding on a predefined category that will stipulate particular dates and times. Instead, these informal sorting mechanisms show that the process of sorting patients prior to diagnosis......In the last couple of years, widespread use of standardized cancer pathways has been seen across a range of countries, including Denmark, to improve prognosis of cancer patients. In Denmark, standardized cancer pathways take the form of guidelines prescribing well-defined sequences where steps...

Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America

OpenAIRE

Villegas, Mark

2015-01-01

By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

"Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

Science.gov (United States)

Callahan, J. Sean; Grantham, Tarek C.

2012-01-01

One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

Science.gov (United States)

Broughton, Anthony

2017-01-01

Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

Science.gov (United States)

Petchauer, Emery

2015-01-01

One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

Hop powdery mildew control through alteration of spring pruning practices

Science.gov (United States)

Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

Hip-Hop, the "Obama Effect," and Urban Science Education

Science.gov (United States)

Emdin, Christopher; Lee, Okhee

2012-01-01

Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

Hip Hop as Empowerment: Voices in El Alto, Bolivia

Science.gov (United States)

Tarifa, Ariana

2012-01-01

In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

Joint Scheduling for Dual-Hop Block-Fading Broadcast Channels

KAUST Repository

Zafar, Ammar

2012-09-16

In this paper, we propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information and as a prerequisite we assume that the relay, which is half-duplex and operates using decode-and-forward, is capable of storing the received packets from the source until the channel condition of the destined user becomes good to be scheduled. We formulate the joint scheduling problem as maximizing the weighted sum of the long term achievable rates by the users under a stability constraint, which means that on the long term the rate received by the relay should equal the rate transmitted by it, in addition to constant or variable power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal priority weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum rate scheduler and the proportional fair scheduler. We demonstrate via numerical results that our proposed joint scheduling scheme enlarges the rate region as compared with a scheme that employs multi-user scheduling alone.

Chip-based droplet sorting

Energy Technology Data Exchange (ETDEWEB)

Beer, Neil Reginald; Lee, Abraham; Hatch, Andrew

2017-11-21

A non-contact system for sorting monodisperse water-in-oil emulsion droplets in a microfluidic device based on the droplet's contents and their interaction with an applied electromagnetic field or by identification and sorting.

Evaluation of airborne methyl salicylate for improved conservation biological control of two-spotted spider mite and hop aphid in Oregon hop yards.

Science.gov (United States)

Woods, J L; James, D G; Lee, J C; Gent, D H

2011-12-01

The use of synthetic herbivore-induced plant volatiles (HIPV) to attract natural enemies has received interest as a tool to enhance conservation biological control (CBC). Methyl salicylate (MeSA) is a HIPV that is attractive to several key predators of two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera: Aphididae). A 2-year study was conducted to evaluate the recommended commercial use of MeSA in hop yards in Oregon. Slow-release MeSA dispensers were stapled to supporting poles in 0.5 ha plots and these plots were compared to a paired non-treated plot on each of three farms in 2008 and 2009. Across both years, there was a trend for reduced (range 40-91%) mean seasonal numbers of T. urticae in five of the six MeSA-baited plots. Stethorus spp., key spider mite predators, tended to be more numerous in MeSA-baited plots compared to control plots on a given farm. Mean seasonal densities of hop aphid and other natural enemies (e.g., Orius spp. and Anystis spp.) were similar between MeSA-treated and control plots. Variability among farms in suppression of two-spotted spider mites and attraction of Stethorus spp. suggests that the use of MeSA to enhance CBC of spider mites in commercial hop yards may be influenced by site-specific factors related to the agroecology of individual farms or seasonal effects that require further investigation. The current study also suggests that CBC of hop aphid with MeSA in this environment may be unsatisfactory.

Linking the mechanics and energetics of hopping with elastic ankle exoskeletons.

Science.gov (United States)

Farris, Dominic James; Sawicki, Gregory S

2012-12-15

The springlike mechanics of the human leg during bouncing gaits has inspired the design of passive assistive devices that use springs to aid locomotion. The purpose of this study was to test whether a passive spring-loaded ankle exoskeleton could reduce the mechanical and energetic demands of bilateral hopping on the musculoskeletal system. Joint level kinematics and kinetics were collected with electromyographic and metabolic energy consumption data for seven participants hopping at four frequencies (2.2, 2.5, 2.8, and 3.2 Hz). Hopping was performed without an exoskeleton; with an springless exoskeleton; and with a spring-loaded exoskeleton. Spring-loaded ankle exoskeletons reduced plantar flexor muscle activity and the biological contribution to ankle joint moment (15-25%) and average positive power (20-40%). They also facilitated reductions in metabolic power (15-20%) across frequencies from 2.2 to 2.8 Hz compared with hopping with a springless exoskeleton. Reductions in metabolic power compared with hopping with no exoskeleton were restricted to hopping at 2.5 Hz only (12%). These results highlighted the importance of reducing the rate of muscular force production and work to achieve metabolic reductions. They also highlighted the importance of assisting muscles acting at the knee joint. Exoskeleton designs may need to be tuned to optimize exoskeleton mass, spring stiffness, and spring slack length to achieve greater metabolic reductions.

Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

Science.gov (United States)

Durham, Aisha S.

2009-01-01

The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

Science.gov (United States)

Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

2012-01-01

"Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

Algorithm Sorts Groups Of Data

Science.gov (United States)

Evans, J. D.

1987-01-01

For efficient sorting, algorithm finds set containing minimum or maximum most significant data. Sets of data sorted as desired. Sorting process simplified by reduction of each multielement set of data to single representative number. First, each set of data expressed as polynomial with suitably chosen base, using elements of set as coefficients. Most significant element placed in term containing largest exponent. Base selected by examining range in value of data elements. Resulting series summed to yield single representative number. Numbers easily sorted, and each such number converted back to original set of data by successive division. Program written in BASIC.

TRAM is involved in IL-18 signaling and functions as a sorting adaptor for MyD88.

Directory of Open Access Journals (Sweden)

Hidenori Ohnishi

Full Text Available MyD88, a Toll/interleukin-1 receptor homology (TIR domain-containing adaptor protein, mediates signals from the Toll-like receptors (TLR or IL-1/IL-18 receptors to downstream kinases. In MyD88-dependent TLR4 signaling, the function of MyD88 is enhanced by another TIR domain-containing adaptor, Mal/TIRAP, which brings MyD88 to the plasma membrane and promotes its interaction with the cytosolic region of TLR4. Hence, Mal is recognized as the "sorting adaptor" for MyD88. In this study, a direct interaction between MyD88-TIR and another membrane-sorting adaptor, TRAM/TICAM-2, was demonstrated in vitro. Cell-based assays including RNA interference experiments and TRAM deficient mice revealed that the interplay between MyD88 and TRAM in cells is important in mediating IL-18 signal transduction. Live cell imaging further demonstrated the co-localized accumulation of MyD88 and TRAM in the membrane regions in HEK293 cells. These findings suggest that TRAM serves as the sorting adaptor for MyD88 in IL-18 signaling, which then facilitates the signal transduction. The binding sites for TRAM are located in the TIR domain of MyD88 and actually overlap with the binding sites for Mal. MyD88, the multifunctional signaling adaptor that works together with most of the TLR members and with the IL-1/IL-18 receptors, can interact with two distinct sorting adaptors, TRAM and Mal, in a conserved manner in a distinct context.

Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping

Directory of Open Access Journals (Sweden)

Christian Schumacher

2017-11-01

Full Text Available In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB, velocity (VFB and force feedback (FFB pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort. Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map. The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency. Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length or environmental parameters (ground compliance. Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a

Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

Science.gov (United States)

Schumacher, Christian; Seyfarth, André

2017-01-01

In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific

The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

Science.gov (United States)

Harakeh, Zeena; Bogt, Tom F M Ter

2018-02-16

Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

Range and energetics of charge hopping in organic semiconductors

Science.gov (United States)

Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

2017-12-01

The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

Uudised : Ooper. Hip-hop. Madonna

Index Scriptorium Estoniae

2005-01-01

Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

Science.gov (United States)

Putnam, Michael

2006-01-01

This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

Membrane-bound ATPase contributes to hop resistance of Lactobacillus brevis

NARCIS (Netherlands)

Sakamoto, K; van Veen, HW; Saito, H; Kobayashi, H; Konings, WN

2002-01-01

The activity of the membrane-bound H+-ATPase of the beer spoilage bacterium Lactobacillus brevis ABBC45 increased upon adaptation to bacteriostatic hop compounds. The ATPase activity was optimal around pH 5.6 and increased up to fourfold when L. brevis was exposed to 666 muM hop compounds. The

Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank) (Hemiptera: Aphididae) and natural enemies on hops in Spain

Energy Technology Data Exchange (ETDEWEB)

Lorenzana, A.; Hermoso de Mendoza, A.; Seco, V.; Campelo, P.; Casquero, P.A.

2017-07-01

A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank) (Hemiptera: Aphididae) and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003) observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae), whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230) and adults (p=0.0245) in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004) where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

Within-field distribution of the damson-hop aphid Phorodon humuli (Schrank) (Hemiptera: Aphididae) and natural enemies on hops in Spain

International Nuclear Information System (INIS)

Lorenzana, A.; Hermoso de Mendoza, A.; Seco, V.; Campelo, P.; Casquero, P.A.

2017-01-01

A field trial was performed in a hop yard throughout 2002, 2003 and 2004 in order to determine the within-field distribution of Phorodon humuli (Schrank) (Hemiptera: Aphididae) and its natural enemies. The distribution of P. humuli was directly affected by the position of the hop plants in the garden, with significantly higher concentrations of aphids (p=0.0122 in 2002 and p=0.0006 in 2003) observed along the edge. However, in 2004 the plants located on the marginal plots had similar populations to those on the more inner plots. This can be explained by a higher wind speed which made it more difficult to land on edge plants first. The hop aphid’s main natural enemy was Coccinella septempunctata (Coleoptera: Coccinellidae), whose population was greatest where the aphids were most abundant with a significantly greater number of eggs (p=0.0230) and adults (p=0.0245) in 2003. Lacewing eggs were also frequently observed, with a significantly higher population (p=0.0221 in 2003 and p=0.0046 in 2004) where the aphid numbers were high. The number of winged aphids was greatest towards the margins of the garden in 2003. It is argued that the spatial distribution of the hop aphid and its natural enemies could be used to plan a sampling program and to estimate the population densities of these insects for use in integrated pest management programs.

ScanSort{sup SM} at Whiteshell Laboratories for sorting of experimental cesium pond soil

Energy Technology Data Exchange (ETDEWEB)

Downey, H., E-mail: heath.downey@amecfw.com [Amec Foster Wheeler, Portland, ME (United States)

2015-07-01

The ScanSort{sup SM} soil sorting system is a unique and efficient radiological instrument used for measuring and sorting bulk soils and volumetric materials. The system performs automatic radioassay and segregation of preconditioned material using a gamma spectroscopy system mounted above a conveyor belt. It was deployed to the Whiteshell Laboratories site to process the excavated soils generated during the decommissioning of the former Experimental Cesium Pond. The ScanSort{sup SM} system was utilized to segregate material with Cs-137 concentrations above the established site unrestricted release and restricted site reuse levels as well as demonstrated the ability to accurately determine the radioactivity concentrations of the radiologically-impacted material and to confidently segregate volumes of that material for appropriate final disposition. (author)

Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

Directory of Open Access Journals (Sweden)

Wang Xue-Wen

2016-01-01

Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

PhySortR: a fast, flexible tool for sorting phylogenetic trees in R.

Science.gov (United States)

Stephens, Timothy G; Bhattacharya, Debashish; Ragan, Mark A; Chan, Cheong Xin

2016-01-01

A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable.

Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

Science.gov (United States)

Emdin, Christopher

2010-01-01

The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

Sorting out Downside Beta

NARCIS (Netherlands)

G.T. Post (Thierry); P. van Vliet (Pim); S.D. Lansdorp (Simon)

2009-01-01

textabstractDownside risk, when properly defined and estimated, helps to explain the cross-section of US stock returns. Sorting stocks by a proper estimate of downside market beta leads to a substantially larger cross-sectional spread in average returns than sorting on regular market beta. This

Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

NARCIS (Netherlands)

van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

2015-01-01

Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

Science.gov (United States)

Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

2017-08-01

Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

Science.gov (United States)

Sulé, V. Thandi

2016-01-01

Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

Three Sorts of Naturalism

DEFF Research Database (Denmark)

Fink, Hans

2006-01-01

In "Two sorts of Naturalism" John McDowell is sketching his own sort of naturalism in ethics as an alternative to "bald naturalism". In this paper I distinguish materialist, idealist and absolute conceptions of nature and of naturalism in order to provide a framework for a clearer understanding...

Towards a Pedagogy of Hip Hop in Urban Teacher Education

Science.gov (United States)

Bridges, Thurman

2011-01-01

This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

Hip-Hop Pop Art

Science.gov (United States)

Talley, Clarence, Sr.

2011-01-01

Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

KAUST Repository

Farooq, Muhammad Junaid

2015-11-19

Carrier sense multiple access (CSMA) protocol is standardized for vehicular communication to ensure a distributed and efficient communication between vehicles. However, several vehicular applications require efficient multi-hop information dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per-hop packet forward progress, per-hop transmission success probability, and spatial frequency reuse (SFR) efficiency imposed by different packet forwarding schemes, namely, most forward with fixed radius (MFR), the nearest with forward progress (NFP), and the random with forward progress (RFP). We also define a new performance metric, denoted as the aggregate packet progress (APP), which is a dimensionless quantity that captures the aforementioned tradeoffs. To this end, the developed model reveals the interplay between the spectrum sensing threshold (th) of the CSMA protocol and the packet forwarding scheme. Our results show that, in contrary to ALOHA networks which always favor NFP, MFR may achieve the highest APP in CSMA networks if th is properly chosen.

Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

International Nuclear Information System (INIS)

Price, D E; Durling, R L

2005-01-01

The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

Science.gov (United States)

Hill, Marc Lamont

2009-01-01

For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

Hip-hop, Onegin - pop! / Tatjana Aleksandrova

Index Scriptorium Estoniae

Aleksandrova, Tatjana, 1945-

2004-01-01

Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

Mechanism of aldolase control of sorting nexin 9 function in endocytosis.

Science.gov (United States)

Rangarajan, Erumbi S; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina

2010-04-16

Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9.dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9.dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains the biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165-171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein.

Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis*

Science.gov (United States)

Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina

2010-01-01

Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9·dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9·dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains the biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165–171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein. PMID:20129922

Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis

Energy Technology Data Exchange (ETDEWEB)

Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina (Scripps); (Montreal)

2010-11-03

Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9-dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9-dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains the biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165-171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein.

Enhancement of Selection, Bubble and Insertion Sorting Algorithm

OpenAIRE

Muhammad Farooq Umar; Ehsan Ullah Munir; Shafqat Ali Shad; Muhammad Wasif Nisar

2014-01-01

In everyday life there is a large amount of data to arrange because sorting removes any ambiguities and make the data analysis and data processing very easy, efficient and provides with cost less effort. In this study a set of improved sorting algorithms are proposed which gives better performance and design idea. In this study five new sorting algorithms (Bi-directional Selection Sort, Bi-directional bubble sort, MIDBiDirectional Selection Sort, MIDBidirectional bubble sort and linear insert...

Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods

OpenAIRE

Torgals, Ann Elisabeth

2015-01-01

The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

Multi-hop localization algorithm based on grid-scanning for wireless sensor networks.

Science.gov (United States)

Wan, Jiangwen; Guo, Xiaolei; Yu, Ning; Wu, Yinfeng; Feng, Renjian

2011-01-01

For large-scale wireless sensor networks (WSNs) with a minority of anchor nodes, multi-hop localization is a popular scheme for determining the geographical positions of the normal nodes. However, in practice existing multi-hop localization methods suffer from various kinds of problems, such as poor adaptability to irregular topology, high computational complexity, low positioning accuracy, etc. To address these issues in this paper, we propose a novel Multi-hop Localization algorithm based on Grid-Scanning (MLGS). First, the factors that influence the multi-hop distance estimation are studied and a more realistic multi-hop localization model is constructed. Then, the feasible regions of the normal nodes are determined according to the intersection of bounding square rings. Finally, a verifiably good approximation scheme based on grid-scanning is developed to estimate the coordinates of the normal nodes. Additionally, the positioning accuracy of the normal nodes can be improved through neighbors' collaboration. Extensive simulations are performed in isotropic and anisotropic networks. The comparisons with some typical algorithms of node localization confirm the effectiveness and efficiency of our algorithm.

Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

Science.gov (United States)

Neiens, Silva D; Steinhaus, Martin

2018-02-14

The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

Science.gov (United States)

Hartmann, Richard; Strunz, Walter T

2017-12-12

We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

Christian Hip Hop as Pedagogy: A South African Case Study

Science.gov (United States)

Abraham, Ibrahim

2015-01-01

Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

Sorting waves and associated eigenvalues

Science.gov (United States)

Carbonari, Costanza; Colombini, Marco; Solari, Luca

2017-04-01

The presence of mixed sediment always characterizes gravel bed rivers. Sorting processes take place during bed load transport of heterogeneous sediment mixtures. The two main elements necessary to the occurrence of sorting are the heterogeneous character of sediments and the presence of an active sediment transport. When these two key ingredients are simultaneously present, the segregation of bed material is consistently detected both in the field [7] and in laboratory [3] observations. In heterogeneous sediment transport, bed altimetric variations and sorting always coexist and both mechanisms are independently capable of driving the formation of morphological patterns. Indeed, consistent patterns of longitudinal and transverse sorting are identified almost ubiquitously. In some cases, such as bar formation [2] and channel bends [5], sorting acts as a stabilizing effect and therefore the dominant mechanism driving pattern formation is associated with bed altimetric variations. In other cases, such as longitudinal streaks, sorting enhances system instability and can therefore be considered the prevailing mechanism. Bedload sheets, first observed by Khunle and Southard [1], represent another classic example of a morphological pattern essentially triggered by sorting, as theoretical [4] and experimental [3] results suggested. These sorting waves cause strong spatial and temporal fluctuations of bedload transport rate typical observed in gravel bed rivers. The problem of bed load transport of a sediment mixture is formulated in the framework of a 1D linear stability analysis. The base state consists of a uniform flow in an infinitely wide channel with active bed load transport. The behaviour of the eigenvalues associated with fluid motion, bed evolution and sorting processes in the space of the significant flow and sediment parameters is analysed. A comparison is attempted with the results of the theoretical analysis of Seminara Colombini and Parker [4] and Stecca

Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth

Science.gov (United States)

Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...

Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

Science.gov (United States)

Wu, Yahui; Deng, Su; Huang, Hongbin

2013-07-01

Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

International Nuclear Information System (INIS)

Wu, Yahui; Deng, Su; Huang, Hongbin

2013-01-01

Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

Ligand recognition and domain structure of Vps10p, a vacuolar protein sorting receptor in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Jørgensen, M U; Emr, S D; Winther, Jakob R.

1999-01-01

Vp10p is a receptor that sorts several different vacuolar proteins by cycling between a late Golgi compartment and the endosome. The cytoplasmic tail of Vps10p is necessary for the recycling, whereas the lumenal domain is predicted to interact with the soluble ligands. We have studied ligand bind...

CellSort: a support vector machine tool for optimizing fluorescence-activated cell sorting and reducing experimental effort.

Science.gov (United States)

Yu, Jessica S; Pertusi, Dante A; Adeniran, Adebola V; Tyo, Keith E J

2017-03-15

High throughput screening by fluorescence activated cell sorting (FACS) is a common task in protein engineering and directed evolution. It can also be a rate-limiting step if high false positive or negative rates necessitate multiple rounds of enrichment. Current FACS software requires the user to define sorting gates by intuition and is practically limited to two dimensions. In cases when multiple rounds of enrichment are required, the software cannot forecast the enrichment effort required. We have developed CellSort, a support vector machine (SVM) algorithm that identifies optimal sorting gates based on machine learning using positive and negative control populations. CellSort can take advantage of more than two dimensions to enhance the ability to distinguish between populations. We also present a Bayesian approach to predict the number of sorting rounds required to enrich a population from a given library size. This Bayesian approach allowed us to determine strategies for biasing the sorting gates in order to reduce the required number of enrichment rounds. This algorithm should be generally useful for improve sorting outcomes and reducing effort when using FACS. Source code available at http://tyolab.northwestern.edu/tools/ . k-tyo@northwestern.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

Energy Technology Data Exchange (ETDEWEB)

Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

2016-06-07

Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

Czech Academy of Sciences Publication Activity Database

Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal

2009-01-01

Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

Surface acoustic wave actuated cell sorting (SAWACS).

Science.gov (United States)

Franke, T; Braunmüller, S; Schmid, L; Wixforth, A; Weitz, D A

2010-03-21

We describe a novel microfluidic cell sorter which operates in continuous flow at high sorting rates. The device is based on a surface acoustic wave cell-sorting scheme and combines many advantages of fluorescence activated cell sorting (FACS) and fluorescence activated droplet sorting (FADS) in microfluidic channels. It is fully integrated on a PDMS device, and allows fast electronic control of cell diversion. We direct cells by acoustic streaming excited by a surface acoustic wave which deflects the fluid independently of the contrast in material properties of deflected objects and the continuous phase; thus the device underlying principle works without additional enhancement of the sorting by prior labelling of the cells with responsive markers such as magnetic or polarizable beads. Single cells are sorted directly from bulk media at rates as fast as several kHz without prior encapsulation into liquid droplet compartments as in traditional FACS. We have successfully directed HaCaT cells (human keratinocytes), fibroblasts from mice and MV3 melanoma cells. The low shear forces of this sorting method ensure that cells survive after sorting.

Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

Science.gov (United States)

Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

2017-08-01

Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

Directory of Open Access Journals (Sweden)

Ming Cheng

2016-10-01

Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

Cache-Aware and Cache-Oblivious Adaptive Sorting

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Fagerberg, Rolf; Moruz, Gabriel

2005-01-01

Two new adaptive sorting algorithms are introduced which perform an optimal number of comparisons with respect to the number of inversions in the input. The first algorithm is based on a new linear time reduction to (non-adaptive) sorting. The second algorithm is based on a new division protocol...... for the GenericSort algorithm by Estivill-Castro and Wood. From both algorithms we derive I/O-optimal cache-aware and cache-oblivious adaptive sorting algorithms. These are the first I/O-optimal adaptive sorting algorithms....

Culturas juveniles en tono de mujer. Hip hop en Medellín (Colombia.

Directory of Open Access Journals (Sweden)

Ángela Garcés Montoya.

2011-04-01

Full Text Available This article is part of the research project, “Youth musical mediations,” that explores the appropriation of alternative means of communication which allow the young to develop identities sharply differentiated from those the adult world. In particular, the article examines the world of hip hop in Medellín and the ways that youth participate in it. To follow key trajectories of women in hip hop, their voices, feelings, and memories must be uncovered. This will allow us to see how the few women who are currently part of hip hop scene in Medellín and Colombia enter, move through, and persevere in it. Since women constitute only a small percentage of the youth who live and remake hip hop in Medellín, it is important to understand how they manage to live in a male-colored world. If hip hop is about strength, denunciation, confrontation, and resistance, it seems that these qualities are more appropriate for men than for women

Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

Directory of Open Access Journals (Sweden)

Francesco Rossini

2016-08-01

Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

An Unsupervised Online Spike-Sorting Framework.

Science.gov (United States)

Knieling, Simeon; Sridharan, Kousik S; Belardinelli, Paolo; Naros, Georgios; Weiss, Daniel; Mormann, Florian; Gharabaghi, Alireza

2016-08-01

Extracellular neuronal microelectrode recordings can include action potentials from multiple neurons. To separate spikes from different neurons, they can be sorted according to their shape, a procedure referred to as spike-sorting. Several algorithms have been reported to solve this task. However, when clustering outcomes are unsatisfactory, most of them are difficult to adjust to achieve the desired results. We present an online spike-sorting framework that uses feature normalization and weighting to maximize the distinctiveness between different spike shapes. Furthermore, multiple criteria are applied to either facilitate or prevent cluster fusion, thereby enabling experimenters to fine-tune the sorting process. We compare our method to established unsupervised offline (Wave_Clus (WC)) and online (OSort (OS)) algorithms by examining their performance in sorting various test datasets using two different scoring systems (AMI and the Adamos metric). Furthermore, we evaluate sorting capabilities on intra-operative recordings using established quality metrics. Compared to WC and OS, our algorithm achieved comparable or higher scores on average and produced more convincing sorting results for intra-operative datasets. Thus, the presented framework is suitable for both online and offline analysis and could substantially improve the quality of microelectrode-based data evaluation for research and clinical application.

Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

Energy Technology Data Exchange (ETDEWEB)

Lakatos, Greg; O' Brien, John; Chou, Tom [Department of Biomathematics and Institute for Pure and Applied Mathematics, UCLA, Los Angeles, CA 90095 (United States)

2006-03-10

We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions.

Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

International Nuclear Information System (INIS)

Lakatos, Greg; O'Brien, John; Chou, Tom

2006-01-01

We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions

Data Sorting Using Graphics Processing Units

Directory of Open Access Journals (Sweden)

M. J. Mišić

2012-06-01

Full Text Available Graphics processing units (GPUs have been increasingly used for general-purpose computation in recent years. The GPU accelerated applications are found in both scientific and commercial domains. Sorting is considered as one of the very important operations in many applications, so its efficient implementation is essential for the overall application performance. This paper represents an effort to analyze and evaluate the implementations of the representative sorting algorithms on the graphics processing units. Three sorting algorithms (Quicksort, Merge sort, and Radix sort were evaluated on the Compute Unified Device Architecture (CUDA platform that is used to execute applications on NVIDIA graphics processing units. Algorithms were tested and evaluated using an automated test environment with input datasets of different characteristics. Finally, the results of this analysis are briefly discussed.

Big Five Measurement via Q-Sort

Directory of Open Access Journals (Sweden)

Chris D. Fluckinger

2014-08-01

Full Text Available Socially desirable responding presents a difficult challenge in measuring personality. I tested whether a partially ipsative measure—a normatively scored Q-sort containing traditional Big Five items—would produce personality scores indicative of less socially desirable responding compared with Likert-based measures. Across both instructions to respond honestly and in the context of applying for a job, the Q-sort produced lower mean scores, lower intercorrelations between dimensions, and similar validity in predicting supervisor performance ratings to Likert. In addition, the Q-sort produced a more orthogonal structure (but not fully orthogonal when modeled at the latent level. These results indicate that the Q-sort method did constrain socially desirable responding. Researchers and practitioners should consider Big Five measurement via Q-sort for contexts in which high socially desirable responding is expected.

Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis*

OpenAIRE

Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina

2010-01-01

Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9·dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9·dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic ...

Magnet sorting algorithms

International Nuclear Information System (INIS)

Dinev, D.

1996-01-01

Several new algorithms for sorting of dipole and/or quadrupole magnets in synchrotrons and storage rings are described. The algorithms make use of a combinatorial approach to the problem and belong to the class of random search algorithms. They use an appropriate metrization of the state space. The phase-space distortion (smear) is used as a goal function. Computational experiments for the case of the JINR-Dubna superconducting heavy ion synchrotron NUCLOTRON have shown a significant reduction of the phase-space distortion after the magnet sorting. (orig.)

Online sorting of recovered wood waste by automated XRF-technology: part II. Sorting efficiencies.

Science.gov (United States)

Hasan, A Rasem; Solo-Gabriele, Helena; Townsend, Timothy

2011-04-01

Sorting of waste wood is an important process practiced at recycling facilities in order to detect and divert contaminants from recycled wood products. Contaminants of concern include arsenic, chromium and copper found in chemically preserved wood. The objective of this research was to evaluate the sorting efficiencies of both treated and untreated parts of the wood waste stream, and metal (As, Cr and Cu) mass recoveries by the use of automated X-ray fluorescence (XRF) systems. A full-scale system was used for experimentation. This unit consisted of an XRF-detection chamber mounted on the top of a conveyor and a pneumatic slide-way diverter which sorted wood into presumed treated and presumed untreated piles. A randomized block design was used to evaluate the operational conveyance parameters of the system, including wood feed rate and conveyor belt speed. Results indicated that online sorting efficiencies of waste wood by XRF technology were high based on number and weight of pieces (70-87% and 75-92% for treated wood and 66-97% and 68-96% for untreated wood, respectively). These sorting efficiencies achieved mass recovery for metals of 81-99% for As, 75-95% for Cu and 82-99% of Cr. The incorrect sorting of wood was attributed almost equally to deficiencies in the detection and conveyance/diversion systems. Even with its deficiencies, the system was capable of producing a recyclable portion that met residential soil quality levels established for Florida, for an infeed that contained 5% of treated wood. Copyright © 2010 Elsevier Ltd. All rights reserved.

Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

Science.gov (United States)

Beyer, Eric W.

The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions

Pengembangan Algoritma Pengurutan SMS (Scan, Move, And Sort)

OpenAIRE

Lubis, Denni Aprilsyah

2015-01-01

Sorting has been a profound area for the algorithmic researchers. And many resources are invested to suggest a more working sorting algorithm. For this purpose many existing sorting algorithms were observed in terms of the efficiency of the algorithmic complexity. Efficient sorting is important to optimize the use of other algorithms that require sorted lists to work correctly. sorting has been considered as a fundamental problem in the study of algorithms that due to many reas...

Ordered particles versus ordered pointers in the hybrid ordered plasma simulation (HOPS) code

International Nuclear Information System (INIS)

Anderson, D.V.; Shumaker, D.E.

1993-01-01

From a computational standpoint, particle simulation calculations for plasmas have not adapted well to the transitions from scalar to vector processing nor from serial to parallel environments. They have suffered from inordinate and excessive accessing of computer memory and have been hobbled by relatively inefficient gather-scatter constructs resulting from the use of indirect indexing. Lastly, the many-to-one mapping characteristic of the deposition phase has made it difficult to perform this in parallel. The authors' code sorts and reorders the particles in a spatial order. This allows them to greatly reduce the memory references, to run in directly indexed vector mode, and to employ domain decomposition to achieve parallelization. The field model solves pre-maxwell equations by interatively implicit methods. The OSOP (Ordered Storage Ordered Processing) version of HOPS keeps the particle tables ordered by rebuilding them after each particle pushing phase. Alternatively, the RSOP (Random Storage Ordered Processing) version keeps a table of pointers ordered by rebuilding them. Although OSOP is somewhat faster than RSOP in tests on vector-parallel machines, it is not clear this advantage will carry over to massively parallel computers

A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

Science.gov (United States)

Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

2017-07-01

African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

Phenotypic and functional characterization of earthworm coelomocyte subsets: Linking light scatter-based cell typing and imaging of the sorted populations.

Science.gov (United States)

Engelmann, Péter; Hayashi, Yuya; Bodó, Kornélia; Ernszt, Dávid; Somogyi, Ildikó; Steib, Anita; Orbán, József; Pollák, Edit; Nyitrai, Miklós; Németh, Péter; Molnár, László

2016-12-01

Flow cytometry is a common approach to study invertebrate immune cells including earthworm coelomocytes. However, the link between light-scatter- and microscopy-based phenotyping remains obscured. Here we show, by means of light scatter-based cell sorting, both subpopulations (amoebocytes and eleocytes) can be physically isolated with good sort efficiency and purity confirmed by downstream morphological and cytochemical applications. Immunocytochemical analysis using anti-EFCC monoclonal antibodies combined with phalloidin staining has revealed antigenically distinct, sorted subsets. Screening of lectin binding capacity indicated wheat germ agglutinin (WGA) as the strongest reactor to amoebocytes. This is further evidenced by WGA inhibition assays that suggest high abundance of N-acetyl-d-glucosamine in amoebocytes. Post-sort phagocytosis assays confirmed the functional differences between amoebocytes and eleocytes, with the former being in favor of bacterial engulfment. This study has proved successful in linking flow cytometry and microscopy analysis and provides further experimental evidence of phenotypic and functional heterogeneity in earthworm coelomocyte subsets. Copyright © 2016 Elsevier Ltd. All rights reserved.

Muziki wa Hip Hop na Haki Za Kijamii: Dhima, Changamoto na ...

African Journals Online (AJOL)

Ni dhahiri kuwa haki za kijamii zinaweza kuwasilishwa kwa jamii pana kupitia sanaa ya hip hop. Makala haya basi, yanabainisha dhima na mchango wa muziki wa hip hop katika masuala ya haki za kijamii, yanafafanua changamoto za muziki huu katika kuwasilisha haki za kijamii na kutoa mapendekezo kwa makundi ...

Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

Science.gov (United States)

He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

2005-01-01

Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

Recent improvements to Binding MOAD: a resource for protein–ligand binding affinities and structures

Science.gov (United States)

Ahmed, Aqeel; Smith, Richard D.; Clark, Jordan J.; Dunbar, James B.; Carlson, Heather A.

2015-01-01

For over 10 years, Binding MOAD (Mother of All Databases; http://www.BindingMOAD.org) has been one of the largest resources for high-quality protein–ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23 269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. PMID:25378330

Word Sorts for General Music Classes

Science.gov (United States)

Cardany, Audrey Berger

2015-01-01

Word sorts are standard practice for aiding children in acquiring skills in English language arts. When included in the general music classroom, word sorts may aid students in acquiring a working knowledge of music vocabulary. The author shares a word sort activity drawn from vocabulary in John Lithgow's children's book "Never Play…

A Sequence of Sorting Strategies.

Science.gov (United States)

Duncan, David R.; Litwiller, Bonnie H.

1984-01-01

Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)

Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

KAUST Repository

Rakia, Tamer

2016-07-28

In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

Cascading Multi-Hop Reservation and Transmission in Underwater Acoustic Sensor Networks

Directory of Open Access Journals (Sweden)

Jae-Won Lee

2014-10-01

Full Text Available The long propagation delay in an underwater acoustic channel makes designing an underwater media access control (MAC protocol more challenging. In particular, handshaking-based MAC protocols widely used in terrestrial radio channels have been known to be inappropriate in underwater acoustic channels, because of the inordinately large latency involved in exchanging control packets. Furthermore, in the case of multi-hop relaying in a hop-by-hop handshaking manner, the end-to-end delay significantly increases. In this paper, we propose a new MAC protocol named cascading multi-hop reservation and transmission (CMRT. In CMRT, intermediate nodes between a source and a destination may start handshaking in advance for the next-hop relaying before handshaking for the previous node is completed. By this concurrent relaying, control packet exchange and data delivery cascade down to the destination. In addition, to improve channel utilization, CMRT adopts a packet-train method where multiple data packets are sent together by handshaking once. Thus, CMRT reduces the time taken for control packet exchange and accordingly increases the throughput. The performance of CMRT is evaluated and compared with that of two conventional MAC protocols (multiple-access collision avoidance for underwater (MACA-U and MACA-U with packet trains (MACA-UPT. The results show that CMRT outperforms other MAC protocols in terms of both throughput and end-to-end delay.

Wavelength-Hopping Time-Spreading Optical CDMA With Bipolar Codes

Science.gov (United States)

Kwong, Wing C.; Yang, Guu-Chang; Chang, Cheng-Yuan

2005-01-01

Two-dimensional wavelength-hopping time-spreading coding schemes have been studied recently for supporting greater numbers of subscribers and simultaneous users than conventional one-dimensional approaches in optical code-division multiple-access (OCDMA) systems. To further improve both numbers without sacrificing performance, a new code design utilizing bipolar codes for both wavelength hopping and time spreading is studied and analyzed in this paper. A rapidly programmable, integratable hardware design for this new coding scheme, based on arrayed-waveguide gratings, is also discussed.

Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

Science.gov (United States)

Price, Robert J., Jr.

2005-01-01

Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

Hip-Hop and a Hybrid Text in a Postsecondary English Class

Science.gov (United States)

Sanchez, Deborah M.

2010-01-01

This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

Comparison of Rheological Properties of Hopped Wort and Malt Wort

Directory of Open Access Journals (Sweden)

Petr Trávníček

2015-01-01

Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

Multilingualism and Hip Hop Consumption in Nigeria: Accounting for the Local Acceptance of a Global Phenomenon Hip-Hop und Mehrsprachigkeit in Nigeria: Zur Erklärung der lokalen Akzeptanz eines globalen Phänomens

Directory of Open Access Journals (Sweden)

Olusegun Fariudeen Liadi

2012-01-01

Full Text Available Hip hop music has enjoyed global popularity and patronage on a level that has transcended that of most other music genres. It is perhaps due to the genre’s worldwide popularity that many forms of hip hop have sprung up across the globe. The Nigerian version of the music has been overwhelmingly accepted by a good number of youths in the country irrespective of class, religion and social status. However, there is some speculation as to what factors are responsible for the recent sudden boom in the popular consumption of this genre among the youth, since hip hop has been a feature of the Nigerian musical landscape since the 1980s. With the aid of qualitative data collection instruments – thirty in-depth interviews and six key informant interviews among hip hop fans and club DJs, respectively – the study establishes the centrality of multilingualism as a primary reason for the acceptance of hip hop among Nigerian youth.Hip-Hop-Musik ist weltweit in einem Maße populär, das die meisten anderen Musikrichtungen übertrifft. Vielleicht hat diese weltweite Beliebtheit dazu geführt, dass rund um den Globus unterschiedliche Formen des Hip-Hop aus dem Boden geschossen sind. Die nigerianische Version dieser Musikrichtung wird von einer überwältigenden Zahl Jugendlicher im Land angenommen, unabhängig von sozialem Status und Religionszugehörigkeit. Es wird jedoch darüber spekuliert, welche Faktoren den jüngsten plötzlichen Boom in dieser Musikrichtung erklären, denn Hip-Hop ist schon seit den 1980er Jahren Teil der nigerianischen Musiklandschaft. Mit Hilfe einer qualitativen Datenerhebung – 30 detaillierte Interviews sowie sechs Interviews mit Schlüsselpersonen unter Hip-Hop-Fans und Club-DJs – kann der Autor die Mehrsprachigkeit als wichtigsten Grund für die Akzeptanz des Hip-Hop unter nigerianischen Jugendlichen ermitteln.

Fixing the Sorting Algorithm for Android, Java and Python

NARCIS (Netherlands)

C.P.T. de Gouw (Stijn); F.S. de Boer (Frank)

2015-01-01

htmlabstractTim Peters developed the Timsort hybrid sorting algorithm in 2002. TimSort was first developed for Python, a popular programming language, but later ported to Java (where it appears as java.util.Collections.sort and java.util.Arrays.sort). TimSort is today used as the default sorting

Multi-hop Relaying: An End-to-End Delay Analysis

KAUST Repository

Chaaban, Anas

2015-12-01

The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode-forward (DF) and amplify-forward (AF) with block coding are considered, and are compared with the point-to-point (P2P) scheme which ignores the relay. Latency expressions for the three schemes are derived, and conditions under which DF and AF reduce latency are obtained for high signal-to-noise ratio (SNR). Interestingly, these conditions are more strict when compared to the conditions under which the same multi-hopping schemes achieve higher long-term (information-theoretic) rates than P2P. It turns out that the relation between the sourcedestination SNR and the harmonic mean of the SNR’s of the channels to and from the relay dictates whether multi-hopping reduces latency or not.

IMPLEMENTATION OF SERIAL AND PARALLEL BUBBLE SORT ON FPGA

Directory of Open Access Journals (Sweden)

Dwi Marhaendro Jati Purnomo

2016-06-01

Full Text Available Sorting is common process in computational world. Its utilization are on many fields from research to industry. There are many sorting algorithm in nowadays. One of the simplest yet powerful is bubble sort. In this study, bubble sort is implemented on FPGA. The implementation was taken on serial and parallel approach. Serial and parallel bubble sort then compared by means of its memory, execution time, and utility which comprises slices and LUTs. The experiments show that serial bubble sort required smaller memory as well as utility compared to parallel bubble sort. Meanwhile, parallel bubble sort performed faster than serial bubble sort

Polish Hip Hop as a Form of Multiliteracies and Situated Learning

Science.gov (United States)

Torrence, Michael L.

2009-01-01

The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

A study on a wheel-based stair-climbing robot with a hopping mechanism

Science.gov (United States)

Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji

2008-08-01

In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.

Automatic spike sorting using tuning information.

Science.gov (United States)

Ventura, Valérie

2009-09-01

Current spike sorting methods focus on clustering neurons' characteristic spike waveforms. The resulting spike-sorted data are typically used to estimate how covariates of interest modulate the firing rates of neurons. However, when these covariates do modulate the firing rates, they provide information about spikes' identities, which thus far have been ignored for the purpose of spike sorting. This letter describes a novel approach to spike sorting, which incorporates both waveform information and tuning information obtained from the modulation of firing rates. Because it efficiently uses all the available information, this spike sorter yields lower spike misclassification rates than traditional automatic spike sorters. This theoretical result is verified empirically on several examples. The proposed method does not require additional assumptions; only its implementation is different. It essentially consists of performing spike sorting and tuning estimation simultaneously rather than sequentially, as is currently done. We used an expectation-maximization maximum likelihood algorithm to implement the new spike sorter. We present the general form of this algorithm and provide a detailed implementable version under the assumptions that neurons are independent and spike according to Poisson processes. Finally, we uncover a systematic flaw of spike sorting based on waveform information only.

Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

Directory of Open Access Journals (Sweden)

Alex S. Porco

2014-12-01

Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

Majorana edge States in atomic wires coupled by pair hopping.

Science.gov (United States)

Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

2013-10-25

We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

Science.gov (United States)

Gibson, W; Campbell, A; Allison, G

2013-09-01

Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

From Broken Glass to Ruf Diamonds: Manchester Hip Hop

OpenAIRE

de Paor-Evans, Adam

2018-01-01

When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

“It may be verifyit that thy wit is thin”: Interpreting Older Scots Flyting through Hip Hop Aesthetics

Directory of Open Access Journals (Sweden)

Caitlin Flynn

2014-03-01

Full Text Available This study seeks to demystify the tradition of Older Scots flyting—a form of poetic invective unique to the late medieval Scottish court. Hip Hop battle raps provide a modern venue for exploring the motivations and potential rewards for engaging in this sort of technical poetic contest. The two forms, though culturally and historically distant, both exhibit analogous rhetorical techniques, which make this comparison possible. Each form is concerned with poetic identity—this is evident through each poet’s identification with specific communities or classes; while the concern with demonstrating superior technical skill is also essential to these invectives and is often highlighted through the manipulation of traditional forms and tropes. As an extension of this comparison, we hope to recover something of the tone and purpose of the medieval tradition, namely, that the poets who engaged in these public invectives were actually amicable rivals competing for increased court status and wealth.

Identification of critical chemical features for Aurora kinase-B inhibitors using Hip-Hop, virtual screening and molecular docking

Science.gov (United States)

Sakkiah, Sugunadevi; Thangapandian, Sundarapandian; John, Shalini; Lee, Keun Woo

2011-01-01

This study was performed to find the selective chemical features for Aurora kinase-B inhibitors using the potent methods like Hip-Hop, virtual screening, homology modeling, molecular dynamics and docking. The best hypothesis, Hypo1 was validated toward a wide range of test set containing the selective inhibitors of Aurora kinase-B. Homology modeling and molecular dynamics studies were carried out to perform the molecular docking studies. The best hypothesis Hypo1 was used as a 3D query to screen the chemical databases. The screened molecules from the databases were sorted based on ADME and drug like properties. The selective hit compounds were docked and the hydrogen bond interactions with the critical amino acids present in Aurora kinase-B were compared with the chemical features present in the Hypo1. Finally, we suggest that the chemical features present in the Hypo1 are vital for a molecule to inhibit the Aurora kinase-B activity.

Auto-acetylation on K289 is not essential for HopZ1a-mediated plant defense suppression

Directory of Open Access Journals (Sweden)

Jose Sebastian Rufian

2015-07-01

Full Text Available The Pseudomonas syringae type III-secreted effector HopZ1a is a member of the HopZ / YopJ superfamily of effectors that triggers immunity in Arabidopsis. We have previously shown that HopZ1a suppresses both local (effector-triggered immunity, ETI and systemic immunity (systemic acquired resistance, SAR triggered by the heterologous effector AvrRpt2. HopZ1a has been shown to possess acetyltransferase activity, and this activity is essential to trigger immunity in Arabidopsis. HopZ1a acetyltransferase activity has been reported to require the auto-acetylation of the effector on a specific lysine (K289 residue. In this paper we analyze the relevance of autoacetylation of lysine residue 289 in HopZ1a ability to suppress plant defenses, and on the light of the results obtained, we also revise its relevance for HopZ1a avirulence activity. Our results indicate that, while the HopZ1aK289R mutant is impaired to some degree in its virulence and avirulence activities, is by no means phenotypically equivalent to the catalytically inactive HopZ1aC216A, since it is still able to trigger a defense response that induces detectable macroscopic HR and effectively protects Arabidopsis from infection, reducing growth of P. syringae within the plant. We also present evidence that the HopZ1aK289R mutant still displays virulence activities, partially suppressing both ETI and SAR.

Hopping absorption edge in silicon inversion layers

International Nuclear Information System (INIS)

Kostadinov, I.Z.

1983-09-01

The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

Don't Believe the Hype: Hip-Hop Literacies and English Education

Science.gov (United States)

Belle, Crystal

2016-01-01

Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

Science.gov (United States)

Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

2014-12-31

Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

Biological and chemical standardization of a hop (Humulus lupulus) botanical dietary supplement.

Science.gov (United States)

Krause, Elizabeth; Yuan, Yang; Hajirahimkhan, Atieh; Dong, Huali; Dietz, Birgit M; Nikolic, Dejan; Pauli, Guido F; Bolton, Judy L; van Breemen, Richard B

2014-06-01

Concerned about the safety of conventional estrogen replacement therapy, women are using botanical dietary supplements as alternatives for the management of menopausal symptoms such as hot flashes. Before botanical dietary supplements can be evaluated clinically for safety and efficacy, botanically authenticated and standardized forms are required. To address the demand for a standardized, estrogenic botanical dietary supplement, an extract of hops (Humulus lupulus L.) was developed. Although valued in the brewing of beer, hop extracts are used as anxiolytics and hypnotics and have well-established estrogenic constituents. Starting with a hop cultivar used in the brewing industry, spent hops (the residue remaining after extraction of bitter acids) were formulated into a botanical dietary supplement that was then chemically and biologically standardized. Biological standardization utilized the estrogen-dependent induction of alkaline phosphatase in the Ishikawa cell line. Chemical standardization was based on the prenylated phenols in hops that included estrogenic 8-prenylnaringenin, its isomer 6-prenylnaringenin, and pro-estrogenic isoxanthohumol and its isomeric chalcone xanthohumol, all of which were measured using high-performance liquid chromatography-tandem mass spectrometry. The product of this process was a reproducible botanical extract suitable for subsequent investigations of safety and efficacy. Copyright © 2014 John Wiley & Sons, Ltd.

Structure and Charge Hopping Dynamics in Green Rust

International Nuclear Information System (INIS)

Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

2007-01-01

Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

Hop pellets as an interesting source of antioxidant active compounds

Directory of Open Access Journals (Sweden)

Andrea Holubková

2013-02-01

Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures

Science.gov (United States)

Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter

2018-05-01

The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.

Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes.

Science.gov (United States)

Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

2017-11-01

Isokinetic strength and hop tests are commonly used to assess athletes' readiness to return to sport after knee surgery. The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Cross-sectional study; Level of evidence, 3. Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation ( r ). The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s ( P = .03), flexion total work/body weight at 180 deg/s ( P = .04), and flexion peak torque/body weight at 300 deg/s ( P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s ( r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s ( r = -0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types

Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

Science.gov (United States)

Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

2012-05-04

In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

A Preliminary Study of MSD-First Radix-Sorting Methed

OpenAIRE

小田, 哲久

1984-01-01

Many kinds of sorting algorithms have been developed from the age of Punched Card System. Nowadays, any sorting algorithm can be called either (1) internal sorting methed or (2) external sorting method. Internal sorting method is used only when the number of records to be sorted (N) is not so large for the internal memory of the computer system. Larger memory space has become available with the aid of semiconductor technology. Therefore, it might be desired to develop a new internal sorting m...

Data parallel sorting for particle simulation

Science.gov (United States)

Dagum, Leonardo

1992-01-01

Sorting on a parallel architecture is a communications intensive event which can incur a high penalty in applications where it is required. In the case of particle simulation, only integer sorting is necessary, and sequential implementations easily attain the minimum performance bound of O (N) for N particles. Parallel implementations, however, have to cope with the parallel sorting problem which, in addition to incurring a heavy communications cost, can make the minimun performance bound difficult to attain. This paper demonstrates how the sorting problem in a particle simulation can be reduced to a merging problem, and describes an efficient data parallel algorithm to solve this merging problem in a particle simulation. The new algorithm is shown to be optimal under conditions usual for particle simulation, and its fieldwise implementation on the Connection Machine is analyzed in detail. The new algorithm is about four times faster than a fieldwise implementation of radix sort on the Connection Machine.

Stochastic Model of Vesicular Sorting in Cellular Organelles

Science.gov (United States)

Vagne, Quentin; Sens, Pierre

2018-02-01

The proper sorting of membrane components by regulated exchange between cellular organelles is crucial to intracellular organization. This process relies on the budding and fusion of transport vesicles, and should be strongly influenced by stochastic fluctuations, considering the relatively small size of many organelles. We identify the perfect sorting of two membrane components initially mixed in a single compartment as a first passage process, and we show that the mean sorting time exhibits two distinct regimes as a function of the ratio of vesicle fusion to budding rates. Low ratio values lead to fast sorting but result in a broad size distribution of sorted compartments dominated by small entities. High ratio values result in two well-defined sorted compartments but sorting is exponentially slow. Our results suggest an optimal balance between vesicle budding and fusion for the rapid and efficient sorting of membrane components and highlight the importance of stochastic effects for the steady-state organization of intracellular compartments.

Application of visible spectroscopy in waste sorting

Science.gov (United States)

Spiga, Philippe; Bourely, Antoine

2011-10-01

Today, waste recycling, (bottles, papers...), is a mechanical operation: the waste are crushed, fused and agglomerated in order to obtain new manufactured products (e.g. new bottles, clothes ...). The plastics recycling is the main application in the color sorting process. The colorless plastics recovered are more valuable than the colored plastics. Other emergent applications are in the paper sorting, where the main goal is to sort dyed paper from white papers. Up to now, Pellenc Selective Technologies has manufactured color sorting machines based on RGB cameras. Three dimensions (red, green and blue) are no longer sufficient to detect low quantities of dye in the considered waste. In order to increase the efficiency of the color detection, a new sorting machine, based on visible spectroscopy, has been developed. This paper presents the principles of the two approaches and their difference in terms of sorting performance, making visible spectroscopy a clear winner.

Communication devices for network-hopping communications and methods of network-hopping communications

Science.gov (United States)

Buttles, John W

2013-04-23

Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

Directory of Open Access Journals (Sweden)

N. Cherouvim

2008-01-01

Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

You know what it is: learning words through listening to hip-hop.

Science.gov (United States)

Chesley, Paula

2011-01-01

Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

You know what it is: learning words through listening to hip-hop.

Directory of Open Access Journals (Sweden)

Paula Chesley

Full Text Available Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

Regulation of lipid droplet dynamics in Saccharomyces cerevisiae depends on the Rab7-like Ypt7p, HOPS complex and V1-ATPase

Directory of Open Access Journals (Sweden)

Isabelle Bouchez

2015-07-01

Full Text Available It has now been clearly shown that lipid droplets (LDs play a dynamic role in the cell. This was reinforced by LD proteomics which suggest that a significant number of trafficking proteins are associated with this organelle. Using microscopy, we showed that LDs partly co-localize with the vacuole in S. cerevisiae. Immunoblot experiments confirmed the association of the vacuolar Rab GTPase Rab7-like Ypt7p with LDs. We observed an increase in fatty acid content and LD number in ypt7Δ mutant and also changes in LD morphology and intra LD fusions, revealing a direct role for Ypt7p in LD dynamics. Using co-immunoprecipitation, we isolated potential Ypt7p partners including, Vma13p, the H subunit of the V1 part of the vacuolar (H+ ATPase (V-ATPase. Deletion of the VMA13 gene, as well as deletion of three other subunits of the V1 part of the V-ATPase, also increased the cell fatty acid content and LD number. Mutants of the Homotypic fusion and vacuole protein sorting (HOPS complex showed similar phenotypes. Here, we demonstrated that LD dynamics and membrane trafficking between the vacuole and LDs are regulated by the Rab7-like Ypt7p and are impaired when the HOPS complex and the V1 domain of the V-ATPase are defective.

ALGORITHM FOR SORTING GROUPED DATA

Science.gov (United States)

Evans, J. D.

1994-01-01

It is often desirable to sort data sets in ascending or descending order. This becomes more difficult for grouped data, i.e., multiple sets of data, where each set of data involves several measurements or related elements. The sort becomes increasingly cumbersome when more than a few elements exist for each data set. In order to achieve an efficient sorting process, an algorithm has been devised in which the maximum most significant element is found, and then compared to each element in succession. The program was written to handle the daily temperature readings of the Voyager spacecraft, particularly those related to the special tracking requirements of Voyager 2. By reducing each data set to a single representative number, the sorting process becomes very easy. The first step in the process is to reduce the data set of width 'n' to a data set of width '1'. This is done by representing each data set by a polynomial of length 'n' based on the differences of the maximum and minimum elements. These single numbers are then sorted and converted back to obtain the original data sets. Required input data are the name of the data file to read and sort, and the starting and ending record numbers. The package includes a sample data file, containing 500 sets of data with 5 elements in each set. This program will perform a sort of the 500 data sets in 3 - 5 seconds on an IBM PC-AT with a hard disk; on a similarly equipped IBM PC-XT the time is under 10 seconds. This program is written in BASIC (specifically the Microsoft QuickBasic compiler) for interactive execution and has been implemented on the IBM PC computer series operating under PC-DOS with a central memory requirement of approximately 40K of 8 bit bytes. A hard disk is desirable for speed considerations, but is not required. This program was developed in 1986.

Effect of storage on the brewing properties of tropical hop substitutes

African Journals Online (AJOL)

SERVER

2007-06-18

Jun 18, 2007 ... Conclusively, tropical hop substitutes stored at 5 ± 1oC to 27 ± 1oC can still be used for brewing even after three to six months storage. .... which is associated with the oxidative depreciation of the soft resins to hard resins ... Changes in the soft resin levels of hop substitutes with storage. Soft resin levels (%).

QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)

Science.gov (United States)

Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...

Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

Science.gov (United States)

Wessel, Roger D.; Wallaert, Kerry A.

2011-01-01

This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

Differential effects of EGFR ligands on endocytic sorting of the receptor

DEFF Research Database (Denmark)

Roepstorff, Kirstine; Grandal, Michael Vibo; Henriksen, Lasse

2009-01-01

signalling and is a more potent mitogen than EGF. In addition to EGF and TGF-alpha, five EGFR ligands have been identified. Although many of these ligands are upregulated in cancers, very little is known about their effect on EGFR trafficking. We have compared the effect of six different ligands on endocytic...... trafficking of EGFR. We find that, whereas they all stimulate receptor internalization, they have very diverse effects on endocytic sorting. Heparin-binding EGF-like growth factor and Betacellulin target all EGFRs for lysosomal degradation. In contrast, TGF-alpha and epiregulin lead to complete receptor...

Recent improvements to Binding MOAD: a resource for protein-ligand binding affinities and structures.

Science.gov (United States)

Ahmed, Aqeel; Smith, Richard D; Clark, Jordan J; Dunbar, James B; Carlson, Heather A

2015-01-01

For over 10 years, Binding MOAD (Mother of All Databases; http://www.BindingMOAD.org) has been one of the largest resources for high-quality protein-ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23,269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Parallel integer sorting with medium and fine-scale parallelism

Science.gov (United States)

Dagum, Leonardo

1993-01-01

Two new parallel integer sorting algorithms, queue-sort and barrel-sort, are presented and analyzed in detail. These algorithms do not have optimal parallel complexity, yet they show very good performance in practice. Queue-sort designed for fine-scale parallel architectures which allow the queueing of multiple messages to the same destination. Barrel-sort is designed for medium-scale parallel architectures with a high message passing overhead. The performance results from the implementation of queue-sort on a Connection Machine CM-2 and barrel-sort on a 128 processor iPSC/860 are given. The two implementations are found to be comparable in performance but not as good as a fully vectorized bucket sort on the Cray YMP.

Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

NARCIS (Netherlands)

Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

2009-01-01

The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

Multi-hop routing in wireless sensor networks an overview, taxonomy, and research challenges

CERN Document Server

Rani, Shalli

2016-01-01

This brief provides an overview of recent developments in multi-hop routing protocols for Wireless Sensor Networks (WSNs). It introduces the various classifications of routing protocols and lists the pros and cons of each category, going beyond the conceptual overview of routing classifications offered in other books. Recently many researchers have proposed numerous multi-hop routing protocols and thereby created a need for a book that provides its readers with an up-to-date road map of this research paradigm.   The authors present some of the most relevant results achieved by applying an algorithmic approach to the research on multi-hop routing protocols. The book covers measurements, experiences and lessons learned from the implementation of multi-hop communication prototypes. Furthermore, it describes future research challenges and as such serves as a useful guide for students and researchers alike.

Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

Energy Technology Data Exchange (ETDEWEB)

Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail: giovanni.granucci@unipi.it; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)

2014-01-28

We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

Science.gov (United States)

Cermak, Michael J.

2012-01-01

This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

KAUST Repository

Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

2017-01-01

In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

Hopping control channel MAC protocol for opportunistic spectrum access networks

Institute of Scientific and Technical Information of China (English)

FU Jing-tuan; JI Hong; MAO Xu

2010-01-01

Opportunistic spectrum access （OSA） is considered as a promising approach to mitigate spectrum scarcity by allowing unlicensed users to exploit spectrum opportunities in licensed frequency bands. Derived from the existing channel-hopping multiple access （CHMA） protocol,we introduce a hopping control channel medium access control （MAC） protocol in the context of OSA networks. In our proposed protocol,all nodes in the network follow a common channel-hopping sequence; every frequency channel can be used as control channel and data channel. Considering primary users＇ occupancy of the channel,we use a primary user （PU） detection model to calculate the channel availability for unlicensed users＇ access. Then,a discrete Markov chain analytical model is applied to describe the channel states and deduce the system throughput. Through simulation,we present numerical results to demonstrate the throughput performance of our protocol and thus validate our work.

UCSD SORT Test (U-SORT): Examination of a newly developed organizational skills assessment tool for severely mentally ill adults.

Science.gov (United States)

Tiznado, Denisse; Mausbach, Brent T; Cardenas, Veronica; Jeste, Dilip V; Patterson, Thomas L

2010-12-01

The present investigation examined the validity of a new cognitive test intended to assess organizational skills. Participants were 180 middle-aged or older participants with a Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition diagnosis of schizophrenia or schizoaffective disorder. Participants' organizational skills were measured using our newly developed University of California, San Diego Sorting Test (U-SORT), a performance-based test of organizational ability in which subjects sort objects (e.g., battery, pens) from a "junk drawer" into "keep" versus "trash" piles. Significant correlations between U-SORT scores and theoretically similar constructs (i.e. functional capacity, cognitive functioning, and clinical symptoms) were acceptable (mean r = 0.34), and weak correlations were found between U-SORT scores and theoretically dissimilar constructs (e.g., health symptoms, social support, gender; mean r = 0.06 ). The correlation between assessment scores provides preliminary support for the U-SORT test as a brief, easily transportable, reliable, and valid measure of functioning for this population.

Categorizing Variations of Student-Implemented Sorting Algorithms

Science.gov (United States)

Taherkhani, Ahmad; Korhonen, Ari; Malmi, Lauri

2012-01-01

In this study, we examined freshmen students' sorting algorithm implementations in data structures and algorithms' course in two phases: at the beginning of the course before the students received any instruction on sorting algorithms, and after taking a lecture on sorting algorithms. The analysis revealed that many students have insufficient…

On the Construction of Sorted Reactive Systems

DEFF Research Database (Denmark)

Birkedal, Lars; Debois, Søren; Hildebrandt, Thomas

2008-01-01

We develop a theory of sorted bigraphical reactive systems. Every application of bigraphs in the literature has required an extension, a sorting, of pure bigraphs. In turn, every such application has required a redevelopment of the theory of pure bigraphical reactive systems for the sorting at hand...... bigraphs. Technically, we give our construction for ordinary reactive systems, then lift it to bigraphical reactive systems. As such, we give also a construction of sortings for ordinary reactive systems. This construction is an improvement over previous attempts in that it produces smaller and much more...

Genetic interactions between the chromosome axis-associated protein Hop1 and homologous recombination determinants in Schizosaccharomyces pombe.

Science.gov (United States)

Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander

2018-03-17

Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.

Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

Science.gov (United States)

Petchauer, Emery

2011-01-01

College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

Trends in German Hip Hop Music and Its Usefulness for the Classroom

Science.gov (United States)

Schmidt, Johannes

2008-01-01

German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…

Implementation of Serial and Parallel Bubble Sort on Fpga

OpenAIRE

Purnomo, Dwi Marhaendro Jati; Arinaldi, Ahmad; Priyantini, Dwi Teguh; Wibisono, Ari; Febrian, Andreas

2016-01-01

Sorting is common process in computational world. Its utilization are on many fields from research to industry. There are many sorting algorithm in nowadays. One of the simplest yet powerful is bubble sort. In this study, bubble sort is implemented on FPGA. The implementation was taken on serial and parallel approach. Serial and parallel bubble sort then compared by means of its memory, execution time, and utility which comprises slices and LUTs. The experiments show that serial bubble sort r...

Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

Science.gov (United States)

Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

2015-08-01

Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

A cargo-sorting DNA robot.

Science.gov (United States)

Thubagere, Anupama J; Li, Wei; Johnson, Robert F; Chen, Zibo; Doroudi, Shayan; Lee, Yae Lim; Izatt, Gregory; Wittman, Sarah; Srinivas, Niranjan; Woods, Damien; Winfree, Erik; Qian, Lulu

2017-09-15

Two critical challenges in the design and synthesis of molecular robots are modularity and algorithm simplicity. We demonstrate three modular building blocks for a DNA robot that performs cargo sorting at the molecular level. A simple algorithm encoding recognition between cargos and their destinations allows for a simple robot design: a single-stranded DNA with one leg and two foot domains for walking, and one arm and one hand domain for picking up and dropping off cargos. The robot explores a two-dimensional testing ground on the surface of DNA origami, picks up multiple cargos of two types that are initially at unordered locations, and delivers them to specified destinations until all molecules are sorted into two distinct piles. The robot is designed to perform a random walk without any energy supply. Exploiting this feature, a single robot can repeatedly sort multiple cargos. Localization on DNA origami allows for distinct cargo-sorting tasks to take place simultaneously in one test tube or for multiple robots to collectively perform the same task. Copyright © 2017, American Association for the Advancement of Science.

New age radiometric ore sorting - the elegant solution

International Nuclear Information System (INIS)

Gordon, H.P.; Heuer, T.

2000-01-01

Radiometric ore sorting technology and application are described in two parts. Part I reviews the history of radiometric sorting in the minerals industry and describes the latest developments in radiometric sorting technology. Part II describes the history, feasibility study and approach used in the application of the new technology at Rossing Uranium Limited. There has been little progress in the field of radiometric sorting since the late 1970s. This has changed with the development of a high capacity radiometric sorter designed to operate on low-grade ore in the +75mm / -300mm size fraction. This has been designed specifically for an application at Rossing. Rossing has a long history in radiometric sorting dating back to 1968 when initial tests were conducted on the Rossing prospect. Past feasibility studies concluded that radiometric sorting would not conclusively reduce the unit cost of production unless sorting was used to increase production levels. The current feasibility study shows that the application of new radiometric sorter technology makes sorting viable without increasing production, and significantly more attractive with increased production. A pilot approach to confirm sorter performance is described. (author)

Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

Science.gov (United States)

Travis, Raphael, Jr.; Deepak, Anne

2011-01-01

Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

Uudised : Pop-karneval. Hip-hop

Index Scriptorium Estoniae

2005-01-01

Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

Use of the Homeland-Defense Operational Planning System (HOPS) for Emergency Management

International Nuclear Information System (INIS)

Durling, Jr. R.L.; Price, D.E.

2005-01-01

The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

The adsorption effect of C6H5 on density of states for double wall carbon nanotubes by tight binding model

International Nuclear Information System (INIS)

Fathalian, A.

2012-01-01

A theoretical approach based on a tight-binding model is developed to study the effects of the adsorption of finite concentrations of C 6 H 5 gas molecules on double-walled carbon nanotube (DWCNT) electronic properties. To obtain proper hopping integrals and random on-site energies for the case of one molecule adsorption, the local density of states for various hopping integrals and random on-site energies are calculated. Since C 6 H 5 molecule is a donor with respect to the carbon nanotubes and their states should appear near the conduction band of the system, effects of various hopping integral deviations and on-site energies for one molecule adsorption are considered to find proper hopping and on-site energies consistent with expected n-type semiconductor. We found that adsorption of C 6 H 5 gas molecules could lead to a (8.0)-(20.0) DWCNT n-type semiconductor. The width of impurity adsorbed gas states in the density of states could be controlled by adsorbed gas concentration.

Contribution of afferent feedback and descending drive to human hopping

DEFF Research Database (Denmark)

Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

2010-01-01

During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed...... contributes to the early EMG burst, then advancing or delaying the touch-down without the subject's knowledge should similarly advance or delay the burst. This was indeed the case when touch-down was advanced or delayed by shifting the height of a programmable platform up or down between two hops...... and this resulted in a correspondent shift of the early EMG burst. Our second hypothesis was that the motor cortex contributes to the first EMG burst during hopping. If so, inhibition of the motor cortex would reduce the magnitude of the burst. By applying a low-intensity magnetic stimulus it was possible...

Observation of correlation effects in the hopping transport in amorphous silicon

International Nuclear Information System (INIS)

Voegele, V.; Kalbitzer, S.; Boehringer, K.

1985-01-01

Amorphous silicon films have been modified by the implantation of Au or Si ions. The d.c. conductivity, measured between 300 and 15 K, was found to exhibit hopping exponents m which increase with decreasing temperature. Depending on the varied defect densities, m ranges between the limits of 1/4 and 1. These results can be explained by variable-range-hopping theory, if a Coulomb correlation term is included. (author)

A Comparison of Card-sorting Analysis Methods

DEFF Research Database (Denmark)

Nawaz, Ather

2012-01-01

This study investigates how the choice of analysis method for card sorting studies affects the suggested information structure for websites. In the card sorting technique, a variety of methods are used to analyse the resulting data. The analysis of card sorting data helps user experience (UX......) designers to discover the patterns in how users make classifications and thus to develop an optimal, user-centred website structure. During analysis, the recurrence of patterns of classification between users influences the resulting website structure. However, the algorithm used in the analysis influences...... the recurrent patterns found and thus has consequences for the resulting website design. This paper draws an attention to the choice of card sorting analysis and techniques and shows how it impacts the results. The research focuses on how the same data for card sorting can lead to different website structures...

Jumping and Hopping in Elite and Amateur Orienteering Athletes and Correlations to Sprinting and Running

DEFF Research Database (Denmark)

Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer

2014-01-01

PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlatio...... and rapid generation of high relative maximal forces, especially vertically. These functional measures were more closely related to sprinting and/or running abilities, indicating benefits of lower-body training in orienteering.......PURPOSE: Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations...... with sprinting and/or running have been examined in orienteering athletes. METHODS: We investigated squat jump (SJ), countermovement jump (CMJ), standing long jump (SLJ), and hopping performed by 8 elite and 8 amateur male foot-orienteering athletes (29 ± 7 y, 183 ± 5 cm, 73 ± 7 kg) and possible correlations...

The Philippine "Hip Hop Stick Dance"

Science.gov (United States)

Lewis, Lisa

2012-01-01

This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

Chemical transformations of characteristic hop secondary metabolites in relation to beer properties and the brewing process: a review.

Science.gov (United States)

Steenackers, Bart; De Cooman, Luc; De Vos, Dirk

2015-04-01

The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.

Three Sorts of Naturalism

OpenAIRE

Fink, Hans

2006-01-01

In "Two sorts of Naturalism" John McDowell is sketching his own sort of naturalism in ethics as an alternative to "bald naturalism". In this paper I distinguish materialist, idealist and absolute conceptions of nature and of naturalism in order to provide a framework for a clearer understanding of what McDowell's own naturalism amounts to. I argue that nothing short of an absolute naturalism will do for a number of McDowell's own purposes, but that it is far from obvious that this is his posi...

Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay

Science.gov (United States)

Zhong, Xuefeng; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

2018-01-01

Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter–receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter–receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity. PMID:29337911

Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay.

Science.gov (United States)

Zhong, Xuefeng; Chen, Fangjiong; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua

2018-01-16

Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter-receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter-receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity.

Is a Multi-Hop Relay Scheme Gainful in an IEEE 802.22-Based Cognitive Radio System?

Science.gov (United States)

Shin, Jungchae; Lee, Dong-Kyu; Cho, Ho-Shin

In this paper, we formulate a plan to operate multi-hop relays in IEEE 802.22-based cognitive radio (CR) systems and evaluate system performance to consider the propriety of a multi-hop relay scheme in CR systems. A centralized radio resource management and a simple deployment of relay stations (RSs) are assessed to make relay operations feasible under CR conditions. Simulation results show that the proposed multi-hop relay scheme significantly increases system throughput compared to a no-relay CR system as the incumbent user (IU) traffic gets heavier. Furthermore, the optimal number of hops can be determined given the traffic conditions.

The apparently contradictory energetics of hopping and running: the counter-intuitive effect of constraints resolves the paradox.

Science.gov (United States)

Gutmann, Anne K; Bertram, John E A

2017-01-15

Metabolic rate appears to increase with the rate of force application for running. Leg function during ground contact is similar in hopping and running, so one might expect that this relationship would hold for hopping as well. Surprisingly, metabolic rate appeared to decrease with increasing force rate for hopping. However, this paradox is the result of comparing different cross-sections of the metabolic cost landscapes for hopping and running. The apparent relationship between metabolic rate and force rate observed in treadmill running is likely not a fundamental characteristic of muscle physiology, but a result of runners responding to speed constraints, i.e. runners selecting step frequencies that minimize metabolic cost per distance for a series of treadmill-specified speeds. Evaluating hopping metabolic rate over a narrow range of hop frequencies similar to that selected by treadmill runners yields energy use trends similar to those of running. © 2017. Published by The Company of Biologists Ltd.

Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

International Nuclear Information System (INIS)

Durling, R L; Price, D E; Spero, K K

2005-01-01

For over ten years, the Counterproliferation Analysis and Planning System (CAPS) at Lawrence Livermore National Laboratory (LLNL) has been a planning tool used by U.S. combatant commands for mission support planning against foreign programs engaged in the manufacture of weapons of mass destruction (WMD). CAPS is endorsed by the Secretary of Defense as the preferred counterproliferation tool to be used by the nation's armed services. A sister system, the Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging CAPS expertise designed to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented

Method Development and Validation for UHPLC-MS-MS Determination of Hop Prenylflavonoids in Human Serum

OpenAIRE

Yuan, Yang; Qiu, Xi; Nikolic, Dejan; Dahl, Jeffrey H.; van Breemen, Richard B.

2012-01-01

Hops (Humulus lupulus L.) are used in the brewing of beer, and hop extracts containing prenylated compounds such as xanthohumol and 8-prenylnaringenin are under investigation as dietary supplements for cancer chemoprevention and for the management of hot flashes in menopausal women. To facilitate clinical studies of hop safety and efficacy, a selective, sensitive, and fast ultra-high pressure liquid chromatography tandem mass spectrometry (UHPLC-MS-MS) method was developed and validated for t...

Application of radix sorting in high energy physics experiment

International Nuclear Information System (INIS)

Chen Xuan; Gu Minhao; Zhu Kejun

2012-01-01

In the high energy physics experiments, there are always requirements to sort the large scale of experiment data. To meet the demand, this paper introduces one radix sorting algorithms, whose sub-sort is counting sorting and time complex is O (n), based on the characteristic of high energy physics experiment data that is marked by time stamp. This paper gives the description, analysis, implementation and experimental result of the sorting algorithms. (authors)

Engineering a Cache-Oblivious Sorting Algorithm

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Fagerberg, Rolf; Vinther, Kristoffer

2007-01-01

This paper is an algorithmic engineering study of cache-oblivious sorting. We investigate by empirical methods a number of implementation issues and parameter choices for the cache-oblivious sorting algorithm Lazy Funnelsort, and compare the final algorithm with Quicksort, the established standard...

A lipid receptor sorts polyomavirus from the endolysosome to the endoplasmic reticulum to cause infection.

Directory of Open Access Journals (Sweden)

Mengding Qian

2009-06-01

Full Text Available The mechanisms by which receptors guide intracellular virus transport are poorly characterized. The murine polyomavirus (Py binds to the lipid receptor ganglioside GD1a and traffics to the endoplasmic reticulum (ER where it enters the cytosol and then the nucleus to initiate infection. How Py reaches the ER is unclear. We show that Py is transported initially to the endolysosome where the low pH imparts a conformational change that enhances its subsequent ER-to-cytosol membrane penetration. GD1a stimulates not viral binding or entry, but rather sorting of Py from late endosomes and/or lysosomes to the ER, suggesting that GD1a binding is responsible for ER targeting. Consistent with this, an artificial particle coated with a GD1a antibody is transported to the ER. Our results provide a rationale for transport of Py through the endolysosome, demonstrate a novel endolysosome-to-ER transport pathway that is regulated by a lipid, and implicate ganglioside binding as a general ER targeting mechanism.

The GTPase Rab43 Controls the Anterograde ER-Golgi Trafficking and Sorting of GPCRs

Directory of Open Access Journals (Sweden)

Chunman Li

2017-10-01

Full Text Available G-protein-coupled receptors (GPCRs constitute the largest superfamily of cell-surface signaling proteins. However, mechanisms underlying their surface targeting and sorting are poorly understood. Here, we screen the Rab family of small GTPases in the surface transport of multiple GPCRs. We find that manipulation of Rab43 function significantly alters the surface presentation and signaling of all GPCRs studied without affecting non-GPCR membrane proteins. Rab43 specifically regulates the transport of nascent GPCRs from the endoplasmic reticulum (ER to the Golgi. More interestingly, Rab43 directly interacts with GPCRs in an activation-dependent fashion. The Rab43-binding domain identified in the receptors effectively converts non-GPCR membrane protein transport into a Rab43-dependent pathway. These data reveal a crucial role for Rab43 in anterograde ER-Golgi transport of nascent GPCRs, as well as the ER sorting of GPCR members by virtue of its ability to interact directly.

Corporeidade e sexualidade em dançarinos de rua: axé e hip hop Bodyness and sexuality of street dancers: axé and hip hop

Directory of Open Access Journals (Sweden)

Fernando Luiz Cardoso

2011-12-01

Full Text Available Analisaram-se aspectos da corporeidade e sexualidade em dançarinos de hip hop e axé (35 homens e 49 mulheres comparativamente a indivíduos não-dançarinos expectadores da plateia (21 homens e 19 mulheres, via questionário anônimo. Os dançarinos de axé foram os mais satisfeitos com suas vidas sexuais, com as preliminares sexuais e os que mais gostavam de se masturbarem em relação aos de hip hop e plateia. Dançarinos do axé apresentaram uma sexualidade mais vinculada ao conhecimento corporal e conexões afetivas. Em ambos estilos, os dançarinos homens davam maior ênfase à genitália e a libido em relação aos aspectos da afetividade.We analyzed selected aspects of the bodyness and sexuality of hip hop and axé dancers (35 men and 49 women in comparison with non-dancer controls (21 men and 19 women through anonymous questionnaire. The axé dancers were the most satisfied with their sexual lives, with sexual preliminaries and who liked more to masturbate when compared with the hip hop dancers and controls. Axé dancers of both sexes presented a strong link between their sexuality and their corporal knowledge and affective connections. Men dancers were more focused in their genitals and gave stronger sexual emphasis to libido rather than affectivity.

Radio resource management scheme and outage analysis for network-assisted multi-hop D2D communications

Directory of Open Access Journals (Sweden)

Leila Melki

2016-11-01

Full Text Available In a cellular network it's very difficult to make spectrum resource more efficiently. Device-to-Device (D2D technology enables new service opportunities, and provides high throughput and reliable communication while reducing the base station load. For better total performance, short-range D2D links and cellular links share the same radio resource and the management of interference becomes a crucial task. Here we argue that single-hop D2D technology can be used to further improve cellular networks performance if the key D2D radio resource management algorithms are suitably extended to support multi-hop D2D communications. Aiming to establish a new paradigm for the analysis and design of multi-hop D2D communications, We propose a radio resource allocation for multi-hop D2D routes based on interference avoidance approach in LTE-A networks. On top of that, we investigate the outage probability of D2D communication. We first introduce a new definition of outage probability by considering the maximum distance to be allowable for single-hop transmission. Then we study and analyze the outage performance of a multi-hop D2D route. We derive the general closed form expression of outage probability of the multi-hop D2D routes. The results demonstrate that the D2D radio, sharing the same resources as the cellular network, provide higher capacity compared to pure cellular communication where all the data is transmitted through the base station. They also demonstrate that the new method of calculation of D2D multi hop outage probability has better performance than classical method defined in the literature.

Condom use and hip hop culture: the case of urban young men in New York City.

Science.gov (United States)

Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

2008-06-01

We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

Duplex Schemes in Multiple Antenna Two-Hop Relaying

Directory of Open Access Journals (Sweden)

Anja Klein

2008-04-01

Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

Performance Analysis of RF-FSO Multi-Hop Networks

KAUST Repository

Makki, Behrooz

2017-05-12

We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

Real-Time On-Board Airborne Demonstration of High-Speed On-Board Data Processing for Science Instruments (HOPS)

Science.gov (United States)

Beyon, Jeffrey Y.; Ng, Tak-Kwong; Davis, Mitchell J.; Adams, James K.; Bowen, Stephen C.; Fay, James J.; Hutchinson, Mark A.

2015-01-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program since April, 2012. The HOPS team recently completed two flight campaigns during the summer of 2014 on two different aircrafts with two different science instruments. The first flight campaign was in July, 2014 based at NASA Langley Research Center (LaRC) in Hampton, VA on the NASA's HU-25 aircraft. The science instrument that flew with HOPS was Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) CarbonHawk Experiment Simulator (ACES) funded by NASA's Instrument Incubator Program (IIP). The second campaign was in August, 2014 based at NASA Armstrong Flight Research Center (AFRC) in Palmdale, CA on the NASA's DC-8 aircraft. HOPS flew with the Multifunctional Fiber Laser Lidar (MFLL) instrument developed by Excelis Inc. The goal of the campaigns was to perform an end-to-end demonstration of the capabilities of the HOPS prototype system (HOPS COTS) while running the most computationally intensive part of the ASCENDS algorithm real-time on-board. The comparison of the two flight campaigns and the results of the functionality tests of the HOPS COTS are presented in this paper.

Assessing hopping developmental level in childhood using wearable inertial sensor devices.

Science.gov (United States)

Masci, Ilaria; Vannozzi, Giuseppe; Getchell, Nancy; Cappozzo, Aurelio

2012-07-01

Assessing movement skills is a fundamental issue in motor development. Current process-oriented assessments, such as developmental sequences, are based on subjective judgments; if paired with quantitative assessments, a better understanding of movement performance and developmental change could be obtained. Our purpose was to examine the use of inertial sensors to evaluate developmental differences in hopping over distance. Forty children executed the task wearing the inertial sensor and relevant time durations and 3D accelerations were obtained. Subjects were also categorized in different developmental levels according to the hopping developmental sequence. Results indicated that some time and kinematic parameters changed with some developmental levels, possibly as a function of anthropometry and previous motor experience. We concluded that, since inertial sensors were suitable in describing hopping performance and sensitive to developmental changes, this technology is promising as an in-field and user-independent motor development assessment tool.

Self-assembly of heteroleptic dinuclear metallosupramolecular kites from multivalent ligands via social self-sorting

Directory of Open Access Journals (Sweden)

Christian Benkhäuser

2015-05-01

Full Text Available A Tröger's base-derived racemic bis(1,10-phenanthroline ligand (rac-1 and a bis(2,2'-bipyridine ligand with a central 1,3-diethynylbenzene unit 2 were synthesized. Each of these ligands acts as a multivalent entity for the binding of two copper(I ions. Upon coordination to the metal ions these two ligands undergo selective self-assembly into heteroleptic dinuclear metallosupramolecular kites in a high-fidelity social self-sorting manner as evidenced by NMR spectroscopy and mass spectrometry.

Distributed Detection with Collisions in a Random, Single-Hop Wireless Sensor Network

Science.gov (United States)

2013-05-26

public release; distribution is unlimited. Distributed detection with collisions in a random, single-hop wireless sensor network The views, opinions...1274 2 ABSTRACT Distributed detection with collisions in a random, single-hop wireless sensor network Report Title We consider the problem of... WIRELESS SENSOR NETWORK Gene T. Whipps?† Emre Ertin† Randolph L. Moses† ?U.S. Army Research Laboratory, Adelphi, MD 20783 †The Ohio State University

Synthesis and Antiproliferative Activity of Minor Hops Prenylflavonoids and New Insights on Prenyl Group Cyclization

Directory of Open Access Journals (Sweden)

Jarosław Popłoński

2018-03-01

Full Text Available Synthesis of minor prenylflavonoids found in hops and their non-natural derivatives were performed. The antiproliferative activity of the obtained compounds against some human cancer cell lines was investigated. Using xanthohumol isolated from spent hops as a lead compound, a series of minor hop prenylflavonoids and synthetic derivatives were obtained by isomerization, cyclisation, oxidative-cyclisation, oxidation, reduction and demethylation reactions. Three human cancer cell lines—breast (MCF-7, prostate (PC-3 and colon (HT-29—were used in antiproliferative assays, with cisplatin as a control compound. Five minor hop prenyl flavonoids and nine non-natural derivatives of xanthohumol have been synthetized. Syntheses of xanthohumol K, its dihydro- and tetrahydro-derivatives and 1″,2″,α,β-tetrahydroxanthohumol C were described for the first time. All of the minor hops prenyl flavonoids exhibited strong to moderate antiproliferative activity in vitro. The minor hops flavonoids xanthohumol C and 1″,2″-dihydroxanthohumol K and non-natural 2,3-dehydroisoxanthohumol exhibited the activity comparable to cisplatin. Results described in the article suggest that flavonoids containing chromane- and chromene-like moieties, especially chalcones, are potent antiproliferative agents. The developed new efficient, regioselective cyclisation reaction of the xanthohumol prenyl group to 1″,2″-dihydroxantohumol K may be used in the synthesis of other compounds with the chromane moiety.

The Pseudomonas syringae type III effector HopG1 targets mitochondria, alters plant development, and suppresses plant innate immunity

Science.gov (United States)

Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.

2009-01-01

Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557

Switched diversity strategies for dual-hop relaying systems

KAUST Repository

Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

2011-01-01

This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station

On the Directly and Subdirectly Irreducible Many-Sorted Algebras

Directory of Open Access Journals (Sweden)

Climent Vidal J.

2015-03-01

Full Text Available A theorem of single-sorted universal algebra asserts that every finite algebra can be represented as a product of a finite family of finite directly irreducible algebras. In this article, we show that the many-sorted counterpart of the above theorem is also true, but under the condition of requiring, in the definition of directly reducible many-sorted algebra, that the supports of the factors should be included in the support of the many-sorted algebra. Moreover, we show that the theorem of Birkhoff, according to which every single-sorted algebra is isomorphic to a subdirect product of subdirectly irreducible algebras, is also true in the field of many-sorted algebras.

Memory effects, two color percolation, and the temperature dependence of Mott variable-range hopping

Science.gov (United States)

Agam, Oded; Aleiner, Igor L.

2014-06-01

There are three basic processes that determine hopping transport: (a) hopping between normally empty sites (i.e., having exponentially small occupation numbers at equilibrium), (b) hopping between normally occupied sites, and (c) transitions between normally occupied and unoccupied sites. In conventional theories all these processes are considered Markovian and the correlations of occupation numbers of different sites are believed to be small (i.e., not exponential in temperature). We show that, contrary to this belief, memory effects suppress the processes of type (c) and manifest themselves in a subleading exponential temperature dependence of the variable-range hopping conductivity. This temperature dependence originates from the property that sites of type (a) and (b) form two independent resistor networks that are weakly coupled to each other by processes of type (c). This leads to a two-color percolation problem which we solve in the critical region.

Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

Science.gov (United States)

Love, Bettina L.

2016-01-01

Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

Rend og hop - Vi si´r stop

DEFF Research Database (Denmark)

Lund, Ole

Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere......Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere...

We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

Science.gov (United States)

Dando, Michael

2017-01-01

Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

Molecular determinants of the interaction between Doa1 and Hse1 involved in endosomal sorting.

Science.gov (United States)

Han, Seungsu; Shin, Donghyuk; Choi, Hoon; Lee, Sangho

2014-03-28

Yeast Doa1/Ufd3 is an adaptor protein for Cdc48 (p97 in mammal), an AAA type ATPase associated with endoplasmic reticulum-associated protein degradation pathway and endosomal sorting into multivesicular bodies. Doa1 functions in the endosomal sorting by its association with Hse1, a component of endosomal sorting complex required for transport (ESCRT) system. The association of Doa1 with Hse1 was previously reported to be mediated between PFU domain of Doa1 and SH3 of Hse1. However, it remains unclear which residues are specifically involved in the interaction. Here we report that Doa1/PFU interacts with Hse1/SH3 with a moderate affinity of 5 μM. Asn-438 of Doa1/PFU and Trp-254 of Hse1/SH3 are found to be critical in the interaction while Phe-434, implicated in ubiquitin binding via a hydrophobic interaction, is not. Small-angle X-ray scattering measurements combined with molecular docking and biochemical analysis yield the solution structure of the Doa1/PFU:Hse1/SH3 complex. Taken together, our results suggest that hydrogen bonding is a major determinant in the interaction of Doa1/PFU with Hse1/SH3. Copyright © 2014 Elsevier Inc. All rights reserved.

Order-sorted Algebraic Specifications with Higher-order Functions

DEFF Research Database (Denmark)

Haxthausen, Anne Elisabeth

1995-01-01

This paper gives a proposal for how order-sorted algebraic specification languages can be extended with higher-order functions. The approach taken is a generalisation to the order-sorted case of an approach given by Mller, Tarlecki and Wirsing for the many-sorted case. The main idea in the proposal...

Sorting and sustaining cooperation

DEFF Research Database (Denmark)

Vikander, Nick

2013-01-01

This paper looks at cooperation in teams where some people are selfish and others are conditional cooperators, and where lay-offs will occur at a fixed future date. I show that the best way to sustain cooperation prior to the lay-offs is often in a sorting equilibrium, where conditional cooperators...... can identify and then work with one another. Changes to parameters that would seem to make cooperation more attractive, such as an increase in the discount factor or the fraction of conditional cooperators, can reduce equilibrium cooperation if they decrease a selfish player's incentive to sort....

A New Time-Hopping Multiple Access Communication System Simulator: Application to Ultra-Wideband

Directory of Open Access Journals (Sweden)

José M. Páez-Borrallo

2005-03-01

Full Text Available Time-hopping ultra-wideband technology presents some very attractive features for future indoor wireless systems in terms of achievable transmission rate and multiple access capabilities. This paper develops an algorithm to design time-hopping system simulators specially suitable for ultra-wideband, which takes advantage of some of the specific characteristics of this kind of systems. The algorithm allows an improvement of both the time capabilities and the achievable sampling rate and can be used to research into the influence of different parameters on the performance of the system. An additional result is the validation of a new general performance formula for time-hopping ultra-wideband systems with multipath channels.

Epigenetic changes detected in micropropagated hop plants.

Science.gov (United States)

Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles

2009-07-01

Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

Science.gov (United States)

Petchauer, Emery

2010-01-01

Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

A Simple Deep Learning Method for Neuronal Spike Sorting

Science.gov (United States)

Yang, Kai; Wu, Haifeng; Zeng, Yu

2017-10-01

Spike sorting is one of key technique to understand brain activity. With the development of modern electrophysiology technology, some recent multi-electrode technologies have been able to record the activity of thousands of neuronal spikes simultaneously. The spike sorting in this case will increase the computational complexity of conventional sorting algorithms. In this paper, we will focus spike sorting on how to reduce the complexity, and introduce a deep learning algorithm, principal component analysis network (PCANet) to spike sorting. The introduced method starts from a conventional model and establish a Toeplitz matrix. Through the column vectors in the matrix, we trains a PCANet, where some eigenvalue vectors of spikes could be extracted. Finally, support vector machine (SVM) is used to sort spikes. In experiments, we choose two groups of simulated data from public databases availably and compare this introduced method with conventional methods. The results indicate that the introduced method indeed has lower complexity with the same sorting errors as the conventional methods.

Differential modulation of plant immune responses by diverse members of the Pseudomonas savastanoi pv. savastanoi HopAF type III effector family.

Science.gov (United States)

Castañeda-Ojeda, M Pilar; López-Solanilla, Emilia; Ramos, Cayo

2017-06-01

The Pseudomonas savastanoi pv. savastanoi NCPPB 3335 type III secretion system (T3SS) effector repertoire includes 33 candidates, seven of which translocate into host cells and interfere with plant defences. The present study was performed to investigate the co-existence of both plasmid- and chromosomal-encoded members of the HopAF effector family, HopAF1-1 and HopAF1-2, respectively, in the genome of NCPPB 3335. Here, we show that the HopAF1 paralogues are widely distributed in the Pseudomonas syringae complex, where HopAF1-1 is most similar to the homologues encoded by other P. syringae pathovars infecting woody hosts that belong to phylogroups 1 and 3. We show that the expression of both HopAF1-1 and HopAF-2 is transcriptionally dependent on HrpL and demonstrate their delivery into Nicotiana tabacum leaves. Although the heterologous delivery of either HopAF1-1 or HopAF1-2 significantly suppressed the production of defence-associated reactive oxygen species levels, only HopAF1-2 reduced the levels of callose deposition. Moreover, the expression of HopAF1-2 by functionally effectorless P. syringae pv. tomato DC3000D28E completely inhibited the hypersensitive response in tobacco and significantly increased the competitiveness of the strain in Nicotiana benthamiana. Despite their functional differences, subcellular localization studies reveal that green fluorescent protein (GFP) fusions to either HopAF1-1 or HopAF1-2 are targeted to the plasma membrane when they are expressed in plant cells, a process that is completely dependent on the integrity of their N-myristoylation motif. Our results further support the notion that highly similar T3SS effectors might differentially interact with diverse plant targets, even when they co-localize in the same cell compartment. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Denni Algorithm An Enhanced Of SMS (Scan, Move and Sort) Algorithm

Science.gov (United States)

Aprilsyah Lubis, Denni; Salim Sitompul, Opim; Marwan; Tulus; Andri Budiman, M.

2017-12-01

Sorting has been a profound area for the algorithmic researchers, and many resources are invested to suggest a more working sorting algorithm. For this purpose many existing sorting algorithms were observed in terms of the efficiency of the algorithmic complexity. Efficient sorting is important to optimize the use of other algorithms that require sorted lists to work correctly. Sorting has been considered as a fundamental problem in the study of algorithms that due to many reasons namely, the necessary to sort information is inherent in many applications, algorithms often use sorting as a key subroutine, in algorithm design there are many essential techniques represented in the body of sorting algorithms, and many engineering issues come to the fore when implementing sorting algorithms., Many algorithms are very well known for sorting the unordered lists, and one of the well-known algorithms that make the process of sorting to be more economical and efficient is SMS (Scan, Move and Sort) algorithm, an enhancement of Quicksort invented Rami Mansi in 2010. This paper presents a new sorting algorithm called Denni-algorithm. The Denni algorithm is considered as an enhancement on the SMS algorithm in average, and worst cases. The Denni algorithm is compared with the SMS algorithm and the results were promising.

The solution space of sorting by DCJ.

Science.gov (United States)

Braga, Marília D V; Stoye, Jens

2010-09-01

In genome rearrangements, the double cut and join (DCJ) operation, introduced by Yancopoulos et al. in 2005, allows one to represent most rearrangement events that could happen in multichromosomal genomes, such as inversions, translocations, fusions, and fissions. No restriction on the genome structure considering linear and circular chromosomes is imposed. An advantage of this general model is that it leads to considerable algorithmic simplifications compared to other genome rearrangement models. Recently, several works concerning the DCJ operation have been published, and in particular, an algorithm was proposed to find an optimal DCJ sequence for sorting one genome into another one. Here we study the solution space of this problem and give an easy-to-compute formula that corresponds to the exact number of optimal DCJ sorting sequences for a particular subset of instances of the problem. We also give an algorithm to count the number of optimal sorting sequences for any instance of the problem. Another interesting result is the demonstration of the possibility of obtaining one optimal sorting sequence by properly replacing any pair of consecutive operations in another optimal sequence. As a consequence, any optimal sorting sequence can be obtained from one other by applying such replacements successively, but the problem of finding the shortest number of replacements between two sorting sequences is still open.

Examining Hip-Hop as Culturally Relevant Pedagogy

Science.gov (United States)

Kim, Jung; Pulido, Isaura

2015-01-01

Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

Particle Transport and Size Sorting in Bubble Microstreaming Flow

Science.gov (United States)

Thameem, Raqeeb; Rallabandi, Bhargav; Wang, Cheng; Hilgenfeldt, Sascha

2014-11-01

Ultrasonic driving of sessile semicylindrical bubbles results in powerful steady streaming flows that are robust over a wide range of driving frequencies. In a microchannel, this flow field pattern can be fine-tuned to achieve size-sensitive sorting and trapping of particles at scales much smaller than the bubble itself; the sorting mechanism has been successfully described based on simple geometrical considerations. We investigate the sorting process in more detail, both experimentally (using new parameter variations that allow greater control over the sorting) and theoretically (incorporating the device geometry as well as the superimposed channel flow into an asymptotic theory). This results in optimized criteria for size sorting and a theoretical description that closely matches the particle behavior close to the bubble, the crucial region for size sorting.

Hop-distance relationship analysis with quasi-UDG model for node localization in wireless sensor networks

Directory of Open Access Journals (Sweden)

Chen Ping

2011-01-01

Full Text Available Abstract In wireless sensor networks (WSNs, location information plays an important role in many fundamental services which includes geographic routing, target tracking, location-based coverage, topology control, and others. One promising approach in sensor network localization is the determination of location based on hop counts. A critical priori of this approach that directly influences the accuracy of location estimation is the hop-distance relationship. However, most of the related works on the hop-distance relationship assume the unit-disk graph (UDG model that is unrealistic in a practical scenario. In this paper, we formulate the hop-distance relationship for quasi-UDG model in WSNs where sensor nodes are randomly and independently deployed in a circular region based on a Poisson point process. Different from the UDG model, quasi-UDG model has the non-uniformity property for connectivity. We derive an approximated recursive expression for the probability of the hop count with a given geographic distance. The border effect and dependence problem are also taken into consideration. Furthermore, we give the expressions describing the distribution of distance with known hop counts for inner nodes and those suffered from the border effect where we discover the insignificance of the border effect. The analytical results are validated by simulations showing the accuracy of the employed approximation. Besides, we demonstrate the localization application of the formulated relationship and show the accuracy improvement in the WSN localization.

On the Capacity of a GSM Frequency Hopping network with Intelligent Underlayer-Overlayer

DEFF Research Database (Denmark)

Nielsen, Thomas Toftegaard; Wigard, Jeroen; Mogensen, Preben Elgaard

1997-01-01

. By combining this reuse partitioning with frequency hopping, an increase in the network capacity in terms of carried traffic per cell is achieved. Simulations have indicated that for slow moving mobiles a gain of approximately 35% is achieved by this new feature when compared with a frequency hopping network...

Scheduling for dual-hop block-fading channels with two source-user pairs sharing one relay

KAUST Repository

Zafar, Ammar

2013-09-01

In this paper, we maximize the achievable rate region of a dual-hop network with two sources serving two users independently through a single shared relay. We formulate the problem as maximizing the sum of the weighted long term average throughputs of the two users under stability constraints on the long term throughputs of the source-user pairs. In order to solve the problem, we propose a joint user-and-hop scheduling scheme, which schedules the first or second hop opportunistically based on instantaneous channel state information, in order to exploit multiuser diversity and multihop diversity gains. Numerical results show that the proposed joint scheduling scheme enhances the achievable rate region as compared to a scheme that employs multi-user scheduling on the second-hop alone. Copyright © 2013 by the Institute of Electrical and Electronic Engineers, Inc.

The role of intrinsic muscle properties for stable hopping-stability is achieved by the force-velocity relation

International Nuclear Information System (INIS)

Haeufle, D F B; Grimmer, S; Seyfarth, A

2010-01-01

A reductionist approach was presented to investigate which level of detail of the physiological muscle is required for stable locomotion. Periodic movements of a simplified one-dimensional hopping model with a Hill-type muscle (one contractile element, neither serial nor parallel elastic elements) were analyzed. Force-length and force-velocity relations of the muscle were varied in three levels of approximation (constant, linear and Hill-shaped nonlinear) resulting in nine different hopping models of different complexity. Stability of these models was evaluated by return map analysis and the performance by the maximum hopping height. The simplest model (constant force-length and constant force-velocity relations) outperformed all others in the maximum hopping height but was unstable. Stable hopping was achieved with linear and Hill-shaped nonlinear characteristic of the force-velocity relation. The characteristics of the force-length relation marginally influenced hopping stability. The results of this approach indicate that the intrinsic properties of the contractile element are responsible for stabilization of periodic movements. This connotes that (a) complex movements like legged locomotion could benefit from stabilizing effects of muscle properties, and (b) technical systems could benefit from the emerging stability when implementing biological characteristics into artificial muscles.

Detecting mode hopping in single-longitudinal-mode fiber ring lasers based on an unbalanced fiber Michelson interferometer.

Science.gov (United States)

Ma, Mingxiang; Hu, Zhengliang; Xu, Pan; Wang, Wei; Hu, Yongming

2012-10-20

A method of detecting mode hopping for single-longitudinal-mode (SLM) fiber ring lasers has been proposed and experimentally demonstrated. The method that is based on an unbalanced Michelson interferometer (MI) utilizing phase generated carrier modulation instantly transforms mode-hopping dynamics into steep phase changes of the interferometer. Multiform mode hops in an SLM erbium-doped fiber ring laser with an 18.6 MHz mode spacing have been detected exactly in real-time domain and discussed in detail. Numerical results show that the MI-based method has a high testing sensitivity for identifying mode hopping, which will play a significant role in evaluating the output stability of SLM fiber lasers.

The Q sort theory and technique.

Science.gov (United States)

Nyatanga, L

1989-10-01

This paper is based on the author's experience of using the Q sort technique with BA Social Sciences (BASS) students, and the community psychiatric nursing (CPN, ENB No 811 course). The paper focuses on two main issues: 1. The theoretical assumptions underpinning the Q Sort technique. Carl Rogers' self theory and some of the values of humanistic psychology are summarised. 2. The actual technique procedure and meaning of results are highlighted. As the Q Sort technique is potentially useful in a variety of sittings some of which are listed in this paper, the emphasis has deliberately been placed in understanding the theoretical underpinning and the operationalisation (sensitive interpretation) of the theory to practice.

Interaction sorting method for molecular dynamics on multi-core SIMD CPU architecture.

Science.gov (United States)

Matvienko, Sergey; Alemasov, Nikolay; Fomin, Eduard

2015-02-01

Molecular dynamics (MD) is widely used in computational biology for studying binding mechanisms of molecules, molecular transport, conformational transitions, protein folding, etc. The method is computationally expensive; thus, the demand for the development of novel, much more efficient algorithms is still high. Therefore, the new algorithm designed in 2007 and called interaction sorting (IS) clearly attracted interest, as it outperformed the most efficient MD algorithms. In this work, a new IS modification is proposed which allows the algorithm to utilize SIMD processor instructions. This paper shows that the improvement provides an additional gain in performance, 9% to 45% in comparison to the original IS method.

A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

International Nuclear Information System (INIS)

Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang

2009-01-01

A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 μm CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm 2 .

A fast-hopping 3-band CMOS frequency synthesizer for MB-OFDM UWB system

Energy Technology Data Exchange (ETDEWEB)

Zheng Yongzheng; Xia Lingli; Li Weinan; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [State Key Laboratory of ASIC and System, Fudan University, Shanghai 201203 (China)

2009-09-15

A fast-hopping 3-band (mode 1) multi-band orthogonal frequency division multiplexing ultra-wideband frequency synthesizer is presented. This synthesizer uses two phase-locked loops for generating steady frequencies and one quadrature single-sideband mixer for frequency shifting and quadrature frequency generation. The generated carriers can hop among 3432 MHz, 3960 MHz, and 4488 MHz. Implemented in a 0.13 {mu}m CMOS process, this fully integrated synthesizer consumes 27 mA current from a 1.2 V supply. Measurement shows that the out-of-band spurious tones are below -50 dBc, while the in-band spurious tones are below -34 dBc. The measured hopping time is below 2 ns. The core die area is 1.0 x 1.8 mm{sup 2}.

Performance Analysis of RF-FSO Multi-Hop Networks

KAUST Repository

Makki, Behrooz; Svensson, Tommy; Brandt-Pearce, Maite; Alouini, Mohamed-Slim

2017-01-01

We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking

Event shape sorting

International Nuclear Information System (INIS)

Kopecna, Renata; Tomasik, Boris

2016-01-01

We propose a novel method for sorting events of multiparticle production according to the azimuthal anisotropy of their momentum distribution. Although the method is quite general, we advocate its use in analysis of ultra-relativistic heavy-ion collisions where a large number of hadrons is produced. The advantage of our method is that it can automatically sort out samples of events with histograms that indicate similar distributions of hadrons. It takes into account the whole measured histograms with all orders of anisotropy instead of a specific observable (e.g., v 2 , v 3 , q 2 ). It can be used for more exclusive experimental studies of flow anisotropies which are then more easily compared to theoretical calculations. It may also be useful in the construction of mixed-events background for correlation studies as it allows to select events with similar momentum distribution. (orig.)

Camp of Hip-Hop - kõigile kohustuslik / Mari Hiiemäe ; kommenteerinud Joel Juht

Index Scriptorium Estoniae

Hiiemäe, Mari

2012-01-01

Üheksandat korda toimuvast rahvusvahelisest tantsulaagrist ja tänavakultuuri tutvustavast noortelaagrist Camp of Hip-Hop, mis toimub Lääne Virumaal Käsmus. 28. juunil toimub kõigile huvilistele meelelahutusüritus Camp of Hip-Hop Championships, kus näitavad oma tantsuoskusi laagris osalejad ja maailmas tunnustatud koreograafid

Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

Science.gov (United States)

Lawson, Carl J

2015-12-01

The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

Science.gov (United States)

Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

2018-03-30

Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

Science.gov (United States)

Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

2013-01-01

Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

Mixed quantum-classical equilibrium in global flux surface hopping

International Nuclear Information System (INIS)

Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.

2015-01-01

Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

System optimization for peer-to-peer multi hop video broadcasting in wireless ad hoc networks

NARCIS (Netherlands)

Dedeoglu, V.; Atici, C.; Salman, F.S.; Sunay, M.O.

2008-01-01

We consider peer-to-peer video broadcasting using cooperation among peers in an ad hoc wireless network. As opposed to the traditional single hop broadcasting, multiple hops cause an increase in broadcast video quality while creating interference and increasing transmission delay. We develop

Development of sorting system control using LABVIEW

International Nuclear Information System (INIS)

Azraf Azman; Mohd Arif Hamzah; Noriah Mod Ali; John Konsoh; Mohd Idris Taib; Maslina Mohd Ibrahim; Nor Arymaswati Abdullah; Abu Bakar Mhd Ghazali

2005-01-01

The development of the Personnel Dosimeter Sorting System, proposed by the Secondary Standard Dosimetry Laboratory (SSDL) is to enhance the system or work flow in preparing the personnel dosimeter. The main objective of the system is to reduce stamping error, time and cost. The Personnel Dosimeter Sorting System is a semi-automatic system with an interfacing method using the Advantec 32 bit PCI interface card of 64 digital input and output. The system is integrated with the Labview version 7.1 programming language to control the sorting system and operation. (Author)

An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

Directory of Open Access Journals (Sweden)

Zheng Zhao

2017-01-01

Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

Sorting and selection in posets

DEFF Research Database (Denmark)

Daskalakis, Constantinos; Karp, Richard M.; Mossel, Elchanan

2011-01-01

from two decades ago by Faigle and Turán. In particular, we present the first algorithm that sorts a width-$w$ poset of size $n$ with query complexity $O(n(w+\\log n))$ and prove that this query complexity is asymptotically optimal. We also describe a variant of Mergesort with query complexity $O......(wn\\log\\frac{n}{w})$ and total complexity $O(w^{2}n\\log\\frac{n}{w})$; an algorithm with the same query complexity was given by Faigle and Turán, but no efficient implementation of that algorithm is known. Both our sorting algorithms can be applied with negligible overhead to the more general problem of reconstructing transitive......Classical problems of sorting and searching assume an underlying linear ordering of the objects being compared. In this paper, we study these problems in the context of partially ordered sets, in which some pairs of objects are incomparable. This generalization is interesting from a combinatorial...

La Música Hip-Hop como Recurso Preventivo del Acoso Escolar: Análisis de 10 Canciones de Hip-Hop en Español sobre Bullying

Directory of Open Access Journals (Sweden)

Gonzalo del Moral Arroyo

2014-02-01

Full Text Available Los objetivos de este estudio son, en primer lugar, conocer la visión sobre el bullying que proporcionan las canciones de hip-hop en español sistematizando sus aportaciones de cara a un mejor aprovechamiento de las mismas como recurso educativo, y en segundo lugar, crear una lista de canciones de hip-hop en español que traten el tema del bullying con el fin de poder utilizarlas como herramientas preventivas en el trabajo con niños y adolescentes. Se propone un diseño cualitativo, analizando el contenido de las letras de las canciones siguiendo los pasos de la Teoría General Inductiva y complementándolo con el análisis cuantitativo de las visualizaciones de los vídeos de dichas canciones en Youtube. Se concluye que las canciones de hip-hop en español seleccionadas favorecen los procesos empáticos con la víctima al poner de manifiesto sus procesos de pensamiento y sus sentimientos así como fomentan entre los testigos el rol de defensor, connotando positivamente los valores implicados en la asunción del mismo.

Simple Models for the Performance Evaluation of a Class of Two-Hop Relay Protocols

NARCIS (Netherlands)

Al Hanbali, Ahmad; Kherani, Arzad A.; Nain, Philippe

2007-01-01

We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

Simple models for the performance evaluation of a class of two-hop relay protocols

NARCIS (Netherlands)

Al Hanbali, A.; Kherani, A.A.; Nain, P.; Akyildiz, I.F.; Sivakumar, R.; Ekici, E.; Cavalcante de Oliveira, J.; McNair, J.

2007-01-01

We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

MODELING WORK OF SORTING STATION USING UML

Directory of Open Access Journals (Sweden)

O. V. Gorbova

2014-12-01

Full Text Available Purpose. The purpose of this paper is the construction of methods and models for the graphical representation process of sorting station, using the unified modeling language (UML. Methodology. Methods of graph theory, finite automata and the representation theory of queuing systems were used as the methods of investigation. A graphical representation of the process was implemented with using the Unified Modeling Language UML. The sorting station process representation is implemented as a state diagram and actions through a set of IBM Rational Rose. Graphs can show parallel operation of sorting station, the parallel existence and influence of objects process and the transition from one state to another. The IBM Rational Rose complex allows developing a diagram of work sequence of varying degrees of detailing. Findings. The study has developed a graphical representation method of the process of sorting station of different kind of complexity. All graphical representations are made using the UML. They are represented as a directed graph with the states. It is clear enough in the study of the subject area. Applying the methodology of the representation process, it allows becoming friendly with the work of any automation object very fast, and exploring the process during algorithms construction of sorting stations and other railway facilities. This model is implemented with using the Unified Modeling Language (UML using a combination of IBM Rational Rose. Originality. The representation process of sorting station was developed by means of the Unified Modeling Language (UML use. Methodology of representation process allows creating the directed graphs based on the order of execution of the works chain, objects and performers of these works. The UML allows visualizing, specifying, constructing and documenting, formalizing the representation process of sorting station and developing sequence diagrams of works of varying degrees of detail. Practical

Cloning of Plasmodium falciparum by single-cell sorting.

Science.gov (United States)

Miao, Jun; Li, Xiaolian; Cui, Liwang

2010-10-01

Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two-dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples. Copyright 2010 Elsevier Inc. All rights reserved.

Cloning of Plasmodium falciparum by single-cell sorting

Science.gov (United States)

Miao, Jun; Li, Xiaolian; Cui, Liwang

2010-01-01

Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples. PMID:20435038

Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States

Science.gov (United States)

Mendels, Dan; Organic Electronics Group Technion Team

2014-03-01

An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

Asynchronous Channel-Hopping Scheme under Jamming Attacks

Directory of Open Access Journals (Sweden)

Yongchul Kim

2018-01-01

Full Text Available Cognitive radio networks (CRNs are considered an attractive technology to mitigate inefficiency in the usage of licensed spectrum. CRNs allow the secondary users (SUs to access the unused licensed spectrum and use a blind rendezvous process to establish communication links between SUs. In particular, quorum-based channel-hopping (CH schemes have been studied recently to provide guaranteed blind rendezvous in decentralized CRNs without using global time synchronization. However, these schemes remain vulnerable to jamming attacks. In this paper, we first analyze the limitations of quorum-based rendezvous schemes called asynchronous channel hopping (ACH. Then, we introduce a novel sequence sensing jamming attack (SSJA model in which a sophisticated jammer can dramatically reduce the rendezvous success rates of ACH schemes. In addition, we propose a fast and robust asynchronous rendezvous scheme (FRARS that can significantly enhance robustness under jamming attacks. Our numerical results demonstrate that the performance of the proposed scheme vastly outperforms the ACH scheme when there are security concerns about a sequence sensing jammer.

Passive sorting of capsules by deformability

Science.gov (United States)

Haener, Edgar; Juel, Anne

We study passive sorting according to deformability of liquid-filled ovalbumin-alginate capsules. We present results for two sorting geometries: a straight channel with a half-cylindrical obstruction and a pinched flow fractioning device (PFF) adapted for use with capsules. In the half-cylinder device, the capsules deform as they encounter the obstruction, and travel around the half-cylinder. The distance from the capsule's centre of mass to the surface of the half-cylinder depends on deformability, and separation between capsules of different deformability is amplified by diverging streamlines in the channel expansion downstream of the obstruction. We show experimentally that capsules can be sorted according to deformability with their downstream position depending on capillary number only, and we establish the sensitivity of the device to experimental variability. In the PFF device, particles are compressed against a wall using a strong pinching flow. We show that capsule deformation increases with the intensity of the pinching flow, but that the downstream capsule position is not set by deformation in the device. However, when using the PFF device like a T-Junction, we achieve improved sorting resolution compared to the half-cylinder device.

"Makin' Somethin' Outta Little-to-Nufin'': Racism, Revision and Rotating Records--The Hip-Hop DJ in Composition Praxis

Science.gov (United States)

Craig, Todd

2015-01-01

Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…

On Sorting Genomes with DCJ and Indels

Science.gov (United States)

Braga, Marília D. V.

A previous work of Braga, Willing and Stoye compared two genomes with unequal content, but without duplications, and presented a new linear time algorithm to compute the genomic distance, considering double cut and join (DCJ) operations, insertions and deletions. Here we derive from this approach an algorithm to sort one genome into another one also using DCJ, insertions and deletions. The optimal sorting scenarios can have different compositions and we compare two types of sorting scenarios: one that maximizes and one that minimizes the number of DCJ operations with respect to the number of insertions and deletions.

Contributions to the quality control of two crops of economic importance : hops and yerba mate

NARCIS (Netherlands)

Wilson, Erica Georgina

2012-01-01

Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

Algorithm 426 : Merge sort algorithm [M1

NARCIS (Netherlands)

Bron, C.

1972-01-01

Sorting by means of a two-way merge has a reputation of requiring a clerically complicated and cumbersome program. This ALGOL 60 procedure demonstrates that, using recursion, an elegant and efficient algorithm can be designed, the correctness of which is easily proved [2]. Sorting n objects gives

Magnethophoretic sorting of fluid catalytic cracking particles

NARCIS (Netherlands)

Solsona, Miguel; Nieuwelink, A. E.; Odijk, Mathieu; Meirer, Florian; Abelmann, Leon; Olthuis, Wouter; Weckhuysen, Bert M.; van den Berg, Albert; Lee, Abraham; DeVoe, Don

2017-01-01

We demonstrate an on-chip particle activity sorter, focused on iron concentration and based on magnetophoresis. This device was used for fast sorting of stepwise homogenously distributed [Fe]s. The preliminary results are very encouraging. We show that we can sort particles on magnetic moment, with

Sorting Tubules Regulate Blood-Brain Barrier Transcytosis

Directory of Open Access Journals (Sweden)

Roberto Villaseñor

2017-12-01

Full Text Available Transcytosis across the blood-brain barrier (BBB regulates key processes of the brain, but the intracellular sorting mechanisms that determine successful receptor-mediated transcytosis in brain endothelial cells (BECs remain unidentified. Here, we used Transferrin receptor-based Brain Shuttle constructs to investigate intracellular transport in BECs, and we uncovered a pathway for the regulation of receptor-mediated transcytosis. By combining live-cell imaging and mathematical modeling in vitro with super-resolution microscopy of the BBB, we show that intracellular tubules promote transcytosis across the BBB. A monovalent construct (sFab sorted for transcytosis was localized to intracellular tubules, whereas a bivalent construct (dFab sorted for degradation formed clusters with impaired transport along tubules. Manipulating tubule biogenesis by overexpressing the small GTPase Rab17 increased dFab transport into tubules and induced its transcytosis in BECs. We propose that sorting tubules regulate transcytosis in BECs and may be a general mechanism for receptor-mediated transport across the BBB.

Emergent gravity in the cubic tight-binding model of Weyl semimetal in the presence of elastic deformations

Energy Technology Data Exchange (ETDEWEB)

Cortijo, Alberto [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, 28049 Madrid (Spain); Zubkov, M.A., E-mail: zubkov@itep.ru [ITEP, B. Cheremushkinskaya 25, Moscow, 117259 (Russian Federation); Moscow Institute of Physics and Technology, 9, Institutskii per., Dolgoprudny, Moscow Region, 141700 (Russian Federation); Far Eastern Federal University, School of Biomedicine, 690950 Vladivostok (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Kashirskoe highway 31, 115409 Moscow (Russian Federation)

2016-03-15

We consider the tight-binding model with cubic symmetry that may be relevant for the description of a certain class of Weyl semimetals. We take into account elastic deformations of the semimetal through the modification of hopping parameters. This modification results in the appearance of emergent gauge field and the coordinate dependent anisotropic Fermi velocity. The latter may be interpreted as emergent gravitational field.

Hopping mixed hybrid excitations in multiple composite quantum wire structures

International Nuclear Information System (INIS)

Nguyen Ba An; Tran Thai Hoa

1995-10-01

A structure consisting of N pairs of inorganic semiconductor and organic quantum wires is considered theoretically. In such an isolated pair of wires, while the intrawire coupling forms Wannier-Mott exciton in an inorganic semiconductor quantum wire and Frenkel exciton in an organic one, the interwire coupling gives rise to hybrid excitons residing within the pair. When N pairs of wires are packed together 2N new mixed hybrid modes appear that are the true elementary excitations and can hop throughout the whole structure. Energies and wave functions of such hopping mixed hybrid excitations are derived analytically in detail accounting for the global interwire coupling and the different polarization configurations. (author). 19 refs

A many-sorted calculus based on resolution and paramodulation

CERN Document Server

Walther, Christoph

1987-01-01

A Many-Sorted Calculus Based on Resolution and Paramodulation emphasizes the utilization of advantages and concepts of many-sorted logic for resolution and paramodulation based automated theorem proving.This book considers some first-order calculus that defines how theorems from given hypotheses by pure syntactic reasoning are obtained, shifting all the semantic and implicit argumentation to the syntactic and explicit level of formal first-order reasoning. This text discusses the efficiency of many-sorted reasoning, formal preliminaries for the RP- and ?RP-calculus, and many-sorted term rewrit

Analysis of the trajectory surface hopping method from the Markov state model perspective

International Nuclear Information System (INIS)

Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara

2015-01-01

We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping

Science.gov (United States)

Bai, Xin; Qiu, Jing; Wang, Linjun

2018-03-01

We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.

Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

Science.gov (United States)

Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

2013-10-01

Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

An empirical study on SAJQ (Sorting Algorithm for Join Queries

Directory of Open Access Journals (Sweden)

Hassan I. Mathkour

2010-06-01

Full Text Available Most queries that applied on database management systems (DBMS depend heavily on the performance of the used sorting algorithm. In addition to have an efficient sorting algorithm, as a primary feature, stability of such algorithms is a major feature that is needed in performing DBMS queries. In this paper, we study a new Sorting Algorithm for Join Queries (SAJQ that has both advantages of being efficient and stable. The proposed algorithm takes the advantage of using the m-way-merge algorithm in enhancing its time complexity. SAJQ performs the sorting operation in a time complexity of O(nlogm, where n is the length of the input array and m is number of sub-arrays used in sorting. An unsorted input array of length n is arranged into m sorted sub-arrays. The m-way-merge algorithm merges the sorted m sub-arrays into the final output sorted array. The proposed algorithm keeps the stability of the keys intact. An analytical proof has been conducted to prove that, in the worst case, the proposed algorithm has a complexity of O(nlogm. Also, a set of experiments has been performed to investigate the performance of the proposed algorithm. The experimental results have shown that the proposed algorithm outperforms other Stable–Sorting algorithms that are designed for join-based queries.

In and out of love with hip-hop: saliency of sexual scripts for young adult African American women in hip-hop and Black-oriented television.

Science.gov (United States)

Coleman, M Nicole; Butler, Ebony O; Long, Amanda M; Fisher, Felicia D

2016-10-01

Hip-hop media and Black-oriented reality television are powerful mechanisms for conveying and promoting stereotypes of Black women. Black women's sexuality is frequently presented as highly-salient in each medium. However, little is known about the impact of those images on Black women's sexuality and identity. The current study uses focus-group methodology to engage young adult Black in critical discussion of two predominant sexual scripts found in hip-hop music and Black-oriented reality television - the Freak and the Gold Digger. Analyses revealed shared and distinct aspects of each sexual script represented in both media and the impact of those scripts on participants' experiences. Implications for future research are discussed.

Hip-Hop--What's in It for the Academy? Self-Understanding, Pedagogy and Aesthetical Learning Processes in Everyday Cultural Praxis

Science.gov (United States)

Söderman, Johan; Sernhede, Ove

2016-01-01

Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…

Science and technology of kernels and TRISO coated particle sorting

International Nuclear Information System (INIS)

Nothnagel, G.

2006-09-01

The ~1mm diameter TRISO coated particles, which form the elemental units of PBMR nuclear fuel, has to be close to spherical in order to best survive damage during sphere pressing. Spherical silicon carbide layers further provide the strongest miniature pressure vessels for fission product retention. To make sure that the final product contains particles of acceptable shape, 100% of kernels and coated particles have to be sorted on a surface-ground sorting table. Broken particles, twins, irregular (odd) shapes and extreme ellipsoids have to be separated from the final kernel and coated particle batches. Proper sorting of particles is an extremely important step in quality fuel production as the final failure fraction depends sensitively on the quality of sorting. After sorting a statistically significant sample of the sorted product is analysed for sphericity, which is defined as the ratio of maximum to minimum diameter, as part of a standard QC test to ensure conformance to German specifications. In addition a burn-leach test is done on coated particles (before pressing) and fuel spheres (after pressing) to ensure adherence to failure specifications. Because of the extreme importance of particle sorting for assurance of fuel quality it is essential to have an in-depth understanding of the capabilities and limitations of particle sorting. In this report a systematic scientific rationale is developed, from fundamental principles, to provide a basis for understanding the relationship between product quality and sorting parameters. The principles and concepts, developed in this report, will be of importance when future sorting tables (or equivalents) are to be designed. A number of new concepts and methodologies are developed to assist with equivalence validation of any two sorting tables. This is aimed in particular towards quantitative assessment of equivalence between current QC tables (closely based on the original NUKEM parameters, except for the driving mechanism

Anomalous temperature dependence of the Seebeck coefficient for the substitutionally-disordered hopping conductors

International Nuclear Information System (INIS)

Raffaelle, R.P.; Parris, P.E.; Anderson, H.U.; Sparlin, D.M.

1991-01-01

Thermoelectric power measurements are presented for the (La,Sr)(Cr,Mn)O 3 series. The nonlinear temperature dependence of the Seebeck coefficient is analyzed in terms of a random distribution of energetically equivalent hopping sites. The limitations of Heikes' formula, which has been traditionally used to calculate small polaron carrier densities in these systems, are discussed. Recent theoretical developments in the interpretation of Seebeck measurements in substitutionally-disordered high-temperature hopping conductors are reviewed

Kinematic and Kinetic Analysis of the Single-Leg Triple Hop Test in Women With and Without Patellofemoral Pain.

Science.gov (United States)

dos Reis, Amir Curcio; Correa, João Carlos Ferrari; Bley, André Serra; Rabelo, Nayra Deise dos Anjos; Fukuda, Thiago Yukio; Lucareli, Paulo Roberto Garcia

2015-10-01

Cross-sectional study. To compare the biomechanical strategies of the trunk and lower extremity during the transition period between the first and second hop of a single-leg triple hop test in women with and without patellofemoral pain (PFP). Recent literature has shown that PFP is associated with biomechanical impairments of the lower extremities. A number of studies have analyzed the position of the trunk and lower extremities for functional activities such as walking, squatting, jumping, and the step-down test. However, studies on more challenging activities, such as the single-leg triple hop test, may be more representative of sports requiring jumping movements. Women between 18 and 35 years of age (control group, n = 20; PFP group, n = 20) participated in the study. Three-dimensional kinematic and kinetic data were collected during the transition period between the first and second hops while participants performed the single-leg triple hop test. Compared to the control group, women with PFP exhibited greater (Pkinetics.

The Container Problem in Bubble-Sort Graphs

Science.gov (United States)

Suzuki, Yasuto; Kaneko, Keiichi

Bubble-sort graphs are variants of Cayley graphs. A bubble-sort graph is suitable as a topology for massively parallel systems because of its simple and regular structure. Therefore, in this study, we focus on n-bubble-sort graphs and propose an algorithm to obtain n-1 disjoint paths between two arbitrary nodes in time bounded by a polynomial in n, the degree of the graph plus one. We estimate the time complexity of the algorithm and the sum of the path lengths after proving the correctness of the algorithm. In addition, we report the results of computer experiments evaluating the average performance of the algorithm.

Multi-hop Relaying: An End-to-End Delay Analysis

KAUST Repository

Chaaban, Anas; Sezgin, Aydin

2015-01-01

The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode

Heuristic framework for parallel sorting computations | Nwanze ...

African Journals Online (AJOL)

Parallel sorting techniques have become of practical interest with the advent of new multiprocessor architectures. The decreasing cost of these processors will probably in the future, make the solutions that are derived thereof to be more appealing. Efficient algorithms for sorting scheme that are encountered in a number of ...

Fruit Sorting Using Fuzzy Logic Techniques

Science.gov (United States)

Elamvazuthi, Irraivan; Sinnadurai, Rajendran; Aftab Ahmed Khan, Mohamed Khan; Vasant, Pandian

2009-08-01

Fruit and vegetables market is getting highly selective, requiring their suppliers to distribute the goods according to very strict standards of quality and presentation. In the last years, a number of fruit sorting and grading systems have appeared to fulfill the needs of the fruit processing industry. However, most of them are overly complex and too costly for the small and medium scale industry (SMIs) in Malaysia. In order to address these shortcomings, a prototype machine was developed by integrating the fruit sorting, labeling and packing processes. To realise the prototype, many design issues were dealt with. Special attention is paid to the electronic weighing sub-system for measuring weight, and the opto-electronic sub-system for determining the height and width of the fruits. Specifically, this paper discusses the application of fuzzy logic techniques in the sorting process.

Hip-Hop Feminism: A Standpoint to Enhance the Positive Self-Identity of Black College Women

Science.gov (United States)

Henry, Wilma J.

2010-01-01

The popularity of hip-hop among young Black college women, coupled with the deluge of negative and positive messages in this culture regarding these women's identity, signals an opportunity for the arrival of a contemporary, culturally relevant epistemology--hip-hop feminism. Through the lens of Black feminist theory, this article explores hip-hop…

Vulnerability And Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

International Nuclear Information System (INIS)

Durling, R.L. Jr.; Price, D.E.; Spero, K.K.

2005-01-01

For over ten years, the Counterproliferation Analysis and Planning System (CAPS) at Lawrence Livermore National Laboratory (LLNL) has been a planning tool used by U.S. combatant commands for mission support planning against foreign programs engaged in the manufacture of weapons of mass destruction (WMD). CAPS is endorsed by the Secretary of Defense as the preferred counterproliferation tool to be used by the nation's armed services. A sister system, the Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging CAPS expertise designed to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors, HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities is presented

Investigación a ritmo de hip-hop

Directory of Open Access Journals (Sweden)

Melisa Rivière

2013-09-01

Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.

Science.gov (United States)

Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W

2009-07-01

The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.

Tradeoffs Between Branch Mispredictions and Comparisons for Sorting Algorithms

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Moruz, Gabriel

2005-01-01

Branch mispredictions is an important factor affecting the running time in practice. In this paper we consider tradeoffs between the number of branch mispredictions and the number of comparisons for sorting algorithms in the comparison model. We prove that a sorting algorithm using O(dnlog n......) comparisons performs Omega(nlogd n) branch mispredictions. We show that Multiway MergeSort achieves this tradeoff by adopting a multiway merger with a low number of branch mispredictions. For adaptive sorting algorithms we similarly obtain that an algorithm performing O(dn(1+log (1+Inv/n))) comparisons must...... perform Omega(nlogd (1+Inv/n)) branch mispredictions, where Inv is the number of inversions in the input. This tradeoff can be achieved by GenericSort by Estivill-Castro and Wood by adopting a multiway division protocol and a multiway merging algorithm with a low number of branch mispredictions....

Recent progress in multi-electrode spike sorting methods.

Science.gov (United States)

Lefebvre, Baptiste; Yger, Pierre; Marre, Olivier

2016-11-01

In recent years, arrays of extracellular electrodes have been developed and manufactured to record simultaneously from hundreds of electrodes packed with a high density. These recordings should allow neuroscientists to reconstruct the individual activity of the neurons spiking in the vicinity of these electrodes, with the help of signal processing algorithms. Algorithms need to solve a source separation problem, also known as spike sorting. However, these new devices challenge the classical way to do spike sorting. Here we review different methods that have been developed to sort spikes from these large-scale recordings. We describe the common properties of these algorithms, as well as their main differences. Finally, we outline the issues that remain to be solved by future spike sorting algorithms. Copyright © 2017 Elsevier Ltd. All rights reserved.

Acoustic bubble sorting for ultrasound contrast agent enrichment.

Science.gov (United States)

Segers, Tim; Versluis, Michel

2014-05-21

An ultrasound contrast agent (UCA) suspension contains encapsulated microbubbles with a wide size distribution, with radii ranging from 1 to 10 μm. Medical transducers typically operate at a single frequency, therefore only a small selection of bubbles will resonate to the driving ultrasound pulse. Thus, the sensitivity can be improved by narrowing down the size distribution. Here, we present a simple lab-on-a-chip method to sort the population of microbubbles on-chip using a traveling ultrasound wave. First, we explore the physical parameter space of acoustic bubble sorting using well-defined bubble sizes formed in a flow-focusing device, then we demonstrate successful acoustic sorting of a commercial UCA. This novel sorting strategy may lead to an overall improvement of the sensitivity of contrast ultrasound by more than 10 dB.

On the Performance Analysis of Dual-Hop FSO Fixed Gain Transmission Systems

KAUST Repository

Zedini, Emna

2015-12-12

Novel exact closed-form results for the end-to-end performance analysis of dual-hop free-space optical (FSO) fixed-gain relaying systems under heterodyne detection as well as intensity modulation with direct detection techniques in the presence of atmospheric turbulence as well as pointing errors are presented. By using dual-hop FSO relaying, we demonstrate a better system performance relative to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

Science.gov (United States)

Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

2010-01-01

This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

Science.gov (United States)

Emdin, Christopher

2011-01-01

This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

I Feel What He Was Doin': Responding to Justice-Oriented Teaching through Hip-Hop Aesthetics

Science.gov (United States)

Petchauer, Emery

2011-01-01

This study illustrates a set of learning activities designed from two hip-hop aesthetics and explores their use among a classroom of African American preservice teachers who graduated from urban school districts. Based on the two hip-hop aesthetics of kinetic consumption and autonomy/distance, the specific goal of these learning activities is to…

"You Don't Have to Claim Her": Reconstructing Black Femininity through Critical Hip-Hop Literacy

Science.gov (United States)

Kelly, Lauren Leigh

2016-01-01

This article explores the ways in which females who identify with hip-hop often develop and construct their identities in relation to media representations of blackness and femininity in hip-hop music and culture. In order for educators to support female students in constructing identities of empowerment and agency, they should be willing and able…

Fresh Faces, New Places: Moving beyond Teacher-Researcher Perspectives in Hip-Hop-Based Education Research

Science.gov (United States)

Irby, Decoteau J.; Hall, H. Bernard

2011-01-01

Grounded in critical and culturally relevant theory, hip-hop-based education (HHBE) research documents the use of hip-hop in educational settings. Despite the richness of the emerging field, overreliance on teacher-researcher perspectives leaves much to be desired. Little is known of the extent and ways HHBE is used by nonresearching K-12…

A very general rate expression for charge hopping in semiconducting polymers

Energy Technology Data Exchange (ETDEWEB)

Fornari, Rocco P.; Aragó, Juan; Troisi, Alessandro [Department of Chemistry and Centre for Scientific Computing, University of Warwick, Coventry CV4 7AL (United Kingdom)

2015-05-14

We propose an expression of the hopping rate between localized states in semiconducting disordered polymers that contain the most used rates in the literature as special cases. We stress that these rates cannot be obtained directly from electron transfer rate theories as it is not possible to define diabatic localized states if the localization is caused by disorder, as in most polymers, rather than nuclear polarization effects. After defining the separate classes of accepting and inducing nuclear modes in the system, we obtain a general expression of the hopping rate. We show that, under the appropriate limits, this expression reduces to (i) a single-phonon rate expression or (ii) the Miller-Abrahams rate or (iii) a multi-phonon expression. The description of these limits from a more general expression is useful to interpolate between them, to validate the assumptions of each limiting case, and to define the simplest rate expression that still captures the main features of the charge transport. When the rate expression is fed with a range of realistic parameters the deviation from the Miller-Abrahams rate is large or extremely large, especially for hopping toward lower energy states, due to the energy gap law.

Switched diversity strategies for dual-hop amplify-and-forward relaying systems

KAUST Repository

Gaaloul, Fakhreddine

2012-01-01

This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

Hydraulic Circuit of Mechanical Pruner Drive for Hops on Low Trellises

Directory of Open Access Journals (Sweden)

Hoffmann David

2015-09-01

Full Text Available A mechanical pruner serves for pruning new hopvine shoots in spring. The later yield depends on the right timing and quality of pruning. That is why hop pruning is one of the most important agrotechnical procedures. A double-disc mechanical pruner used on high trellises cannot be used on low trellises due to its large size. Abroad, for pruning hops on low trellises a specially adapted sprinkler is used (chemical pruning. With regard to the effort to minimize the chemical environmental burden, we opted for the design of the mechanical pruner. Firstly, the low trellis, mechanical pruner, and also elements used in the design of hydraulic circuit are described. Next part of the paper is devoted to the input requirements for both the hydraulic circuit and the mechanical pruner designs. Then a description of an adapted inter-axle carrier used for the experimental model of the hop mechanical pruner and of the effected field measurement follows, along with interpretation of the measured data. These data are depicted in clearly arranged graphs showing the dependency of pressure and hydraulic oil flow on the cutting disc rotational frequency.

Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

DEFF Research Database (Denmark)

Dyre, Jeppe; Schrøder, Thomas

1996-01-01

A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation path...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

Automatic Color Sorting of Hardwood Edge-Glued Panel Parts

Science.gov (United States)

D. Earl Kline; Richard Conners; Qiang Lu; Philip A. Araman

1997-01-01

This paper describes an automatic color sorting system for red oak edge-glued panel parts. The color sorting system simultaneously examines both faces of a panel part and then determines which face has the "best" color, and sorts the part into one of a number of color classes at plant production speeds. Initial test results show that the system generated over...

Subunit Organisation of In Vitro Reconstituted HOPS and CORVET Multisubunit Membrane Tethering Complexes

Science.gov (United States)

Guo, Zhong; Johnston, Wayne; Kovtun, Oleksiy; Mureev, Sergey; Bröcker, Cornelia; Ungermann, Christian; Alexandrov, Kirill

2013-01-01

Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data. PMID:24312556

Jovens mulheres: reflexões sobre juventude e gênero a partir do Movimento Hip Hop

Directory of Open Access Journals (Sweden)

Maria Natália Matias-Rodrigues

2014-01-01

Full Text Available Este trabajo es el resultado de una investigación realizada en la maestría en psicología donde discutimos la experiencia de mujeres jóvenes raperas. Partimos de un enfoque cualitativo para realizar: observaciones al Movimiento Hip Hop en la ciudad de Recife-Nordeste de Brasil; entrevistas semi-estructuradas a mujeres jóvenes raperas y análisis a diez composiciones de Rap producidas por mujeres. Percibimos en el Movimiento Hip Hop, que si bien valora la presencia de mujeres, todavía continúa reproduciendo discursos hegemónicos relacionados con las desigualdades de género. La participación de las mujeres en este Movimiento ha contribuido a desestabilizar la dicotomía público / privada; ellas, a través de sus músicas, consiguen espacios de visibilidad, pueden desafiar los códigos del género del Movimiento Hip Hop, proponiendo nuevas formas de pensar y de tener voz y voto, en una sociedad marcada por los valores machistas. Palabras clave autoras: movimiento hip hop.

Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network

Science.gov (United States)

Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji

In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.

Automorphism group of the modified bubble-sort graph

OpenAIRE

Ganesan, Ashwin

2014-01-01

The modified bubble-sort graph of dimension $n$ is the Cayley graph of $S_n$ generated by $n$ cyclically adjacent transpositions. In the present paper, it is shown that the automorphism group of the modified bubble sort graph of dimension $n$ is $S_n \\times D_{2n}$, for all $n \\ge 5$. Thus, a complete structural description of the automorphism group of the modified bubble-sort graph is obtained. A similar direct product decomposition is seen to hold for arbitrary normal Cayley graphs generate...

Small polaron hopping in magnetic semiconductors

International Nuclear Information System (INIS)

Emin, D.; Liu, N.L.H.

1978-01-01

In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

Energy Technology Data Exchange (ETDEWEB)

Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

2015-10-07

We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

Sorting signed permutations by short operations.

Science.gov (United States)

Galvão, Gustavo Rodrigues; Lee, Orlando; Dias, Zanoni

2015-01-01

During evolution, global mutations may alter the order and the orientation of the genes in a genome. Such mutations are referred to as rearrangement events, or simply operations. In unichromosomal genomes, the most common operations are reversals, which are responsible for reversing the order and orientation of a sequence of genes, and transpositions, which are responsible for switching the location of two contiguous portions of a genome. The problem of computing the minimum sequence of operations that transforms one genome into another - which is equivalent to the problem of sorting a permutation into the identity permutation - is a well-studied problem that finds application in comparative genomics. There are a number of works concerning this problem in the literature, but they generally do not take into account the length of the operations (i.e. the number of genes affected by the operations). Since it has been observed that short operations are prevalent in the evolution of some species, algorithms that efficiently solve this problem in the special case of short operations are of interest. In this paper, we investigate the problem of sorting a signed permutation by short operations. More precisely, we study four flavors of this problem: (i) the problem of sorting a signed permutation by reversals of length at most 2; (ii) the problem of sorting a signed permutation by reversals of length at most 3; (iii) the problem of sorting a signed permutation by reversals and transpositions of length at most 2; and (iv) the problem of sorting a signed permutation by reversals and transpositions of length at most 3. We present polynomial-time solutions for problems (i) and (iii), a 5-approximation for problem (ii), and a 3-approximation for problem (iv). Moreover, we show that the expected approximation ratio of the 5-approximation algorithm is not greater than 3 for random signed permutations with more than 12 elements. Finally, we present experimental results that show

Real-World Sorting of RHIC Superconducting Magnets

International Nuclear Information System (INIS)

Wei, J.; Gupta, R.; Harrison, M.; Jain, A.; Peggs, S.; Thompson, P.; Trbojevic, D.; Wanderer, P.

1999-01-01

During the seven-year construction of the Relativistic Heavy Ion Collider (RHIC), more than 1700 superconducting dipoles, quadrupoles, sextupoles, and multi-layer correctors have been constructed and installed. These magnets have been sorted at several production stages to optimize their performance and reliability. For arc magnets, priorities have bene put first on quench performance and operational risk minimization, second on field transfer function and other first-order quantities, and finally on nonlinear field errors which were painstakingly optimized at design. For Interaction-Region (IR) magnets, sorting is applied to select the best possible combination of magnets for the low-β interaction points (IP). This paper summarizes the history of this real-world sorting process

Sorting Out Seasonal Allergies

Science.gov (United States)

... Close ‹ Back to Healthy Living Sorting Out Seasonal Allergies Sneezing, runny nose, nasal congestion. Symptoms of the ... How do I know if I have seasonal allergies? According to Dr. Georgeson, the best way to ...

“Benvenuti all’inferno”: aggressione neo-nazista e cultura hip-hop turco-tedesca negli anni Novanta

Directory of Open Access Journals (Sweden)

Matthias Kappler

2013-12-01

Full Text Available The article explores the trauma of the racist attacks of Hoyerswerda, Rostock-Lichtenhagen, Mölln and Solingen in the early 1990s and their impact on the Turkish community in Germany using the example of rap lyrics composed during those years. Hip-hop culture in Germany is primarily appropriated by male immigrant youths, especially with Turkish roots. During the first years of German rap (early 1990s, it is thus natural that the themes of the rappers were dominated by issues of social integration, multicultural coexistence and, after traumatic events of the racist attacks, of xenophobia and racism. After a short introduction to Turkish-German hip-hop culture (general features, social and cultural implications, Kanaksta Rap and the Kanak Attak community, the article provides some lyrics (in German and Turkish and an analysis of the reception of the attacks in German hip-hop culture, especially in the production of the rap formation Cartel, a merging of several hip-hop groups with mainly Turkish elements.

Development of a reactor thermalhydraulic experiment databank(SORTED1)

International Nuclear Information System (INIS)

Bang, Young Seck; Kim, Eun Kyoung; Kim, Hho Jung; Lee, Sang Yong

1994-01-01

The recent trend in thermalhydraulic safety analysis of nuclear power plant shows the best-estimate and probabilistic approaches, therefore, the verification of the best-estimate code based on the applicable experiment data has been required. The present study focused on developing a simple databank, SORTED1, to be effectively used for code verification. The development of SORTED1 includes a data collection from the various sources including ENCOUNTER, which is the reactor safety data bank of U.S. Nuclear Regulatory Commission, a reorganization of collected resources suitable for requirements of SORTED1 database management system (DBMS), and a development of a simple DBMS. The SORTED1 is designed in Unix environment with graphic user interface to improve a user convenience and has a capability to provide the test related information. The currently registered data in SORTED1 cover 759 thermalhydraulic tests including LOFT, Semiscale, etc

Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture

Science.gov (United States)

Baszile, Denise Taliaferro

2009-01-01

Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…

Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

Science.gov (United States)

Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

2017-11-01

Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

Second Culture, Good Vibrations, and Writings on the Wall: Hip-Hop in the GDR as a Case of Afro-Americanophilia

Directory of Open Access Journals (Sweden)

Leonard Schmieding

2015-09-01

Full Text Available This essay examines Afro-Americanophilia in the German Democratic Republic by analyzing the cultural transfer of hip-hop between 1983 and 1990. It argues that the individuals who participated in this transfer from the United States into East Germany shared an appreciation of African Americans and Black culture and thus facilitated the import, growth, and dissemination of breakdance, graffiti, rap, and deejaying. Focusing on three individuals, it details the specific characteristics of their Afro-Americanophilia and scrutinizes their roles for the hip-hop scene in state socialism. While a cultural critic interpreted hip-hop as ‘second culture,’ which, according to Marxist-Leninist ideology, was to be endorsed as international working-class culture, a radio host from East Berlin spread information and music throughout the country, equipping the teenage audience with what they needed for their own practice of hip-hop. Finally, a look at a graffiti writer from Dresden shows how hip-hop artists imagined themselves into the community of hip-hop in New York City and fashioned themselves as Black youth living in the Bronx.

Determination of the Geographical and Botanical Origin of Hops (Humulus lupulus L.) Using Stable Isotopes of C, N, and S.

Science.gov (United States)

Ocvirk, Miha; Ogrinc, Nives; Košir, Iztok Jože

2018-02-28

A need exists for a reliable method to determine the geographical and botanical origin of hops. For this study, three sets of samples were collected: the first set comprised 5 German samples; the second set comprised samples of hops from 10 of the world's major hop-growing regions; and the third comprised the 4 main Slovenian regions. The samples were analyzed using isotope ratio mass spectrometry (IRMS) to obtain δ 13 C, δ 15 N, and δ 34 S values. The δ 15 N (2.2 ‰ to 8.4 ‰) and δ 34 S (0.7 ‰ to 12.3 ‰) values were the most discriminating parameters for classifying hop according to geographical origin. ANOVA showed distinct groupings for 8 out of the 10 hop-growing regions. Although it was not possible to distinguish the geographical origin of hops based on δ 13 C (-28.9 ‰ to -24.7 ‰), in the case of botanical origin, δ 13 C values proved to be the most discriminative albeit with limited success.

Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

Science.gov (United States)

Liu, Zechang; Wang, Liping; Liu, Yumei

2018-01-18

Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

KAUST Repository

Gaaloul, Fakhreddine

2012-02-13

This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a single-antenna station is assumed to relay information from a multiple-antenna transmitter to a multiple-antenna receiver, and the activation of the receive antennas is adaptively performed based on the second-hop statistics, regardless of the first-hop conditions. On the other hand, the two-phase-based combining suggests using multiple single-antenna stations between the multiple-antenna transmitter and the single-antenna receiver, where the suitable set of active relays is identified according to the precombining end-to-end fading conditions. To facilitate comparisons between the two schemes, formulations for the statistics of the combined signal-to-noise ratio and some performance measures are presented. Numerical and simulation results are shown to clarify the tradeoff between the achieved diversity-array gain, the processing complexity, and the power consumption.

Study on a resource allocation scheme in multi-hop MIMO-OFDM systems over lognormal-rayleigh compound channels

Directory of Open Access Journals (Sweden)

LIU Jun

2015-10-01

Full Text Available For new generation wireless communication networks,this paper studies the optimization of the capacity and end-to-end throughput of the MIMO-OFDM based multi-hop relay systems.A water-filling power allocation method is proposed to improve the channel capacity and the throughput of the MIMO-OFDM system based multi-hop relay system in the Lognormal-Rayleigh shadowing compound channels.Simulations on the capacity and throughput show that the water-filling algorithm can improve the system throughput effectively in the MIMO-OFDM multi-hop relay system.

Attractor hopping between polarization dynamical states in a vertical-cavity surface-emitting laser subject to parallel optical injection

Science.gov (United States)

Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc

2018-03-01

We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.

NeatSort - A practical adaptive algorithm

OpenAIRE

La Rocca, Marcello; Cantone, Domenico

2014-01-01

We present a new adaptive sorting algorithm which is optimal for most disorder metrics and, more important, has a simple and quick implementation. On input $X$, our algorithm has a theoretical $\\Omega (|X|)$ lower bound and a $\\mathcal{O}(|X|\\log|X|)$ upper bound, exhibiting amazing adaptive properties which makes it run closer to its lower bound as disorder (computed on different metrics) diminishes. From a practical point of view, \\textit{NeatSort} has proven itself competitive with (and of...

Queue and stack sorting algorithm optimization and performance analysis

Science.gov (United States)

Qian, Mingzhu; Wang, Xiaobao

2018-04-01

Sorting algorithm is one of the basic operation of a variety of software development, in data structures course specializes in all kinds of sort algorithm. The performance of the sorting algorithm is directly related to the efficiency of the software. A lot of excellent scientific research queue is constantly optimizing algorithm, algorithm efficiency better as far as possible, the author here further research queue combined with stacks of sorting algorithms, the algorithm is mainly used for alternating operation queue and stack storage properties, Thus avoiding the need for a large number of exchange or mobile operations in the traditional sort. Before the existing basis to continue research, improvement and optimization, the focus on the optimization of the time complexity of the proposed optimization and improvement, The experimental results show that the improved effectively, at the same time and the time complexity and space complexity of the algorithm, the stability study corresponding research. The improvement and optimization algorithm, improves the practicability.

O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

Directory of Open Access Journals (Sweden)

Cristiano Nunes Alves

2013-01-01

Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

Conformational Transitions and Convergence of Absolute Binding Free Energy Calculations

Science.gov (United States)

Lapelosa, Mauro; Gallicchio, Emilio; Levy, Ronald M.

2011-01-01

The Binding Energy Distribution Analysis Method (BEDAM) is employed to compute the standard binding free energies of a series of ligands to a FK506 binding protein (FKBP12) with implicit solvation. Binding free energy estimates are in reasonably good agreement with experimental affinities. The conformations of the complexes identified by the simulations are in good agreement with crystallographic data, which was not used to restrain ligand orientations. The BEDAM method is based on λ -hopping Hamiltonian parallel Replica Exchange (HREM) molecular dynamics conformational sampling, the OPLS-AA/AGBNP2 effective potential, and multi-state free energy estimators (MBAR). Achieving converged and accurate results depends on all of these elements of the calculation. Convergence of the binding free energy is tied to the level of convergence of binding energy distributions at critical intermediate states where bound and unbound states are at equilibrium, and where the rate of binding/unbinding conformational transitions is maximal. This finding mirrors similar observations in the context of order/disorder transitions as for example in protein folding. Insights concerning the physical mechanism of ligand binding and unbinding are obtained. Convergence for the largest FK506 ligand is achieved only after imposing strict conformational restraints, which however require accurate prior structural knowledge of the structure of the complex. The analytical AGBNP2 model is found to underestimate the magnitude of the hydrophobic driving force towards binding in these systems characterized by loosely packed protein-ligand binding interfaces. Rescoring of the binding energies using a numerical surface area model corrects this deficiency. This study illustrates the complex interplay between energy models, exploration of conformational space, and free energy estimators needed to obtain robust estimates from binding free energy calculations. PMID:22368530

Transcriptional profiling of cells sorted by RNA abundance

NARCIS (Netherlands)

Klemm, Sandy; Semrau, Stefan; Wiebrands, Kay; Mooijman, Dylan; Faddah, Dina A; Jaenisch, Rudolf; van Oudenaarden, Alexander

We have developed a quantitative technique for sorting cells on the basis of endogenous RNA abundance, with a molecular resolution of 10-20 transcripts. We demonstrate efficient and unbiased RNA extraction from transcriptionally sorted cells and report a high-fidelity transcriptome measurement of

Fast frequency hopping codes applied to SAC optical CDMA network

Science.gov (United States)

Tseng, Shin-Pin

2015-06-01

This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

Correlated Hopping in the 1D Falicov--Kimball Model

Science.gov (United States)

Gajek, Z.; Lemanski, R.

2001-10-01

Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

Model design and simulation of automatic sorting machine using proximity sensor

Directory of Open Access Journals (Sweden)

Bankole I. Oladapo

2016-09-01

Full Text Available The automatic sorting system has been reported to be complex and a global problem. This is because of the inability of sorting machines to incorporate flexibility in their design concept. This research therefore designed and developed an automated sorting object of a conveyor belt. The developed automated sorting machine is able to incorporate flexibility and separate species of non-ferrous metal objects and at the same time move objects automatically to the basket as defined by the regulation of the Programmable Logic Controllers (PLC with a capacitive proximity sensor to detect a value range of objects. The result obtained shows that plastic, wood, and steel were sorted into their respective and correct position with an average, sorting, time of 9.903 s, 14.072 s and 18.648 s respectively. The proposed developed model of this research could be adopted at any institution or industries, whose practices are based on mechatronics engineering systems. This is to guide the industrial sector in sorting of object and teaching aid to institutions and hence produce the list of classified materials according to the enabled sorting program commands.

The Hip Hop peer crowd: An opportunity for intervention to reduce tobacco use among at-risk youth.

Science.gov (United States)

Walker, Matthew W; Navarro, Mario A; Hoffman, Leah; Wagner, Dana E; Stalgaitis, Carolyn A; Jordan, Jeffrey W

2018-07-01

Peer crowds, peer groups with macro-level connections and shared norms that transcend geography and race/ethnicity, have been linked to risky health behaviors. Research has demonstrated that Hip Hop peer crowd identification, which is common among multicultural youth, is associated with increased risk of tobacco use. To address this, the FDA Center for Tobacco Products created Fresh Empire, the first national tobacco education campaign tailored for Hip Hop youth aged 12-17 who are multicultural (Hispanic, African American, Asian-Pacific Islander, or Multiracial). As part of campaign development, peer crowd (Hip Hop, Mainstream, Popular, Alternative, Country) and cigarette smoking status were examined for the first time with a nationally recruited sample. Youth were recruited via targeted social media advertisements. Participants aged 13-17 (n = 5153) self-reported peer crowd identification via the I-Base Survey™ and cigarette smoking status. Differences in smoking status by peer crowd were examined using chi-square and followed up with z-tests to identify specific differences. Alternative youth were most at risk of cigarette smoking, followed by Hip Hop. Specifically, Hip Hop youth were significantly less likely to be Non-susceptible Non-triers than Popular, Mainstream, and Country youth, and more likely to be Experimenters than Popular and Mainstream youth. Representative studies show that Alternative is relatively small compared to other high-risk crowds, such as the Hip Hop peer crowd. The current research underscores the potential utility of interventions tailored to larger at-risk crowds for campaigns like Fresh Empire. Published by Elsevier Ltd.

Two-sorted Point-Interval Temporal Logics

DEFF Research Database (Denmark)

Balbiani, Philippe; Goranko, Valentin; Sciavicco, Guido

2011-01-01

There are two natural and well-studied approaches to temporal ontology and reasoning: point-based and interval-based. Usually, interval-based temporal reasoning deals with points as particular, duration-less intervals. Here we develop explicitly two-sorted point-interval temporal logical framework...... whereby time instants (points) and time periods (intervals) are considered on a par, and the perspective can shift between them within the formal discourse. We focus on fragments involving only modal operators that correspond to the inter-sort relations between points and intervals. We analyze...

Robust segmentation of medical images using competitive hop field neural network as a clustering tool

International Nuclear Information System (INIS)

Golparvar Roozbahani, R.; Ghassemian, M. H.; Sharafat, A. R.

2001-01-01

This paper presents the application of competitive Hop field neural network for medical images segmentation. Our proposed approach consists of Two steps: 1) translating segmentation of the given medical image into an optimization problem, and 2) solving this problem by a version of Hop field network known as competitive Hop field neural network. Segmentation is considered as a clustering problem and its validity criterion is based on both intra set distance and inter set distance. The algorithm proposed in this paper is based on gray level features only. This leads to near optimal solutions if both intra set distance and inter set distance are considered at the same time. If only one of these distances is considered, the result of segmentation process by competitive Hop field neural network will be far from optimal solution and incorrect even for very simple cases. Furthermore, sometimes the algorithm receives at unacceptable states. Both these problems may be solved by contributing both in tera distance and inter distances in the segmentation (optimization) process. The performance of the proposed algorithm is tested on both phantom and real medical images. The promising results and the robustness of algorithm to system noises show near optimal solutions

Exact Results on Quantum Interference and Magnetoconductance in Variable-Range Hopping

Science.gov (United States)

Lin, Yeong-Lieh; Nori, Franco

1997-03-01

We study quantum interference effects on the transition strength for strongly localized electrons hopping on 2D square and 3D cubic lattices in a magnetic field B. In 2D, we obtain closed-form expressions for the tunneling probability between two arbitrary sites by exactly summing the corresponding phase factors of all directed paths connecting them. An analytic expression for the magnetoconductance, as an explicit function of the magnetic flux, is derived. A positive MC is clearly observed when turning on the magnetic field. When the strength of B reaches a certain value, which is inversely proportional to twice the hopping length, the MC is increased by a factor of two compared to that at zero field. The periodicity in the flux of the MC is found to be equal to hc/2e. In the experimentally important 3D case, we show how the interference patterns and the small-B behavior of the magnetoconductance vary according to the orientation of B. Furthermore, for a 3D sample, the effect on the low-flux MC due to the randomness of the angles between the hopping direction and the orientation of B is examined analytically.(Y.-L. Lin and F. Nori, Phys. Rev. Lett. 76), 4580 (1996); Phys. Rev. B 53, 15543 (1996).

Hops (Humulus lupulus L. Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

Directory of Open Access Journals (Sweden)

Michael D. Flythe

2017-08-01

Full Text Available Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L. produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid. Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1 the ionophore-like mechanism of action and spectrum of activity and (2 the literature available on the plant due to its use in brewing.

Abortion and contemporary hip-hop: a thematic analysis of lyrics from 1990-2015.

Science.gov (United States)

Premkumar, Ashish; Brown, Katherine; Mengesha, Biftu; Jackson, Andrea V

2017-07-01

To evaluate the representation of abortion in contemporary hip-hop music, gaining insight into the myriad of attitudes of abortion in the black community. We used Genius, an online storehouse for lyrical content, to identify songs by querying the database for search terms related to family planning, including slang terms. We then cross-referenced identified songs using an online list of songs about abortion. We analyzed eligible songs using grounded theory in order to identify key themes. Of 6577 songs available, a total of 101 songs performed by 122 individual artists met inclusion criteria. The majority of artists were Black men; five artists were Black women. Key themes were: use of abortion as braggadocio; equating abortion with sin, genocide, or murder; male pressure for women to seek abortion; and the specific association of Planned Parenthood services with abortion. The moral and ethical themes surrounding abortion in hip-hop lyrics reveal a unique perspective within a marginalized community. The overall negative context of abortion in hip-hop lyrics needs to be reconciled with the gendered, economic, historical, political, racial and ethnic background of hip-hop and rap music in America. This study is the first to evaluate lyrical content from contemporary popular music in relation to abortion and family planning. Examining the intersection of reproductive rights and popular culture can provide a unique insight into the limited knowledge of the perspectives of abortion in the black community. Copyright © 2017 Elsevier Inc. All rights reserved.

Sorting on STAR. [CDC computer algorithm timing comparison

Science.gov (United States)

Stone, H. S.

1978-01-01

Timing comparisons are given for three sorting algorithms written for the CDC STAR computer. One algorithm is Hoare's (1962) Quicksort, which is the fastest or nearly the fastest sorting algorithm for most computers. A second algorithm is a vector version of Quicksort that takes advantage of the STAR's vector operations. The third algorithm is an adaptation of Batcher's (1968) sorting algorithm, which makes especially good use of vector operations but has a complexity of N(log N)-squared as compared with a complexity of N log N for the Quicksort algorithms. In spite of its worse complexity, Batcher's sorting algorithm is competitive with the serial version of Quicksort for vectors up to the largest that can be treated by STAR. Vector Quicksort outperforms the other two algorithms and is generally preferred. These results indicate that unusual instruction sets can introduce biases in program execution time that counter results predicted by worst-case asymptotic complexity analysis.

Unsupervised spike sorting based on discriminative subspace learning.

Science.gov (United States)

Keshtkaran, Mohammad Reza; Yang, Zhi

2014-01-01

Spike sorting is a fundamental preprocessing step for many neuroscience studies which rely on the analysis of spike trains. In this paper, we present two unsupervised spike sorting algorithms based on discriminative subspace learning. The first algorithm simultaneously learns the discriminative feature subspace and performs clustering. It uses histogram of features in the most discriminative projection to detect the number of neurons. The second algorithm performs hierarchical divisive clustering that learns a discriminative 1-dimensional subspace for clustering in each level of the hierarchy until achieving almost unimodal distribution in the subspace. The algorithms are tested on synthetic and in-vivo data, and are compared against two widely used spike sorting methods. The comparative results demonstrate that our spike sorting methods can achieve substantially higher accuracy in lower dimensional feature space, and they are highly robust to noise. Moreover, they provide significantly better cluster separability in the learned subspace than in the subspace obtained by principal component analysis or wavelet transform.

A Quality Sorting of Fruit Using a New Automatic Image Processing Method

Science.gov (United States)

Amenomori, Michihiro; Yokomizu, Nobuyuki

This paper presents an innovative approach for quality sorting of objects such as apples sorting in an agricultural factory, using an image processing algorithm. The objective of our approach are; firstly to sort the objects by their colors precisely; secondly to detect any irregularity of the colors surrounding the apples efficiently. An experiment has been conducted and the results have been obtained and compared with that has been preformed by human sorting process and by color sensor sorting devices. The results demonstrate that our approach is capable to sort the objects rapidly and the percentage of classification valid rate was 100 %.

Sista Girl Rock: Women of Colour and Hip-Hop Deejaying as Raced/Gendered Knowledge and Language

Science.gov (United States)

Craig, Todd; Kynard, Carmen

2017-01-01

This article seeks to introduce and situate a seldom-explored subject: the role and contribution of women hip-hop deejays in the testosterone-filled genre called hip-hop. Grounding the analysis in the interviews of six women deejays--Spinderella, Kuttin Kandi, Pam the Funkstress, Reborn, Shorty Wop and Natasha Diggs--"Sista Girl Rock"…

Gender Sorting across K-12 Schools in the United States

Science.gov (United States)

Long, Mark C.; Conger, Dylan

2013-01-01

This article documents evidence of nonrandom gender sorting across K-12 schools in the United States. The sorting exists among coed schools and at all grade levels, and it is highest in the secondary school grades. We observe some gender sorting across school sectors and types: for instance, males are slightly underrepresented in private schools…

Security for multi-hop wireless networks

CERN Document Server

Mahmoud, Mohamed M E A

2014-01-01

This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

Correlated Hopping in the 1d Falicov-Kimball Model

International Nuclear Information System (INIS)

Gajek, Z.; Lemanski, R.

2001-01-01

Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

Software information sorting code 'PLUTO-R'

International Nuclear Information System (INIS)

Tsunematsu, Toshihide; Naraoka, Kenitsu; Adachi, Masao; Takeda, Tatsuoki

1984-10-01

A software information sorting code PLUTO-R is developed as one of the supporting codes of the TRITON system for the fusion plasma analysis. The objective of the PLUTO-R code is to sort reference materials of the codes in the TRITON code system. The easiness in the registration of information is especially pursued. As experience and skill in the data registration are not required, this code is usable for construction of general small-scale information system. This report gives an overall description and the user's manual of the PLUTO-R code. (author)

Sorting signed permutations by inversions in O(nlogn) time.

Science.gov (United States)

Swenson, Krister M; Rajan, Vaibhav; Lin, Yu; Moret, Bernard M E

2010-03-01

The study of genomic inversions (or reversals) has been a mainstay of computational genomics for nearly 20 years. After the initial breakthrough of Hannenhalli and Pevzner, who gave the first polynomial-time algorithm for sorting signed permutations by inversions, improved algorithms have been designed, culminating with an optimal linear-time algorithm for computing the inversion distance and a subquadratic algorithm for providing a shortest sequence of inversions--also known as sorting by inversions. Remaining open was the question of whether sorting by inversions could be done in O(nlogn) time. In this article, we present a qualified answer to this question, by providing two new sorting algorithms, a simple and fast randomized algorithm and a deterministic refinement. The deterministic algorithm runs in time O(nlogn + kn), where k is a data-dependent parameter. We provide the results of extensive experiments showing that both the average and the standard deviation for k are small constants, independent of the size of the permutation. We conclude (but do not prove) that almost all signed permutations can be sorted by inversions in O(nlogn) time.

Hopping transport and electrical conductivity in one-dimensional systems with off-diagonal disorder

International Nuclear Information System (INIS)

Ma Songshan; Xu Hui; Li Yanfeng; Song Zhaoquan

2007-01-01

In this paper, we present a model to describe hopping transport and electrical conductivity of one-dimensional systems with off-diagonal disorder, in which electrons are transported via hopping between localized states. We find that off-diagonal disorder leads to delocalization and drastically enhances the electrical conductivity of systems. The model also quantitatively explains the temperature and electrical field dependence of the conductivity in one-dimensional systems with off-diagonal disorder. In addition, we also show the dependence of the conductivity on the strength of off-diagonal disorder

A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

KAUST Repository

Farooq, Muhammad Junaid; Elsawy, Hesham; Alouini, Mohamed-Slim

2015-01-01

dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per

DETERMINATION OF CLINICALLY RELEVANT DIFFERENCES IN FRONTAL PLANE HOP TESTS IN WOMEN'S COLLEGIATE BASKETBALL AND SOCCER PLAYERS

Science.gov (United States)

Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung

2017-01-01

Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified. Conclusions Women's basketball players exhibit decreased performance of frontal plane hop tests when compared to women's soccer players. Additionally

Using TESS to predict transcription factor binding sites in DNA sequence.

Science.gov (United States)

Schug, Jonathan

2008-03-01

This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.

Dual-Hop FSO Transmission Systems over Gamma-Gamma Turbulence with Pointing Errors

KAUST Repository

Zedini, Emna

2016-11-18

In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems under heterodyne detection and intensity modulation with direct detection techniques in the presence of atmospheric turbulence as well as pointing errors. In particular, we derive the cumulative distribution function (CDF) of the end-to-end signal-to-noise ratio (SNR) in exact closed-form in terms of the bivariate Fox’s H function. Capitalizing on this CDF expression, novel closed-form expressions for the outage probability, the average bit-error rate (BER) for different modulation schemes, and the ergodic capacity of dual-hop FSO transmission systems are presented. Moreover, we present very tight asymptotic results for the outage probability and the average BER at high SNR regime in terms of simple elementary functions and we derive the diversity order of the considered system. By using dual-hop FSO relaying, we demonstrate a better system performance as compared to the single FSO link. Numerical and Monte-Carlo simulation results are provided to verify the accuracy of the newly proposed results, and a perfect agreement is observed.

Low-Complexity Combining Schemes in Dual-Hop AF Relaying Systems

KAUST Repository

Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

2011-01-01

This paper investigates the performance of different low-complexity combining schemes in the context of dual-hop amplify-and-forward (AF) relaying networks. It is assumed that the relay uses single transmit (receive) antenna due to space limitation

Wireless multi-hop networks with stealing : large buffer asymptotics

NARCIS (Netherlands)

Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.

2010-01-01

Wireless networks equipped with CSMA are scheduled in a fully distributed manner. A disadvantage of such distributed control in multi-hop networks is the hidden node problem that causes the effect of stealing, in which a downstream node steals the channel from an upstream node with probability p.

Maroc-hop: music and youth identities in the Netherlands

NARCIS (Netherlands)

Gazzah, M.; Herrera, L.; Bayat, A.

2010-01-01

Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

Nuclear magnetic resonance and high-performance liquid chromatography techniques for the characterization of bioactive compounds from Humulus lupulus L. (hop).

Science.gov (United States)

Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica

2018-06-01

Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.

A QR code identification technology in package auto-sorting system

Science.gov (United States)

di, Yi-Juan; Shi, Jian-Ping; Mao, Guo-Yong

2017-07-01

Traditional manual sorting operation is not suitable for the development of Chinese logistics. For better sorting packages, a QR code recognition technology is proposed to identify the QR code label on the packages in package auto-sorting system. The experimental results compared with other algorithms in literatures demonstrate that the proposed method is valid and its performance is superior to other algorithms.

Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

Science.gov (United States)

Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

2012-01-01

Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

Bipedal hopping timed to a metronome to detect impairments in anticipatory motor control in people with mild multiple sclerosis.

Science.gov (United States)

Kirkland, Megan C; Chen, Alice; Downer, Matthew B; Holloway, Brett J; Wallack, Elizabeth M; Lockyer, Evan J; Buckle, Natasha C M; Abbott, Courtney L; Ploughman, Michelle

2018-06-01

People with mild multiple sclerosis (MS) often report subtle deficits in balance and cognition but display no measurable impairment on clinical assessments. We examined whether hopping to a metronome beat had the potential to detect anticipatory motor control deficits among people with mild MS (Expanded Disability Status Scale ≤ 3.5). Participants with MS (n = 13), matched controls (n = 9), and elderly subjects (n = 13) completed tests of cognition (Montreal Cognitive Assessment (MoCA)) and motor performance (Timed 25 Foot Walk Test (T25FWT)). Participants performed two bipedal hopping tasks: at 40 beats/min (bpm) and 60-bpm in random order. Hop characteristics (length, symmetry, variability) and delay from the metronome beat were extracted from an instrumented walkway and compared between groups. The MS group became more delayed from the metronome beat over time whereas elderly subjects tended to hop closer to the beat (F = 4.52, p = 0.02). Delay of the first hop during 60-bpm predicted cognition in people with MS (R = 0.55, β = 4.64 (SD 4.63), F = 4.85, p = 0.05) but not among control (R = 0.07, p = 0.86) or elderly subjects (R = 0.17, p = 0.57). In terms of hopping characteristics, at 60-bpm, people with MS and matched controls were significantly different from the elderly group. However, at 40-bpm, the MS group was no longer significantly different from the elderly group, even though matched controls and elderly still differed significantly. This new timed hopping test may be able to detect both physical ability, and feed-forward anticipatory control impairments in people with mild MS. Hopping at a frequency of 40-bpm seemed more challenging. Several aspects of anticipatory motor control can be measured: including reaction time to the first metronome cue and the ability to adapt and anticipate the beat over time. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

BayesMotif: de novo protein sorting motif discovery from impure datasets.

Science.gov (United States)

Hu, Jianjun; Zhang, Fan

2010-01-18

Protein sorting is the process that newly synthesized proteins are transported to their target locations within or outside of the cell. This process is precisely regulated by protein sorting signals in different forms. A major category of sorting signals are amino acid sub-sequences usually located at the N-terminals or C-terminals of protein sequences. Genome-wide experimental identification of protein sorting signals is extremely time-consuming and costly. Effective computational algorithms for de novo discovery of protein sorting signals is needed to improve the understanding of protein sorting mechanisms. We formulated the protein sorting motif discovery problem as a classification problem and proposed a Bayesian classifier based algorithm (BayesMotif) for de novo identification of a common type of protein sorting motifs in which a highly conserved anchor is present along with a less conserved motif regions. A false positive removal procedure is developed to iteratively remove sequences that are unlikely to contain true motifs so that the algorithm can identify motifs from impure input sequences. Experiments on both implanted motif datasets and real-world datasets showed that the enhanced BayesMotif algorithm can identify anchored sorting motifs from pure or impure protein sequence dataset. It also shows that the false positive removal procedure can help to identify true motifs even when there is only 20% of the input sequences containing true motif instances. We proposed BayesMotif, a novel Bayesian classification based algorithm for de novo discovery of a special category of anchored protein sorting motifs from impure datasets. Compared to conventional motif discovery algorithms such as MEME, our algorithm can find less-conserved motifs with short highly conserved anchors. Our algorithm also has the advantage of easy incorporation of additional meta-sequence features such as hydrophobicity or charge of the motifs which may help to overcome the limitations of

A Model Vision of Sorting System Application Using Robotic Manipulator

Directory of Open Access Journals (Sweden)

Maralo Sinaga

2010-08-01

Full Text Available Image processing in today’s world grabs massive attentions as it leads to possibilities of broaden application in many fields of high technology. The real challenge is how to improve existing sorting system in the Moduler Processing System (MPS laboratory which consists of four integrated stations of distribution, testing, processing and handling with a new image processing feature. Existing sorting method uses a set of inductive, capacitive and optical sensors do differentiate object color. This paper presents a mechatronics color sorting system solution with the application of image processing. Supported by OpenCV, image processing procedure senses the circular objects in an image captured in realtime by a webcam and then extracts color and position information out of it. This information is passed as a sequence of sorting commands to the manipulator (Mitsubishi Movemaster RV-M1 that does pick-and-place mechanism. Extensive testing proves that this color based object sorting system works 100% accurate under ideal condition in term of adequate illumination, circular objects’ shape and color. The circular objects tested for sorting are silver, red and black. For non-ideal condition, such as unspecified color the accuracy reduces to 80%.

Rap as the language of conflict in hip-hop subculture

Directory of Open Access Journals (Sweden)

Т М Кожелупенко

2008-12-01

Full Text Available This article is devoted to such notions of sociolinguistics as subculture and the language of conflict. These aspects are studied by the example of the rapidly developing hip-hop subculture and rap-texts as its main component.

Young Children Manifest Spiritualities in Their Hip-Hop Writing

Science.gov (United States)

Norton, Nadjwa E. L.

2014-01-01

In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

A feedback-retransmission based asynchronous frequency hopping MAC protocol for military aeronautical ad hoc networks

Directory of Open Access Journals (Sweden)

Jinhui TANG

2018-05-01

Full Text Available Attacking time-sensitive targets has rigid demands for the timeliness and reliability of information transmission, while typical Media Access Control (MAC designed for this application works well only in very light-load scenarios; as a consequence, the performances of system throughput and channel utilization are degraded. For this problem, a feedback-retransmission based asynchronous FRequency hopping Media Access (FRMA control protocol is proposed. Burst communication, asynchronous Frequency Hopping (FH, channel coding, and feedback retransmission are utilized in FRMA. With the mechanism of asynchronous FH, immediate packet transmission and multi-packet reception can be realized, and thus the timeliness is improved. Furthermore, reliability can be achieved via channel coding and feedback retransmission. With theories of queuing theory, Markov model, packets collision model, and discrete Laplace transformation, the formulas of packet success probability, system throughput, average packet end-to-end delay, and delay distribution are obtained. The approximation accuracy of theoretical derivation is verified by experimental results. Within a light-load network, the proposed FRMA has the ability of millisecond delay and 99% reliability as well as outperforms the non-feedback-retransmission based asynchronous frequency hopping media access control protocol. Keywords: Ad hoc networks, Aeronautical communications, Frequency hopping, Media Access Control (MAC, Time-sensitive

Industrial brewing yeast engineered for the production of primary flavor determinants in hopped beer.

Science.gov (United States)

Denby, Charles M; Li, Rachel A; Vu, Van T; Costello, Zak; Lin, Weiyin; Chan, Leanne Jade G; Williams, Joseph; Donaldson, Bryan; Bamforth, Charles W; Petzold, Christopher J; Scheller, Henrik V; Martin, Hector Garcia; Keasling, Jay D

2018-03-20

Flowers of the hop plant provide both bitterness and "hoppy" flavor to beer. Hops are, however, both a water and energy intensive crop and vary considerably in essential oil content, making it challenging to achieve a consistent hoppy taste in beer. Here, we report that brewer's yeast can be engineered to biosynthesize aromatic monoterpene molecules that impart hoppy flavor to beer by incorporating recombinant DNA derived from yeast, mint, and basil. Whereas metabolic engineering of biosynthetic pathways is commonly enlisted to maximize product titers, tuning expression of pathway enzymes to affect target production levels of multiple commercially important metabolites without major collateral metabolic changes represents a unique challenge. By applying state-of-the-art engineering techniques and a framework to guide iterative improvement, strains are generated with target performance characteristics. Beers produced using these strains are perceived as hoppier than traditionally hopped beers by a sensory panel in a double-blind tasting.