WorldWideScience

Sample records for sorting hops binds

  1. Parallel deposition, sorting, and reordering methods in the Hybrid Ordered Plasma Simulation (HOPS) code

    International Nuclear Information System (INIS)

    Anderson, D.V.; Shumaker, D.E.

    1993-01-01

    From a computational standpoint, particle simulation calculations for plasmas have not adapted well to the transitions from scalar to vector processing nor from serial to parallel environments. They have suffered from inordinate and excessive accessing of computer memory and have been hobbled by relatively inefficient gather-scatter constructs resulting from the use of indirect indexing. Lastly, the many-to-one mapping characteristic of the deposition phase has made it difficult to perform this in parallel. The authors' code sorts and reorders the particles in a spatial order. This allows them to greatly reduce the memory references, to run in directly indexed vector mode, and to employ domain decomposition to achieve parallelization. In this hybrid simulation the electrons are modeled as a fluid and the field equations solved are obtained from the electron momentum equation together with the pre-Maxwell equations (displacement current neglected). Either zero or finite electron mass can be used in the electron model. The resulting field equations are solved with an iteratively explicit procedure which is thus trivial to parallelize. Likewise, the field interpolations and the particle pushing is simple to parallelize. The deposition, sorting, and reordering phases are less simple and it is for these that the authors present detailed algorithms. They have now successfully tested the parallel version of HOPS in serial mode and it is now being readied for parallel execution on the Cray C-90. They will then port HOPS to a massively parallel computer, in the next year

  2. Hops

    Science.gov (United States)

    ... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...

  3. Structure and DNA-binding of meiosis-specific protein Hop2

    Science.gov (United States)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  4. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    OpenAIRE

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expre...

  5. Flow cytometric sex sorting affects CD4 membrane distribution and binding of exogenous DNA on bovine sperm cells.

    Science.gov (United States)

    Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias

    2017-08-01

    Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.

  6. Sorting by the cytoplasmic domain of the amyloid precursor protein binding receptor SorLA

    DEFF Research Database (Denmark)

    Nielsen, Morten S; Gustafsen, Camilla; Madsen, Peder

    2007-01-01

    -formation with the amyloid precursor protein it downregulates generation of Alzheimer's disease-associated Abeta-peptide. The receptor is mainly located in vesicles, suggesting a function in protein sorting and transport. Here we examined SorLA's trafficking using full-length and chimeric receptors and find that its...

  7. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    Science.gov (United States)

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  8. Sorting Out Sorts

    OpenAIRE

    Jonathan B. Berk

    1998-01-01

    In this paper we analyze the theoretical implications of sorting data into groups and then running asset pricing tests within each group. We show that the way this procedure is implemented introduces a severe bias in favor of rejecting the model under consideration. By simply picking enough groups to sort into even the true asset pricing model can be shown to have no explanatory power within each group.

  9. Scaffold hopping from (5-hydroxymethyl) isophthalates to multisubstituted pyrimidines diminishes binding affinity to the C1 domain of protein kinase C.

    Science.gov (United States)

    Provenzani, Riccardo; Tarvainen, Ilari; Brandoli, Giulia; Lempinen, Antti; Artes, Sanna; Turku, Ainoleena; Jäntti, Maria Helena; Talman, Virpi; Yli-Kauhaluoma, Jari; Tuominen, Raimo K; Boije Af Gennäs, Gustav

    2018-01-01

    Protein kinase C (PKC) isoforms play a pivotal role in the regulation of numerous cellular functions, making them extensively studied and highly attractive drug targets. Utilizing the crystal structure of the PKCδ C1B domain, we have developed hydrophobic isophthalic acid derivatives that modify PKC functions by binding to the C1 domain of the enzyme. In the present study, we aimed to improve the drug-like properties of the isophthalic acid derivatives by increasing their solubility and enhancing the binding affinity. Here we describe the design and synthesis of a series of multisubstituted pyrimidines as analogs of C1 domain-targeted isophthalates and characterize their binding affinities to the PKCα isoform. In contrast to our computational predictions, the scaffold hopping from phenyl to pyrimidine core diminished the binding affinity. Although the novel pyrimidines did not establish improved binding affinity for PKCα compared to our previous isophthalic acid derivatives, the present results provide useful structure-activity relationship data for further development of ligands targeted to the C1 domain of PKC.

  10. The small GTPase Arl8b regulates assembly of the mammalian HOPS complex on lysosomes

    Science.gov (United States)

    Khatter, Divya; Raina, Vivek B.; Dwivedi, Devashish; Sindhwani, Aastha; Bahl, Surbhi; Sharma, Mahak

    2015-01-01

    The homotypic fusion and protein sorting (HOPS) complex is a multi-subunit complex conserved from yeast to mammals that regulates late endosome and lysosome fusion. However, little is known about how the HOPS complex is recruited to lysosomes in mammalian cells. Here, we report that the small GTPase Arl8b, but not Rab7 (also known as RAB7A), is essential for membrane localization of the human (h)Vps41 subunit of the HOPS complex. Assembly of the core HOPS subunits to Arl8b- and hVps41-positive lysosomes is guided by their subunit–subunit interactions. RNA interference (RNAi)-mediated depletion of hVps41 resulted in the impaired degradation of EGFR that was rescued upon expression of wild-type but not an Arl8b-binding-defective mutant of hVps41, suggesting that Arl8b-dependent lysosomal localization of hVps41 is required for its endocytic function. Furthermore, we have also identified that the Arl8b effector SKIP (also known as PLEKHM2) interacts with and recruits HOPS subunits to Arl8b and kinesin-positive peripheral lysosomes. Accordingly, RNAi-mediated depletion of SKIP impaired lysosomal trafficking and degradation of EGFR. These findings reveal that Arl8b regulates the association of the human HOPS complex with lysosomal membranes, which is crucial for the function of this tethering complex in endocytic degradation. PMID:25908847

  11. The small GTPase Arl8b regulates assembly of the mammalian HOPS complex on lysosomes.

    Science.gov (United States)

    Khatter, Divya; Raina, Vivek B; Dwivedi, Devashish; Sindhwani, Aastha; Bahl, Surbhi; Sharma, Mahak

    2015-05-01

    The homotypic fusion and protein sorting (HOPS) complex is a multi-subunit complex conserved from yeast to mammals that regulates late endosome and lysosome fusion. However, little is known about how the HOPS complex is recruited to lysosomes in mammalian cells. Here, we report that the small GTPase Arl8b, but not Rab7 (also known as RAB7A), is essential for membrane localization of the human (h)Vps41 subunit of the HOPS complex. Assembly of the core HOPS subunits to Arl8b- and hVps41-positive lysosomes is guided by their subunit-subunit interactions. RNA interference (RNAi)-mediated depletion of hVps41 resulted in the impaired degradation of EGFR that was rescued upon expression of wild-type but not an Arl8b-binding-defective mutant of hVps41, suggesting that Arl8b-dependent lysosomal localization of hVps41 is required for its endocytic function. Furthermore, we have also identified that the Arl8b effector SKIP (also known as PLEKHM2) interacts with and recruits HOPS subunits to Arl8b and kinesin-positive peripheral lysosomes. Accordingly, RNAi-mediated depletion of SKIP impaired lysosomal trafficking and degradation of EGFR. These findings reveal that Arl8b regulates the association of the human HOPS complex with lysosomal membranes, which is crucial for the function of this tethering complex in endocytic degradation. © 2015. Published by The Company of Biologists Ltd.

  12. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA

    NARCIS (Netherlands)

    Sakamoto, K; Margolles, A; van Veen, HW; Konings, WN

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino

  13. A library of 7TM receptor C-terminal tails - Interactions with the proposed post-endocytic sorting proteins ERM-binding phosphoprotein 50 (EBP50), N-ethylmaleimide-sensitive factor (NSF), sorting nexin 1 (SNX1), and G protein-coupled receptor-associated sorting protein (GASP)

    DEFF Research Database (Denmark)

    Heydorn, A.; Sondergaard, B.P.; Ersbøll, Bjarne Kjær

    2004-01-01

    Adaptor and scaffolding proteins determine the cellular targeting, the spatial, and thereby the functional association of G protein-coupled seven-transmembrane receptors with co-receptors, transducers, and downstream effectors and the adaptors determine post-signaling events such as receptor...... only a single receptor tail, i.e. the beta(2)-adrenergic receptor, whereas N-ethylmaleimide-sensitive factor bound 11 of the tail-fusion proteins. Of the two proteins proposed to target receptors for lysosomal degradation, sorting nexin 1 (SNX1) bound 10 and the C-terminal domain of G protein...... the expected nanomolar affinities for interaction with SNX1. Truncations of the NK1 receptor revealed that an extended binding epitope is responsible for the interaction with both SNX1 and G protein-coupled receptor-associated sorting protein as well as with N-ethylmaleimide-sensitive factor. It is concluded...

  14. A library of 7TM receptor C-terminal tails. Interactions with the proposed post-endocytic sorting proteins ERM-binding phosphoprotein 50 (EBP50), N-ethylmaleimide-sensitive factor (NSF), sorting nexin 1 (SNX1), and G protein-coupled receptor-associated sorting protein (GASP)

    DEFF Research Database (Denmark)

    Heydorn, Arne; Søndergaard, Birgitte P; Ersbøll, Bjarne

    2004-01-01

    Adaptor and scaffolding proteins determine the cellular targeting, the spatial, and thereby the functional association of G protein-coupled seven-transmembrane receptors with co-receptors, transducers, and downstream effectors and the adaptors determine post-signaling events such as receptor...... only a single receptor tail, i.e. the beta(2)-adrenergic receptor, whereas N-ethylmaleimide-sensitive factor bound 11 of the tail-fusion proteins. Of the two proteins proposed to target receptors for lysosomal degradation, sorting nexin 1 (SNX1) bound 10 and the C-terminal domain of G protein...... the expected nanomolar affinities for interaction with SNX1. Truncations of the NK(1) receptor revealed that an extended binding epitope is responsible for the interaction with both SNX1 and G protein-coupled receptor-associated sorting protein as well as with N-ethylmaleimide-sensitive factor. It is concluded...

  15. Ore sorting

    International Nuclear Information System (INIS)

    Hawkins, A.P.; Richards, A.W.

    1982-01-01

    In an ore sorting apparatus, ore particles are bombarded with neutrons in a chamber and sorted by detecting radiation emitted by isotopes of elements, such as gold, forming or contained in the particles, using detectors and selectively controlling fluid jets. The isotopes can be selectively recognised by their radiation characteristics. In an alternative embodiment, shorter life isotopes are formed by neutron bombardment and detection of radiation takes place immediately adjacent the region of bombardment

  16. Detecting drug-target binding in cells using fluorescence-activated cell sorting coupled with mass spectrometry analysis

    Science.gov (United States)

    Wilson, Kris; Webster, Scott P.; Iredale, John P.; Zheng, Xiaozhong; Homer, Natalie Z.; Pham, Nhan T.; Auer, Manfred; Mole, Damian J.

    2018-01-01

    The assessment of drug-target engagement for determining the efficacy of a compound inside cells remains challenging, particularly for difficult target proteins. Existing techniques are more suited to soluble protein targets. Difficult target proteins include those with challenging in vitro solubility, stability or purification properties that preclude target isolation. Here, we report a novel technique that measures intracellular compound-target complex formation, as well as cellular permeability, specificity and cytotoxicity-the toxicity-affinity-permeability-selectivity (TAPS) technique. The TAPS assay is exemplified here using human kynurenine 3-monooxygenase (KMO), a challenging intracellular membrane protein target of significant current interest. TAPS confirmed target binding of known KMO inhibitors inside cells. We conclude that the TAPS assay can be used to facilitate intracellular hit validation on most, if not all intracellular drug targets.

  17. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  18. Binar Sort: A Linear Generalized Sorting Algorithm

    OpenAIRE

    Gilreath, William F.

    2008-01-01

    Sorting is a common and ubiquitous activity for computers. It is not surprising that there exist a plethora of sorting algorithms. For all the sorting algorithms, it is an accepted performance limit that sorting algorithms are linearithmic or O(N lg N). The linearithmic lower bound in performance stems from the fact that the sorting algorithms use the ordering property of the data. The sorting algorithm uses comparison by the ordering property to arrange the data elements from an initial perm...

  19. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  20. Verification of counting sort and radix sort

    NARCIS (Netherlands)

    C.P.T. de Gouw (Stijn); F.S. de Boer (Frank); J.C. Rot (Jurriaan)

    2016-01-01

    textabstractSorting is an important algorithmic task used in many applications. Two main aspects of sorting algorithms which have been studied extensively are complexity and correctness. [Foley and Hoare, 1971] published the first formal correctness proof of a sorting algorithm (Quicksort). While

  1. A new method of hybrid frequency hopping signals selection and blind parameter estimation

    Science.gov (United States)

    Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

    2018-04-01

    Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

  2. Particle trapping and hopping in an optofluidic fishnet

    Science.gov (United States)

    Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.

    2017-08-01

    Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

  3. Climate, weather, and hops

    Science.gov (United States)

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  4. Electron hopping through proteins

    Czech Academy of Sciences Publication Activity Database

    Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

    2012-01-01

    Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

  5. Basin Hopping Graph

    DEFF Research Database (Denmark)

    Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

    2014-01-01

    of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

  6. Parallel sorting algorithms

    CERN Document Server

    Akl, Selim G

    1985-01-01

    Parallel Sorting Algorithms explains how to use parallel algorithms to sort a sequence of items on a variety of parallel computers. The book reviews the sorting problem, the parallel models of computation, parallel algorithms, and the lower bounds on the parallel sorting problems. The text also presents twenty different algorithms, such as linear arrays, mesh-connected computers, cube-connected computers. Another example where algorithm can be applied is on the shared-memory SIMD (single instruction stream multiple data stream) computers in which the whole sequence to be sorted can fit in the

  7. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  8. Sorting a distribution theory

    CERN Document Server

    Mahmoud, Hosam M

    2011-01-01

    A cutting-edge look at the emerging distributional theory of sorting Research on distributions associated with sorting algorithms has grown dramatically over the last few decades, spawning many exact and limiting distributions of complexity measures for many sorting algorithms. Yet much of this information has been scattered in disparate and highly specialized sources throughout the literature. In Sorting: A Distribution Theory, leading authority Hosam Mahmoud compiles, consolidates, and clarifies the large volume of available research, providing a much-needed, comprehensive treatment of the

  9. RNAi knockdown of Hop (Hsp70/Hsp90 organising protein) decreases invasion via MMP-2 down regulation.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2011-07-28

    We previously identified Hop as over expressed in invasive pancreatic cancer cell lines and malignant tissues of pancreatic cancer patients, suggesting an important role for Hop in the biology of invasive pancreatic cancer. Hop is a co-chaperone protein that binds to both Hsp70\\/Hsp90. We hypothesised that by targeting Hop, signalling pathways modulating invasion and client protein stabilisation involving Hsp90-dependent complexes may be altered. In this study, we show that Hop knockdown by small interfering (si)RNA reduces the invasion of pancreatic cancer cells, resulting in decreased expression of the downstream target gene, matrix metalloproteinases-2 (MMP-2). Hop in conditioned media co-immunoprecipitates with MMP-2, implicating a possible extracellular function for Hop. Knockdown of Hop expression also reduced expression levels of Hsp90 client proteins, HER2, Bcr-Abl, c-MET and v-Src. Furthermore, Hop is strongly expressed in high grade PanINs compared to lower PanIN grades, displaying differential localisation in invasive ductal pancreatic cancer, indicating that the localisation of Hop is an important factor in pancreatic tumours. Our data suggests that the attenuation of Hop expression inactivates key signal transduction proteins which may decrease the invasiveness of pancreatic cancer cells possibly through the modulation of Hsp90 activity. Therefore, targeting Hop in pancreatic cancer may constitute a viable strategy for targeted cancer therapy.

  10. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.

    1990-01-01

    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  11. Sorting out Downside Beta

    NARCIS (Netherlands)

    G.T. Post (Thierry); P. van Vliet (Pim); S.D. Lansdorp (Simon)

    2009-01-01

    textabstractDownside risk, when properly defined and estimated, helps to explain the cross-section of US stock returns. Sorting stocks by a proper estimate of downside market beta leads to a substantially larger cross-sectional spread in average returns than sorting on regular market beta. This

  12. Three Sorts of Naturalism

    DEFF Research Database (Denmark)

    Fink, Hans

    2006-01-01

    In "Two sorts of Naturalism" John McDowell is sketching his own sort of naturalism in ethics as an alternative to "bald naturalism". In this paper I distinguish materialist, idealist and absolute conceptions of nature and of naturalism in order to provide a framework for a clearer understanding...

  13. Supercritical fluid extraction of hops

    Directory of Open Access Journals (Sweden)

    ZORAN ZEKOVIC

    2007-01-01

    Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

  14. Perbandingan Kecepatan Gabungan Algoritma Quick Sort dan Merge Sort dengan Insertion Sort, Bubble Sort dan Selection Sort

    OpenAIRE

    Al Rivan, Muhammad Ezar

    2017-01-01

    Ordering is one of the process done before doing data processing. The sorting algorithm has its own strengths and weaknesses. By taking strengths of each algorithm then combined can be a better algorithm. Quick Sort and Merge Sort are algorithms that divide the data into parts and each part divide again into sub-section until one element. Usually one element join with others and then sorted by. In this experiment data divide into parts that have size not more than threshold. This part then so...

  15. Hall effect in hopping regime

    International Nuclear Information System (INIS)

    Avdonin, A.; Skupiński, P.; Grasza, K.

    2016-01-01

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  16. Hall effect in hopping regime

    Energy Technology Data Exchange (ETDEWEB)

    Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

    2016-02-15

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  17. Sorting Out Seasonal Allergies

    Science.gov (United States)

    ... Close ‹ Back to Healthy Living Sorting Out Seasonal Allergies Sneezing, runny nose, nasal congestion. Symptoms of the ... How do I know if I have seasonal allergies? According to Dr. Georgeson, the best way to ...

  18. Wage Sorting Trends

    DEFF Research Database (Denmark)

    Bagger, Jesper; Vejlin, Rune Majlund; Sørensen, Kenneth Lykke

    Using a population-wide Danish Matched Employer-Employee panel from 1980-2006, we document a strong trend towards more positive assortative wage sorting. The correlation between worker and firm fixed effects estimated from a log wage regression increases from -0.07 in 1981 to .14 in 2001. The non......Using a population-wide Danish Matched Employer-Employee panel from 1980-2006, we document a strong trend towards more positive assortative wage sorting. The correlation between worker and firm fixed effects estimated from a log wage regression increases from -0.07 in 1981 to .14 in 2001....... The nonstationary wage sorting pattern is not due to compositional changes in the labor market, primarily occurs among high wage workers, and comprises 41 percent of the increase in the standard deviation of log real wages between 1980 and 2006. We show that the wage sorting trend is associated with worker...

  19. What is a Sorting Function?

    DEFF Research Database (Denmark)

    Henglein, Fritz

    2009-01-01

    What is a sorting function—not a sorting function for a given ordering relation, but a sorting function with nothing given? Formulating four basic properties of sorting algorithms as defining requirements, we arrive at intrinsic notions of sorting and stable sorting: A function is a sorting...... are derivable without compromising data abstraction. Finally we point out that stable sorting functions as default representations of ordering relations have the advantage of permitting linear-time sorting algorithms; inequality tests forfeit this possibility....... function if and only it is an intrinsically parametric permutation function. It is a stable sorting function if and only if it is an intrinsically stable permutation function. We show that ordering relations can be represented isomorphically as inequality tests, comparators and stable sorting functions...

  20. LazySorted: A Lazily, Partially Sorted Python List

    Directory of Open Access Journals (Sweden)

    Naftali Harris

    2015-06-01

    Full Text Available LazySorted is a Python C extension implementing a partially and lazily sorted list data structure. It solves a common problem faced by programmers, in which they need just part of a sorted list, like its middle element (the median, but sort the entire list to get it. LazySorted presents them with the abstraction that they are working with a fully sorted list, while actually only sorting the list partially with quicksort partitions to return the requested sub-elements. This enables programmers to use naive "sort first" algorithms but nonetheless attain linear run-times when possible. LazySorted may serve as a drop-in replacement for the built-in sorted function in most cases, and can sometimes achieve run-times more than 7 times faster.

  1. Ready, steady, SORT!

    CERN Document Server

    Laëtitia Pedroso

    2010-01-01

    The selective or ecological sorting of waste is already second nature to many of us and concerns us all. As the GS Department's new awareness-raising campaign reminds us, everything we do to sort waste contributes to preserving the environment.    Placemats printed on recycled paper using vegetable-based ink will soon be distributed in Restaurant No.1.   Environmental protection is never far from the headlines, and CERN has a responsibility to ensure that the 3000 tonnes and more of waste it produces every year are correctly and selectively sorted. Materials can be given a second life through recycling and re-use, thereby avoiding pollution from landfill sites and incineration plants and saving on processing costs. The GS Department is launching a new poster campaign designed to raise awareness of the importance of waste sorting and recycling. "After conducting a survey to find out whether members of the personnel were prepared to make an effort to sort a...

  2. Supercritical carbon dioxide hop extraction

    Directory of Open Access Journals (Sweden)

    Pfaf-Šovljanski Ivana I.

    2005-01-01

    Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

  3. Magnet sorting algorithms

    International Nuclear Information System (INIS)

    Dinev, D.

    1996-01-01

    Several new algorithms for sorting of dipole and/or quadrupole magnets in synchrotrons and storage rings are described. The algorithms make use of a combinatorial approach to the problem and belong to the class of random search algorithms. They use an appropriate metrization of the state space. The phase-space distortion (smear) is used as a goal function. Computational experiments for the case of the JINR-Dubna superconducting heavy ion synchrotron NUCLOTRON have shown a significant reduction of the phase-space distortion after the magnet sorting. (orig.)

  4. Sorting and sustaining cooperation

    DEFF Research Database (Denmark)

    Vikander, Nick

    2013-01-01

    This paper looks at cooperation in teams where some people are selfish and others are conditional cooperators, and where lay-offs will occur at a fixed future date. I show that the best way to sustain cooperation prior to the lay-offs is often in a sorting equilibrium, where conditional cooperators...... can identify and then work with one another. Changes to parameters that would seem to make cooperation more attractive, such as an increase in the discount factor or the fraction of conditional cooperators, can reduce equilibrium cooperation if they decrease a selfish player's incentive to sort....

  5. Three Sorts of Naturalism

    OpenAIRE

    Fink, Hans

    2006-01-01

    In "Two sorts of Naturalism" John McDowell is sketching his own sort of naturalism in ethics as an alternative to "bald naturalism". In this paper I distinguish materialist, idealist and absolute conceptions of nature and of naturalism in order to provide a framework for a clearer understanding of what McDowell's own naturalism amounts to. I argue that nothing short of an absolute naturalism will do for a number of McDowell's own purposes, but that it is far from obvious that this is his posi...

  6. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  7. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  8. Event shape sorting

    International Nuclear Information System (INIS)

    Kopecna, Renata; Tomasik, Boris

    2016-01-01

    We propose a novel method for sorting events of multiparticle production according to the azimuthal anisotropy of their momentum distribution. Although the method is quite general, we advocate its use in analysis of ultra-relativistic heavy-ion collisions where a large number of hadrons is produced. The advantage of our method is that it can automatically sort out samples of events with histograms that indicate similar distributions of hadrons. It takes into account the whole measured histograms with all orders of anisotropy instead of a specific observable (e.g., v 2 , v 3 , q 2 ). It can be used for more exclusive experimental studies of flow anisotropies which are then more easily compared to theoretical calculations. It may also be useful in the construction of mixed-events background for correlation studies as it allows to select events with similar momentum distribution. (orig.)

  9. A Sequence of Sorting Strategies.

    Science.gov (United States)

    Duncan, David R.; Litwiller, Bonnie H.

    1984-01-01

    Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)

  10. Chip-based droplet sorting

    Energy Technology Data Exchange (ETDEWEB)

    Beer, Neil Reginald; Lee, Abraham; Hatch, Andrew

    2017-11-21

    A non-contact system for sorting monodisperse water-in-oil emulsion droplets in a microfluidic device based on the droplet's contents and their interaction with an applied electromagnetic field or by identification and sorting.

  11. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  12. Protein Sorting Prediction

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2017-01-01

    and drawbacks of each of these approaches is described through many examples of methods that predict secretion, integration into membranes, or subcellular locations in general. The aim of this chapter is to provide a user-level introduction to the field with a minimum of computational theory.......Many computational methods are available for predicting protein sorting in bacteria. When comparing them, it is important to know that they can be grouped into three fundamentally different approaches: signal-based, global-property-based and homology-based prediction. In this chapter, the strengths...

  13. Det sorte USA

    DEFF Research Database (Denmark)

    Brøndal, Jørn

    Bogen gennemgår det sorte USAs historie fra 1776 til 2016, idet grundtemaet er spændingsforholdet mellem USAs grundlæggelsesidealer og den racemæssige praksis, et spændingsforhold som Gunnar Myrdal kaldte "det amerikanske dilemma." Bogen, der er opbygget som politisk, social og racemæssig histori......, er opdelt i 13 kapitler og består af fire dele: Første del: Slaveriet; anden del: Jim Crow; tredje del. King-årene; fjerde del: Frem mod Obama....

  14. Gender Differences in Sorting

    DEFF Research Database (Denmark)

    Merlino, Luca Paolo; Parrotta, Pierpaolo; Pozzoli, Dario

    and causing the most productive female workers to seek better jobs in more female-friendly firms in which they can pursue small career advancements. Nonetheless, gender differences in promotion persist and are found to be similar in all firms when we focus on large career advancements. These results provide......In this paper, we investigate the sorting of workers in firms to understand gender gaps in labor market outcomes. Using Danish employer-employee matched data, we fiend strong evidence of glass ceilings in certain firms, especially after motherhood, preventing women from climbing the career ladder...

  15. Selective sorting of waste

    CERN Multimedia

    2007-01-01

    Not much effort needed, just willpower In order to keep the cost of disposing of waste materials as low as possible, CERN provides two types of recipient at the entrance to each building: a green plastic one for paper/cardboard and a metal one for general refuse. For some time now we have noticed, to our great regret, a growing negligence as far as selective sorting is concerned, with, for example, the green recipients being filled with a mixture of cardboard boxes full of polystyrene or protective wrappers, plastic bottles, empty yogurts pots, etc. …We have been able to ascertain, after careful checking, that this haphazard mixing of waste cannot be attributed to the cleaning staff but rather to members of the personnel who unscrupulously throw away their rubbish in a completely random manner. Non-sorted waste entails heavy costs for CERN. For information, once a non-compliant item is found in a green recipient, the entire contents are sent off for incineration rather than recycling… We are all concerned...

  16. Wireless Multi Hop Access Networks and Protocols

    OpenAIRE

    Nilsson Plymoth, Anders

    2007-01-01

    As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

  17. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  18. Simple sorting algorithm test based on CUDA

    OpenAIRE

    Meng, Hongyu; Guo, Fangjin

    2015-01-01

    With the development of computing technology, CUDA has become a very important tool. In computer programming, sorting algorithm is widely used. There are many simple sorting algorithms such as enumeration sort, bubble sort and merge sort. In this paper, we test some simple sorting algorithm based on CUDA and draw some useful conclusions.

  19. Teleoperated robotic sorting system

    Science.gov (United States)

    Roos, Charles E.; Sommer, Edward J.; Parrish, Robert H.; Russell, James R.

    2000-01-01

    A method and apparatus are disclosed for classifying materials utilizing a computerized touch sensitive screen or other computerized pointing device for operator identification and electronic marking of spatial coordinates of materials to be extracted. An operator positioned at a computerized touch sensitive screen views electronic images of the mixture of materials to be sorted as they are conveyed past a sensor array which transmits sequences of images of the mixture either directly or through a computer to the touch sensitive display screen. The operator manually "touches" objects displayed on the screen to be extracted from the mixture thereby registering the spatial coordinates of the objects within the computer. The computer then tracks the registered objects as they are conveyed and directs automated devices including mechanical means such as air jets, robotic arms, or other mechanical diverters to extract the registered objects.

  20. Track data sort program

    International Nuclear Information System (INIS)

    Abramov, N.A.; Matveev, V.A.; Fedotov, O.P.

    1977-01-01

    The description is given of the MASKA program, based on the principle of sorting points array at surface due to their belonging to the topologically connected regions with boundaries of locked broken lines. The algorithm is realized on the ES-1010 computer for automatic image processing from the bubble chambers by scanning measuring projector. The methods are considered for constructing the above mentioned regions for all the images according to the base points measured on the semiautomatic measuring table. The MASKA program is written in the ASSEMBLER-2 language and equals 3.5K words of the main memory. The average processing time for 10000 points according to one mask is 1 sec

  1. Algorithm Sorts Groups Of Data

    Science.gov (United States)

    Evans, J. D.

    1987-01-01

    For efficient sorting, algorithm finds set containing minimum or maximum most significant data. Sets of data sorted as desired. Sorting process simplified by reduction of each multielement set of data to single representative number. First, each set of data expressed as polynomial with suitably chosen base, using elements of set as coefficients. Most significant element placed in term containing largest exponent. Base selected by examining range in value of data elements. Resulting series summed to yield single representative number. Numbers easily sorted, and each such number converted back to original set of data by successive division. Program written in BASIC.

  2. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  3. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  4. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  5. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  6. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  7. Hopping Conductivity Enhanced by Microwave Radiation

    International Nuclear Information System (INIS)

    Ovadyahu, Z

    2012-01-01

    Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

  8. Perbandingan Bubble Sort dengan Insertion Sort pada Bahasa Pemrograman C dan Fortran

    OpenAIRE

    Reina, Reina; Gautama, Josef Bernadi

    2013-01-01

    Sorting is a basic algorithm studied by students of computer science major. Sorting algorithm is the basis of other algorithms such as searching algorithm, pattern matching algorithm. Bubble sort is a popular basic sorting algorithm due to its easiness to be implemented. Besides bubble sort, there is insertion sort. It is lesspopular than bubble sort because it has more difficult algorithm. This paper discusses about process time between insertion sort and bubble sort with two kinds of data. ...

  9. SHOP: scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

    2007-01-01

    A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...... scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...

  10. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    Science.gov (United States)

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  11. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Flow sorting in aquatic ecology

    Directory of Open Access Journals (Sweden)

    Marcus Reckermann

    2000-06-01

    Full Text Available Flow sorting can be a very helpful tool in revealing phytoplankton and bacterial community structure and elaborating specific physiological parameters of isolated species. Droplet sorting has been the most common technique. Despite the high optical and hydro-dynamic stress for the cells to be sorted, many species grow in culture subsequent to sorting. To date, flow sorting has been applied to post-incubation separation in natural water samples to account for group-specific physiological parameters (radiotracer-uptake rates, to the production of clonal or non-clonal cultures from mixtures, to the isolaton of cell groups from natural assemblages for molecular analyses, and for taxonomic identification of sorted cells by microscopy. The application of cell sorting from natural water samples from the Wadden Sea, including different cryptophytes, cyanobacteria and diatoms, is shown, as well as the establishment of laboratory cultures from field samples. The optional use of a red laser to account for phycocyanine-rich cells is also discussed.

  13. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2007-01-01

    semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

  14. Variable range hopping in ZnO films

    Science.gov (United States)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  15. Electronic transport of molecular nanowires by considering of electron hopping energy between the second neighbors

    Directory of Open Access Journals (Sweden)

    H Rabani

    2015-07-01

    Full Text Available In this paper, we study the electronic conductance of molecular nanowires by considering the electron hopping between the first and second neighbors with the help Green’s function method at the tight-binding approach. We investigate three types of structures including linear uniform and periodic chains as well as poly(p-phenylene molecule which are embedded between two semi-infinite metallic leads. The results show that in the second neighbor approximation, the resonance, anti-resonance and Fano phenomena occur in the conductance spectra of these structures. Moreover, a new gap is observed at edge of the lead energy band wich its width depends on the value of the electron hopping energy between the second neighbors. In the systems including intrinsic gap, this hopping energy shifts the gap in the energy spectra.

  16. Hopping absorption edge in silicon inversion layers

    International Nuclear Information System (INIS)

    Kostadinov, I.Z.

    1983-09-01

    The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

  17. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  18. Beer spoilage bacteria and hop resistance.

    Science.gov (United States)

    Sakamoto, Kanta; Konings, Wil N

    2003-12-31

    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

  19. Degradation of hop bitter acids by fungi

    International Nuclear Information System (INIS)

    Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

    2008-01-01

    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

  20. Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

    Science.gov (United States)

    Nelson, Gregory M; Huffman, Holly; Smith, David F

    2003-01-01

    Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

  1. ALGORITHM FOR SORTING GROUPED DATA

    Science.gov (United States)

    Evans, J. D.

    1994-01-01

    It is often desirable to sort data sets in ascending or descending order. This becomes more difficult for grouped data, i.e., multiple sets of data, where each set of data involves several measurements or related elements. The sort becomes increasingly cumbersome when more than a few elements exist for each data set. In order to achieve an efficient sorting process, an algorithm has been devised in which the maximum most significant element is found, and then compared to each element in succession. The program was written to handle the daily temperature readings of the Voyager spacecraft, particularly those related to the special tracking requirements of Voyager 2. By reducing each data set to a single representative number, the sorting process becomes very easy. The first step in the process is to reduce the data set of width 'n' to a data set of width '1'. This is done by representing each data set by a polynomial of length 'n' based on the differences of the maximum and minimum elements. These single numbers are then sorted and converted back to obtain the original data sets. Required input data are the name of the data file to read and sort, and the starting and ending record numbers. The package includes a sample data file, containing 500 sets of data with 5 elements in each set. This program will perform a sort of the 500 data sets in 3 - 5 seconds on an IBM PC-AT with a hard disk; on a similarly equipped IBM PC-XT the time is under 10 seconds. This program is written in BASIC (specifically the Microsoft QuickBasic compiler) for interactive execution and has been implemented on the IBM PC computer series operating under PC-DOS with a central memory requirement of approximately 40K of 8 bit bytes. A hard disk is desirable for speed considerations, but is not required. This program was developed in 1986.

  2. Layers in sorting practices: Sorting out patients with potential cancer

    DEFF Research Database (Denmark)

    Møller, Naja Holten; Bjørn, Pernille

    2011-01-01

    for a particular patient. Due to the limited resources within the Danish healthcare system, initiating cancer pathways for all patients with a remote suspicion of cancer would crash the system, as it would be impossible for healthcare professionals to commit to the prescribed schedules and times defined...... they show that sorting patients before initiating a standardized cancer pathway is not a simple process of deciding on a predefined category that will stipulate particular dates and times. Instead, these informal sorting mechanisms show that the process of sorting patients prior to diagnosis......In the last couple of years, widespread use of standardized cancer pathways has been seen across a range of countries, including Denmark, to improve prognosis of cancer patients. In Denmark, standardized cancer pathways take the form of guidelines prescribing well-defined sequences where steps...

  3. Plasmodium falciparum Hop (PfHop Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    Directory of Open Access Journals (Sweden)

    Tawanda Zininga

    Full Text Available Heat shock proteins (Hsps play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70 is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90 facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop. We previously characterised the Hop protein from Plasmodium falciparum (PfHop. We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we

  4. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  5. Sorting waves and associated eigenvalues

    Science.gov (United States)

    Carbonari, Costanza; Colombini, Marco; Solari, Luca

    2017-04-01

    The presence of mixed sediment always characterizes gravel bed rivers. Sorting processes take place during bed load transport of heterogeneous sediment mixtures. The two main elements necessary to the occurrence of sorting are the heterogeneous character of sediments and the presence of an active sediment transport. When these two key ingredients are simultaneously present, the segregation of bed material is consistently detected both in the field [7] and in laboratory [3] observations. In heterogeneous sediment transport, bed altimetric variations and sorting always coexist and both mechanisms are independently capable of driving the formation of morphological patterns. Indeed, consistent patterns of longitudinal and transverse sorting are identified almost ubiquitously. In some cases, such as bar formation [2] and channel bends [5], sorting acts as a stabilizing effect and therefore the dominant mechanism driving pattern formation is associated with bed altimetric variations. In other cases, such as longitudinal streaks, sorting enhances system instability and can therefore be considered the prevailing mechanism. Bedload sheets, first observed by Khunle and Southard [1], represent another classic example of a morphological pattern essentially triggered by sorting, as theoretical [4] and experimental [3] results suggested. These sorting waves cause strong spatial and temporal fluctuations of bedload transport rate typical observed in gravel bed rivers. The problem of bed load transport of a sediment mixture is formulated in the framework of a 1D linear stability analysis. The base state consists of a uniform flow in an infinitely wide channel with active bed load transport. The behaviour of the eigenvalues associated with fluid motion, bed evolution and sorting processes in the space of the significant flow and sediment parameters is analysed. A comparison is attempted with the results of the theoretical analysis of Seminara Colombini and Parker [4] and Stecca

  6. Sex-sorting sperm using flow cytometry/cell sorting.

    Science.gov (United States)

    Garner, Duane L; Evans, K Michael; Seidel, George E

    2013-01-01

    The sex of mammalian offspring can be predetermined by flow sorting relatively pure living populations of X- and Y-chromosome-bearing sperm. This method is based on precise staining of the DNA of sperm with the nucleic acid-specific fluorophore, Hoechst 33342, to differentiate between the subpopulations of X- and Y-sperm. The fluorescently stained sperm are then sex-sorted using a specialized high speed sorter, MoFlo(®) SX XDP, and collected into biologically supportive media prior to reconcentration and cryopreservation in numbers adequate for use with artificial insemination for some species or for in vitro fertilization. Sperm sorting can provide subpopulations of X- or Y-bearing bovine sperm at rates in the 8,000 sperm/s range while maintaining; a purity of 90% such that it has been applied to cattle on a commercial basis. The sex of offspring has been predetermined in a wide variety of mammalian species including cattle, swine, horses, sheep, goats, dogs, cats, deer, elk, dolphins, water buffalo as well as in humans using flow cytometric sorting of X- and Y-sperm.

  7. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  8. Crowding and hopping in a protein’s diffusive transport on DNA

    International Nuclear Information System (INIS)

    Koslover, Elena F; Spakowitz, Andrew J; Díaz de la Rosa, Mario

    2017-01-01

    Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work. (paper)

  9. Collective probabilities algorithm for surface hopping calculations

    International Nuclear Information System (INIS)

    Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

    2003-01-01

    General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

  10. Learning banknote fitness for sorting

    NARCIS (Netherlands)

    Geusebroek, J.M.; Markus, P.; Balke, P.

    2011-01-01

    In this work, a machine learning method is proposed for banknote soiling determination. We apply proven techniques from computer vision to come up with a robust and effective method for automatic sorting of banknotes. The proposed method is evaluated with respect to various invariance classes. The

  11. Quantum lower bound for sorting

    OpenAIRE

    Shi, Yaoyun

    2000-01-01

    We prove that \\Omega(n log(n)) comparisons are necessary for any quantum algorithm that sorts n numbers with high success probability and uses only comparisons. If no error is allowed, at least 0.110nlog_2(n) - 0.067n + O(1) comparisons must be made. The previous known lower bound is \\Omega(n).

  12. Sorting out river channel patterns

    NARCIS (Netherlands)

    Kleinhans, M.G.

    2010-01-01

    Rivers self-organize their pattern/planform through feedbacks between bars, channels, floodplain and vegetation, which emerge as a result of the basic spatial sorting process of wash load sediment and bed sediment. The balance between floodplain formation and destruction determines the width and

  13. Research on synchronization technology of frequency hopping communication system

    Science.gov (United States)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

    2018-05-01

    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  14. Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

    Science.gov (United States)

    Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

    2018-04-01

    Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

  15. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  16. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  17. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  18. Performance analysis of multi-hop wireless packet networks

    Directory of Open Access Journals (Sweden)

    Lim J.-T.

    1997-01-01

    Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

  19. Sorting fluorescent nanocrystals with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Gerion, Daniele; Parak, Wolfgang J.; Williams, Shara C.; Zanchet, Daniela; Micheel, Christine M.; Alivisatos, A. Paul

    2001-12-10

    Semiconductor nanocrystals with narrow and tunable fluorescence are covalently linked to oligonucleotides. These biocompounds retain the properties of both nanocrystals and DNA. Therefore, different sequences of DNA can be coded with nanocrystals and still preserve their ability to hybridize to their complements. We report the case where four different sequences of DNA are linked to four nanocrystal samples having different colors of emission in the range of 530-640 nm. When the DNA-nanocrystal conjugates are mixed together, it is possible to sort each type of nanoparticle using hybridization on a defined micrometer -size surface containing the complementary oligonucleotide. Detection of sorting requires only a single excitation source and an epifluorescence microscope. The possibility of directing fluorescent nanocrystals towards specific biological targets and detecting them, combined with their superior photo-stability compared to organic dyes, opens the way to improved biolabeling experiments, such as gene mapping on a nanometer scale or multicolor microarray analysis.

  20. Flow cytogenetics and chromosome sorting.

    Science.gov (United States)

    Cram, L S

    1990-06-01

    This review of flow cytogenetics and chromosome sorting provides an overview of general information in the field and describes recent developments in more detail. From the early developments of chromosome analysis involving single parameter or one color analysis to the latest developments in slit scanning of single chromosomes in a flow stream, the field has progressed rapidly and most importantly has served as an important enabling technology for the human genome project. Technological innovations that advanced flow cytogenetics are described and referenced. Applications in basic cell biology, molecular biology, and clinical investigations are presented. The necessary characteristics for large number chromosome sorting are highlighted. References to recent review articles are provided as a starting point for locating individual references that provide more detail. Specific references are provided for recent developments.

  1. School accountability Incentives or sorting?

    OpenAIRE

    Hege Marie Gjefsen; Trude Gunnes

    2015-01-01

    We exploit a nested school accountability reform to estimate the causal effect on teacher mobility, sorting, and student achievement. In 2003, lower-secondary schools in Oslo became accountable to the school district authority for student achievement. In 2005, information on school performance in lower secondary education also became public. Using a difference-in-difference-in-difference approach, we find a significant increase in teacher mobility and that almost all non-stayers leave the tea...

  2. External parallel sorting with multiprocessor computers

    International Nuclear Information System (INIS)

    Comanceau, S.I.

    1984-01-01

    This article describes methods of external sorting in which the entire main computer memory is used for the internal sorting of entries, forming out of them sorted segments of the greatest possible size, and outputting them to external memories. The obtained segments are merged into larger segments until all entries form one ordered segment. The described methods are suitable for sequential files stored on magnetic tape. The needs of the sorting algorithm can be met by using the relatively slow peripheral storage devices (e.g., tapes, disks, drums). The efficiency of the external sorting methods is determined by calculating the total sorting time as a function of the number of entries to be sorted and the number of parallel processors participating in the sorting process

  3. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  4. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  5. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  6. Communication: Fully coherent quantum state hopping

    Energy Technology Data Exchange (ETDEWEB)

    Martens, Craig C., E-mail: cmartens@uci.edu [University of California, Irvine, California 92697-2025 (United States)

    2015-10-14

    In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

  7. Sorting and selection in posets

    DEFF Research Database (Denmark)

    Daskalakis, Constantinos; Karp, Richard M.; Mossel, Elchanan

    2011-01-01

    from two decades ago by Faigle and Turán. In particular, we present the first algorithm that sorts a width-$w$ poset of size $n$ with query complexity $O(n(w+\\log n))$ and prove that this query complexity is asymptotically optimal. We also describe a variant of Mergesort with query complexity $O......(wn\\log\\frac{n}{w})$ and total complexity $O(w^{2}n\\log\\frac{n}{w})$; an algorithm with the same query complexity was given by Faigle and Turán, but no efficient implementation of that algorithm is known. Both our sorting algorithms can be applied with negligible overhead to the more general problem of reconstructing transitive......Classical problems of sorting and searching assume an underlying linear ordering of the objects being compared. In this paper, we study these problems in the context of partially ordered sets, in which some pairs of objects are incomparable. This generalization is interesting from a combinatorial...

  8. Perbandingan Bubble Sort dengan Insertion Sort pada Bahasa Pemrograman C dan Fortran

    Directory of Open Access Journals (Sweden)

    Reina Reina

    2013-12-01

    Full Text Available Sorting is a basic algorithm studied by students of computer science major. Sorting algorithm is the basis of other algorithms such as searching algorithm, pattern matching algorithm. Bubble sort is a popular basic sorting algorithm due to its easiness to be implemented. Besides bubble sort, there is insertion sort. It is lesspopular than bubble sort because it has more difficult algorithm. This paper discusses about process time between insertion sort and bubble sort with two kinds of data. First is randomized data, and the second is data of descending list. Comparison of process time has been done in two kinds of programming language that is C programming language and FORTRAN programming language. The result shows that bubble sort needs more time than insertion sort does.

  9. Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

    Science.gov (United States)

    Moktan, Hem; Pezza, Roberto; Zhou, Donghua

    2015-03-01

    The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

  10. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  11. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  12. Word Sorts for General Music Classes

    Science.gov (United States)

    Cardany, Audrey Berger

    2015-01-01

    Word sorts are standard practice for aiding children in acquiring skills in English language arts. When included in the general music classroom, word sorts may aid students in acquiring a working knowledge of music vocabulary. The author shares a word sort activity drawn from vocabulary in John Lithgow's children's book "Never Play…

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Hrs and SNX3 functions in sorting and membrane invagination within multivesicular bodies.

    Directory of Open Access Journals (Sweden)

    Véronique Pons

    2008-09-01

    Full Text Available After internalization, ubiquitinated signaling receptors are delivered to early endosomes. There, they are sorted and incorporated into the intralumenal invaginations of nascent multivesicular bodies, which function as transport intermediates to late endosomes. Receptor sorting is achieved by Hrs--an adaptor--like protein that binds membrane PtdIns3P via a FYVE motif-and then by ESCRT complexes, which presumably also mediate the invagination process. Eventually, intralumenal vesicles are delivered to lysosomes, leading to the notion that EGF receptor sorting into multivesicular bodies mediates lysosomal targeting. Here, we report that Hrs is essential for lysosomal targeting but dispensable for multivesicular body biogenesis and transport to late endosomes. By contrast, we find that the PtdIns3P-binding protein SNX3 is required for multivesicular body formation, but not for EGF receptor degradation. PtdIns3P thus controls the complementary functions of Hrs and SNX3 in sorting and multivesicular body biogenesis.

  15. Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in Lactobacillus brevis.

    Science.gov (United States)

    Schurr, Benjamin C; Hahne, Hannes; Kuster, Bernhard; Behr, Jürgen; Vogel, Rudi F

    2015-04-01

    The main bittering component in beer, hop iso-α-acids, have been characterised as weak acids, which act as ionophores impairing microbial cells' function under acidic conditions as present in beer. Besides medium pH, divalent cations play a central role regarding the efficacy of the antimicrobial effect. The iso-α-acids' non-bitter derivatives humulinic acids can be found in isomerised hop extracts and can be generated during hop storage. Therefore, they have been under investigation concerning their influence on beer sensory properties. This study sketches the molecular mechanism behind iso-α-acids' antimicrobial activity in Lactobacillus (L.) brevis regarding their ionophore activity versus the dependence of the inhibitory potential on manganese binding, and suggests humulinic acids as novel tasteless food preservatives. We designed and synthesised chemically modified iso-α-acids to enhance the basic understanding of the molecular mechanism of antimicrobial iso-α-acids. It could be observed that a manganese-binding dependent transmembrane redox reaction (oxidative stress) plays a crucial role in inhibition. Privation of an acidic hydroxyl group neither erased ionophore activity, nor did it entirely abolish antimicrobial activity. Humulinic acids proved to be highly inhibitory, even outperforming iso-α-acids. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. EGFRvIII escapes down-regulation due to impaired internalization and sorting to lysosomes

    DEFF Research Database (Denmark)

    Grandal, Michael V; Zandi, Roza; Pedersen, Mikkel W

    2007-01-01

    . Moreover, internalized EGFRvIII is recycled rather than delivered to lysosomes. EGFRvIII binds the ubiquitin ligase c-Cbl via Grb2, whereas binding via phosphorylated tyrosine residue 1045 seems to be limited. Despite c-Cbl binding, the receptor fails to become effectively ubiquitinylated. Thus, our...... results suggest that the long lifetime of EGFRvIII is caused by inefficient internalization and impaired sorting to lysosomes due to lack of effective ubiquitinylation....

  17. Epigenetic changes detected in micropropagated hop plants.

    Science.gov (United States)

    Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles

    2009-07-01

    Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

  18. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  19. Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

    Science.gov (United States)

    Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

    2015-12-17

    The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

  20. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  1. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  2. Small polaron hopping in magnetic semiconductors

    International Nuclear Information System (INIS)

    Emin, D.; Liu, N.L.H.

    1978-01-01

    In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

  3. Energy efficient data sorting using standard sorting algorithms

    KAUST Repository

    Bunse, Christian; Hö pfner, Hagen; Roychoudhury, Suman; Mansour, Essam

    2011-01-01

    Protecting the environment by saving energy and thus reducing carbon dioxide emissions is one of todays hottest and most challenging topics. Although the perspective for reducing energy consumption, from ecological and business perspectives is clear, from a technological point of view, the realization especially for mobile systems still falls behind expectations. Novel strategies that allow (software) systems to dynamically adapt themselves at runtime can be effectively used to reduce energy consumption. This paper presents a case study that examines the impact of using an energy management component that dynamically selects and applies the "optimal" sorting algorithm, from an energy perspective, during multi-party mobile communication. Interestingly, the results indicate that algorithmic performance is not key and that dynamically switching algorithms at runtime does have a significant impact on energy consumption. © Springer-Verlag Berlin Heidelberg 2011.

  4. Fixing the Sorting Algorithm for Android, Java and Python

    NARCIS (Netherlands)

    C.P.T. de Gouw (Stijn); F.S. de Boer (Frank)

    2015-01-01

    htmlabstractTim Peters developed the Timsort hybrid sorting algorithm in 2002. TimSort was first developed for Python, a popular programming language, but later ported to Java (where it appears as java.util.Collections.sort and java.util.Arrays.sort). TimSort is today used as the default sorting

  5. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  6. Application of visible spectroscopy in waste sorting

    Science.gov (United States)

    Spiga, Philippe; Bourely, Antoine

    2011-10-01

    Today, waste recycling, (bottles, papers...), is a mechanical operation: the waste are crushed, fused and agglomerated in order to obtain new manufactured products (e.g. new bottles, clothes ...). The plastics recycling is the main application in the color sorting process. The colorless plastics recovered are more valuable than the colored plastics. Other emergent applications are in the paper sorting, where the main goal is to sort dyed paper from white papers. Up to now, Pellenc Selective Technologies has manufactured color sorting machines based on RGB cameras. Three dimensions (red, green and blue) are no longer sufficient to detect low quantities of dye in the considered waste. In order to increase the efficiency of the color detection, a new sorting machine, based on visible spectroscopy, has been developed. This paper presents the principles of the two approaches and their difference in terms of sorting performance, making visible spectroscopy a clear winner.

  7. On the Construction of Sorted Reactive Systems

    DEFF Research Database (Denmark)

    Birkedal, Lars; Debois, Søren; Hildebrandt, Thomas

    2008-01-01

    We develop a theory of sorted bigraphical reactive systems. Every application of bigraphs in the literature has required an extension, a sorting, of pure bigraphs. In turn, every such application has required a redevelopment of the theory of pure bigraphical reactive systems for the sorting at hand...... bigraphs. Technically, we give our construction for ordinary reactive systems, then lift it to bigraphical reactive systems. As such, we give also a construction of sortings for ordinary reactive systems. This construction is an improvement over previous attempts in that it produces smaller and much more...

  8. Design and realization of sort manipulator of crystal-angle sort machine

    Science.gov (United States)

    Wang, Ming-shun; Chen, Shu-ping; Guan, Shou-ping; Zhang, Yao-wei

    2005-12-01

    It is a current tendency of development in automation technology to replace manpower with manipulators in working places where dangerous, harmful, heavy or repetitive work is involved. The sort manipulator is installed in a crystal-angle sort machine to take the place of manpower, and engaged in unloading and sorting work. It is the outcome of combing together mechanism, electric transmission, and pneumatic element and micro-controller control. The step motor makes the sort manipulator operate precisely. The pneumatic elements make the sort manipulator be cleverer. Micro-controller's software bestows some simple artificial intelligence on the sort manipulator, so that it can precisely repeat its unloading and sorting work. The combination of manipulator's zero position and step motor counting control puts an end to accumulating error in long time operation. A sort manipulator's design in the practice engineering has been proved to be correct and reliable.

  9. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  10. Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

    Czech Academy of Sciences Publication Activity Database

    Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal

    2009-01-01

    Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

  11. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  12. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  13. Enhancement of Selection, Bubble and Insertion Sorting Algorithm

    OpenAIRE

    Muhammad Farooq Umar; Ehsan Ullah Munir; Shafqat Ali Shad; Muhammad Wasif Nisar

    2014-01-01

    In everyday life there is a large amount of data to arrange because sorting removes any ambiguities and make the data analysis and data processing very easy, efficient and provides with cost less effort. In this study a set of improved sorting algorithms are proposed which gives better performance and design idea. In this study five new sorting algorithms (Bi-directional Selection Sort, Bi-directional bubble sort, MIDBiDirectional Selection Sort, MIDBidirectional bubble sort and linear insert...

  14. Surface acoustic wave actuated cell sorting (SAWACS).

    Science.gov (United States)

    Franke, T; Braunmüller, S; Schmid, L; Wixforth, A; Weitz, D A

    2010-03-21

    We describe a novel microfluidic cell sorter which operates in continuous flow at high sorting rates. The device is based on a surface acoustic wave cell-sorting scheme and combines many advantages of fluorescence activated cell sorting (FACS) and fluorescence activated droplet sorting (FADS) in microfluidic channels. It is fully integrated on a PDMS device, and allows fast electronic control of cell diversion. We direct cells by acoustic streaming excited by a surface acoustic wave which deflects the fluid independently of the contrast in material properties of deflected objects and the continuous phase; thus the device underlying principle works without additional enhancement of the sorting by prior labelling of the cells with responsive markers such as magnetic or polarizable beads. Single cells are sorted directly from bulk media at rates as fast as several kHz without prior encapsulation into liquid droplet compartments as in traditional FACS. We have successfully directed HaCaT cells (human keratinocytes), fibroblasts from mice and MV3 melanoma cells. The low shear forces of this sorting method ensure that cells survive after sorting.

  15. Algorithm 426 : Merge sort algorithm [M1

    NARCIS (Netherlands)

    Bron, C.

    1972-01-01

    Sorting by means of a two-way merge has a reputation of requiring a clerically complicated and cumbersome program. This ALGOL 60 procedure demonstrates that, using recursion, an elegant and efficient algorithm can be designed, the correctness of which is easily proved [2]. Sorting n objects gives

  16. Engineering a Cache-Oblivious Sorting Algorithm

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Fagerberg, Rolf; Vinther, Kristoffer

    2007-01-01

    This paper is an algorithmic engineering study of cache-oblivious sorting. We investigate by empirical methods a number of implementation issues and parameter choices for the cache-oblivious sorting algorithm Lazy Funnelsort, and compare the final algorithm with Quicksort, the established standard...

  17. Heuristic framework for parallel sorting computations | Nwanze ...

    African Journals Online (AJOL)

    Parallel sorting techniques have become of practical interest with the advent of new multiprocessor architectures. The decreasing cost of these processors will probably in the future, make the solutions that are derived thereof to be more appealing. Efficient algorithms for sorting scheme that are encountered in a number of ...

  18. Magnethophoretic sorting of fluid catalytic cracking particles

    NARCIS (Netherlands)

    Solsona, Miguel; Nieuwelink, A. E.; Odijk, Mathieu; Meirer, Florian; Abelmann, Leon; Olthuis, Wouter; Weckhuysen, Bert M.; van den Berg, Albert; Lee, Abraham; DeVoe, Don

    2017-01-01

    We demonstrate an on-chip particle activity sorter, focused on iron concentration and based on magnetophoresis. This device was used for fast sorting of stepwise homogenously distributed [Fe]s. The preliminary results are very encouraging. We show that we can sort particles on magnetic moment, with

  19. Data parallel sorting for particle simulation

    Science.gov (United States)

    Dagum, Leonardo

    1992-01-01

    Sorting on a parallel architecture is a communications intensive event which can incur a high penalty in applications where it is required. In the case of particle simulation, only integer sorting is necessary, and sequential implementations easily attain the minimum performance bound of O (N) for N particles. Parallel implementations, however, have to cope with the parallel sorting problem which, in addition to incurring a heavy communications cost, can make the minimun performance bound difficult to attain. This paper demonstrates how the sorting problem in a particle simulation can be reduced to a merging problem, and describes an efficient data parallel algorithm to solve this merging problem in a particle simulation. The new algorithm is shown to be optimal under conditions usual for particle simulation, and its fieldwise implementation on the Connection Machine is analyzed in detail. The new algorithm is about four times faster than a fieldwise implementation of radix sort on the Connection Machine.

  20. Data Sorting Using Graphics Processing Units

    Directory of Open Access Journals (Sweden)

    M. J. Mišić

    2012-06-01

    Full Text Available Graphics processing units (GPUs have been increasingly used for general-purpose computation in recent years. The GPU accelerated applications are found in both scientific and commercial domains. Sorting is considered as one of the very important operations in many applications, so its efficient implementation is essential for the overall application performance. This paper represents an effort to analyze and evaluate the implementations of the representative sorting algorithms on the graphics processing units. Three sorting algorithms (Quicksort, Merge sort, and Radix sort were evaluated on the Compute Unified Device Architecture (CUDA platform that is used to execute applications on NVIDIA graphics processing units. Algorithms were tested and evaluated using an automated test environment with input datasets of different characteristics. Finally, the results of this analysis are briefly discussed.

  1. Big Five Measurement via Q-Sort

    Directory of Open Access Journals (Sweden)

    Chris D. Fluckinger

    2014-08-01

    Full Text Available Socially desirable responding presents a difficult challenge in measuring personality. I tested whether a partially ipsative measure—a normatively scored Q-sort containing traditional Big Five items—would produce personality scores indicative of less socially desirable responding compared with Likert-based measures. Across both instructions to respond honestly and in the context of applying for a job, the Q-sort produced lower mean scores, lower intercorrelations between dimensions, and similar validity in predicting supervisor performance ratings to Likert. In addition, the Q-sort produced a more orthogonal structure (but not fully orthogonal when modeled at the latent level. These results indicate that the Q-sort method did constrain socially desirable responding. Researchers and practitioners should consider Big Five measurement via Q-sort for contexts in which high socially desirable responding is expected.

  2. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  3. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  4. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  5. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  6. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  7. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  8. Hop powdery mildew control through alteration of spring pruning practices

    Science.gov (United States)

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  9. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  10. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  11. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  12. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  13. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  14. Evaluation of Estrogenic Activity of Licorice Species in Comparison with Hops Used in Botanicals for Menopausal Symptoms

    Science.gov (United States)

    Hajirahimkhan, Atieh; Simmler, Charlotte; Yuan, Yang; Anderson, Jeffrey R.; Chen, Shao-Nong; Nikolić, Dejan; Dietz, Birgit M.; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

    2013-01-01

    The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus) and licorice (Glycyrrhiza spec.) to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata) in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE)-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of botanical

  15. Evaluation of estrogenic activity of licorice species in comparison with hops used in botanicals for menopausal symptoms.

    Directory of Open Access Journals (Sweden)

    Atieh Hajirahimkhan

    Full Text Available The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus and licorice (Glycyrrhiza spec. to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of

  16. IMPLEMENTATION OF SERIAL AND PARALLEL BUBBLE SORT ON FPGA

    Directory of Open Access Journals (Sweden)

    Dwi Marhaendro Jati Purnomo

    2016-06-01

    Full Text Available Sorting is common process in computational world. Its utilization are on many fields from research to industry. There are many sorting algorithm in nowadays. One of the simplest yet powerful is bubble sort. In this study, bubble sort is implemented on FPGA. The implementation was taken on serial and parallel approach. Serial and parallel bubble sort then compared by means of its memory, execution time, and utility which comprises slices and LUTs. The experiments show that serial bubble sort required smaller memory as well as utility compared to parallel bubble sort. Meanwhile, parallel bubble sort performed faster than serial bubble sort

  17. Electronic and vibrational hopping transport in boron carbides

    International Nuclear Information System (INIS)

    Emin, D.

    1991-01-01

    General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

  18. Vortex variable range hopping in a conventional superconducting film

    Science.gov (United States)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  19. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  20. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  1. An Unsupervised Online Spike-Sorting Framework.

    Science.gov (United States)

    Knieling, Simeon; Sridharan, Kousik S; Belardinelli, Paolo; Naros, Georgios; Weiss, Daniel; Mormann, Florian; Gharabaghi, Alireza

    2016-08-01

    Extracellular neuronal microelectrode recordings can include action potentials from multiple neurons. To separate spikes from different neurons, they can be sorted according to their shape, a procedure referred to as spike-sorting. Several algorithms have been reported to solve this task. However, when clustering outcomes are unsatisfactory, most of them are difficult to adjust to achieve the desired results. We present an online spike-sorting framework that uses feature normalization and weighting to maximize the distinctiveness between different spike shapes. Furthermore, multiple criteria are applied to either facilitate or prevent cluster fusion, thereby enabling experimenters to fine-tune the sorting process. We compare our method to established unsupervised offline (Wave_Clus (WC)) and online (OSort (OS)) algorithms by examining their performance in sorting various test datasets using two different scoring systems (AMI and the Adamos metric). Furthermore, we evaluate sorting capabilities on intra-operative recordings using established quality metrics. Compared to WC and OS, our algorithm achieved comparable or higher scores on average and produced more convincing sorting results for intra-operative datasets. Thus, the presented framework is suitable for both online and offline analysis and could substantially improve the quality of microelectrode-based data evaluation for research and clinical application.

  2. The Q sort theory and technique.

    Science.gov (United States)

    Nyatanga, L

    1989-10-01

    This paper is based on the author's experience of using the Q sort technique with BA Social Sciences (BASS) students, and the community psychiatric nursing (CPN, ENB No 811 course). The paper focuses on two main issues: 1. The theoretical assumptions underpinning the Q Sort technique. Carl Rogers' self theory and some of the values of humanistic psychology are summarised. 2. The actual technique procedure and meaning of results are highlighted. As the Q Sort technique is potentially useful in a variety of sittings some of which are listed in this paper, the emphasis has deliberately been placed in understanding the theoretical underpinning and the operationalisation (sensitive interpretation) of the theory to practice.

  3. Development of sorting system control using LABVIEW

    International Nuclear Information System (INIS)

    Azraf Azman; Mohd Arif Hamzah; Noriah Mod Ali; John Konsoh; Mohd Idris Taib; Maslina Mohd Ibrahim; Nor Arymaswati Abdullah; Abu Bakar Mhd Ghazali

    2005-01-01

    The development of the Personnel Dosimeter Sorting System, proposed by the Secondary Standard Dosimetry Laboratory (SSDL) is to enhance the system or work flow in preparing the personnel dosimeter. The main objective of the system is to reduce stamping error, time and cost. The Personnel Dosimeter Sorting System is a semi-automatic system with an interfacing method using the Advantec 32 bit PCI interface card of 64 digital input and output. The system is integrated with the Labview version 7.1 programming language to control the sorting system and operation. (Author)

  4. On Sorting Genomes with DCJ and Indels

    Science.gov (United States)

    Braga, Marília D. V.

    A previous work of Braga, Willing and Stoye compared two genomes with unequal content, but without duplications, and presented a new linear time algorithm to compute the genomic distance, considering double cut and join (DCJ) operations, insertions and deletions. Here we derive from this approach an algorithm to sort one genome into another one also using DCJ, insertions and deletions. The optimal sorting scenarios can have different compositions and we compare two types of sorting scenarios: one that maximizes and one that minimizes the number of DCJ operations with respect to the number of insertions and deletions.

  5. The Pch2 AAA+ ATPase promotes phosphorylation of the Hop1 meiotic checkpoint adaptor in response to synaptonemal complex defects.

    Science.gov (United States)

    Herruzo, Esther; Ontoso, David; González-Arranz, Sara; Cavero, Santiago; Lechuga, Ana; San-Segundo, Pedro A

    2016-09-19

    Meiotic cells possess surveillance mechanisms that monitor critical events such as recombination and chromosome synapsis. Meiotic defects resulting from the absence of the synaptonemal complex component Zip1 activate a meiosis-specific checkpoint network resulting in delayed or arrested meiotic progression. Pch2 is an evolutionarily conserved AAA+ ATPase required for the checkpoint-induced meiotic block in the zip1 mutant, where Pch2 is only detectable at the ribosomal DNA array (nucleolus). We describe here that high levels of the Hop1 protein, a checkpoint adaptor that localizes to chromosome axes, suppress the checkpoint defect of a zip1 pch2 mutant restoring Mek1 activity and meiotic cell cycle delay. We demonstrate that the critical role of Pch2 in this synapsis checkpoint is to sustain Mec1-dependent phosphorylation of Hop1 at threonine 318. We also show that the ATPase activity of Pch2 is essential for its checkpoint function and that ATP binding to Pch2 is required for its localization. Previous work has shown that Pch2 negatively regulates Hop1 chromosome abundance during unchallenged meiosis. Based on our results, we propose that, under checkpoint-inducing conditions, Pch2 also possesses a positive action on Hop1 promoting its phosphorylation and its proper distribution on unsynapsed chromosome axes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  7. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun

    2007-01-01

    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  8. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  9. Particle hopping vs. fluid-dynamical models for traffic flow

    Energy Technology Data Exchange (ETDEWEB)

    Nagel, K.

    1995-12-31

    Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

  10. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  11. Pengembangan Algoritma Pengurutan SMS (Scan, Move, And Sort)

    OpenAIRE

    Lubis, Denni Aprilsyah

    2015-01-01

    Sorting has been a profound area for the algorithmic researchers. And many resources are invested to suggest a more working sorting algorithm. For this purpose many existing sorting algorithms were observed in terms of the efficiency of the algorithmic complexity. Efficient sorting is important to optimize the use of other algorithms that require sorted lists to work correctly. sorting has been considered as a fundamental problem in the study of algorithms that due to many reas...

  12. Implementation of Serial and Parallel Bubble Sort on Fpga

    OpenAIRE

    Purnomo, Dwi Marhaendro Jati; Arinaldi, Ahmad; Priyantini, Dwi Teguh; Wibisono, Ari; Febrian, Andreas

    2016-01-01

    Sorting is common process in computational world. Its utilization are on many fields from research to industry. There are many sorting algorithm in nowadays. One of the simplest yet powerful is bubble sort. In this study, bubble sort is implemented on FPGA. The implementation was taken on serial and parallel approach. Serial and parallel bubble sort then compared by means of its memory, execution time, and utility which comprises slices and LUTs. The experiments show that serial bubble sort r...

  13. NeatSort - A practical adaptive algorithm

    OpenAIRE

    La Rocca, Marcello; Cantone, Domenico

    2014-01-01

    We present a new adaptive sorting algorithm which is optimal for most disorder metrics and, more important, has a simple and quick implementation. On input $X$, our algorithm has a theoretical $\\Omega (|X|)$ lower bound and a $\\mathcal{O}(|X|\\log|X|)$ upper bound, exhibiting amazing adaptive properties which makes it run closer to its lower bound as disorder (computed on different metrics) diminishes. From a practical point of view, \\textit{NeatSort} has proven itself competitive with (and of...

  14. Scaffold hopping in drug discovery using inductive logic programming.

    Science.gov (United States)

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

    2008-05-01

    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  15. Automatic spike sorting using tuning information.

    Science.gov (United States)

    Ventura, Valérie

    2009-09-01

    Current spike sorting methods focus on clustering neurons' characteristic spike waveforms. The resulting spike-sorted data are typically used to estimate how covariates of interest modulate the firing rates of neurons. However, when these covariates do modulate the firing rates, they provide information about spikes' identities, which thus far have been ignored for the purpose of spike sorting. This letter describes a novel approach to spike sorting, which incorporates both waveform information and tuning information obtained from the modulation of firing rates. Because it efficiently uses all the available information, this spike sorter yields lower spike misclassification rates than traditional automatic spike sorters. This theoretical result is verified empirically on several examples. The proposed method does not require additional assumptions; only its implementation is different. It essentially consists of performing spike sorting and tuning estimation simultaneously rather than sequentially, as is currently done. We used an expectation-maximization maximum likelihood algorithm to implement the new spike sorter. We present the general form of this algorithm and provide a detailed implementable version under the assumptions that neurons are independent and spike according to Poisson processes. Finally, we uncover a systematic flaw of spike sorting based on waveform information only.

  16. The solution space of sorting by DCJ.

    Science.gov (United States)

    Braga, Marília D V; Stoye, Jens

    2010-09-01

    In genome rearrangements, the double cut and join (DCJ) operation, introduced by Yancopoulos et al. in 2005, allows one to represent most rearrangement events that could happen in multichromosomal genomes, such as inversions, translocations, fusions, and fissions. No restriction on the genome structure considering linear and circular chromosomes is imposed. An advantage of this general model is that it leads to considerable algorithmic simplifications compared to other genome rearrangement models. Recently, several works concerning the DCJ operation have been published, and in particular, an algorithm was proposed to find an optimal DCJ sequence for sorting one genome into another one. Here we study the solution space of this problem and give an easy-to-compute formula that corresponds to the exact number of optimal DCJ sorting sequences for a particular subset of instances of the problem. We also give an algorithm to count the number of optimal sorting sequences for any instance of the problem. Another interesting result is the demonstration of the possibility of obtaining one optimal sorting sequence by properly replacing any pair of consecutive operations in another optimal sequence. As a consequence, any optimal sorting sequence can be obtained from one other by applying such replacements successively, but the problem of finding the shortest number of replacements between two sorting sequences is still open.

  17. Hopping conductivity via deep impurity states in InP

    International Nuclear Information System (INIS)

    Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.

    1984-01-01

    Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

  18. Crossover in tunneling hops in systems of strongly localized electrons

    International Nuclear Information System (INIS)

    Lien Nguyen, V.; Gamietea, A.D.

    1995-11-01

    Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

  19. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  20. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  1. Understanding Mott's law from scaling of variable-range-hopping currents and intrinsic current fluctuations

    NARCIS (Netherlands)

    Pasveer, W.F.; Michels, M.A.J.

    2006-01-01

    We have used the master equation to simulate variable-range hopping (VRH) of charges in a strongly disordered d-dimensional energy landscape (d=1,2,3). The current distribution over hopping distances and hopping energies gives a clear insight into the difference between hops that occur most

  2. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    Directory of Open Access Journals (Sweden)

    Haejoon Jung

    2018-01-01

    Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  3. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  4. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    POSPÍŠIL, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  5. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2011-01-01

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station

  6. Majorana edge States in atomic wires coupled by pair hopping.

    Science.gov (United States)

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  7. Signaling induced by hop/STI-1 depends on endocytosis

    International Nuclear Information System (INIS)

    Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

    2007-01-01

    The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

  8. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  9. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  10. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  11. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    Science.gov (United States)

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  12. Fruit Sorting Using Fuzzy Logic Techniques

    Science.gov (United States)

    Elamvazuthi, Irraivan; Sinnadurai, Rajendran; Aftab Ahmed Khan, Mohamed Khan; Vasant, Pandian

    2009-08-01

    Fruit and vegetables market is getting highly selective, requiring their suppliers to distribute the goods according to very strict standards of quality and presentation. In the last years, a number of fruit sorting and grading systems have appeared to fulfill the needs of the fruit processing industry. However, most of them are overly complex and too costly for the small and medium scale industry (SMIs) in Malaysia. In order to address these shortcomings, a prototype machine was developed by integrating the fruit sorting, labeling and packing processes. To realise the prototype, many design issues were dealt with. Special attention is paid to the electronic weighing sub-system for measuring weight, and the opto-electronic sub-system for determining the height and width of the fruits. Specifically, this paper discusses the application of fuzzy logic techniques in the sorting process.

  13. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  14. MODELING WORK OF SORTING STATION USING UML

    Directory of Open Access Journals (Sweden)

    O. V. Gorbova

    2014-12-01

    Full Text Available Purpose. The purpose of this paper is the construction of methods and models for the graphical representation process of sorting station, using the unified modeling language (UML. Methodology. Methods of graph theory, finite automata and the representation theory of queuing systems were used as the methods of investigation. A graphical representation of the process was implemented with using the Unified Modeling Language UML. The sorting station process representation is implemented as a state diagram and actions through a set of IBM Rational Rose. Graphs can show parallel operation of sorting station, the parallel existence and influence of objects process and the transition from one state to another. The IBM Rational Rose complex allows developing a diagram of work sequence of varying degrees of detailing. Findings. The study has developed a graphical representation method of the process of sorting station of different kind of complexity. All graphical representations are made using the UML. They are represented as a directed graph with the states. It is clear enough in the study of the subject area. Applying the methodology of the representation process, it allows becoming friendly with the work of any automation object very fast, and exploring the process during algorithms construction of sorting stations and other railway facilities. This model is implemented with using the Unified Modeling Language (UML using a combination of IBM Rational Rose. Originality. The representation process of sorting station was developed by means of the Unified Modeling Language (UML use. Methodology of representation process allows creating the directed graphs based on the order of execution of the works chain, objects and performers of these works. The UML allows visualizing, specifying, constructing and documenting, formalizing the representation process of sorting station and developing sequence diagrams of works of varying degrees of detail. Practical

  15. Software information sorting code 'PLUTO-R'

    International Nuclear Information System (INIS)

    Tsunematsu, Toshihide; Naraoka, Kenitsu; Adachi, Masao; Takeda, Tatsuoki

    1984-10-01

    A software information sorting code PLUTO-R is developed as one of the supporting codes of the TRITON system for the fusion plasma analysis. The objective of the PLUTO-R code is to sort reference materials of the codes in the TRITON code system. The easiness in the registration of information is especially pursued. As experience and skill in the data registration are not required, this code is usable for construction of general small-scale information system. This report gives an overall description and the user's manual of the PLUTO-R code. (author)

  16. Application of radix sorting in high energy physics experiment

    International Nuclear Information System (INIS)

    Chen Xuan; Gu Minhao; Zhu Kejun

    2012-01-01

    In the high energy physics experiments, there are always requirements to sort the large scale of experiment data. To meet the demand, this paper introduces one radix sorting algorithms, whose sub-sort is counting sorting and time complex is O (n), based on the characteristic of high energy physics experiment data that is marked by time stamp. This paper gives the description, analysis, implementation and experimental result of the sorting algorithms. (authors)

  17. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  18. TECHNICAL EQUIPMENT FOR SORTING APPLES BY SIZE

    Directory of Open Access Journals (Sweden)

    Vasilica Ştefan

    2012-01-01

    Full Text Available Need to increase the competitiveness of semi-subsistence farms, by valorisation of the fruits, led to research for designing of an equipment for sorting apples by size, in order to meet market requirement, pricing according to the size of the fruits.

  19. Integration through a Card-Sort Activity

    Science.gov (United States)

    Green, Kris; Ricca, Bernard P.

    2015-01-01

    Learning to compute integrals via the various techniques of integration (e.g., integration by parts, partial fractions, etc.) is difficult for many students. Here, we look at how students in a college level Calculus II course develop the ability to categorize integrals and the difficulties they encounter using a card sort-resort activity. Analysis…

  20. A note on sorting buffrs offline

    NARCIS (Netherlands)

    Chan, H.L.; Megow, N.; Sitters, R.A.; van Stee, R.

    2012-01-01

    We consider the offline sorting buffer problem. The input is a sequence of items of different types. All items must be processed one by one by a server. The server is equipped with a random-access buffer of limited capacity which can be used to rearrange items. The problem is to design a scheduling

  1. A cargo-sorting DNA robot.

    Science.gov (United States)

    Thubagere, Anupama J; Li, Wei; Johnson, Robert F; Chen, Zibo; Doroudi, Shayan; Lee, Yae Lim; Izatt, Gregory; Wittman, Sarah; Srinivas, Niranjan; Woods, Damien; Winfree, Erik; Qian, Lulu

    2017-09-15

    Two critical challenges in the design and synthesis of molecular robots are modularity and algorithm simplicity. We demonstrate three modular building blocks for a DNA robot that performs cargo sorting at the molecular level. A simple algorithm encoding recognition between cargos and their destinations allows for a simple robot design: a single-stranded DNA with one leg and two foot domains for walking, and one arm and one hand domain for picking up and dropping off cargos. The robot explores a two-dimensional testing ground on the surface of DNA origami, picks up multiple cargos of two types that are initially at unordered locations, and delivers them to specified destinations until all molecules are sorted into two distinct piles. The robot is designed to perform a random walk without any energy supply. Exploiting this feature, a single robot can repeatedly sort multiple cargos. Localization on DNA origami allows for distinct cargo-sorting tasks to take place simultaneously in one test tube or for multiple robots to collectively perform the same task. Copyright © 2017, American Association for the Advancement of Science.

  2. Smoothsort, an alternative for sorting in situ

    NARCIS (Netherlands)

    Dijkstra, E.W.

    1982-01-01

    Like heapsort - which inspired it - smoothsort is an algorithm for sorting in situ. It is of order N · log N in the worst case, but of order N in the best case, with a smooth transition between the two. (Hence its name.)

  3. Passive sorting of capsules by deformability

    Science.gov (United States)

    Haener, Edgar; Juel, Anne

    We study passive sorting according to deformability of liquid-filled ovalbumin-alginate capsules. We present results for two sorting geometries: a straight channel with a half-cylindrical obstruction and a pinched flow fractioning device (PFF) adapted for use with capsules. In the half-cylinder device, the capsules deform as they encounter the obstruction, and travel around the half-cylinder. The distance from the capsule's centre of mass to the surface of the half-cylinder depends on deformability, and separation between capsules of different deformability is amplified by diverging streamlines in the channel expansion downstream of the obstruction. We show experimentally that capsules can be sorted according to deformability with their downstream position depending on capillary number only, and we establish the sensitivity of the device to experimental variability. In the PFF device, particles are compressed against a wall using a strong pinching flow. We show that capsule deformation increases with the intensity of the pinching flow, but that the downstream capsule position is not set by deformation in the device. However, when using the PFF device like a T-Junction, we achieve improved sorting resolution compared to the half-cylinder device.

  4. 6. Algorithms for Sorting and Searching

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 3. Algorithms - Algorithms for Sorting and Searching. R K Shyamasundar. Series Article ... Author Affiliations. R K Shyamasundar1. Computer Science Group, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400 005, India ...

  5. Axon-Axon Interactions Regulate Topographic Optic Tract Sorting via CYFIP2-Dependent WAVE Complex Function.

    Science.gov (United States)

    Cioni, Jean-Michel; Wong, Hovy Ho-Wai; Bressan, Dario; Kodama, Lay; Harris, William A; Holt, Christine E

    2018-03-07

    The axons of retinal ganglion cells (RGCs) are topographically sorted before they arrive at the optic tectum. This pre-target sorting, typical of axon tracts throughout the brain, is poorly understood. Here, we show that cytoplasmic FMR1-interacting proteins (CYFIPs) fulfill non-redundant functions in RGCs, with CYFIP1 mediating axon growth and CYFIP2 specifically involved in axon sorting. We find that CYFIP2 mediates homotypic and heterotypic contact-triggered fasciculation and repulsion responses between dorsal and ventral axons. CYFIP2 associates with transporting ribonucleoprotein particles in axons and regulates translation. Axon-axon contact stimulates CYFIP2 to move into growth cones where it joins the actin nucleating WAVE regulatory complex (WRC) in the periphery and regulates actin remodeling and filopodial dynamics. CYFIP2's function in axon sorting is mediated by its binding to the WRC but not its translational regulation. Together, these findings uncover CYFIP2 as a key regulatory link between axon-axon interactions, filopodial dynamics, and optic tract sorting. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  7. Surface hopping simulation of vibrational predissociation of methanol dimer

    Science.gov (United States)

    Jiang, Ruomu; Sibert, Edwin L.

    2012-06-01

    The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

  8. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  9. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  10. “It may be verifyit that thy wit is thin”: Interpreting Older Scots Flyting through Hip Hop Aesthetics

    Directory of Open Access Journals (Sweden)

    Caitlin Flynn

    2014-03-01

    Full Text Available This study seeks to demystify the tradition of Older Scots flyting—a form of poetic invective unique to the late medieval Scottish court. Hip Hop battle raps provide a modern venue for exploring the motivations and potential rewards for engaging in this sort of technical poetic contest. The two forms, though culturally and historically distant, both exhibit analogous rhetorical techniques, which make this comparison possible. Each form is concerned with poetic identity—this is evident through each poet’s identification with specific communities or classes; while the concern with demonstrating superior technical skill is also essential to these invectives and is often highlighted through the manipulation of traditional forms and tropes. As an extension of this comparison, we hope to recover something of the tone and purpose of the medieval tradition, namely, that the poets who engaged in these public invectives were actually amicable rivals competing for increased court status and wealth.

  11. Identification of critical chemical features for Aurora kinase-B inhibitors using Hip-Hop, virtual screening and molecular docking

    Science.gov (United States)

    Sakkiah, Sugunadevi; Thangapandian, Sundarapandian; John, Shalini; Lee, Keun Woo

    2011-01-01

    This study was performed to find the selective chemical features for Aurora kinase-B inhibitors using the potent methods like Hip-Hop, virtual screening, homology modeling, molecular dynamics and docking. The best hypothesis, Hypo1 was validated toward a wide range of test set containing the selective inhibitors of Aurora kinase-B. Homology modeling and molecular dynamics studies were carried out to perform the molecular docking studies. The best hypothesis Hypo1 was used as a 3D query to screen the chemical databases. The screened molecules from the databases were sorted based on ADME and drug like properties. The selective hit compounds were docked and the hydrogen bond interactions with the critical amino acids present in Aurora kinase-B were compared with the chemical features present in the Hypo1. Finally, we suggest that the chemical features present in the Hypo1 are vital for a molecule to inhibit the Aurora kinase-B activity.

  12. PhySortR: a fast, flexible tool for sorting phylogenetic trees in R.

    Science.gov (United States)

    Stephens, Timothy G; Bhattacharya, Debashish; Ragan, Mark A; Chan, Cheong Xin

    2016-01-01

    A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable.

  13. ScanSort{sup SM} at Whiteshell Laboratories for sorting of experimental cesium pond soil

    Energy Technology Data Exchange (ETDEWEB)

    Downey, H., E-mail: heath.downey@amecfw.com [Amec Foster Wheeler, Portland, ME (United States)

    2015-07-01

    The ScanSort{sup SM} soil sorting system is a unique and efficient radiological instrument used for measuring and sorting bulk soils and volumetric materials. The system performs automatic radioassay and segregation of preconditioned material using a gamma spectroscopy system mounted above a conveyor belt. It was deployed to the Whiteshell Laboratories site to process the excavated soils generated during the decommissioning of the former Experimental Cesium Pond. The ScanSort{sup SM} system was utilized to segregate material with Cs-137 concentrations above the established site unrestricted release and restricted site reuse levels as well as demonstrated the ability to accurately determine the radioactivity concentrations of the radiologically-impacted material and to confidently segregate volumes of that material for appropriate final disposition. (author)

  14. Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

    Science.gov (United States)

    Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

    2009-05-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

  15. Sequence analyses reveal that a TPR–DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR–DP domains and prokaryotic GerD proteins

    Science.gov (United States)

    Papandreou, Nikolaos; Chomilier, Jacques

    2008-01-01

    The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR–DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR–DP domains. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0083-8) contains supplementary material, which is available to authorized users. PMID:18987995

  16. Sorting signed permutations by short operations.

    Science.gov (United States)

    Galvão, Gustavo Rodrigues; Lee, Orlando; Dias, Zanoni

    2015-01-01

    During evolution, global mutations may alter the order and the orientation of the genes in a genome. Such mutations are referred to as rearrangement events, or simply operations. In unichromosomal genomes, the most common operations are reversals, which are responsible for reversing the order and orientation of a sequence of genes, and transpositions, which are responsible for switching the location of two contiguous portions of a genome. The problem of computing the minimum sequence of operations that transforms one genome into another - which is equivalent to the problem of sorting a permutation into the identity permutation - is a well-studied problem that finds application in comparative genomics. There are a number of works concerning this problem in the literature, but they generally do not take into account the length of the operations (i.e. the number of genes affected by the operations). Since it has been observed that short operations are prevalent in the evolution of some species, algorithms that efficiently solve this problem in the special case of short operations are of interest. In this paper, we investigate the problem of sorting a signed permutation by short operations. More precisely, we study four flavors of this problem: (i) the problem of sorting a signed permutation by reversals of length at most 2; (ii) the problem of sorting a signed permutation by reversals of length at most 3; (iii) the problem of sorting a signed permutation by reversals and transpositions of length at most 2; and (iv) the problem of sorting a signed permutation by reversals and transpositions of length at most 3. We present polynomial-time solutions for problems (i) and (iii), a 5-approximation for problem (ii), and a 3-approximation for problem (iv). Moreover, we show that the expected approximation ratio of the 5-approximation algorithm is not greater than 3 for random signed permutations with more than 12 elements. Finally, we present experimental results that show

  17. Hopping control channel MAC protocol for opportunistic spectrum access networks

    Institute of Scientific and Technical Information of China (English)

    FU Jing-tuan; JI Hong; MAO Xu

    2010-01-01

    Opportunistic spectrum access (OSA) is considered as a promising approach to mitigate spectrum scarcity by allowing unlicensed users to exploit spectrum opportunities in licensed frequency bands. Derived from the existing channel-hopping multiple access (CHMA) protocol,we introduce a hopping control channel medium access control (MAC) protocol in the context of OSA networks. In our proposed protocol,all nodes in the network follow a common channel-hopping sequence; every frequency channel can be used as control channel and data channel. Considering primary users' occupancy of the channel,we use a primary user (PU) detection model to calculate the channel availability for unlicensed users' access. Then,a discrete Markov chain analytical model is applied to describe the channel states and deduce the system throughput. Through simulation,we present numerical results to demonstrate the throughput performance of our protocol and thus validate our work.

  18. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček

    2015-01-01

    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  19. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  20. Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

    Science.gov (United States)

    Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

    2012-05-04

    In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

  1. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed...... contributes to the early EMG burst, then advancing or delaying the touch-down without the subject's knowledge should similarly advance or delay the burst. This was indeed the case when touch-down was advanced or delayed by shifting the height of a programmable platform up or down between two hops...... and this resulted in a correspondent shift of the early EMG burst. Our second hypothesis was that the motor cortex contributes to the first EMG burst during hopping. If so, inhibition of the motor cortex would reduce the magnitude of the burst. By applying a low-intensity magnetic stimulus it was possible...

  2. Fascin- and α-Actinin-Bundled Networks Contain Intrinsic Structural Features that Drive Protein Sorting.

    Science.gov (United States)

    Winkelman, Jonathan D; Suarez, Cristian; Hocky, Glen M; Harker, Alyssa J; Morganthaler, Alisha N; Christensen, Jenna R; Voth, Gregory A; Bartles, James R; Kovar, David R

    2016-10-24

    Cells assemble and maintain functionally distinct actin cytoskeleton networks with various actin filament organizations and dynamics through the coordinated action of different sets of actin-binding proteins. The biochemical and functional properties of diverse actin-binding proteins, both alone and in combination, have been increasingly well studied. Conversely, how different sets of actin-binding proteins properly sort to distinct actin filament networks in the first place is not nearly as well understood. Actin-binding protein sorting is critical for the self-organization of diverse dynamic actin cytoskeleton networks within a common cytoplasm. Using in vitro reconstitution techniques including biomimetic assays and single-molecule multi-color total internal reflection fluorescence microscopy, we discovered that sorting of the prominent actin-bundling proteins fascin and α-actinin to distinct networks is an intrinsic behavior, free of complicated cellular signaling cascades. When mixed, fascin and α-actinin mutually exclude each other by promoting their own recruitment and inhibiting recruitment of the other, resulting in the formation of distinct fascin- or α-actinin-bundled domains. Subdiffraction-resolution light microscopy and negative-staining electron microscopy revealed that fascin domains are densely packed, whereas α-actinin domains consist of widely spaced parallel actin filaments. Importantly, other actin-binding proteins such as fimbrin and espin show high specificity between these two bundle types within the same reaction. Here we directly observe that fascin and α-actinin intrinsically segregate to discrete bundled domains that are specifically recognized by other actin-binding proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

    2017-01-01

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

  4. From Broken Glass to Ruf Diamonds: Manchester Hip Hop

    OpenAIRE

    de Paor-Evans, Adam

    2018-01-01

    When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

  5. A mower detector to judge soil sorting

    International Nuclear Information System (INIS)

    Bramlitt, E.T.; Johnson, N.R.

    1995-01-01

    Thermo Nuclear Services (TNS) has developed a mower detector as an inexpensive and fast means for deciding potential value of soil sorting for cleanup. It is a shielded detector box on wheels pushed over the ground (as a person mows grass) at 30 ft/min with gamma-ray counts recorded every 0.25 sec. It mirror images detection by the TNS transportable sorter system which conveys soil at 30 ft/min and toggles a gate to send soil on separate paths based on counts. The mower detector shows if contamination is variable and suitable for sorting, and by unique calibration sources, it indicates detection sensitivity. The mower detector has been used to characterize some soil at Department of Energy sites in New Jersey and South Carolina

  6. Sorting processes with energy-constrained comparisons*

    Science.gov (United States)

    Geissmann, Barbara; Penna, Paolo

    2018-05-01

    We study very simple sorting algorithms based on a probabilistic comparator model. In this model, errors in comparing two elements are due to (1) the energy or effort put in the comparison and (2) the difference between the compared elements. Such algorithms repeatedly compare and swap pairs of randomly chosen elements, and they correspond to natural Markovian processes. The study of these Markov chains reveals an interesting phenomenon. Namely, in several cases, the algorithm that repeatedly compares only adjacent elements is better than the one making arbitrary comparisons: in the long-run, the former algorithm produces sequences that are "better sorted". The analysis of the underlying Markov chain poses interesting questions as the latter algorithm yields a nonreversible chain, and therefore its stationary distribution seems difficult to calculate explicitly. We nevertheless provide bounds on the stationary distributions and on the mixing time of these processes in several restrictions.

  7. Microtechnology for cell manipulation and sorting

    CERN Document Server

    Tseng, Peter; Carlo, Dino

    2017-01-01

    This book delves into the recent developments in the microscale and microfluidic technologies that allow manipulation at the single and cell aggregate level. Expert authors review the dominant mechanisms that manipulate and sort biological structures, making this a state-of-the-art overview of conventional cell sorting techniques, the principles of microfluidics, and of microfluidic devices. All chapters highlight the benefits and drawbacks of each technique they discuss, which include magnetic, electrical, optical, acoustic, gravity/sedimentation, inertial, deformability, and aqueous two-phase systems as the dominant mechanisms utilized by microfluidic devices to handle biological samples. Each chapter explains the physics of the mechanism at work, and reviews common geometries and devices to help readers decide the type of style of device required for various applications. This book is appropriate for graduate-level biomedical engineering and analytical chemistry students, as well as engineers and scientist...

  8. A Novel and Simple Spike Sorting Implementation.

    Science.gov (United States)

    Petrantonakis, Panagiotis C; Poirazi, Panayiota

    2017-04-01

    Monitoring the activity of multiple, individual neurons that fire spikes in the vicinity of an electrode, namely perform a Spike Sorting (SS) procedure, comprises one of the most important tools for contemporary neuroscience in order to reverse-engineer the brain. As recording electrodes' technology rabidly evolves by integrating thousands of electrodes in a confined spatial setting, the algorithms that are used to monitor individual neurons from recorded signals have to become even more reliable and computationally efficient. In this work, we propose a novel framework of the SS approach in which a single-step processing of the raw (unfiltered) extracellular signal is sufficient for both the detection and sorting of the activity of individual neurons. Despite its simplicity, the proposed approach exhibits comparable performance with state-of-the-art approaches, especially for spike detection in noisy signals, and paves the way for a new family of SS algorithms with the potential for multi-recording, fast, on-chip implementations.

  9. Colour based sorting station with Matlab simulation

    Directory of Open Access Journals (Sweden)

    Constantin Victor

    2017-01-01

    Full Text Available The paper presents the design process and manufacturing elements of a colour-based sorting station. The system is comprised of a gravitational storage, which also contains the colour sensor. Parts are extracted using a linear pneumatic motor and are fed onto an electrically driven conveyor belt. Extraction of the parts is done at 4 points, using two pneumatic motors and a geared DC motor, while the 4th position is at the end of the belt. The mechanical parts of the system are manufactured using 3D printer technology, allowing for easy modification and adaption to the geometry of different parts. The paper shows all of the stages needed to design, optimize, test and implement the proposed solution. System optimization was performed using a graphical Matlab interface which also allows for sorting algorithm optimization.

  10. Efficient sorting using registers and caches

    DEFF Research Database (Denmark)

    Wickremesinghe, Rajiv; Arge, Lars Allan; Chase, Jeffrey S.

    2002-01-01

    . Inadequate models lead to poor algorithmic choices and an incomplete understanding of algorithm behavior on real machines.A key step toward developing better models is to quantify the performance effects of features not reflected in the models. This paper explores the effect of memory system features...... on sorting performance. We introduce a new cache-conscious sorting algorithm, R-MERGE, which achieves better performance in practice over algorithms that are superior in the theoretical models. R-MERGE is designed to minimize memory stall cycles rather than cache misses by considering features common to many......Modern computer systems have increasingly complex memory systems. Common machine models for algorithm analysis do not reflect many of the features of these systems, e.g., large register sets, lockup-free caches, cache hierarchies, associativity, cache line fetching, and streaming behavior...

  11. A mower detector to judge soil sorting

    Energy Technology Data Exchange (ETDEWEB)

    Bramlitt, E.T.; Johnson, N.R. [Thermo Nuclear Services, Inc., Albuquerque, NM (United States)

    1995-12-31

    Thermo Nuclear Services (TNS) has developed a mower detector as an inexpensive and fast means for deciding potential value of soil sorting for cleanup. It is a shielded detector box on wheels pushed over the ground (as a person mows grass) at 30 ft/min with gamma-ray counts recorded every 0.25 sec. It mirror images detection by the TNS transportable sorter system which conveys soil at 30 ft/min and toggles a gate to send soil on separate paths based on counts. The mower detector shows if contamination is variable and suitable for sorting, and by unique calibration sources, it indicates detection sensitivity. The mower detector has been used to characterize some soil at Department of Energy sites in New Jersey and South Carolina.

  12. System for optical sorting of microscopic objects

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a system for optical sorting of microscopic objects and corresponding method. An optical detection system (52) is capable of determining the positions of said first and/or said second objects. One or more force transfer units (200, 205, 210, 215) are placed...... in a first reservoir, the one or more force units being suitable for optical momentum transfer. An electromagnetic radiation source (42) yields a radiation beam (31, 32) capable of optically displacing the force transfer units from one position to another within the first reservoir (1R). The force transfer...... units are displaced from positions away from the first objects to positions close to the first objects, and then displacing the first objects via a contact force (300) between the first objects and the force transfer units facilitates an optical sorting of the first objects and the second objects....

  13. Efficient Sorting on the Tilera Manycore Architecture

    Energy Technology Data Exchange (ETDEWEB)

    Morari, Alessandro; Tumeo, Antonino; Villa, Oreste; Secchi, Simone; Valero, Mateo

    2012-10-24

    e present an efficient implementation of the radix sort algo- rithm for the Tilera TILEPro64 processor. The TILEPro64 is one of the first successful commercial manycore processors. It is com- posed of 64 tiles interconnected through multiple fast Networks- on-chip and features a fully coherent, shared distributed cache. The architecture has a large degree of flexibility, and allows various optimization strategies. We describe how we mapped the algorithm to this architecture. We present an in-depth analysis of the optimizations for each phase of the algorithm with respect to the processor’s sustained performance. We discuss the overall throughput reached by our radix sort implementation (up to 132 MK/s) and show that it provides comparable or better performance-per-watt with respect to state-of-the art implemen- tations on x86 processors and graphic processing units.

  14. Performance pay, sorting and social motivation

    OpenAIRE

    Eriksson, Tor; Villeval, Marie Claire

    2008-01-01

    International audience; Variable pay links pay and performance but may also help firms in attracting more productive employees. Our experiment investigates the impact of performance pay on both incentives and sorting and analyzes the influence of repeated interactions between firms and employees on these effects. We show that (i) the opportunity to switch from a fixed wage to variable pay scheme increases the average effort level and its variance; (ii) high skill employees concentrate under t...

  15. A sorting network in bounded arithmetic

    Czech Academy of Sciences Publication Activity Database

    Jeřábek, Emil

    2011-01-01

    Roč. 162, č. 4 (2011), s. 341-355 ISSN 0168-0072 R&D Projects: GA AV ČR IAA1019401; GA MŠk(CZ) 1M0545 Institutional research plan: CEZ:AV0Z10190503 Keywords : bounded arithmetic * sorting network * proof complexity * monotone sequent calculus Subject RIV: BA - General Mathematics Impact factor: 0.450, year: 2011 http://www.sciencedirect.com/science/article/pii/S0168007210001272

  16. Job Sorting in African Labor Markets

    OpenAIRE

    Marcel Fafchamps; Mans Soderbom; Najy Benhassine

    2006-01-01

    Using matched employer-employee data from eleven African countries, we investigate if there is a job sorting in African labor markets. We find that much of the wage gap correlated with education is driven by selection across occupations and firms. This is consistent with educated workers being more effective at complex tasks like labor management. In all countries the education wage gap widens rapidly at high low levels of education. Most of the education wage gap at low levels of education c...

  17. Direct current hopping conductance in one-dimensional diagonal disordered systems

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Xiao Jian-Rong

    2006-01-01

    Based on a tight-binding disordered model describing a single electron band, we establish a direct current (dc) electronic hopping transport conductance model of one-dimensional diagonal disordered systems, and also derive a dc conductance formula. By calculating the dc conductivity, the relationships between electric field and conductivity and between temperature and conductivity are analysed, and the role played by the degree of disorder in electronic transport is studied. The results indicate the conductivity of systems decreasing with the increase of the degree of disorder, characteristics of negative differential dependence of resistance on temperature at low temperatures in diagonal disordered systems, and the conductivity of systems decreasing with the increase of electric field, featuring the non-Ohm's law conductivity.

  18. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  19. Parallel integer sorting with medium and fine-scale parallelism

    Science.gov (United States)

    Dagum, Leonardo

    1993-01-01

    Two new parallel integer sorting algorithms, queue-sort and barrel-sort, are presented and analyzed in detail. These algorithms do not have optimal parallel complexity, yet they show very good performance in practice. Queue-sort designed for fine-scale parallel architectures which allow the queueing of multiple messages to the same destination. Barrel-sort is designed for medium-scale parallel architectures with a high message passing overhead. The performance results from the implementation of queue-sort on a Connection Machine CM-2 and barrel-sort on a 128 processor iPSC/860 are given. The two implementations are found to be comparable in performance but not as good as a fully vectorized bucket sort on the Cray YMP.

  20. Stochastic Model of Vesicular Sorting in Cellular Organelles

    Science.gov (United States)

    Vagne, Quentin; Sens, Pierre

    2018-02-01

    The proper sorting of membrane components by regulated exchange between cellular organelles is crucial to intracellular organization. This process relies on the budding and fusion of transport vesicles, and should be strongly influenced by stochastic fluctuations, considering the relatively small size of many organelles. We identify the perfect sorting of two membrane components initially mixed in a single compartment as a first passage process, and we show that the mean sorting time exhibits two distinct regimes as a function of the ratio of vesicle fusion to budding rates. Low ratio values lead to fast sorting but result in a broad size distribution of sorted compartments dominated by small entities. High ratio values result in two well-defined sorted compartments but sorting is exponentially slow. Our results suggest an optimal balance between vesicle budding and fusion for the rapid and efficient sorting of membrane components and highlight the importance of stochastic effects for the steady-state organization of intracellular compartments.

  1. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Directory of Open Access Journals (Sweden)

    María Pilar Castañeda-Ojeda

    2017-05-01

    Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

  2. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  3. Ligand recognition and domain structure of Vps10p, a vacuolar protein sorting receptor in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jørgensen, M U; Emr, S D; Winther, Jakob R.

    1999-01-01

    Vp10p is a receptor that sorts several different vacuolar proteins by cycling between a late Golgi compartment and the endosome. The cytoplasmic tail of Vps10p is necessary for the recycling, whereas the lumenal domain is predicted to interact with the soluble ligands. We have studied ligand bind...

  4. Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

    NARCIS (Netherlands)

    van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

    2015-01-01

    Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

  5. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  6. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    Science.gov (United States)

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  7. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  8. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  9. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  10. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  11. Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

    National Research Council Canada - National Science Library

    Roberts, Christopher

    2003-01-01

    .... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

  12. Ordered particles versus ordered pointers in the hybrid ordered plasma simulation (HOPS) code

    International Nuclear Information System (INIS)

    Anderson, D.V.; Shumaker, D.E.

    1993-01-01

    From a computational standpoint, particle simulation calculations for plasmas have not adapted well to the transitions from scalar to vector processing nor from serial to parallel environments. They have suffered from inordinate and excessive accessing of computer memory and have been hobbled by relatively inefficient gather-scatter constructs resulting from the use of indirect indexing. Lastly, the many-to-one mapping characteristic of the deposition phase has made it difficult to perform this in parallel. The authors' code sorts and reorders the particles in a spatial order. This allows them to greatly reduce the memory references, to run in directly indexed vector mode, and to employ domain decomposition to achieve parallelization. The field model solves pre-maxwell equations by interatively implicit methods. The OSOP (Ordered Storage Ordered Processing) version of HOPS keeps the particle tables ordered by rebuilding them after each particle pushing phase. Alternatively, the RSOP (Random Storage Ordered Processing) version keeps a table of pointers ordered by rebuilding them. Although OSOP is somewhat faster than RSOP in tests on vector-parallel machines, it is not clear this advantage will carry over to massively parallel computers

  13. Automatic Color Sorting of Hardwood Edge-Glued Panel Parts

    Science.gov (United States)

    D. Earl Kline; Richard Conners; Qiang Lu; Philip A. Araman

    1997-01-01

    This paper describes an automatic color sorting system for red oak edge-glued panel parts. The color sorting system simultaneously examines both faces of a panel part and then determines which face has the "best" color, and sorts the part into one of a number of color classes at plant production speeds. Initial test results show that the system generated over...

  14. Categorizing Variations of Student-Implemented Sorting Algorithms

    Science.gov (United States)

    Taherkhani, Ahmad; Korhonen, Ari; Malmi, Lauri

    2012-01-01

    In this study, we examined freshmen students' sorting algorithm implementations in data structures and algorithms' course in two phases: at the beginning of the course before the students received any instruction on sorting algorithms, and after taking a lecture on sorting algorithms. The analysis revealed that many students have insufficient…

  15. Order-sorted Algebraic Specifications with Higher-order Functions

    DEFF Research Database (Denmark)

    Haxthausen, Anne Elisabeth

    1995-01-01

    This paper gives a proposal for how order-sorted algebraic specification languages can be extended with higher-order functions. The approach taken is a generalisation to the order-sorted case of an approach given by Mller, Tarlecki and Wirsing for the many-sorted case. The main idea in the proposal...

  16. Gender Sorting across K-12 Schools in the United States

    Science.gov (United States)

    Long, Mark C.; Conger, Dylan

    2013-01-01

    This article documents evidence of nonrandom gender sorting across K-12 schools in the United States. The sorting exists among coed schools and at all grade levels, and it is highest in the secondary school grades. We observe some gender sorting across school sectors and types: for instance, males are slightly underrepresented in private schools…

  17. Costs and returns of producing hops in established tree plantations

    Science.gov (United States)

    Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith. Woeste

    2017-01-01

    This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...

  18. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  19. Wireless multi-hop networks with stealing : large buffer asymptotics

    NARCIS (Netherlands)

    Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.

    2010-01-01

    Wireless networks equipped with CSMA are scheduled in a fully distributed manner. A disadvantage of such distributed control in multi-hop networks is the hidden node problem that causes the effect of stealing, in which a downstream node steals the channel from an upstream node with probability p.

  20. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  1. Crossing the Lexicon: Anglicisms in the German Hip Hop Community

    Science.gov (United States)

    Garley, Matthew E.

    2012-01-01

    The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…

  2. Powdery mildew reaction of hop cultivars and USDA germplasm, 2015

    Science.gov (United States)

    This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

  3. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz; Svensson, Tommy; Brandt-Pearce, Maite; Alouini, Mohamed-Slim

    2017-01-01

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking

  4. Correlated Hopping in the 1D Falicov--Kimball Model

    Science.gov (United States)

    Gajek, Z.; Lemanski, R.

    2001-10-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

  5. Correlated Hopping in the 1d Falicov-Kimball Model

    International Nuclear Information System (INIS)

    Gajek, Z.; Lemanski, R.

    2001-01-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

  6. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  7. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  8. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  9. High Order Differential Frequency Hopping: Design and Analysis

    Directory of Open Access Journals (Sweden)

    Yong Li

    2015-01-01

    Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

  10. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  11. Cache-Aware and Cache-Oblivious Adaptive Sorting

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Fagerberg, Rolf; Moruz, Gabriel

    2005-01-01

    Two new adaptive sorting algorithms are introduced which perform an optimal number of comparisons with respect to the number of inversions in the input. The first algorithm is based on a new linear time reduction to (non-adaptive) sorting. The second algorithm is based on a new division protocol...... for the GenericSort algorithm by Estivill-Castro and Wood. From both algorithms we derive I/O-optimal cache-aware and cache-oblivious adaptive sorting algorithms. These are the first I/O-optimal adaptive sorting algorithms....

  12. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  13. Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2016-06-07

    Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

  14. Online sorting of recovered wood waste by automated XRF-technology: part II. Sorting efficiencies.

    Science.gov (United States)

    Hasan, A Rasem; Solo-Gabriele, Helena; Townsend, Timothy

    2011-04-01

    Sorting of waste wood is an important process practiced at recycling facilities in order to detect and divert contaminants from recycled wood products. Contaminants of concern include arsenic, chromium and copper found in chemically preserved wood. The objective of this research was to evaluate the sorting efficiencies of both treated and untreated parts of the wood waste stream, and metal (As, Cr and Cu) mass recoveries by the use of automated X-ray fluorescence (XRF) systems. A full-scale system was used for experimentation. This unit consisted of an XRF-detection chamber mounted on the top of a conveyor and a pneumatic slide-way diverter which sorted wood into presumed treated and presumed untreated piles. A randomized block design was used to evaluate the operational conveyance parameters of the system, including wood feed rate and conveyor belt speed. Results indicated that online sorting efficiencies of waste wood by XRF technology were high based on number and weight of pieces (70-87% and 75-92% for treated wood and 66-97% and 68-96% for untreated wood, respectively). These sorting efficiencies achieved mass recovery for metals of 81-99% for As, 75-95% for Cu and 82-99% of Cr. The incorrect sorting of wood was attributed almost equally to deficiencies in the detection and conveyance/diversion systems. Even with its deficiencies, the system was capable of producing a recyclable portion that met residential soil quality levels established for Florida, for an infeed that contained 5% of treated wood. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Ore sorting using natural gamma radiation

    International Nuclear Information System (INIS)

    Clark, G.J.; Dickson, B.L.; Gray, F.E.

    1980-01-01

    A method of sorting an ore which emits natural gamma radiation is described, comprising the steps of: (a) mining the ore, (b) placing, substantially at the mining location, the sampled or mined ore on to a moving conveyor belt, (c) measuring the natural gamma emission, water content and mass of the ore while the ore is on the conveyor belt, (d) using the gamma, water content and mass measurements to determine the ore grade, and (e) directing the ore to a location characteristic of its grade when it leaves the conveyor belt

  16. Optical cell sorting with multiple imaging modalities

    DEFF Research Database (Denmark)

    Banas, Andrew; Carrissemoux, Caro; Palima, Darwin

    2017-01-01

    healthy cells. With the richness of visual information, a lot of microscopy techniques have been developed and have been crucial in biological studies. To utilize their complementary advantages we adopt both fluorescence and brightfield imaging in our optical cell sorter. Brightfield imaging has...... the advantage of being non-invasive, thus maintaining cell viability. Fluorescence imaging, on the other hand, takes advantages of the chemical specificity of fluorescence markers and can validate machine vision results from brightfield images. Visually identified cells are sorted using optical manipulation...

  17. Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang

    2017-10-01

    Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

  18. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  19. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  20. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  1. Sorting waste - A question of good will

    CERN Multimedia

    TS Department - FM Group

    2006-01-01

    In order to minimise waste-sorting costs, CERN provides two types of container at the entrance of buildings: a green plastic container for paper/cardboard and a metal container for household-type waste. We regret that recently there has been a significant decrease in the extent to which these types of waste are sorted, for example green containers have been found to hold assorted waste such as cardboard boxes filled with polystyrene, bubble-wrap or even plastic bottles, yoghurt pots, etc. Checks have shown that this 'non-compliant' waste does not come from the rubbish bins emptied by the cleaners but is deposited there directly by inconsiderate users. During the months of October and November alone, for example, only 15% of the waste from the paper/cardboard containers was recycled and the remaining 85% had to be incinerated, which entails a high cost for CERN. You should note that once an item of non-compliant waste is found in a green container its contents are immediately sent as waste to be incinerated ...

  2. Efficiency at Sorting Cards in Compressed Air

    Science.gov (United States)

    Poulton, E. C.; Catton, M. J.; Carpenter, A.

    1964-01-01

    At a site where compressed air was being used in the construction of a tunnel, 34 men sorted cards twice, once at normal atmospheric pressure and once at 3½, 2½, or 2 atmospheres absolute pressure. An additional six men sorted cards twice at normal atmospheric pressure. When the task was carried out for the first time, all the groups of men performing at raised pressure were found to yield a reliably greater proportion of very slow responses than the group of men performing at normal pressure. There was reliably more variability in timing at 3½ and 2½ atmospheres absolute than at normal pressure. At 3½ atmospheres absolute the average performance was also reliably slower. When the task was carried out for the second time, exposure to 3½ atmospheres absolute pressure had no reliable effect. Thus compressed air affected performance only while the task was being learnt; it had little effect after practice. No reliable differences were found related to age, to length of experience in compressed air, or to the duration of the exposure to compressed air, which was never less than 10 minutes at 3½ atmospheres absolute pressure. PMID:14180485

  3. PACMan to Help Sort Hubble Proposals

    Science.gov (United States)

    Kohler, Susanna

    2017-04-01

    Every year, astronomers submit over a thousand proposals requesting time on the Hubble Space Telescope (HST). Currently, humans must sort through each of these proposals by hand before sending them off for review. Could this burden be shifted to computers?A Problem of VolumeAstronomer Molly Peeples gathered stats on the HST submissions sent in last week for the upcoming HST Cycle 25 (the deadline was Friday night), relative to previous years. This years proposal round broke the record, with over 1200 proposals submitted in total for Cycle 25. [Molly Peeples]Each proposal cycle for HST time attracts on the order of 1100 proposals accounting for far more HST time than is available. The proposals are therefore carefully reviewed by around 150 international members of the astronomy community during a six-month process to select those with the highest scientific merit.Ideally, each proposal will be read by reviewers that have scientific expertise relevant to the proposal topic: if a proposal requests HST time to study star formation, for instance, then the reviewers assigned to it should have research expertise in star formation.How does this matching of proposals to reviewers occur? The current method relies on self-reported categorization of the submitted proposals. This is unreliable, however; proposals are often mis-categorized by submitters due to misunderstanding or ambiguous cases.As a result, the Science Policies Group at the Space Telescope Science Institute (STScI) which oversees the review of HST proposals must go through each of the proposals by hand and re-categorize them. The proposals are then matched to reviewers with self-declared expertise in the same category.With the number of HST proposals on the rise and the expectation that the upcoming James Webb Space Telescope (JWST) will elicit even more proposals for time than Hubble scientists at STScI and NASA are now asking: could the human hours necessary for this task be spared? Could a computer program

  4. Bacterial lipoproteins; biogenesis, sorting and quality control.

    Science.gov (United States)

    Narita, Shin-Ichiro; Tokuda, Hajime

    2017-11-01

    Bacterial lipoproteins are a subset of membrane proteins localized on either leaflet of the lipid bilayer. These proteins are anchored to membranes through their N-terminal lipid moiety attached to a conserved Cys. Since the protein moiety of most lipoproteins is hydrophilic, they are expected to play various roles in a hydrophilic environment outside the cytoplasmic membrane. Gram-negative bacteria such as Escherichia coli possess an outer membrane, to which most lipoproteins are sorted. The Lol pathway plays a central role in the sorting of lipoproteins to the outer membrane after lipoprotein precursors are processed to mature forms in the cytoplasmic membrane. Most lipoproteins are anchored to the inner leaflet of the outer membrane with their protein moiety in the periplasm. However, recent studies indicated that some lipoproteins further undergo topology change in the outer membrane, and play critical roles in the biogenesis and quality control of the outer membrane. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Vertical sorting and the morphodynamics of bed form-dominated rivers : a sorting evolution model

    NARCIS (Netherlands)

    Blom, Astrid; Ribberink, Jan S.; Parker, Gary

    2008-01-01

    Existing sediment continuity models for nonuniform sediment suffer from a number of shortcomings, as they fail to describe vertical sorting fluxes other than through net aggradation or degradation of the bed and are based on a discrete representation of the bed material interacting with the flow. We

  6. The GTPase Rab43 Controls the Anterograde ER-Golgi Trafficking and Sorting of GPCRs

    Directory of Open Access Journals (Sweden)

    Chunman Li

    2017-10-01

    Full Text Available G-protein-coupled receptors (GPCRs constitute the largest superfamily of cell-surface signaling proteins. However, mechanisms underlying their surface targeting and sorting are poorly understood. Here, we screen the Rab family of small GTPases in the surface transport of multiple GPCRs. We find that manipulation of Rab43 function significantly alters the surface presentation and signaling of all GPCRs studied without affecting non-GPCR membrane proteins. Rab43 specifically regulates the transport of nascent GPCRs from the endoplasmic reticulum (ER to the Golgi. More interestingly, Rab43 directly interacts with GPCRs in an activation-dependent fashion. The Rab43-binding domain identified in the receptors effectively converts non-GPCR membrane protein transport into a Rab43-dependent pathway. These data reveal a crucial role for Rab43 in anterograde ER-Golgi transport of nascent GPCRs, as well as the ER sorting of GPCR members by virtue of its ability to interact directly.

  7. Mixed quantum-classical equilibrium in global flux surface hopping

    International Nuclear Information System (INIS)

    Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.

    2015-01-01

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

  8. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  9. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  10. Hopping mixed hybrid excitations in multiple composite quantum wire structures

    International Nuclear Information System (INIS)

    Nguyen Ba An; Tran Thai Hoa

    1995-10-01

    A structure consisting of N pairs of inorganic semiconductor and organic quantum wires is considered theoretically. In such an isolated pair of wires, while the intrawire coupling forms Wannier-Mott exciton in an inorganic semiconductor quantum wire and Frenkel exciton in an organic one, the interwire coupling gives rise to hybrid excitons residing within the pair. When N pairs of wires are packed together 2N new mixed hybrid modes appear that are the true elementary excitations and can hop throughout the whole structure. Energies and wave functions of such hopping mixed hybrid excitations are derived analytically in detail accounting for the global interwire coupling and the different polarization configurations. (author). 19 refs

  11. Rend og hop - Vi si´r stop

    DEFF Research Database (Denmark)

    Lund, Ole

    Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere......Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere...

  12. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  13. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  14. Particle Transport and Size Sorting in Bubble Microstreaming Flow

    Science.gov (United States)

    Thameem, Raqeeb; Rallabandi, Bhargav; Wang, Cheng; Hilgenfeldt, Sascha

    2014-11-01

    Ultrasonic driving of sessile semicylindrical bubbles results in powerful steady streaming flows that are robust over a wide range of driving frequencies. In a microchannel, this flow field pattern can be fine-tuned to achieve size-sensitive sorting and trapping of particles at scales much smaller than the bubble itself; the sorting mechanism has been successfully described based on simple geometrical considerations. We investigate the sorting process in more detail, both experimentally (using new parameter variations that allow greater control over the sorting) and theoretically (incorporating the device geometry as well as the superimposed channel flow into an asymptotic theory). This results in optimized criteria for size sorting and a theoretical description that closely matches the particle behavior close to the bubble, the crucial region for size sorting.

  15. On the Directly and Subdirectly Irreducible Many-Sorted Algebras

    Directory of Open Access Journals (Sweden)

    Climent Vidal J.

    2015-03-01

    Full Text Available A theorem of single-sorted universal algebra asserts that every finite algebra can be represented as a product of a finite family of finite directly irreducible algebras. In this article, we show that the many-sorted counterpart of the above theorem is also true, but under the condition of requiring, in the definition of directly reducible many-sorted algebra, that the supports of the factors should be included in the support of the many-sorted algebra. Moreover, we show that the theorem of Birkhoff, according to which every single-sorted algebra is isomorphic to a subdirect product of subdirectly irreducible algebras, is also true in the field of many-sorted algebras.

  16. Cross-layer optimization of wireless multi-hop networks

    OpenAIRE

    Soldati, Pablo

    2007-01-01

    The interest in wireless communications has grown constantly for the past decades, leading to an enormous number of applications and services embraced by billions of users. In order to meet the increasing demand for mobile Internet access, several high data-rate radio networking technologies have been proposed to offer wide area high-speed wireless communications, eventually replacing fixed (wired) networks for many applications. This thesis considers cross-layer optimization of multi-hop rad...

  17. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  18. Radiometric sorting of Rio Algom uranium ore

    International Nuclear Information System (INIS)

    Cristovici, M.A.

    1983-11-01

    An ore sample of about 0.2 percent uranium from Quirke Mine was subjected to radiometric sorting by Ore Sorters Limited. Approximately 60 percent of the sample weight fell within the sortable size range: -150 + 25 mm. Rejects of low uranium content ( 2 (2 counts/in 2 ) but only 7.6 percent of the ore, by weight, was discarded. At 0.8-0.9 counts/cm 2 (5-6 counts/in 2 ) a significant amount of rejects was removed (> 25 percent) but the uranium loss was unacceptably high (7.7 percent). Continuation of the testwork to improve the results is proposed by trying to extend the sortable size range and to reduce the amount of fines during crushing

  19. Machine-vision based optofluidic cell sorting

    DEFF Research Database (Denmark)

    Glückstad, Jesper; Bañas, Andrew

    the available light and creating 2D or 3D beam distributions aimed at the positions of the detected cells. Furthermore, the beam shaping freedom provided by GPC can allow optimizations in the beam’s propagation and its interaction with the laser catapulted and sorted cells....... machine vision1. This approach is gentler, less invasive and more economical compared to conventional FACS-systems. As cells are less responsive to plastic or glass objects commonly used in the optical manipulation literature2, and since laser safety would be an issue in clinical use, we develop efficient...... approaches in utilizing lasers and light modulation devices. The Generalized Phase Contrast (GPC) method3-9 that can be used for efficiently illuminating spatial light modulators10 or creating well-defined contiguous optical traps11 is supplemented by diffractive techniques capable of integrating...

  20. Learning sorting algorithms through visualization construction

    Science.gov (United States)

    Cetin, Ibrahim; Andrews-Larson, Christine

    2016-01-01

    Recent increased interest in computational thinking poses an important question to researchers: What are the best ways to teach fundamental computing concepts to students? Visualization is suggested as one way of supporting student learning. This mixed-method study aimed to (i) examine the effect of instruction in which students constructed visualizations on students' programming achievement and students' attitudes toward computer programming, and (ii) explore how this kind of instruction supports students' learning according to their self-reported experiences in the course. The study was conducted with 58 pre-service teachers who were enrolled in their second programming class. They expect to teach information technology and computing-related courses at the primary and secondary levels. An embedded experimental model was utilized as a research design. Students in the experimental group were given instruction that required students to construct visualizations related to sorting, whereas students in the control group viewed pre-made visualizations. After the instructional intervention, eight students from each group were selected for semi-structured interviews. The results showed that the intervention based on visualization construction resulted in significantly better acquisition of sorting concepts. However, there was no significant difference between the groups with respect to students' attitudes toward computer programming. Qualitative data analysis indicated that students in the experimental group constructed necessary abstractions through their engagement in visualization construction activities. The authors of this study argue that the students' active engagement in the visualization construction activities explains only one side of students' success. The other side can be explained through the instructional approach, constructionism in this case, used to design instruction. The conclusions and implications of this study can be used by researchers and

  1. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  2. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  3. Using Design Sketch to Teach Bubble Sort in High School

    OpenAIRE

    Liu, Chih-Hao; Jiu, Yi-Wen; Chen, Jason Jen-Yen

    2009-01-01

    Bubble Sort is simple. Yet, it seems a bit difficult for high school students. This paper presents a pedagogical methodology: Using Design Sketch to visualize the concepts in Bubble Sort, and to evaluate how this approach assists students to understand the pseudo code of Bubble Sort. An experiment is conducted in Wu-Ling Senior High School with 250 students taking part. The statistical analysis of experimental results shows that, for relatively high abstraction concepts, such as iteration num...

  4. An empirical study on SAJQ (Sorting Algorithm for Join Queries

    Directory of Open Access Journals (Sweden)

    Hassan I. Mathkour

    2010-06-01

    Full Text Available Most queries that applied on database management systems (DBMS depend heavily on the performance of the used sorting algorithm. In addition to have an efficient sorting algorithm, as a primary feature, stability of such algorithms is a major feature that is needed in performing DBMS queries. In this paper, we study a new Sorting Algorithm for Join Queries (SAJQ that has both advantages of being efficient and stable. The proposed algorithm takes the advantage of using the m-way-merge algorithm in enhancing its time complexity. SAJQ performs the sorting operation in a time complexity of O(nlogm, where n is the length of the input array and m is number of sub-arrays used in sorting. An unsorted input array of length n is arranged into m sorted sub-arrays. The m-way-merge algorithm merges the sorted m sub-arrays into the final output sorted array. The proposed algorithm keeps the stability of the keys intact. An analytical proof has been conducted to prove that, in the worst case, the proposed algorithm has a complexity of O(nlogm. Also, a set of experiments has been performed to investigate the performance of the proposed algorithm. The experimental results have shown that the proposed algorithm outperforms other Stable–Sorting algorithms that are designed for join-based queries.

  5. A many-sorted calculus based on resolution and paramodulation

    CERN Document Server

    Walther, Christoph

    1987-01-01

    A Many-Sorted Calculus Based on Resolution and Paramodulation emphasizes the utilization of advantages and concepts of many-sorted logic for resolution and paramodulation based automated theorem proving.This book considers some first-order calculus that defines how theorems from given hypotheses by pure syntactic reasoning are obtained, shifting all the semantic and implicit argumentation to the syntactic and explicit level of formal first-order reasoning. This text discusses the efficiency of many-sorted reasoning, formal preliminaries for the RP- and ?RP-calculus, and many-sorted term rewrit

  6. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  7. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana

    2013-04-01

    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  8. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  9. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  10. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...... is less of an alternative public sphere and more a way of articulating and contextualizing the world in a specific locality, which produces connections and opportunities in the young rappers’ lives....

  11. Method Development and Validation for UHPLC-MS-MS Determination of Hop Prenylflavonoids in Human Serum

    OpenAIRE

    Yuan, Yang; Qiu, Xi; Nikolic, Dejan; Dahl, Jeffrey H.; van Breemen, Richard B.

    2012-01-01

    Hops (Humulus lupulus L.) are used in the brewing of beer, and hop extracts containing prenylated compounds such as xanthohumol and 8-prenylnaringenin are under investigation as dietary supplements for cancer chemoprevention and for the management of hot flashes in menopausal women. To facilitate clinical studies of hop safety and efficacy, a selective, sensitive, and fast ultra-high pressure liquid chromatography tandem mass spectrometry (UHPLC-MS-MS) method was developed and validated for t...

  12. Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America

    OpenAIRE

    Villegas, Mark

    2015-01-01

    By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

  13. Sediment sorting at a side channel bifurcation

    Science.gov (United States)

    van Denderen, Pepijn; Schielen, Ralph; Hulscher, Suzanne

    2017-04-01

    Side channels have been constructed to reduce the flood risk and to increase the ecological value of the river. In various Dutch side channels large aggradation in these channels occurred after construction. Measurements show that the grain size of the deposited sediment in the side channel is smaller than the grain size found on the bed of the main channel. This suggest that sorting occurs at the bifurcation of the side channel. The objective is to reproduce with a 2D morphological model the fining of the bed in the side channel and to study the effect of the sediment sorting on morphodynamic development of the side channel. We use a 2D Delft3D model with two sediment fractions. The first fraction corresponds with the grain size that can be found on the bed of the main channel and the second fraction corresponds with the grain size found in the side channel. With the numerical model we compute several side channel configurations in which we vary the length and the width of the side channel, and the curvature of the upstream channel. From these computations we can derive the equilibrium state and the time scale of the morphodynamic development of the side channel. Preliminary results show that even when a simple sediment transport relation is used, like Engelund & Hansen, more fine sediment enters the side channel than coarse sediment. This is as expected, and is probably related to the bed slope effects which are a function of the Shields parameter. It is expected that by adding a sill at the entrance of the side channel the slope effect increases. This might reduce the amount of coarse sediment which enters the side channel even more. It is unclear whether the model used is able to reproduce the effect of such a sill correctly as modelling a sill and reproducing the correct hydrodynamic and morphodynamic behaviour is not straightforward in a 2D model. Acknowledgements: This research is funded by STW, part of the Dutch Organization for Scientific Research under

  14. Interaction sorting method for molecular dynamics on multi-core SIMD CPU architecture.

    Science.gov (United States)

    Matvienko, Sergey; Alemasov, Nikolay; Fomin, Eduard

    2015-02-01

    Molecular dynamics (MD) is widely used in computational biology for studying binding mechanisms of molecules, molecular transport, conformational transitions, protein folding, etc. The method is computationally expensive; thus, the demand for the development of novel, much more efficient algorithms is still high. Therefore, the new algorithm designed in 2007 and called interaction sorting (IS) clearly attracted interest, as it outperformed the most efficient MD algorithms. In this work, a new IS modification is proposed which allows the algorithm to utilize SIMD processor instructions. This paper shows that the improvement provides an additional gain in performance, 9% to 45% in comparison to the original IS method.

  15. Differential effects of EGFR ligands on endocytic sorting of the receptor

    DEFF Research Database (Denmark)

    Roepstorff, Kirstine; Grandal, Michael Vibo; Henriksen, Lasse

    2009-01-01

    signalling and is a more potent mitogen than EGF. In addition to EGF and TGF-alpha, five EGFR ligands have been identified. Although many of these ligands are upregulated in cancers, very little is known about their effect on EGFR trafficking. We have compared the effect of six different ligands on endocytic...... trafficking of EGFR. We find that, whereas they all stimulate receptor internalization, they have very diverse effects on endocytic sorting. Heparin-binding EGF-like growth factor and Betacellulin target all EGFRs for lysosomal degradation. In contrast, TGF-alpha and epiregulin lead to complete receptor...

  16. Self-assembly of heteroleptic dinuclear metallosupramolecular kites from multivalent ligands via social self-sorting

    Directory of Open Access Journals (Sweden)

    Christian Benkhäuser

    2015-05-01

    Full Text Available A Tröger's base-derived racemic bis(1,10-phenanthroline ligand (rac-1 and a bis(2,2'-bipyridine ligand with a central 1,3-diethynylbenzene unit 2 were synthesized. Each of these ligands acts as a multivalent entity for the binding of two copper(I ions. Upon coordination to the metal ions these two ligands undergo selective self-assembly into heteroleptic dinuclear metallosupramolecular kites in a high-fidelity social self-sorting manner as evidenced by NMR spectroscopy and mass spectrometry.

  17. Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis*

    OpenAIRE

    Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina

    2010-01-01

    Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9·dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9·dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic ...

  18. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    Science.gov (United States)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-07-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

  19. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    International Nuclear Information System (INIS)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-01-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

  20. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

    Science.gov (United States)

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

    2015-08-01

    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  1. Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

    Science.gov (United States)

    He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

    2005-01-01

    Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

  2. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  3. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  4. A Preliminary Study of MSD-First Radix-Sorting Methed

    OpenAIRE

    小田, 哲久

    1984-01-01

    Many kinds of sorting algorithms have been developed from the age of Punched Card System. Nowadays, any sorting algorithm can be called either (1) internal sorting methed or (2) external sorting method. Internal sorting method is used only when the number of records to be sorted (N) is not so large for the internal memory of the computer system. Larger memory space has become available with the aid of semiconductor technology. Therefore, it might be desired to develop a new internal sorting m...

  5. Actin-Sorting Nexin 27 (SNX27)-Retromer Complex Mediates Rapid Parathyroid Hormone Receptor Recycling*

    Science.gov (United States)

    McGarvey, Jennifer C.; Xiao, Kunhong; Bowman, Shanna L.; Mamonova, Tatyana; Zhang, Qiangmin; Bisello, Alessandro; Sneddon, W. Bruce; Ardura, Juan A.; Jean-Alphonse, Frederic; Vilardaga, Jean-Pierre; Puthenveedu, Manojkumar A.; Friedman, Peter A.

    2016-01-01

    The G protein-coupled parathyroid hormone receptor (PTHR) regulates mineral-ion homeostasis and bone remodeling. Upon parathyroid hormone (PTH) stimulation, the PTHR internalizes into early endosomes and subsequently traffics to the retromer complex, a sorting platform on early endosomes that promotes recycling of surface receptors. The C terminus of the PTHR contains a type I PDZ ligand that binds PDZ domain-containing proteins. Mass spectrometry identified sorting nexin 27 (SNX27) in isolated endosomes as a PTHR binding partner. PTH treatment enriched endosomal PTHR. SNX27 contains a PDZ domain and serves as a cargo selector for the retromer complex. VPS26, VPS29, and VPS35 retromer subunits were isolated with PTHR in endosomes from cells stimulated with PTH. Molecular dynamics and protein binding studies establish that PTHR and SNX27 interactions depend on the PDZ recognition motif in PTHR and the PDZ domain of SNX27. Depletion of either SNX27 or VPS35 or actin depolymerization decreased the rate of PTHR recycling following agonist stimulation. Mutating the PDZ ligand of PTHR abolished the interaction with SNX27 but did not affect the overall rate of recycling, suggesting that PTHR may directly engage the retromer complex. Coimmunoprecipitation and overlay experiments show that both intact and mutated PTHR bind retromer through the VPS26 protomer and sequentially assemble a ternary complex with PTHR and SNX27. SNX27-independent recycling may involve N-ethylmaleimide-sensitive factor, which binds both PDZ intact and mutant PTHRs. We conclude that PTHR recycles rapidly through at least two pathways, one involving the ASRT complex of actin, SNX27, and retromer and another possibly involving N-ethylmaleimide-sensitive factor. PMID:27008860

  6. Transcriptional profiling of cells sorted by RNA abundance

    NARCIS (Netherlands)

    Klemm, Sandy; Semrau, Stefan; Wiebrands, Kay; Mooijman, Dylan; Faddah, Dina A; Jaenisch, Rudolf; van Oudenaarden, Alexander

    We have developed a quantitative technique for sorting cells on the basis of endogenous RNA abundance, with a molecular resolution of 10-20 transcripts. We demonstrate efficient and unbiased RNA extraction from transcriptionally sorted cells and report a high-fidelity transcriptome measurement of

  7. An introduction to three algorithms for sorting in situ

    NARCIS (Netherlands)

    Dijkstra, E.W.; Gasteren, van A.J.M.

    1982-01-01

    The purpose of this paper is to give a crisp introduction to three algorithms for sorting in situ, viz. insertion sort, heapsort and smoothsort. The more complicated the algorithm, the more elaborate the justification for the design decisions embodied by it. In passing we offer a style for the

  8. The PreferenSort: A Holistic Instrument for Career Counseling

    Science.gov (United States)

    Amit, Adi; Sagiv, Lilach

    2013-01-01

    We present the PreferenSort, a career counseling instrument that derives counselees' vocational interests from their preferences among occupational titles. The PreferenSort allows for a holistic decision process, while taking into account the full complexity of occupations and encouraging deliberation about one's preferences and acceptable…

  9. New age radiometric ore sorting - the elegant solution

    International Nuclear Information System (INIS)

    Gordon, H.P.; Heuer, T.

    2000-01-01

    Radiometric ore sorting technology and application are described in two parts. Part I reviews the history of radiometric sorting in the minerals industry and describes the latest developments in radiometric sorting technology. Part II describes the history, feasibility study and approach used in the application of the new technology at Rossing Uranium Limited. There has been little progress in the field of radiometric sorting since the late 1970s. This has changed with the development of a high capacity radiometric sorter designed to operate on low-grade ore in the +75mm / -300mm size fraction. This has been designed specifically for an application at Rossing. Rossing has a long history in radiometric sorting dating back to 1968 when initial tests were conducted on the Rossing prospect. Past feasibility studies concluded that radiometric sorting would not conclusively reduce the unit cost of production unless sorting was used to increase production levels. The current feasibility study shows that the application of new radiometric sorter technology makes sorting viable without increasing production, and significantly more attractive with increased production. A pilot approach to confirm sorter performance is described. (author)

  10. Magnetic fluid equipment for sorting of secondary polyolefins from waste

    NARCIS (Netherlands)

    Rem, P.C.; Di Maio, F.; Hu, B.; Houzeaux, G.; Baltes, L.; Tierean, M.

    2012-01-01

    The paper presents the researches made on the FP7 project „Magnetic Sorting and Ultrasound Sensor Technologies for Production of High Purity Secondary Polyolefins from Waste” in order to develop a magnetic fluid equipment for sorting of polypropylene (PP) and polyethylene (PE) from polymers mixed

  11. Decision trees with minimum average depth for sorting eight elements

    KAUST Repository

    AbouEisha, Hassan M.; Chikalov, Igor; Moshkov, Mikhail

    2015-01-01

    We prove that the minimum average depth of a decision tree for sorting 8 pairwise different elements is equal to 620160/8!. We show also that each decision tree for sorting 8 elements, which has minimum average depth (the number of such trees

  12. Multiple pathways for vacuolar sorting of yeast proteinase A

    DEFF Research Database (Denmark)

    Westphal, V; Marcusson, E G; Winther, Jakob R.

    1996-01-01

    The sorting of the yeast proteases proteinase A and carboxypeptidase Y to the vacuole is a saturable, receptor-mediated process. Information sufficient for vacuolar sorting of the normally secreted protein invertase has in fusion constructs previously been found to reside in the propeptide...

  13. Science and technology of kernels and TRISO coated particle sorting

    International Nuclear Information System (INIS)

    Nothnagel, G.

    2006-09-01

    The ~1mm diameter TRISO coated particles, which form the elemental units of PBMR nuclear fuel, has to be close to spherical in order to best survive damage during sphere pressing. Spherical silicon carbide layers further provide the strongest miniature pressure vessels for fission product retention. To make sure that the final product contains particles of acceptable shape, 100% of kernels and coated particles have to be sorted on a surface-ground sorting table. Broken particles, twins, irregular (odd) shapes and extreme ellipsoids have to be separated from the final kernel and coated particle batches. Proper sorting of particles is an extremely important step in quality fuel production as the final failure fraction depends sensitively on the quality of sorting. After sorting a statistically significant sample of the sorted product is analysed for sphericity, which is defined as the ratio of maximum to minimum diameter, as part of a standard QC test to ensure conformance to German specifications. In addition a burn-leach test is done on coated particles (before pressing) and fuel spheres (after pressing) to ensure adherence to failure specifications. Because of the extreme importance of particle sorting for assurance of fuel quality it is essential to have an in-depth understanding of the capabilities and limitations of particle sorting. In this report a systematic scientific rationale is developed, from fundamental principles, to provide a basis for understanding the relationship between product quality and sorting parameters. The principles and concepts, developed in this report, will be of importance when future sorting tables (or equivalents) are to be designed. A number of new concepts and methodologies are developed to assist with equivalence validation of any two sorting tables. This is aimed in particular towards quantitative assessment of equivalence between current QC tables (closely based on the original NUKEM parameters, except for the driving mechanism

  14. A Fully Automated Approach to Spike Sorting.

    Science.gov (United States)

    Chung, Jason E; Magland, Jeremy F; Barnett, Alex H; Tolosa, Vanessa M; Tooker, Angela C; Lee, Kye Y; Shah, Kedar G; Felix, Sarah H; Frank, Loren M; Greengard, Leslie F

    2017-09-13

    Understanding the detailed dynamics of neuronal networks will require the simultaneous measurement of spike trains from hundreds of neurons (or more). Currently, approaches to extracting spike times and labels from raw data are time consuming, lack standardization, and involve manual intervention, making it difficult to maintain data provenance and assess the quality of scientific results. Here, we describe an automated clustering approach and associated software package that addresses these problems and provides novel cluster quality metrics. We show that our approach has accuracy comparable to or exceeding that achieved using manual or semi-manual techniques with desktop central processing unit (CPU) runtimes faster than acquisition time for up to hundreds of electrodes. Moreover, a single choice of parameters in the algorithm is effective for a variety of electrode geometries and across multiple brain regions. This algorithm has the potential to enable reproducible and automated spike sorting of larger scale recordings than is currently possible. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Particle sorting by Paramecium cilia arrays.

    Science.gov (United States)

    Mayne, Richard; Whiting, James G H; Wheway, Gabrielle; Melhuish, Chris; Adamatzky, Andrew

    Motile cilia are cell-surface organelles whose purposes, in ciliated protists and certain ciliated metazoan epithelia, include generating fluid flow, sensing and substance uptake. Certain properties of cilia arrays, such as beating synchronisation and manipulation of external proximate particulate matter, are considered emergent, but remain incompletely characterised despite these phenomena having being the subject of extensive modelling. This study constitutes a laboratory experimental characterisation of one of the emergent properties of motile cilia: manipulation of adjacent particulates. The work demonstrates through automated videomicrographic particle tracking that interactions between microparticles and somatic cilia arrays of the ciliated model organism Paramecium caudatum constitute a form of rudimentary 'sorting'. Small particles are drawn into the organism's proximity by cilia-induced fluid currents at all times, whereas larger particles may be held immobile at a distance from the cell margin when the cell generates characteristic feeding currents in the surrounding media. These findings can contribute to the design and fabrication of biomimetic cilia, with potential applications to the study of ciliopathies. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. A Parallel Modular Biomimetic Cilia Sorting Platform

    Directory of Open Access Journals (Sweden)

    James G. H. Whiting

    2018-03-01

    Full Text Available The aquatic unicellular organism Paramecium caudatum uses cilia to swim around its environment and to graze on food particles and bacteria. Paramecia use waves of ciliary beating for locomotion, intake of food particles and sensing. There is some evidence that Paramecia pre-sort food particles by discarding larger particles, but intake the particles matching their mouth cavity. Most prior attempts to mimic cilia-based manipulation merely mimicked the overall action rather than the beating of cilia. The majority of massive-parallel actuators are controlled by a central computer; however, a distributed control would be far more true-to-life. We propose and test a distributed parallel cilia platform where each actuating unit is autonomous, yet exchanging information with its closest neighboring units. The units are arranged in a hexagonal array. Each unit is a tileable circuit board, with a microprocessor, color-based object sensor and servo-actuated biomimetic cilia actuator. Localized synchronous communication between cilia allowed for the emergence of coordinated action, moving different colored objects together. The coordinated beating action was capable of moving objects up to 4 cm/s at its highest beating frequency; however, objects were moved at a speed proportional to the beat frequency. Using the local communication, we were able to detect the shape of objects and rotating an object using edge detection was performed; however, lateral manipulation using shape information was unsuccessful.

  17. Microfluidic-chip platform for cell sorting

    Science.gov (United States)

    Malik, Sarul; Balyan, Prerna; Akhtar, J.; Agarwal, Ajay

    2016-04-01

    Cell sorting and separation are considered to be very crucial preparatory steps for numerous clinical diagnostics and therapeutics applications in cell biology research arena. Label free cell separation techniques acceptance rate has been increased to multifold by various research groups. Size based cell separation method focuses on the intrinsic properties of the cell which not only avoids clogging issues associated with mechanical and centrifugation filtration methods but also reduces the overall cost for the process. Consequentially flow based cell separation method for continuous flow has attracted the attention of millions. Due to the realization of structures close to particle size in micro dimensions, the microfluidic devices offer precise and rapid particle manipulation which ultimately leads to an extraordinary cell separation results. The proposed microfluidic device is fabricated to separate polystyrene beads of size 1 µm, 5 µm, 10 µm and 20 µm. The actual dimensions of blood corpuscles were kept in mind while deciding the particle size of polystyrene beads which are used as a model particles for study.

  18. Nanoplasmonic lenses for bacteria sorting (Presentation Recording)

    Science.gov (United States)

    Zhu, Xiangchao; Yanik, Ahmet A.

    2015-08-01

    We demonstrate that patches of two dimensional arrays of circular plasmonic nanoholes patterned on gold-titanium thin film enables subwavelength focusing of visible light in far field region. Efficient coupling of the light with the excited surface plasmon at metal dielectric interface results in strong light transmission. As a result, surface plasmon plays an important role in the far field focusing behavior of the nanohole-aperture patches device. Furthermore, the focal length of the focused beam was found to be predominantly dependent on the overall size of the patch, which is in good agreement with that calculated by Rayleigh-Sommerfield integral formula. The focused light beam can be utilized to separate bio-particles in the dynamic range from 0.1 μm to 1 μm through mainly overcoming the drag force induced by fluid flow. In our proposed model, focused light generated by our plasmonic lenses will push the larger bio-particles in size back to the source of fluid flow and allow the smaller particles to move towards the central aperture of the patch. Such a new kind of plasmonic lenses open up possibility of sorting bacterium-like particles with plasmonic nanolenses, and also represent a promising tool in the field of virology.

  19. Help the planet by sorting your waste!

    CERN Multimedia

    2012-01-01

    Paper and cardboard waste comes in various forms, from newspapers to the toughest cardboard. Every year CERN dispatches about 200 tonnes of paper and cardboard to a recycling plant, but this is still too little when you take into consideration the tonnes of paper and cardboard that are still thrown out as part of ordinary rubbish or are incorrectly sorted into other rubbish skips.   Each office is equipped with a wastepaper bin, and a paper and cardboard container is available near every building. Cardboard boxes should be folded before they are placed in the containers in order to save space. Please note: Here are some sobering statistics: - 2 to 3 tonnes of wood pulp are required to manufacture 1 tonne of paper. - Each tonne of recycled paper means that we can save approximately 15 trees and substantial amounts of the water that is needed to extract cellulose (60 litres of water per kilo of paper). - A production of 100% recycled paper represents a 90% saving in water. - 5000 kWh of e...

  20. Tradeoffs Between Branch Mispredictions and Comparisons for Sorting Algorithms

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Moruz, Gabriel

    2005-01-01

    Branch mispredictions is an important factor affecting the running time in practice. In this paper we consider tradeoffs between the number of branch mispredictions and the number of comparisons for sorting algorithms in the comparison model. We prove that a sorting algorithm using O(dnlog n......) comparisons performs Omega(nlogd n) branch mispredictions. We show that Multiway MergeSort achieves this tradeoff by adopting a multiway merger with a low number of branch mispredictions. For adaptive sorting algorithms we similarly obtain that an algorithm performing O(dn(1+log (1+Inv/n))) comparisons must...... perform Omega(nlogd (1+Inv/n)) branch mispredictions, where Inv is the number of inversions in the input. This tradeoff can be achieved by GenericSort by Estivill-Castro and Wood by adopting a multiway division protocol and a multiway merging algorithm with a low number of branch mispredictions....

  1. Queue and stack sorting algorithm optimization and performance analysis

    Science.gov (United States)

    Qian, Mingzhu; Wang, Xiaobao

    2018-04-01

    Sorting algorithm is one of the basic operation of a variety of software development, in data structures course specializes in all kinds of sort algorithm. The performance of the sorting algorithm is directly related to the efficiency of the software. A lot of excellent scientific research queue is constantly optimizing algorithm, algorithm efficiency better as far as possible, the author here further research queue combined with stacks of sorting algorithms, the algorithm is mainly used for alternating operation queue and stack storage properties, Thus avoiding the need for a large number of exchange or mobile operations in the traditional sort. Before the existing basis to continue research, improvement and optimization, the focus on the optimization of the time complexity of the proposed optimization and improvement, The experimental results show that the improved effectively, at the same time and the time complexity and space complexity of the algorithm, the stability study corresponding research. The improvement and optimization algorithm, improves the practicability.

  2. Standard practice for cell sorting in a BSL-3 facility.

    Science.gov (United States)

    Perfetto, Stephen P; Ambrozak, David R; Nguyen, Richard; Roederer, Mario; Koup, Richard A; Holmes, Kevin L

    2011-01-01

    Over the past decade, there has been a rapid growth in the number of BSL-3 and BSL-4 laboratories in the USA and an increase in demand for infectious cell sorting in BSL-3 laboratories. In 2007, the International Society for Advancement of Cytometry (ISAC) Biosafety Committee published standards for the sorting of unfixed cells and is an important resource for biosafety procedures when performing infectious cell sorting. Following a careful risk assessment, if it is determined that a cell sorter must be located within a BSL-3 laboratory, there are a variety of factors to be considered prior to the establishment of the laboratory. This chapter outlines procedures for infectious cell sorting in a BSL-3 environment to facilitate the establishment and safe operation of a BSL-3 cell sorting laboratory. Subjects covered include containment verification, remote operation, disinfection, personal protective equipment (PPE), and instrument-specific modifications for enhanced aerosol evacuation.

  3. Development of a reactor thermalhydraulic experiment databank(SORTED1)

    International Nuclear Information System (INIS)

    Bang, Young Seck; Kim, Eun Kyoung; Kim, Hho Jung; Lee, Sang Yong

    1994-01-01

    The recent trend in thermalhydraulic safety analysis of nuclear power plant shows the best-estimate and probabilistic approaches, therefore, the verification of the best-estimate code based on the applicable experiment data has been required. The present study focused on developing a simple databank, SORTED1, to be effectively used for code verification. The development of SORTED1 includes a data collection from the various sources including ENCOUNTER, which is the reactor safety data bank of U.S. Nuclear Regulatory Commission, a reorganization of collected resources suitable for requirements of SORTED1 database management system (DBMS), and a development of a simple DBMS. The SORTED1 is designed in Unix environment with graphic user interface to improve a user convenience and has a capability to provide the test related information. The currently registered data in SORTED1 cover 759 thermalhydraulic tests including LOFT, Semiscale, etc

  4. A Comparison of Card-sorting Analysis Methods

    DEFF Research Database (Denmark)

    Nawaz, Ather

    2012-01-01

    This study investigates how the choice of analysis method for card sorting studies affects the suggested information structure for websites. In the card sorting technique, a variety of methods are used to analyse the resulting data. The analysis of card sorting data helps user experience (UX......) designers to discover the patterns in how users make classifications and thus to develop an optimal, user-centred website structure. During analysis, the recurrence of patterns of classification between users influences the resulting website structure. However, the algorithm used in the analysis influences...... the recurrent patterns found and thus has consequences for the resulting website design. This paper draws an attention to the choice of card sorting analysis and techniques and shows how it impacts the results. The research focuses on how the same data for card sorting can lead to different website structures...

  5. Molecular determinants of the interaction between Doa1 and Hse1 involved in endosomal sorting.

    Science.gov (United States)

    Han, Seungsu; Shin, Donghyuk; Choi, Hoon; Lee, Sangho

    2014-03-28

    Yeast Doa1/Ufd3 is an adaptor protein for Cdc48 (p97 in mammal), an AAA type ATPase associated with endoplasmic reticulum-associated protein degradation pathway and endosomal sorting into multivesicular bodies. Doa1 functions in the endosomal sorting by its association with Hse1, a component of endosomal sorting complex required for transport (ESCRT) system. The association of Doa1 with Hse1 was previously reported to be mediated between PFU domain of Doa1 and SH3 of Hse1. However, it remains unclear which residues are specifically involved in the interaction. Here we report that Doa1/PFU interacts with Hse1/SH3 with a moderate affinity of 5 μM. Asn-438 of Doa1/PFU and Trp-254 of Hse1/SH3 are found to be critical in the interaction while Phe-434, implicated in ubiquitin binding via a hydrophobic interaction, is not. Small-angle X-ray scattering measurements combined with molecular docking and biochemical analysis yield the solution structure of the Doa1/PFU:Hse1/SH3 complex. Taken together, our results suggest that hydrogen bonding is a major determinant in the interaction of Doa1/PFU with Hse1/SH3. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Bicaudal-D1 regulates the intracellular sorting and signalling of neurotrophin receptors.

    Science.gov (United States)

    Terenzio, Marco; Golding, Matthew; Russell, Matthew R G; Wicher, Krzysztof B; Rosewell, Ian; Spencer-Dene, Bradley; Ish-Horowicz, David; Schiavo, Giampietro

    2014-07-17

    We have identified a new function for the dynein adaptor Bicaudal D homolog 1 (BICD1) by screening a siRNA library for genes affecting the dynamics of neurotrophin receptor-containing endosomes in motor neurons (MNs). Depleting BICD1 increased the intracellular accumulation of brain-derived neurotrophic factor (BDNF)-activated TrkB and p75 neurotrophin receptor (p75(NTR)) by disrupting the endosomal sorting, reducing lysosomal degradation and increasing the co-localisation of these neurotrophin receptors with retromer-associated sorting nexin 1. The resulting re-routing of active receptors increased their recycling to the plasma membrane and altered the repertoire of signalling-competent TrkB isoforms and p75(NTR) available for ligand binding on the neuronal surface. This resulted in attenuated, but more sustained, AKT activation in response to BDNF stimulation. These data, together with our observation that Bicd1 expression is restricted to the developing nervous system when neurotrophin receptor expression peaks, indicate that BICD1 regulates neurotrophin signalling by modulating the endosomal sorting of internalised ligand-activated receptors. © 2014 The Authors.

  7. CellSort: a support vector machine tool for optimizing fluorescence-activated cell sorting and reducing experimental effort.

    Science.gov (United States)

    Yu, Jessica S; Pertusi, Dante A; Adeniran, Adebola V; Tyo, Keith E J

    2017-03-15

    High throughput screening by fluorescence activated cell sorting (FACS) is a common task in protein engineering and directed evolution. It can also be a rate-limiting step if high false positive or negative rates necessitate multiple rounds of enrichment. Current FACS software requires the user to define sorting gates by intuition and is practically limited to two dimensions. In cases when multiple rounds of enrichment are required, the software cannot forecast the enrichment effort required. We have developed CellSort, a support vector machine (SVM) algorithm that identifies optimal sorting gates based on machine learning using positive and negative control populations. CellSort can take advantage of more than two dimensions to enhance the ability to distinguish between populations. We also present a Bayesian approach to predict the number of sorting rounds required to enrich a population from a given library size. This Bayesian approach allowed us to determine strategies for biasing the sorting gates in order to reduce the required number of enrichment rounds. This algorithm should be generally useful for improve sorting outcomes and reducing effort when using FACS. Source code available at http://tyolab.northwestern.edu/tools/ . k-tyo@northwestern.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  8. Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2012-01-01

    Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

  9. Anisotropy of hopping conductivity in TIGaSe2, crystal

    International Nuclear Information System (INIS)

    Nadjafov, A.I.; Sardarli, R.M.; Samedov, O. A.; Abdullayev, A.P.; Zeynalova, E.A.; Jabbarov, J.H.

    2005-01-01

    Full Text: The temperature dependences of electrical conductivity of a chained semiconductor crystal TIGaTe 2 in a direction of chains and perpendicularly have been investigated. It was established that in a constant electrical field in both crystallographic directions took place hopping conductivity with variable length of a jump on located near Fermi level. The energy activation of conductivity has been determined. It was appreciated density of a condition in a vicinity of a Fermi level, their disorder, radius of localization, average distance of jumps of carriers

  10. Semiclassical quantization of nonadiabatic systems with hopping periodic orbits

    International Nuclear Information System (INIS)

    Fujii, Mikiya; Yamashita, Koichi

    2015-01-01

    We present a semiclassical quantization condition, i.e., quantum–classical correspondence, for steady states of nonadiabatic systems consisting of fast and slow degrees of freedom (DOFs) by extending Gutzwiller’s trace formula to a nonadiabatic form. The quantum–classical correspondence indicates that a set of primitive hopping periodic orbits, which are invariant under time evolution in the phase space of the slow DOF, should be quantized. The semiclassical quantization is then applied to a simple nonadiabatic model and accurately reproduces exact quantum energy levels. In addition to the semiclassical quantization condition, we also discuss chaotic dynamics involved in the classical limit of nonadiabatic dynamics

  11. Electron hopping and optic phonons in Eu3S4

    International Nuclear Information System (INIS)

    Guentherodt, G.

    1981-01-01

    Raman scattering on single crystals of Eu 3 S 4 does not show the allowed q=o phonon modes in the cubic phase and exhibits no new modes in the distorted low temperature phase (T 2- ions. This mode does not show any anomaly near the charge order -disorder phase transition Tsub(t)=186 K. Temperature tunable spin fluctuations associated with the temperature activated Eu 2+ → Eu 3+ electron hopping are detected in the scattering intensity, superimposed on the usual thermal spin disorder. (author)

  12. High-Speed On-Board Data Processing for Science Instruments: HOPS

    Science.gov (United States)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  13. Regulation of lipid droplet dynamics in Saccharomyces cerevisiae depends on the Rab7-like Ypt7p, HOPS complex and V1-ATPase

    Directory of Open Access Journals (Sweden)

    Isabelle Bouchez

    2015-07-01

    Full Text Available It has now been clearly shown that lipid droplets (LDs play a dynamic role in the cell. This was reinforced by LD proteomics which suggest that a significant number of trafficking proteins are associated with this organelle. Using microscopy, we showed that LDs partly co-localize with the vacuole in S. cerevisiae. Immunoblot experiments confirmed the association of the vacuolar Rab GTPase Rab7-like Ypt7p with LDs. We observed an increase in fatty acid content and LD number in ypt7Δ mutant and also changes in LD morphology and intra LD fusions, revealing a direct role for Ypt7p in LD dynamics. Using co-immunoprecipitation, we isolated potential Ypt7p partners including, Vma13p, the H subunit of the V1 part of the vacuolar (H+ ATPase (V-ATPase. Deletion of the VMA13 gene, as well as deletion of three other subunits of the V1 part of the V-ATPase, also increased the cell fatty acid content and LD number. Mutants of the Homotypic fusion and vacuole protein sorting (HOPS complex showed similar phenotypes. Here, we demonstrated that LD dynamics and membrane trafficking between the vacuole and LDs are regulated by the Rab7-like Ypt7p and are impaired when the HOPS complex and the V1 domain of the V-ATPase are defective.

  14. Mechanism of aldolase control of sorting nexin 9 function in endocytosis.

    Science.gov (United States)

    Rangarajan, Erumbi S; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina

    2010-04-16

    Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9.dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9.dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains the biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165-171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein.

  15. Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis*

    Science.gov (United States)

    Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina

    2010-01-01

    Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9·dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9·dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains the biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165–171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein. PMID:20129922

  16. Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis

    Energy Technology Data Exchange (ETDEWEB)

    Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle; Sygusch, Jurgen; Izard, Tina (Scripps); (Montreal)

    2010-11-03

    Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9-dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9-dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains the biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165-171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein.

  17. A Simple Deep Learning Method for Neuronal Spike Sorting

    Science.gov (United States)

    Yang, Kai; Wu, Haifeng; Zeng, Yu

    2017-10-01

    Spike sorting is one of key technique to understand brain activity. With the development of modern electrophysiology technology, some recent multi-electrode technologies have been able to record the activity of thousands of neuronal spikes simultaneously. The spike sorting in this case will increase the computational complexity of conventional sorting algorithms. In this paper, we will focus spike sorting on how to reduce the complexity, and introduce a deep learning algorithm, principal component analysis network (PCANet) to spike sorting. The introduced method starts from a conventional model and establish a Toeplitz matrix. Through the column vectors in the matrix, we trains a PCANet, where some eigenvalue vectors of spikes could be extracted. Finally, support vector machine (SVM) is used to sort spikes. In experiments, we choose two groups of simulated data from public databases availably and compare this introduced method with conventional methods. The results indicate that the introduced method indeed has lower complexity with the same sorting errors as the conventional methods.

  18. Effect of storage on the brewing properties of tropical hop substitutes

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... Conclusively, tropical hop substitutes stored at 5 ± 1oC to 27 ± 1oC can still be used for brewing even after three to six months storage. .... which is associated with the oxidative depreciation of the soft resins to hard resins ... Changes in the soft resin levels of hop substitutes with storage. Soft resin levels (%).

  19. Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

    Science.gov (United States)

    Price, Robert J., Jr.

    2005-01-01

    Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

  20. Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

    Science.gov (United States)

    Travis, Raphael, Jr.; Deepak, Anne

    2011-01-01

    Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

  1. Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

    Science.gov (United States)

    Putnam, Michael

    2006-01-01

    This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

  2. Hop/STI1 modulates retinal proliferation and cell death independent of PrPC

    International Nuclear Information System (INIS)

    Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.; Linden, Rafael; Chiarini, Luciana B.

    2007-01-01

    Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP C ). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP C dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 (α-STI1) blocked both ganglion cell and NBL cell death independent of PrP C . cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while α-STI1 increased proliferation in the developing retina, both independent of PrP C . We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP C

  3. Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

  4. Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

    Science.gov (United States)

    Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

    2010-01-01

    This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

  5. Polish Hip Hop as a Form of Multiliteracies and Situated Learning

    Science.gov (United States)

    Torrence, Michael L.

    2009-01-01

    The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

  6. Simple Models for the Performance Evaluation of a Class of Two-Hop Relay Protocols

    NARCIS (Netherlands)

    Al Hanbali, Ahmad; Kherani, Arzad A.; Nain, Philippe

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  7. Simple models for the performance evaluation of a class of two-hop relay protocols

    NARCIS (Netherlands)

    Al Hanbali, A.; Kherani, A.A.; Nain, P.; Akyildiz, I.F.; Sivakumar, R.; Ekici, E.; Cavalcante de Oliveira, J.; McNair, J.

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  8. Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

    Science.gov (United States)

    Cermak, Michael J.

    2012-01-01

    This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

  9. Muziki wa Hip Hop na Haki Za Kijamii: Dhima, Changamoto na ...

    African Journals Online (AJOL)

    Ni dhahiri kuwa haki za kijamii zinaweza kuwasilishwa kwa jamii pana kupitia sanaa ya hip hop. Makala haya basi, yanabainisha dhima na mchango wa muziki wa hip hop katika masuala ya haki za kijamii, yanafafanua changamoto za muziki huu katika kuwasilisha haki za kijamii na kutoa mapendekezo kwa makundi ...

  10. Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth

    Science.gov (United States)

    Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...

  11. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability of radio links and communication routes. This paper presents an analytical study of the link and route availability in inter-working multi-hop wireless networks....

  12. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    Science.gov (United States)

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  13. QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)

    Science.gov (United States)

    Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...

  14. Membrane-bound ATPase contributes to hop resistance of Lactobacillus brevis

    NARCIS (Netherlands)

    Sakamoto, K; van Veen, HW; Saito, H; Kobayashi, H; Konings, WN

    2002-01-01

    The activity of the membrane-bound H+-ATPase of the beer spoilage bacterium Lactobacillus brevis ABBC45 increased upon adaptation to bacteriostatic hop compounds. The ATPase activity was optimal around pH 5.6 and increased up to fourfold when L. brevis was exposed to 666 muM hop compounds. The

  15. Trends in German Hip Hop Music and Its Usefulness for the Classroom

    Science.gov (United States)

    Schmidt, Johannes

    2008-01-01

    German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…

  16. Hip-Hop and a Hybrid Text in a Postsecondary English Class

    Science.gov (United States)

    Sanchez, Deborah M.

    2010-01-01

    This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

  17. We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

    Science.gov (United States)

    Dando, Michael

    2017-01-01

    Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

  18. Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

    Science.gov (United States)

    Emdin, Christopher

    2011-01-01

    This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

  19. Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher

    2010-01-01

    The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

  20. Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

    Science.gov (United States)

    Petchauer, Emery

    2010-01-01

    Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

  1. Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

    Science.gov (United States)

    Wessel, Roger D.; Wallaert, Kerry A.

    2011-01-01

    This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

  2. Don't Believe the Hype: Hip-Hop Literacies and English Education

    Science.gov (United States)

    Belle, Crystal

    2016-01-01

    Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

  3. Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture

    Science.gov (United States)

    Baszile, Denise Taliaferro

    2009-01-01

    Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…

  4. Contributions to the quality control of two crops of economic importance : hops and yerba mate

    NARCIS (Netherlands)

    Wilson, Erica Georgina

    2012-01-01

    Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

  5. On the Capacity of a GSM Frequency Hopping network with Intelligent Underlayer-Overlayer

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wigard, Jeroen; Mogensen, Preben Elgaard

    1997-01-01

    . By combining this reuse partitioning with frequency hopping, an increase in the network capacity in terms of carried traffic per cell is achieved. Simulations have indicated that for slow moving mobiles a gain of approximately 35% is achieved by this new feature when compared with a frequency hopping network...

  6. System optimization for peer-to-peer multi hop video broadcasting in wireless ad hoc networks

    NARCIS (Netherlands)

    Dedeoglu, V.; Atici, C.; Salman, F.S.; Sunay, M.O.

    2008-01-01

    We consider peer-to-peer video broadcasting using cooperation among peers in an ad hoc wireless network. As opposed to the traditional single hop broadcasting, multiple hops cause an increase in broadcast video quality while creating interference and increasing transmission delay. We develop

  7. The Container Problem in Bubble-Sort Graphs

    Science.gov (United States)

    Suzuki, Yasuto; Kaneko, Keiichi

    Bubble-sort graphs are variants of Cayley graphs. A bubble-sort graph is suitable as a topology for massively parallel systems because of its simple and regular structure. Therefore, in this study, we focus on n-bubble-sort graphs and propose an algorithm to obtain n-1 disjoint paths between two arbitrary nodes in time bounded by a polynomial in n, the degree of the graph plus one. We estimate the time complexity of the algorithm and the sum of the path lengths after proving the correctness of the algorithm. In addition, we report the results of computer experiments evaluating the average performance of the algorithm.

  8. Automorphism group of the modified bubble-sort graph

    OpenAIRE

    Ganesan, Ashwin

    2014-01-01

    The modified bubble-sort graph of dimension $n$ is the Cayley graph of $S_n$ generated by $n$ cyclically adjacent transpositions. In the present paper, it is shown that the automorphism group of the modified bubble sort graph of dimension $n$ is $S_n \\times D_{2n}$, for all $n \\ge 5$. Thus, a complete structural description of the automorphism group of the modified bubble-sort graph is obtained. A similar direct product decomposition is seen to hold for arbitrary normal Cayley graphs generate...

  9. Generalization of fewest-switches surface hopping for coherences

    Science.gov (United States)

    Tempelaar, Roel; Reichman, David R.

    2018-03-01

    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  10. Robust hopping based on virtual pendulum posture control

    International Nuclear Information System (INIS)

    Sharbafi, Maziar A; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Maufroy, Christophe; Seyfarth, Andre

    2013-01-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved. (paper)

  11. A decentralized scheduling algorithm for time synchronized channel hopping

    Directory of Open Access Journals (Sweden)

    Andrew Tinka

    2011-09-01

    Full Text Available Time Synchronized Channel Hopping (TSCH is an existing Medium Access Control scheme which enables robust communication through channel hopping and high data rates through synchronization. It is based on a time-slotted architecture, and its correct functioning depends on a schedule which is typically computed by a central node. This paper presents, to our knowledge, the first scheduling algorithm for TSCH networks which both is distributed and which copes with mobile nodes. Two variations on scheduling algorithms are presented. Aloha-based scheduling allocates one channel for broadcasting advertisements for new neighbors. Reservation- based scheduling augments Aloha-based scheduling with a dedicated timeslot for targeted advertisements based on gossip information. A mobile ad hoc motorized sensor network with frequent connectivity changes is studied, and the performance of the two proposed algorithms is assessed. This performance analysis uses both simulation results and the results of a field deployment of floating wireless sensors in an estuarial canal environment. Reservation-based scheduling performs significantly better than Aloha-based scheduling, suggesting that the improved network reactivity is worth the increased algorithmic complexity and resource consumption.

  12. Asynchronous Channel-Hopping Scheme under Jamming Attacks

    Directory of Open Access Journals (Sweden)

    Yongchul Kim

    2018-01-01

    Full Text Available Cognitive radio networks (CRNs are considered an attractive technology to mitigate inefficiency in the usage of licensed spectrum. CRNs allow the secondary users (SUs to access the unused licensed spectrum and use a blind rendezvous process to establish communication links between SUs. In particular, quorum-based channel-hopping (CH schemes have been studied recently to provide guaranteed blind rendezvous in decentralized CRNs without using global time synchronization. However, these schemes remain vulnerable to jamming attacks. In this paper, we first analyze the limitations of quorum-based rendezvous schemes called asynchronous channel hopping (ACH. Then, we introduce a novel sequence sensing jamming attack (SSJA model in which a sophisticated jammer can dramatically reduce the rendezvous success rates of ACH schemes. In addition, we propose a fast and robust asynchronous rendezvous scheme (FRARS that can significantly enhance robustness under jamming attacks. Our numerical results demonstrate that the performance of the proposed scheme vastly outperforms the ACH scheme when there are security concerns about a sequence sensing jammer.

  13. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  14. Hip-Hop to Health Jr. for Latino preschool children.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2006-09-01

    Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

  15. Interaction between hopping and static spins in a discrete network

    Energy Technology Data Exchange (ETDEWEB)

    Ciccarello, Francesco, E-mail: francesco.ciccarello@sns.it [CNISM and Dipartimento di Fisica, Universita' degli Studi di Palermo, Viale delle Scienze, Edificio 18, I-90128 Palermo (Italy); NEST, Scuola Normale Superiore and Istituto Nanoscienze-CNR, Piazza dei Cavalieri 7, I-56126 Pisa (Italy)

    2011-06-27

    We consider a process where a spin hops across a discrete network and at certain sites couples to static spins. While this setting is implementable in various scenarios (e.g. quantum dots or coupled cavities) the physics of such processes is still basically unknown. Here, we take a first step along this line by scrutinizing a two-site and a three-site lattices, each with two static spins. Despite a generally complex dynamics occurs, we show a regime such that the spin dynamics is described by an effective three-spin chain. Tasks such as entanglement generation and quantum state transfer can be achieved accordingly. -- Highlights: → We study mobile spins hopping in a discrete network and coupled to static spins. → This setting can be implemented in various scenarios. → We address a two-site and a three-site lattice, each with two static spins. → We show a regime where the setup can be described by an effective three-spin chain. → Accordingly, it is prone to be exploited for some QIP applications.

  16. HOPS 383: AN OUTBURSTING CLASS 0 PROTOSTAR IN ORION

    Energy Technology Data Exchange (ETDEWEB)

    Safron, Emily J.; Megeath, S. Thomas; Booker, Joseph [Ritter Astrophysical Observatory, Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Fischer, William J. [NASA Goddard Space Flight Center, Greenbelt, MD (United States); Furlan, Elise; Rebull, Luisa M. [Infrared Processing and Analysis Center, Caltech, Pasadena, CA (United States); Stutz, Amelia M. [Max-Planck-Institut für Astronomie, Heidelberg (Germany); Stanke, Thomas [European Southern Observatory, Garching bei München (Germany); Billot, Nicolas [Instituto de Radio Astronomía Milimétrica, Granada (Spain); Tobin, John J. [Leiden Observatory, Leiden (Netherlands); Ali, Babar [Space Science Institute, Boulder, CO (United States); Allen, Lori E. [National Optical Astronomy Observatory, Tucson, AZ (United States); Watson, Dan M. [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States); Wilson, T. L., E-mail: wjfischer@gmail.com [Naval Research Laboratory, Washington, DC (United States)

    2015-02-10

    We report the dramatic mid-infrared brightening between 2004 and 2006 of Herschel Orion Protostar Survey (HOPS) 383, a deeply embedded protostar adjacent to NGC 1977 in Orion. By 2008, the source became a factor of 35 brighter at 24 μm with a brightness increase also apparent at 4.5 μm. The outburst is also detected in the submillimeter by comparing APEX/SABOCA to SCUBA data, and a scattered-light nebula appeared in NEWFIRM K{sub s} imaging. The post-outburst spectral energy distribution indicates a Class 0 source with a dense envelope and a luminosity between 6 and 14 L{sub ⊙}. Post-outburst time-series mid- and far-infrared photometry show no long-term fading and variability at the 18% level between 2009 and 2012. HOPS 383 is the first outbursting Class 0 object discovered, pointing to the importance of episodic accretion at early stages in the star formation process. Its dramatic rise and lack of fading over a 6 year period hint that it may be similar to FU Ori outbursts, although the luminosity appears to be significantly smaller than the canonical luminosities of such objects.

  17. Design and analysis on sorting blade for automated size-based sorting device

    Science.gov (United States)

    Razali, Zol Bahri; Kader, Mohamed Mydin M. Abdul; Samsudin, Yasser Suhaimi; Daud, Mohd Hisam

    2017-09-01

    Nowadays rubbish separating or recycling is a main problem of nation, where peoples dumped their rubbish into dumpsite without caring the value of the rubbish if it can be recycled and reused. Thus the author proposed an automated segregating device, purposely to teach people to separate their rubbish and value the rubbish that can be reused. The automated size-based mechanical segregating device provides significant improvements in terms of efficiency and consistency in this segregating process. This device is designed to make recycling easier, user friendly, in the hope that more people will take responsibility if it is less of an expense of time and effort. This paper discussed about redesign a blade for the sorting device which is to develop an efficient automated mechanical sorting device for the similar material but in different size. The machine is able to identify the size of waste and it depends to the coil inside the container to separate it out. The detail design and methodology is described in detail in this paper.

  18. A real time sorting algorithm to time sort any deterministic time disordered data stream

    Science.gov (United States)

    Saini, J.; Mandal, S.; Chakrabarti, A.; Chattopadhyay, S.

    2017-12-01

    In new generation high intensity high energy physics experiments, millions of free streaming high rate data sources are to be readout. Free streaming data with associated time-stamp can only be controlled by thresholds as there is no trigger information available for the readout. Therefore, these readouts are prone to collect large amount of noise and unwanted data. For this reason, these experiments can have output data rate of several orders of magnitude higher than the useful signal data rate. It is therefore necessary to perform online processing of the data to extract useful information from the full data set. Without trigger information, pre-processing on the free streaming data can only be done with time based correlation among the data set. Multiple data sources have different path delays and bandwidth utilizations and therefore the unsorted merged data requires significant computational efforts for real time manifestation of sorting before analysis. Present work reports a new high speed scalable data stream sorting algorithm with its architectural design, verified through Field programmable Gate Array (FPGA) based hardware simulation. Realistic time based simulated data likely to be collected in an high energy physics experiment have been used to study the performance of the algorithm. The proposed algorithm uses parallel read-write blocks with added memory management and zero suppression features to make it efficient for high rate data-streams. This algorithm is best suited for online data streams with deterministic time disorder/unsorting on FPGA like hardware.

  19. The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of β-glucuronidase

    International Nuclear Information System (INIS)

    Watanabe, H.; Grubb, J.H.; Sly, W.S.

    1990-01-01

    The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human β-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3% of the total functional receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of β-glucuronidase. At pH 7.5, the rate of endocytosis was only 14% the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized β-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized β-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor

  20. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    Science.gov (United States)

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  1. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  2. Hopping system control with an approximated dynamics model and upper-body motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

    2015-11-15

    A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

  3. Backoff-stage synchronization in three-hop string-topology wireless networks with hidden nodes

    Science.gov (United States)

    Sanada, Kosuke; Sekiya, Hiroo; Komuro, Nobuyoshi; Sakata, Shiro

    In IEEE 802.11 wireless multi-hop networks, each node works individually and their individual operations generate entire network dynamics. It is important to clarify the network dynamics in wireless multi-hop networks for designing and constructing multi-hop communication networks. This paper presents the network-dynamics investigations for three-hop string-topology wireless network in detail. From the investigations, a “backoff-stage synchronization” phenomenon, which is mutuality between hidden nodes, is found. The mechanism of the backoff-stage synchronization is expressed and the sufficient conditions for the synchronization occurrence are given. This phenomenon gives some impacts on the IEEE 802.11 multi-hop-network communications.

  4. Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

    Directory of Open Access Journals (Sweden)

    Alex S. Porco

    2014-12-01

    Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

  5. Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

    Science.gov (United States)

    Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

    2013-01-01

    Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

  6. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    Science.gov (United States)

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  7. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  8. Natural Selection Is a Sorting Process: What Does that Mean?

    Science.gov (United States)

    Price, Rebecca M.

    2013-01-01

    To learn why natural selection acts only on existing variation, students categorize processes as either creative or sorting. This activity helps students confront the misconception that adaptations evolve because species need them.

  9. Acoustic bubble sorting for ultrasound contrast agent enrichment.

    Science.gov (United States)

    Segers, Tim; Versluis, Michel

    2014-05-21

    An ultrasound contrast agent (UCA) suspension contains encapsulated microbubbles with a wide size distribution, with radii ranging from 1 to 10 μm. Medical transducers typically operate at a single frequency, therefore only a small selection of bubbles will resonate to the driving ultrasound pulse. Thus, the sensitivity can be improved by narrowing down the size distribution. Here, we present a simple lab-on-a-chip method to sort the population of microbubbles on-chip using a traveling ultrasound wave. First, we explore the physical parameter space of acoustic bubble sorting using well-defined bubble sizes formed in a flow-focusing device, then we demonstrate successful acoustic sorting of a commercial UCA. This novel sorting strategy may lead to an overall improvement of the sensitivity of contrast ultrasound by more than 10 dB.

  10. Recent progress in multi-electrode spike sorting methods.

    Science.gov (United States)

    Lefebvre, Baptiste; Yger, Pierre; Marre, Olivier

    2016-11-01

    In recent years, arrays of extracellular electrodes have been developed and manufactured to record simultaneously from hundreds of electrodes packed with a high density. These recordings should allow neuroscientists to reconstruct the individual activity of the neurons spiking in the vicinity of these electrodes, with the help of signal processing algorithms. Algorithms need to solve a source separation problem, also known as spike sorting. However, these new devices challenge the classical way to do spike sorting. Here we review different methods that have been developed to sort spikes from these large-scale recordings. We describe the common properties of these algorithms, as well as their main differences. Finally, we outline the issues that remain to be solved by future spike sorting algorithms. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Sorting on STAR. [CDC computer algorithm timing comparison

    Science.gov (United States)

    Stone, H. S.

    1978-01-01

    Timing comparisons are given for three sorting algorithms written for the CDC STAR computer. One algorithm is Hoare's (1962) Quicksort, which is the fastest or nearly the fastest sorting algorithm for most computers. A second algorithm is a vector version of Quicksort that takes advantage of the STAR's vector operations. The third algorithm is an adaptation of Batcher's (1968) sorting algorithm, which makes especially good use of vector operations but has a complexity of N(log N)-squared as compared with a complexity of N log N for the Quicksort algorithms. In spite of its worse complexity, Batcher's sorting algorithm is competitive with the serial version of Quicksort for vectors up to the largest that can be treated by STAR. Vector Quicksort outperforms the other two algorithms and is generally preferred. These results indicate that unusual instruction sets can introduce biases in program execution time that counter results predicted by worst-case asymptotic complexity analysis.

  12. Unsupervised spike sorting based on discriminative subspace learning.

    Science.gov (United States)

    Keshtkaran, Mohammad Reza; Yang, Zhi

    2014-01-01

    Spike sorting is a fundamental preprocessing step for many neuroscience studies which rely on the analysis of spike trains. In this paper, we present two unsupervised spike sorting algorithms based on discriminative subspace learning. The first algorithm simultaneously learns the discriminative feature subspace and performs clustering. It uses histogram of features in the most discriminative projection to detect the number of neurons. The second algorithm performs hierarchical divisive clustering that learns a discriminative 1-dimensional subspace for clustering in each level of the hierarchy until achieving almost unimodal distribution in the subspace. The algorithms are tested on synthetic and in-vivo data, and are compared against two widely used spike sorting methods. The comparative results demonstrate that our spike sorting methods can achieve substantially higher accuracy in lower dimensional feature space, and they are highly robust to noise. Moreover, they provide significantly better cluster separability in the learned subspace than in the subspace obtained by principal component analysis or wavelet transform.

  13. In-flight Sorting of BNNTs by Aspect Ratio

    Data.gov (United States)

    National Aeronautics and Space Administration — The key technical challenges are: (a) mechanical sorting is ineffective for nanoscale product, (b) BNNTs are non-conductive and the agglomeration tendency is strong,...

  14. Using Sorting Networks for Skill Building and Reasoning

    Science.gov (United States)

    Andre, Robert; Wiest, Lynda R.

    2007-01-01

    Sorting networks, used in graph theory, have instructional value as a skill- building tool as well as an interesting exploration in discrete mathematics. Students can practice mathematics facts and develop reasoning and logic skills with this topic. (Contains 4 figures.)

  15. Sorting and quantifying orbital angular momentum of laser beams

    CSIR Research Space (South Africa)

    Schulze, C

    2013-10-01

    Full Text Available We present a novel tool for sorting the orbital angular momentum and to determine the orbital angular momentum density of laser beams, which is based on the use of correlation filters....

  16. A Model Vision of Sorting System Application Using Robotic Manipulator

    Directory of Open Access Journals (Sweden)

    Maralo Sinaga

    2010-08-01

    Full Text Available Image processing in today’s world grabs massive attentions as it leads to possibilities of broaden application in many fields of high technology. The real challenge is how to improve existing sorting system in the Moduler Processing System (MPS laboratory which consists of four integrated stations of distribution, testing, processing and handling with a new image processing feature. Existing sorting method uses a set of inductive, capacitive and optical sensors do differentiate object color. This paper presents a mechatronics color sorting system solution with the application of image processing. Supported by OpenCV, image processing procedure senses the circular objects in an image captured in realtime by a webcam and then extracts color and position information out of it. This information is passed as a sequence of sorting commands to the manipulator (Mitsubishi Movemaster RV-M1 that does pick-and-place mechanism. Extensive testing proves that this color based object sorting system works 100% accurate under ideal condition in term of adequate illumination, circular objects’ shape and color. The circular objects tested for sorting are silver, red and black. For non-ideal condition, such as unspecified color the accuracy reduces to 80%.

  17. A lipid receptor sorts polyomavirus from the endolysosome to the endoplasmic reticulum to cause infection.

    Directory of Open Access Journals (Sweden)

    Mengding Qian

    2009-06-01

    Full Text Available The mechanisms by which receptors guide intracellular virus transport are poorly characterized. The murine polyomavirus (Py binds to the lipid receptor ganglioside GD1a and traffics to the endoplasmic reticulum (ER where it enters the cytosol and then the nucleus to initiate infection. How Py reaches the ER is unclear. We show that Py is transported initially to the endolysosome where the low pH imparts a conformational change that enhances its subsequent ER-to-cytosol membrane penetration. GD1a stimulates not viral binding or entry, but rather sorting of Py from late endosomes and/or lysosomes to the ER, suggesting that GD1a binding is responsible for ER targeting. Consistent with this, an artificial particle coated with a GD1a antibody is transported to the ER. Our results provide a rationale for transport of Py through the endolysosome, demonstrate a novel endolysosome-to-ER transport pathway that is regulated by a lipid, and implicate ganglioside binding as a general ER targeting mechanism.

  18. Implementation of surface hopping molecular dynamics using semiempirical methods

    International Nuclear Information System (INIS)

    Fabiano, E.; Keal, T.W.; Thiel, W.

    2008-01-01

    A molecular dynamics driver and surface hopping algorithm for nonadiabatic dynamics has been implemented in a development version of the MNDO semiempirical electronic structure package. The required energies, gradients and nonadiabatic couplings are efficiently evaluated on the fly using semiempirical configuration interaction methods. The choice of algorithms for the time evolution of the nuclear motion and quantum amplitudes is discussed, and different schemes for the computation of nonadiabatic couplings are analysed. The importance of molecular orbital tracking and electronic state following is underlined in the context of configuration interaction calculations. The method is applied to three case studies (ethylene, methaniminium ion, and methanimine) using the orthogonalization corrected OM2 Hamiltonian. In all three cases decay times and dynamics paths similar to high-level ab initio results are obtained

  19. Nonregenerative Dual-Hop Cooperative Links with Selection Diversity

    Directory of Open Access Journals (Sweden)

    Karagiannidis George K

    2006-01-01

    Full Text Available The end-to-end performance of dual-hop cooperative diversity systems equipped with nonregenerative relays and a selection combining receiver at the destination terminal over independent and nonidentical Nakagami- fading channels is studied. Closed-form expressions for the cumulative distribution function and the probability density function of the end-to-end signal-to-noise ratio ( are presented, while analytical formulae are derived for the moments and the moment generating function. Using these statistical results, closed-form expressions for the outage probability are presented for both channel state information and fixed gain relays. Furthermore, for the case of fixed gain relay, the average end-to-end , the amount of fading, and the average bit error rate can be numerically evaluated. The proposed mathematical analysis is complemented by numerical examples, including the effects on the overall performance of the s unbalancing as well as the fading severity.

  20. SDN-Based Double Hopping Communication against Sniffer Attack

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2016-01-01

    Full Text Available Sniffer attack has been a severe threat to network communication security. Traditional network usually uses static network configuration, which provides convenience to sniffer attack. In this paper, an SDN-based double hopping communication (DHC approach is proposed to solve this problem. In DHC, ends in communication packets as well as the routing paths are changed dynamically. Therefore, the traffic will be distributed to multiple flows and transmitted along different paths. Moreover, the data from multiple users will be mixed, bringing difficulty for attackers in obtaining and recovering the communication data, so that sniffer attack will be prevented effectively. It is concluded that DHC is able to increase the overhead of sniffer attack, as well as the difficulty of communication data recovery.

  1. Mode competition and hopping in optomechanical nano-oscillators

    Science.gov (United States)

    Zhang, Xingwang; Lin, Tong; Tian, Feng; Du, Han; Zou, Yongchao; Chau, Fook Siong; Zhou, Guangya

    2018-04-01

    We investigate the inter-mode nonlinear interaction in the multi-mode optomechanical nano-oscillator which consists of coupled silicon nanocantilevers, where the integrated photonic crystal nanocavities provide the coupling between the optical and mechanical modes. Due to the self-saturation and cross-saturation of the mechanical gain, the inter-mode competition is observed, which leads to the bistable operation of the optomechanical nano-oscillator: only one of the mechanical modes can oscillate at any one time, and the oscillation of one mode extremely suppresses that of the other with a side mode suppression ratio (SMSR) up to 40 dB. In the meantime, mode hopping, i.e., the optomechanical oscillation switches from one mode to the other, is also observed and found to be able to be provoked by excitation laser fluctuations.

  2. Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

    Science.gov (United States)

    Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

    2014-12-31

    Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

  3. UCSD SORT Test (U-SORT): Examination of a newly developed organizational skills assessment tool for severely mentally ill adults.

    Science.gov (United States)

    Tiznado, Denisse; Mausbach, Brent T; Cardenas, Veronica; Jeste, Dilip V; Patterson, Thomas L

    2010-12-01

    The present investigation examined the validity of a new cognitive test intended to assess organizational skills. Participants were 180 middle-aged or older participants with a Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition diagnosis of schizophrenia or schizoaffective disorder. Participants' organizational skills were measured using our newly developed University of California, San Diego Sorting Test (U-SORT), a performance-based test of organizational ability in which subjects sort objects (e.g., battery, pens) from a "junk drawer" into "keep" versus "trash" piles. Significant correlations between U-SORT scores and theoretically similar constructs (i.e. functional capacity, cognitive functioning, and clinical symptoms) were acceptable (mean r = 0.34), and weak correlations were found between U-SORT scores and theoretically dissimilar constructs (e.g., health symptoms, social support, gender; mean r = 0.06 ). The correlation between assessment scores provides preliminary support for the U-SORT test as a brief, easily transportable, reliable, and valid measure of functioning for this population.

  4. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems

    Science.gov (United States)

    Barnett, George; D'Souza, Raissa M.

    2015-01-01

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast–slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to ‘hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. PMID:26559684

  5. Photometric evidence of electron precipitation induced by first hop whistlers

    International Nuclear Information System (INIS)

    Doolittle, J.H.; Carpenter, D.L.

    1983-01-01

    Electron precipitation events induced by discrete VLF whistler mode waves have previously been detected by photometers at Siple Station, Antarctica. This paper presents the first observations of ionospheric optical emissions correlated with VLF waves at the conjugate location, near Roberval, Quebec. Since most whistlers recorded at Siple or Roberval originate in the north, Roberval affords a clear perspective on the direct precipitation induced during the first pass of the wave as it propagates southward. For such a wave the direct precipitation and that induced in the ''mirrored mode'' by the returning two-hop wave should differ in arrival time by roughly twice the wave propagation time between hemispheres, while at Siple the effects of the direct and mirrored modes may overlap in time. A well defined series of observations of structured lambda4278 optical emissions was observed on August 30, 1979 in the aftermath of an intense magnetic storm. The optical emissions were found to lead the arrival time of the two-hop waves by about 0.7 s instead of lagging the local waves by about 1--2 s as had been previously observed for whistler driven events at Siple. The observed arrival time relationships are consistent with the predictions of a cyclotron resonance interaction model, and thus support previous observations of x-rays at Roberval. The importance of the first pass of the wave is further emphasized by an approximate proportionality between the amplitude of the VLF waves recorded at Siple and the intensity of the optical emission bursts at Roberval. Although structured optical emissions correlated with wave bursts can clearly be detected at Roberval, relatively large magnetospheric particle fluxes may be required to produce such events

  6. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  7. Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

    Directory of Open Access Journals (Sweden)

    Francesco Rossini

    2016-08-01

    Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

  8. Spike sorting for polytrodes: a divide and conquer approach

    Directory of Open Access Journals (Sweden)

    Nicholas V. Swindale

    2014-02-01

    Full Text Available In order to determine patterns of neural activity, spike signals recorded by extracellular electrodes have to be clustered (sorted with the aim of ensuring that each cluster represents all the spikes generated by an individual neuron. Many methods for spike sorting have been proposed but few are easily applicable to recordings from polytrodes which may have 16 or more recording sites. As with tetrodes, these are spaced sufficiently closely that signals from single neurons will usually be recorded on several adjacent sites. Although this offers a better chance of distinguishing neurons with similarly shaped spikes, sorting is difficult in such cases because of the high dimensionality of the space in which the signals must be classified. This report details a method for spike sorting based on a divide and conquer approach. Clusters are initially formed by assigning each event to the channel on which it is largest. Each channel-based cluster is then sub-divided into as many distinct clusters as possible. These are then recombined on the basis of pairwise tests into a final set of clusters. Pairwise tests are also performed to establish how distinct each cluster is from the others. A modified gradient ascent clustering (GAC algorithm is used to do the clustering. The method can sort spikes with minimal user input in times comparable to real time for recordings lasting up to 45 minutes. Our results illustrate some of the difficulties inherent in spike sorting, including changes in spike shape over time. We show that some physiologically distinct units may have very similar spike shapes. We show that RMS measures of spike shape similarity are not sensitive enough to discriminate clusters that can otherwise be separated by principal components analysis. Hence spike sorting based on least-squares matching to templates may be unreliable. Our methods should be applicable to tetrodes and scaleable to larger multi-electrode arrays (MEAs.

  9. Neuronal spike sorting based on radial basis function neural networks

    Directory of Open Access Journals (Sweden)

    Taghavi Kani M

    2011-02-01

    Full Text Available "nBackground: Studying the behavior of a society of neurons, extracting the communication mechanisms of brain with other tissues, finding treatment for some nervous system diseases and designing neuroprosthetic devices, require an algorithm to sort neuralspikes automatically. However, sorting neural spikes is a challenging task because of the low signal to noise ratio (SNR of the spikes. The main purpose of this study was to design an automatic algorithm for classifying neuronal spikes that are emitted from a specific region of the nervous system."n "nMethods: The spike sorting process usually consists of three stages: detection, feature extraction and sorting. We initially used signal statistics to detect neural spikes. Then, we chose a limited number of typical spikes as features and finally used them to train a radial basis function (RBF neural network to sort the spikes. In most spike sorting devices, these signals are not linearly discriminative. In order to solve this problem, the aforesaid RBF neural network was used."n "nResults: After the learning process, our proposed algorithm classified any arbitrary spike. The obtained results showed that even though the proposed Radial Basis Spike Sorter (RBSS reached to the same error as the previous methods, however, the computational costs were much lower compared to other algorithms. Moreover, the competitive points of the proposed algorithm were its good speed and low computational complexity."n "nConclusion: Regarding the results of this study, the proposed algorithm seems to serve the purpose of procedures that require real-time processing and spike sorting.

  10. Identification of a new target of miR-16, Vacuolar Protein Sorting 4a.

    Directory of Open Access Journals (Sweden)

    Neeta Adhikari

    Full Text Available The rationale was to utilize a bioinformatics approach to identify miRNA binding sites in genes with single nucleotide mutations (SNPs to discover pathways in heart failure (HF.The objective was to focus on the genes containing miRNA binding sites with miRNAs that were significantly altered in end-stage HF and in response to a left ventricular assist device (LVAD.BEDTools v2.14.3 was used to discriminate SNPs within predicted 3'UTR miRNA binding sites. A member of the miR-15/107 family, miR-16, was decreased in the circulation of end-stage HF patients and increased in response to a LVAD (p<0.001. MiR-16 decreased Vacuolar Protein Sorting 4a (VPS4a expression in HEK 293T cells (p<0.01. The SNP rs16958754 was identified in the miR-15/107 family binding site of VPS4a which abolished direct binding of miR-16 to the 3'UTR of VPS4a (p<0.05. VPS4a was increased in the circulation of end-stage HF patients (p<0.001, and led to a decrease in the number of HEK 293T cells in vitro (p<0.001.We provide evidence that miR-16 decreases in the circulation of end-stage HF patients and increases with a LVAD. Modeling studies suggest that miR-16 binds to and decreases expression of VPS4a. Overexpression of VPS4a decreases cell number. Together, these experiments suggest that miR-16 and VPS4a expression are altered in end-stage HF and in response to unloading with a LVAD. This signaling pathway may lead to reduced circulating cell number in HF.

  11. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer

    2016-07-28

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

  12. A Sort-Last Rendering System over an Optical Backplane

    Directory of Open Access Journals (Sweden)

    Yasuhiro Kirihata

    2005-06-01

    Full Text Available Sort-Last is a computer graphics technique for rendering extremely large data sets on clusters of computers. Sort-Last works by dividing the data set into even-sized chunks for parallel rendering and then composing the images to form the final result. Since sort-last rendering requires the movement of large amounts of image data among cluster nodes, the network interconnecting the nodes becomes a major bottleneck. In this paper, we describe a sort-last rendering system implemented on a cluster of computers whose nodes are connected by an all-optical switch. The rendering system introduces the notion of the Photonic Computing Engine, a computing system built dynamically by using the optical switch to create dedicated network connections among cluster nodes. The sort-last volume rendering algorithm was implemented on the Photonic Computing Engine, and its performance is evaluated. Prelimi- nary experiments show that performance is affected by the image composition time and average payload size. In an attempt to stabilize the performance of the system, we have designed a flow control mechanism that uses feedback messages to dynamically adjust the data flow rate within the computing engine.

  13. Cloning of Plasmodium falciparum by single-cell sorting.

    Science.gov (United States)

    Miao, Jun; Li, Xiaolian; Cui, Liwang

    2010-10-01

    Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two-dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples. Copyright 2010 Elsevier Inc. All rights reserved.

  14. Sorting signed permutations by inversions in O(nlogn) time.

    Science.gov (United States)

    Swenson, Krister M; Rajan, Vaibhav; Lin, Yu; Moret, Bernard M E

    2010-03-01

    The study of genomic inversions (or reversals) has been a mainstay of computational genomics for nearly 20 years. After the initial breakthrough of Hannenhalli and Pevzner, who gave the first polynomial-time algorithm for sorting signed permutations by inversions, improved algorithms have been designed, culminating with an optimal linear-time algorithm for computing the inversion distance and a subquadratic algorithm for providing a shortest sequence of inversions--also known as sorting by inversions. Remaining open was the question of whether sorting by inversions could be done in O(nlogn) time. In this article, we present a qualified answer to this question, by providing two new sorting algorithms, a simple and fast randomized algorithm and a deterministic refinement. The deterministic algorithm runs in time O(nlogn + kn), where k is a data-dependent parameter. We provide the results of extensive experiments showing that both the average and the standard deviation for k are small constants, independent of the size of the permutation. We conclude (but do not prove) that almost all signed permutations can be sorted by inversions in O(nlogn) time.

  15. UNIFICATION OF PROCESSES OF SORTING OUT OF DESTROYED CONSTRUCTION OBJECTS

    Directory of Open Access Journals (Sweden)

    SHATOV S. V.

    2015-09-01

    Full Text Available Summary. Problem statement. Technogenic catastrophes, failures or natural calamities, result in destruction of build objects. Under the obstructions of destructions can be victims. The most widespread technogenic failure is explosions of gas. The structure of obstructions changes and depends on parameters and direction of explosion, firstly its size and location of wreckages. Sorting out of obstructions is carried out with machines and mechanisms which do not meet the requirements of these works, that predetermines of carrying out of rescue or restoration works on imperfect scheme , especially on the initial stages, and it increases terms and labour intensiveness of their conduct. Development technological solution is needed for the effective sorting out of destructions of construction objects. Purpose. Development of unification solution on the improvement of technological processes of sorting out of destructions of buildings and constructions. Conclusion. The analysis of experience of works shows on sorting out of the destroyed construction objects, show that they are carried out on imperfect scheme, which do not take into account character of destruction of objects and are based on the use of construction machines which do not meet the requirements of these processes, and lead to considerable resource losses. Developed unified scheme of sorting out of the destroyed construction objects depending on character of their destruction and possibility of line of works, and also with the use of build machines with a multipurpose equipment, provide the increase of efficiency of carrying out of rescue and construction works.

  16. Cloning of Plasmodium falciparum by single-cell sorting

    Science.gov (United States)

    Miao, Jun; Li, Xiaolian; Cui, Liwang

    2010-01-01

    Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples. PMID:20435038

  17. Coupling Bacterial Activity Measurements with Cell Sorting by Flow Cytometry.

    Science.gov (United States)

    Servais; Courties; Lebaron; Troussellier

    1999-08-01

    > Abstract A new procedure to investigate the relationship between bacterial cell size and activity at the cellular level has been developed; it is based on the coupling of radioactive labeling of bacterial cells and cell sorting by flow cytometry after SYTO 13 staining. Before sorting, bacterial cells were incubated in the presence of tritiated leucine using a procedure similar to that used for measuring bacterial production by leucine incorporation and then stained with SYTO 13. Subpopulations of bacterial cells were sorted according to their average right-angle light scatter (RALS) and fluorescence. Average RALS was shown to be significantly related to the average biovolume. Experiments were performed on samples collected at different times in a Mediterranean seawater mesocosm enriched with nitrogen and phosphorus. At four sampling times, bacteria were sorted in two subpopulations (cells smaller and larger than 0.25 µm(3)). The results indicate that, at each sampling time, the growth rate of larger cells was higher than that of smaller cells. In order to confirm this tendency, cell sorting was performed on six subpopulations differing in average biovolume during the mesocosm follow-up. A clear increase of the bacterial growth rates was observed with increasing cell size for the conditions met in this enriched mesocosm.http://link.springer-ny.com/link/service/journals/00248/bibs/38n2p180.html

  18. Sorting Real Numbers in $O(n\\sqrt{\\log n})$ Time and Linear Space

    OpenAIRE

    Han, Yijie

    2017-01-01

    We present an $O(n\\sqrt{\\log n})$ time and linear space algorithm for sorting real numbers. This breaks the long time illusion that real numbers have to be sorted by comparison sorting and take $\\Omega (n\\log n)$ time to be sorted.

  19. Adaptive differential correspondence imaging based on sorting technique

    Directory of Open Access Journals (Sweden)

    Heng Wu

    2017-04-01

    Full Text Available We develop an adaptive differential correspondence imaging (CI method using a sorting technique. Different from the conventional CI schemes, the bucket detector signals (BDS are first processed by a differential technique, and then sorted in a descending (or ascending order. Subsequently, according to the front and last several frames of the sorted BDS, the positive and negative subsets (PNS are created by selecting the relative frames from the reference detector signals. Finally, the object image is recovered from the PNS. Besides, an adaptive method based on two-step iteration is designed to select the optimum number of frames. To verify the proposed method, a single-detector computational ghost imaging (GI setup is constructed. We experimentally and numerically compare the performance of the proposed method with different GI algorithms. The results show that our method can improve the reconstruction quality and reduce the computation cost by using fewer measurement data.

  20. Particle migration and sorting in microbubble streaming flows

    Science.gov (United States)

    Thameem, Raqeeb; Hilgenfeldt, Sascha

    2016-01-01

    Ultrasonic driving of semicylindrical microbubbles generates strong streaming flows that are robust over a wide range of driving frequencies. We show that in microchannels, these streaming flow patterns can be combined with Poiseuille flows to achieve two distinctive, highly tunable methods for size-sensitive sorting and trapping of particles much smaller than the bubble itself. This method allows higher throughput than typical passive sorting techniques, since it does not require the inclusion of device features on the order of the particle size. We propose a simple mechanism, based on channel and flow geometry, which reliably describes and predicts the sorting behavior observed in experiment. It is also shown that an asymptotic theory that incorporates the device geometry and superimposed channel flow accurately models key flow features such as peak speeds and particle trajectories, provided it is appropriately modified to account for 3D effects caused by the axial confinement of the bubble. PMID:26958103

  1. Real-World Sorting of RHIC Superconducting Magnets

    International Nuclear Information System (INIS)

    Wei, J.; Gupta, R.; Harrison, M.; Jain, A.; Peggs, S.; Thompson, P.; Trbojevic, D.; Wanderer, P.

    1999-01-01

    During the seven-year construction of the Relativistic Heavy Ion Collider (RHIC), more than 1700 superconducting dipoles, quadrupoles, sextupoles, and multi-layer correctors have been constructed and installed. These magnets have been sorted at several production stages to optimize their performance and reliability. For arc magnets, priorities have bene put first on quench performance and operational risk minimization, second on field transfer function and other first-order quantities, and finally on nonlinear field errors which were painstakingly optimized at design. For Interaction-Region (IR) magnets, sorting is applied to select the best possible combination of magnets for the low-β interaction points (IP). This paper summarizes the history of this real-world sorting process

  2. TRAM is involved in IL-18 signaling and functions as a sorting adaptor for MyD88.

    Directory of Open Access Journals (Sweden)

    Hidenori Ohnishi

    Full Text Available MyD88, a Toll/interleukin-1 receptor homology (TIR domain-containing adaptor protein, mediates signals from the Toll-like receptors (TLR or IL-1/IL-18 receptors to downstream kinases. In MyD88-dependent TLR4 signaling, the function of MyD88 is enhanced by another TIR domain-containing adaptor, Mal/TIRAP, which brings MyD88 to the plasma membrane and promotes its interaction with the cytosolic region of TLR4. Hence, Mal is recognized as the "sorting adaptor" for MyD88. In this study, a direct interaction between MyD88-TIR and another membrane-sorting adaptor, TRAM/TICAM-2, was demonstrated in vitro. Cell-based assays including RNA interference experiments and TRAM deficient mice revealed that the interplay between MyD88 and TRAM in cells is important in mediating IL-18 signal transduction. Live cell imaging further demonstrated the co-localized accumulation of MyD88 and TRAM in the membrane regions in HEK293 cells. These findings suggest that TRAM serves as the sorting adaptor for MyD88 in IL-18 signaling, which then facilitates the signal transduction. The binding sites for TRAM are located in the TIR domain of MyD88 and actually overlap with the binding sites for Mal. MyD88, the multifunctional signaling adaptor that works together with most of the TLR members and with the IL-1/IL-18 receptors, can interact with two distinct sorting adaptors, TRAM and Mal, in a conserved manner in a distinct context.

  3. Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

    Directory of Open Access Journals (Sweden)

    Wang Xue-Wen

    2016-01-01

    Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

  4. Multi-hop routing in wireless sensor networks an overview, taxonomy, and research challenges

    CERN Document Server

    Rani, Shalli

    2016-01-01

    This brief provides an overview of recent developments in multi-hop routing protocols for Wireless Sensor Networks (WSNs). It introduces the various classifications of routing protocols and lists the pros and cons of each category, going beyond the conceptual overview of routing classifications offered in other books. Recently many researchers have proposed numerous multi-hop routing protocols and thereby created a need for a book that provides its readers with an up-to-date road map of this research paradigm.   The authors present some of the most relevant results achieved by applying an algorithmic approach to the research on multi-hop routing protocols. The book covers measurements, experiences and lessons learned from the implementation of multi-hop communication prototypes. Furthermore, it describes future research challenges and as such serves as a useful guide for students and researchers alike.

  5. The SAHR Setup-Controlling Hopping Speed and Height Using a Single Actuator

    Directory of Open Access Journals (Sweden)

    N. Cherouvim

    2008-01-01

    Full Text Available In this paper we present and experimentally validate a control method for regulating both the forward speed and the apex height of a one-legged hopping robot, using only a single actuator. The control method is based on a dynamic model of the hopping robot and makes use of the dynamic coupling of the vertical and forward motions of the robot. The control is applied first to a simulated model of the robot and shown to track a desired forward robot speed and a desired apex height. Then the SAHR (single actuator hopping robot hardware is introduced and is used as an experimental platform with which to evaluate the performance of the control method. The control method is applied to the physical setup and is shown to lead to a stable hopping gait with a desired forward speed and apex height, despite the unmodelled disturbances met on the laboratory floor.

  6. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer; Yang, Hong Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

    2016-01-01

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest

  7. The iterative hopping expansion algorithm for Monte Carlo calculations with very light fermions

    International Nuclear Information System (INIS)

    Montvay, I.

    1985-03-01

    The number of numerical operations necessary for a Monte Carlo simulation with very light fermions (like u- and d-quarks in quantum chromodynamics) is estimated within the iterative hopping expansion method. (orig.)

  8. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Radaydeh, Redha Mahmoud Mesleh; Alouini, Mohamed-Slim

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using

  9. Antiproliferative effects of prenylflavonoids from hops on human colon cancer cell lines

    Czech Academy of Sciences Publication Activity Database

    Hudcová, T.; Bryndová, Jana; Fialová, K.; Fiala, J.; Karabín, M.; Jelínek, L.; Dostalek, P.

    2014-01-01

    Roč. 120, č. 3 (2014), s. 225-230 ISSN 0046-9750 Institutional support: RVO:67985823 Keywords : hop * prenylflavonoids * xanthohumol * isoxanthohumol * antiproliferative * colon cancer Subject RIV: GM - Food Processing Impact factor: 1.240, year: 2014

  10. Memory effects, two color percolation, and the temperature dependence of Mott variable-range hopping

    Science.gov (United States)

    Agam, Oded; Aleiner, Igor L.

    2014-06-01

    There are three basic processes that determine hopping transport: (a) hopping between normally empty sites (i.e., having exponentially small occupation numbers at equilibrium), (b) hopping between normally occupied sites, and (c) transitions between normally occupied and unoccupied sites. In conventional theories all these processes are considered Markovian and the correlations of occupation numbers of different sites are believed to be small (i.e., not exponential in temperature). We show that, contrary to this belief, memory effects suppress the processes of type (c) and manifest themselves in a subleading exponential temperature dependence of the variable-range hopping conductivity. This temperature dependence originates from the property that sites of type (a) and (b) form two independent resistor networks that are weakly coupled to each other by processes of type (c). This leads to a two-color percolation problem which we solve in the critical region.

  11. Multi-hop Relaying: An End-to-End Delay Analysis

    KAUST Repository

    Chaaban, Anas; Sezgin, Aydin

    2015-01-01

    The impact of multi-hopping schemes on the communication latency in a relay channel is studied. The main aim is to characterize conditions under which such schemes decrease the communication latency given a reliability requirement. Both decode

  12. Energy-efficient power allocation of two-hop cooperative systems with imperfect channel estimation

    KAUST Repository

    Amin, Osama; Bedeer, Ebrahim; Ahmed, Mohamed H.; Dobre, Octavia A.; Alouini, Mohamed-Slim

    2015-01-01

    an accurate EE metric for cooperative two-hop systems that use the amplify-and-forward relaying scheme. Different from the existing research that assumes the availability of perfect channel state information (CSI) at the communication cooperative nodes, we

  13. A Stochastic Geometry Model for Multi-hop Highway Vehicular Communication

    KAUST Repository

    Farooq, Muhammad Junaid; Elsawy, Hesham; Alouini, Mohamed-Slim

    2015-01-01

    dissemination. This paper exploits stochastic geometry to develop a tractable and accurate modeling framework to characterize the multi-hop transmissions for vehicular networks in a multi-lane highway setup. In particular, we study the tradeoffs between per

  14. Dual-Hop FSO Transmission Systems over Gamma-Gamma Turbulence with Pointing Errors

    KAUST Repository

    Zedini, Emna; Soury, Hamza; Alouini, Mohamed-Slim

    2016-01-01

    In this paper, we analyze the end-to-end performance of dual-hop free-space optical (FSO) fixed gain relaying systems under heterodyne detection and intensity modulation with direct detection techniques in the presence of atmospheric turbulence

  15. You know what it is: learning words through listening to hip-hop.

    Science.gov (United States)

    Chesley, Paula

    2011-01-01

    Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

  16. Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

    Science.gov (United States)

    Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

    2018-04-01

    Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p hop (417 ± 106 vs 519 ± 102% limb length, p hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the

  17. Interplay of radiative and nonradiative transitions in surface hopping with radiation-molecule interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bajo, Juan José [Departamento de Química-Física I, Universidad Complutense de Madrid, 28040 Madrid (Spain); Granucci, Giovanni, E-mail: giovanni.granucci@unipi.it; Persico, Maurizio [Università di Pisa, Dipartimento di Chimica e Chimica Industriale, via Risorgimento 35, 56126 Pisa (Italy)

    2014-01-28

    We implemented a method for the treatment of field induced transitions in trajectory surface hopping simulations, in the framework of the local diabatization scheme, especially suited for on-the-fly dynamics. The method is applied to a simple one-dimensional model with an avoided crossing and compared with quantum wavepacket dynamics. The results show the importance of introducing a proper decoherence correction to surface hopping, in order to obtain meaningful results. Also the energy conservation policy of standard surface hopping must be revised: in fact, the quantum wavepacket energetics is well reproduced if energy absorption/emission is allowed for in the hops determined by radiation-molecule coupling. To our knowledge, this is the first time the issues of decoherence and energy conservation have been analyzed in depth to devise a mixed quantum-classical method for dynamics with molecule-field interactions.

  18. Distributed Detection with Collisions in a Random, Single-Hop Wireless Sensor Network

    Science.gov (United States)

    2013-05-26

    public release; distribution is unlimited. Distributed detection with collisions in a random, single-hop wireless sensor network The views, opinions...1274 2 ABSTRACT Distributed detection with collisions in a random, single-hop wireless sensor network Report Title We consider the problem of... WIRELESS SENSOR NETWORK Gene T. Whipps?† Emre Ertin† Randolph L. Moses† ?U.S. Army Research Laboratory, Adelphi, MD 20783 †The Ohio State University

  19. Observation of correlation effects in the hopping transport in amorphous silicon

    International Nuclear Information System (INIS)

    Voegele, V.; Kalbitzer, S.; Boehringer, K.

    1985-01-01

    Amorphous silicon films have been modified by the implantation of Au or Si ions. The d.c. conductivity, measured between 300 and 15 K, was found to exhibit hopping exponents m which increase with decreasing temperature. Depending on the varied defect densities, m ranges between the limits of 1/4 and 1. These results can be explained by variable-range-hopping theory, if a Coulomb correlation term is included. (author)

  20. Anomalous temperature dependence of the Seebeck coefficient for the substitutionally-disordered hopping conductors

    International Nuclear Information System (INIS)

    Raffaelle, R.P.; Parris, P.E.; Anderson, H.U.; Sparlin, D.M.

    1991-01-01

    Thermoelectric power measurements are presented for the (La,Sr)(Cr,Mn)O 3 series. The nonlinear temperature dependence of the Seebeck coefficient is analyzed in terms of a random distribution of energetically equivalent hopping sites. The limitations of Heikes' formula, which has been traditionally used to calculate small polaron carrier densities in these systems, are discussed. Recent theoretical developments in the interpretation of Seebeck measurements in substitutionally-disordered high-temperature hopping conductors are reviewed

  1. Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    1996-01-01

    A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation path...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

  2. Long term estimates for sorting strategies of the LHC dipoles

    CERN Document Server

    Scandale, Walter; Giovannozzi, Massimo; Todesco, Ezio

    1998-01-01

    Sorting strategies are investigated in view of improving the dynamic aperture of the CERN-LHC. Local and quasi-local compensation of the random field shape imperfections are discussed and applied to simplified model of the LHC lattice. The most promising strategies are further investigated on a realistic LHC model with particular emphasis on the analysis of the robustness of the dynamic aperture improvements including long term effects. First results on the application of the recently developed extrapolation law for the prediction of the dynamic aperture to the sorting problem are presented.

  3. Sorting, Searching, and Simulation in the MapReduce Framework

    DEFF Research Database (Denmark)

    Goodrich, Michael T.; Sitchinava, Nodari; Zhang, Qin

    2011-01-01

    usefulness of our approach by designing and analyzing efficient MapReduce algorithms for fundamental sorting, searching, and simulation problems. This study is motivated by a goal of ultimately putting the MapReduce framework on an equal theoretical footing with the well-known PRAM and BSP parallel...... in parallel computational geometry for the MapReduce framework, which result in efficient MapReduce algorithms for sorting, 2- and 3-dimensional convex hulls, and fixed-dimensional linear programming. For the case when mappers and reducers have a memory/message-I/O size of M = (N), for a small constant > 0...

  4. Dynamic colloidal sorting on a magnetic bubble lattice

    Science.gov (United States)

    Tierno, Pietro; Soba, Alejandro; Johansen, Tom H.; Sagués, Francesc

    2008-11-01

    We use a uniaxial garnet film with a magnetic bubble lattice to sort paramagnetic colloidal particles with different diameters, i.e., 1.0 and 2.8μm. We apply an external magnetic field which precesses around an axis normal to the film with a frequency Ω =62.8s-1 and intensity 3120A/m bubbles while the others are transported through the array. We complement the experimental measurements with numerical simulations to explore the sorting capability for particles with different magnetic moments.

  5. Faster magnet sorting with a threshold acceptance algorithm

    International Nuclear Information System (INIS)

    Lidia, S.; Carr, R.

    1995-01-01

    We introduce here a new technique for sorting magnets to minimize the field errors in permanent magnet insertion devices. Simulated annealing has been used in this role, but we find the technique of threshold acceptance produces results of equal quality in less computer time. Threshold accepting would be of special value in designing very long insertion devices, such as long free electron lasers (FELs). Our application of threshold acceptance to magnet sorting showed that it converged to equivalently low values of the cost function, but that it converged significantly faster. We present typical cases showing time to convergence for various error tolerances, magnet numbers, and temperature schedules

  6. Two-sorted Point-Interval Temporal Logics

    DEFF Research Database (Denmark)

    Balbiani, Philippe; Goranko, Valentin; Sciavicco, Guido

    2011-01-01

    There are two natural and well-studied approaches to temporal ontology and reasoning: point-based and interval-based. Usually, interval-based temporal reasoning deals with points as particular, duration-less intervals. Here we develop explicitly two-sorted point-interval temporal logical framework...... whereby time instants (points) and time periods (intervals) are considered on a par, and the perspective can shift between them within the formal discourse. We focus on fragments involving only modal operators that correspond to the inter-sort relations between points and intervals. We analyze...

  7. Constructing Efficient Dictionaries in Close to Sorting Time

    DEFF Research Database (Denmark)

    Ruzic, Milan

    2008-01-01

    to be a particularly challenging task. We present solutions to the static dictionary problem that significantly improve the previously known upper bounds and bring them close to obvious lower bounds. Our dictionaries have a constant lookup cost and use linear space, which was known to be possible, but the worst......-case cost of construction of the structures is proportional to only loglogn times the cost of sorting the input. Our claimed performance bounds are obtained in the word RAM model and in the external memory models; only the involved sorting procedures in the algorithms need to be changed between the models....

  8. 4D CT sorting based on patient internal anatomy

    Science.gov (United States)

    Li, Ruijiang; Lewis, John H.; Cerviño, Laura I.; Jiang, Steve B.

    2009-08-01

    Respiratory motion during free-breathing computed tomography (CT) scan may cause significant errors in target definition for tumors in the thorax and upper abdomen. A four-dimensional (4D) CT technique has been widely used for treatment simulation of thoracic and abdominal cancer radiotherapy. The current 4D CT techniques require retrospective sorting of the reconstructed CT slices oversampled at the same couch position. Most sorting methods depend on external surrogates of respiratory motion recorded by extra instruments. However, respiratory signals obtained from these external surrogates may not always accurately represent the internal target motion, especially when irregular breathing patterns occur. We have proposed a new sorting method based on multiple internal anatomical features for multi-slice CT scan acquired in the cine mode. Four features are analyzed in this study, including the air content, lung area, lung density and body area. We use a measure called spatial coherence to select the optimal internal feature at each couch position and to generate the respiratory signals for 4D CT sorting. The proposed method has been evaluated for ten cancer patients (eight with thoracic cancer and two with abdominal cancer). For nine patients, the respiratory signals generated from the combined internal features are well correlated to those from external surrogates recorded by the real-time position management (RPM) system (average correlation: 0.95 ± 0.02), which is better than any individual internal measures at 95% confidence level. For these nine patients, the 4D CT images sorted by the combined internal features are almost identical to those sorted by the RPM signal. For one patient with an irregular breathing pattern, the respiratory signals given by the combined internal features do not correlate well with those from RPM (correlation: 0.68 ± 0.42). In this case, the 4D CT image sorted by our method presents fewer artifacts than that from the RPM signal. Our

  9. New designs in the reconstruction of coke-sorting systems

    Energy Technology Data Exchange (ETDEWEB)

    A.S. Larin; V.V. Demenko; V.L. Voitanik [Giprokoks, the State Institute for the Design of Coke-Industry Enterprises, Kharkov (Ukraine)

    2009-07-15

    In recent Giprokoks designs for the reconstruction of coke-sorting systems, high-productivity vibrational-inertial screens have been employed. This permits single-stage screening and reduction in capital and especially operating expenditures, without loss of coke quality. In two-stage screening, >80 mm coke (for foundry needs) is additionally separated, with significant improvement in quality of the metallurgical coke (25-80 mm). New designs for the reconstruction of coke-sorting systems employ mechanical treatment of the coke outside the furnace, which offers new scope for stabilization of coke quality and permits considerable improvement in mechanical strength and granulometric composition of the coke by mechanical crushing.

  10. Decision trees with minimum average depth for sorting eight elements

    KAUST Repository

    AbouEisha, Hassan M.

    2015-11-19

    We prove that the minimum average depth of a decision tree for sorting 8 pairwise different elements is equal to 620160/8!. We show also that each decision tree for sorting 8 elements, which has minimum average depth (the number of such trees is approximately equal to 8.548×10^326365), has also minimum depth. Both problems were considered by Knuth (1998). To obtain these results, we use tools based on extensions of dynamic programming which allow us to make sequential optimization of decision trees relative to depth and average depth, and to count the number of decision trees with minimum average depth.

  11. Generic sorting of raft lipids into secretory vesicles in yeast

    DEFF Research Database (Denmark)

    Surma, Michal A; Klose, Christian; Klemm, Robin W

    2011-01-01

    Previous work has showed that ergosterol and sphingolipids become sorted to secretory vesicles immunoisolated using a chimeric, artificial raft membrane protein as bait. In this study, we have extended this analysis to three populations of secretory vesicles isolated using natural yeast plasma...... a complete lipid overview of the yeast late secretory pathway. We could show that vesicles captured with different baits carry the same cargo and have almost identical lipid compositions; being highly enriched in ergosterol and sphingolipids. This finding indicates that lipid raft sorting is a generic...

  12. Faster magnet sorting with a threshold acceptance algorithm

    International Nuclear Information System (INIS)

    Lidia, S.

    1994-08-01

    The authors introduce here a new technique for sorting magnets to minimize the field errors in permanent magnet insertion devices. Simulated annealing has been used in this role, but they find the technique of threshold acceptance produces results of equal quality in less computer time. Threshold accepting would be of special value in designing very long insertion devices, such as long FEL's. Their application of threshold acceptance to magnet sorting showed that it converged to equivalently low values of the cost function, but that it converged significantly faster. They present typical cases showing time to convergence for various error tolerances, magnet numbers, and temperature schedules

  13. Combinatorial analysis of lupulin gland transcription factors from R2R3Myb, bHLH and WDR families indicates a complex regulation of chs_H1 genes essential for prenylflavonoid biosynthesis in hop (Humulus Lupulus L.

    Directory of Open Access Journals (Sweden)

    Matoušek Jaroslav

    2012-02-01

    Full Text Available Abstract Background Lupulin glands of hop produce a specific metabolome including hop bitter acids valuable for the brewing process and prenylflavonoids with promising health-beneficial activities. The detailed analysis of the transcription factor (TF-mediated regulation of the oligofamily of one of the key enzymes, i.e., chalcone synthase CHS_H1 that efficiently catalyzes the production of naringenin chalcone, a direct precursor of prenylflavonoids in hop, constitutes an important part of the dissection of the biosynthetic pathways leading to the accumulation of these compounds. Results Homologues of flavonoid-regulating TFs HlMyb2 (M2, HlbHLH2 (B2 and HlWDR1 (W1 from hop were cloned using a lupulin gland-specific cDNA library from the hop variety Osvald's 72. Using a "combinatorial" transient GUS expression system it was shown that these unique lupulin-gland-associated TFs significantly activated the promoter (P of chs_H1 in ternary combinations of B2, W1 and either M2 or the previously characterized HlMyb3 (M3. The promoter activation was strongly dependent on the Myb-P binding box TCCTACC having a core sequence CCWACC positioned on its 5' end region and it seems that the complexity of the promoter plays an important role. M2B2W1-mediated activation significantly exceeded the strength of expression of native chs_H1 gene driven by the 35S promoter of CaMV, while M3B2W1 resulted in 30% of the 35S:chs_H1 expression level, as quantified by real-time PCR. Another newly cloned hop TF, HlMyb7, containing a transcriptional repressor-like motif pdLNLD/ELxiG/S (PDLNLELRIS, was identified as an efficient inhibitor of chs_H1-activating TFs. Comparative analyses of hop and A. thaliana TFs revealed a complex activation of Pchs_H1 and Pchs4 in combinatorial or independent manners. Conclusions This study on the sequences and functions of various lupulin gland-specific transcription factors provides insight into the complex character of the regulation of the

  14. Effects of powdery mildew fungicide programs on twospotted spider mite (Acari: Tetranychidae), hop aphid (Hemiptera: Aphididae), and their natural enemies in hop yards.

    Science.gov (United States)

    Gent, D H; James, D G; Wright, L C; Brooks, D J; Barbour, J D; Dreves, A J; Fisher, G C; Walton, V M

    2009-02-01

    Twospotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Hemiptera: Aphididae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological control strategies for spider mites and hop aphid is the extensive use of fungicides for management of hop powdery mildew, Podosphaera macularis (Wallr.:Fr.) U. Braun & S. Takamatsu. Field studies conducted in experimental plots in Oregon and Washington in 2005 and 2006 quantified the effects of powdery mildew fungicide programs (i.e., sulfur, paraffinic oil, and synthetic fungicides) on arthropod pests and natural enemies on hop. Fungicide treatment significantly affected spider mite populations in all four studies. Multiple applications of sulfur fungicides applied before burr development resulted in 1.4-3.3-fold greater spider mite populations during summer. Near the cessation of the sulfur applications, or after a lag of 20-30 d, spider mite populations increased significantly faster on sulfur treated plants compared with water-treated plants in three of four experiments. The effect of paraffinic oil on spider mites was varied, leading to exacerbation of spider mites in Oregon and Washington in 2005, suppression of mites in Oregon in 2006, and no significant effect compared with water in Washington in 2006. Significant relative treatment effects for cone damage due to spider mite feeding were detected in Oregon in 2005 in plots treated with sulfur and paraffinic oil compared with water and synthetic fungicides. Mean populations of hop aphids were similar among treatments in Oregon, although sulfur treatment suppressed hop aphid populations in Washington in 2005 and 2006. Populations of individual predacious insect species and cumulative abundance of macropredators were not consistently suppressed or stimulated by treatments in all trials. However, predatory mite

  15. Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods

    OpenAIRE

    Torgals, Ann Elisabeth

    2015-01-01

    The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

  16. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  17. A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

    Science.gov (United States)

    Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

    2018-05-08

    With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

  18. The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.

    Science.gov (United States)

    Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W

    2009-07-01

    The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.

  19. Linking the mechanics and energetics of hopping with elastic ankle exoskeletons.

    Science.gov (United States)

    Farris, Dominic James; Sawicki, Gregory S

    2012-12-15

    The springlike mechanics of the human leg during bouncing gaits has inspired the design of passive assistive devices that use springs to aid locomotion. The purpose of this study was to test whether a passive spring-loaded ankle exoskeleton could reduce the mechanical and energetic demands of bilateral hopping on the musculoskeletal system. Joint level kinematics and kinetics were collected with electromyographic and metabolic energy consumption data for seven participants hopping at four frequencies (2.2, 2.5, 2.8, and 3.2 Hz). Hopping was performed without an exoskeleton; with an springless exoskeleton; and with a spring-loaded exoskeleton. Spring-loaded ankle exoskeletons reduced plantar flexor muscle activity and the biological contribution to ankle joint moment (15-25%) and average positive power (20-40%). They also facilitated reductions in metabolic power (15-20%) across frequencies from 2.2 to 2.8 Hz compared with hopping with a springless exoskeleton. Reductions in metabolic power compared with hopping with no exoskeleton were restricted to hopping at 2.5 Hz only (12%). These results highlighted the importance of reducing the rate of muscular force production and work to achieve metabolic reductions. They also highlighted the importance of assisting muscles acting at the knee joint. Exoskeleton designs may need to be tuned to optimize exoskeleton mass, spring stiffness, and spring slack length to achieve greater metabolic reductions.

  20. Condom use and hip hop culture: the case of urban young men in New York City.

    Science.gov (United States)

    Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

    2008-06-01

    We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

  1. No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

    Science.gov (United States)

    Gibson, W; Campbell, A; Allison, G

    2013-09-01

    Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

    Energy Technology Data Exchange (ETDEWEB)

    Lakatos, Greg; O' Brien, John; Chou, Tom [Department of Biomathematics and Institute for Pure and Applied Mathematics, UCLA, Los Angeles, CA 90095 (United States)

    2006-03-10

    We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions.

  3. Hydrodynamic mean-field solutions of 1D exclusion processes with spatially varying hopping rates

    International Nuclear Information System (INIS)

    Lakatos, Greg; O'Brien, John; Chou, Tom

    2006-01-01

    We analyse the open boundary partially asymmetric exclusion process with smoothly varying internal hopping rates in the infinite-size, mean-field limit. The mean-field equations for particle densities are written in terms of Ricatti equations with the steady-state current J as a parameter. These equations are solved both analytically and numerically. Upon imposing the boundary conditions set by the injection and extraction rates, the currents J are found self-consistently. We find a number of cases where analytic solutions can be found exactly or approximated. Results for J from asymptotic analyses for slowly varying hopping rates agree extremely well with those from extensive Monte Carlo simulations, suggesting that mean-field currents asymptotically approach the exact currents in the hydrodynamic limit, as the hopping rates vary slowly over the lattice. If the forward hopping rate is greater than or less than the backward hopping rate throughout the entire chain, the three standard steady-state phases are preserved. Our analysis reveals the sensitivity of the current to the relative phase between the forward and backward hopping rate functions

  4. Synthesis and Antiproliferative Activity of Minor Hops Prenylflavonoids and New Insights on Prenyl Group Cyclization

    Directory of Open Access Journals (Sweden)

    Jarosław Popłoński

    2018-03-01

    Full Text Available Synthesis of minor prenylflavonoids found in hops and their non-natural derivatives were performed. The antiproliferative activity of the obtained compounds against some human cancer cell lines was investigated. Using xanthohumol isolated from spent hops as a lead compound, a series of minor hop prenylflavonoids and synthetic derivatives were obtained by isomerization, cyclisation, oxidative-cyclisation, oxidation, reduction and demethylation reactions. Three human cancer cell lines—breast (MCF-7, prostate (PC-3 and colon (HT-29—were used in antiproliferative assays, with cisplatin as a control compound. Five minor hop prenyl flavonoids and nine non-natural derivatives of xanthohumol have been synthetized. Syntheses of xanthohumol K, its dihydro- and tetrahydro-derivatives and 1″,2″,α,β-tetrahydroxanthohumol C were described for the first time. All of the minor hops prenyl flavonoids exhibited strong to moderate antiproliferative activity in vitro. The minor hops flavonoids xanthohumol C and 1″,2″-dihydroxanthohumol K and non-natural 2,3-dehydroisoxanthohumol exhibited the activity comparable to cisplatin. Results described in the article suggest that flavonoids containing chromane- and chromene-like moieties, especially chalcones, are potent antiproliferative agents. The developed new efficient, regioselective cyclisation reaction of the xanthohumol prenyl group to 1″,2″-dihydroxantohumol K may be used in the synthesis of other compounds with the chromane moiety.

  5. SDN-based path hopping communication against eavesdropping attack

    Science.gov (United States)

    Zhang, Chuanhao; Bu, Youjun; Zhao, Zheng

    2016-10-01

    Network eavesdropping is one of the most popular means used by cyber attackers, which has been a severe threat to network communication security. Adversaries could capture and analyze network communication data from network nodes or links, monitor network status and steal sensitive data such as username and password etc. Traditional network usually uses static network configuration, and existing defense methods, including firewall, IDS, IPS etc., cannot prevent eavesdropping, which has no distinguishing characteristic. Network eavesdropping become silent during most of the time of the attacking process, which is why it is difficult to discover and to defend. But A successful eavesdropping attack also has its' precondition, which is the target path should be relatively stable and has enough time of duration. So, In order to resolve this problem, it has to work on the network architecture. In this paper, a path hopping communication(PHC) mechanism based on Software Define Network (SDN) was proposed to solve this problem. In PHC, Ends in communication packets as well as the routing paths were changed dynamically. Therefore, the traffic would be distributed to multiple flows and transmitted along different paths. so that Network eavesdropping attack could be prevented effectively. It was concluded that PHC was able to increase the overhead of Network eavesdropping, as well as the difficulty of communication data recovery.

  6. Characteristics of alternating current hopping conductivity in DNA sequences

    International Nuclear Information System (INIS)

    Song-Shan, Ma; Hui, Xu; Huan-You, Wang; Rui, Guo

    2009-01-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of ø ac (ω) ∼ ω 2 ln 2 (1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p ≥ 0.5, the conductivity increases with the increase of p. (cross-disciplinary physics and related areas of science and technology)

  7. GHz band frequency hopping PLL-based frequency synthesizers

    Institute of Scientific and Technical Information of China (English)

    XU Yong; WANG Zhi-gong; GUAN Yu; XU Zhi-jun; QIAO Lu-feng

    2005-01-01

    In this paper we describe a full-integrated circuit containing all building blocks of a completed PLL-based synthesizer except for low pass filter(LPF).The frequency synthesizer is designed for a frequency hopping (FH) transceiver operating up to 1.5 GHz as a local oscillator. The architecture of Voltage Controlled Oscillator (VCO) is optimized to get better performance, and a phase noise of -111.85-dBc/Hz @ 1 MHz and a tuning range of 250 MHz are gained at a centre frequency of 1.35 GHz.A novel Dual-Modulus Prescaler(DMP) is designed to achieve a very low jitter and a lower power.The settling time of PLL is 80 μs while the reference frequency is 400 KHz.This monolithic frequency synthesizer is to integrate all main building blocks of PLL except for the low pass filter,with a maximum VCO output frequency of 1.5 GHz,and is fabricated with a 0.18 μm mixed signal CMOS process. Low power dissipation, low phase noise, large tuning range and fast settling time are gained in this design.

  8. Power and delay optimisation in multi-hop wireless networks

    KAUST Repository

    Xia, Li

    2014-02-05

    In this paper, we study the optimisation problem of transmission power and delay in a multi-hop wireless network consisting of multiple nodes. The goal is to determine the optimal policy of transmission rates at various buffer and channel states in order to minimise the power consumption and the queueing delay of the whole network. With the assumptions of interference-free links and independently and identically distributed (i.i.d.) channel states, we formulate this problem using a semi-open Jackson network model for data transmission and a Markov model for channel states transition. We derive a difference equation of the system performance under any two different policies. The necessary and sufficient condition of optimal policy is obtained. We also prove that the system performance is monotonic with respect to (w.r.t.) the transmission rate and the optimal transmission rate can be either maximal or minimal. That is, the ‘bang-bang’ control is an optimal control. This optimality structure greatly reduces the problem complexity. Furthermore, we develop an iterative algorithm to find the optimal solution. Finally, we conduct the simulation experiments to demonstrate the effectiveness of our approach. We hope our work can shed some insights on solving this complicated optimisation problem.

  9. Two-Hop Secure Communication Using an Untrusted Relay

    Directory of Open Access Journals (Sweden)

    Xiang He

    2009-01-01

    Full Text Available We consider a source-destination pair that can only communicate through an untrusted intermediate relay node. The intermediate node is willing to employ a designated relaying scheme to facilitate reliable communication between the source and the destination. Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable. The center piece of the achievability scheme is the help provided by either the destination node with transmission capability, or an external “good samaritan” node. In either case, the helper performs cooperative jamming that confuses the eavesdropping relay and disables it from being able to decipher what it is relaying. We next derive an upper bound on the secrecy rate for this system. We observe that the gap between the upper bound and the achievable rate vanishes as the power of the relay node goes to infinity. Overall, the paper presents a case for intentional interference, that is, cooperative jamming, as an enabler for secure communication.

  10. Characteristics of alternating current hopping conductivity in DNA sequences

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui

    2009-01-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)~ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p<0.5,the conductivity of DNA sequence decreases with the increase of p,while for p > 0.5,the conductivity increases with the increase of p.

  11. Therapeutic Perspectives of 8-Prenylnaringenin, a Potent Phytoestrogen from Hops

    Directory of Open Access Journals (Sweden)

    Kateřina Štulíková

    2018-03-01

    Full Text Available Hop (Humulus lupulus L., as a key ingredient for beer brewing, is also a source of many biologically active molecules. A notable compound, 8-prenylnaringenin (8-PN, structurally belonging to the group of prenylated flavonoids, was shown to be a potent phytoestrogen, and thus, became the topic of active research. Here, we overview the pharmacological properties of 8-PN and its therapeutic opportunities. Due to its estrogenic effects, administration of 8-PN represents a novel therapeutic approach to the treatment of menopausal and post-menopausal symptoms that occur as a consequence of a progressive decline in hormone levels in women. Application of 8-PN in the treatment of menopause has been clinically examined with promising results. Other activities that have already been assessed include the potential to prevent bone-resorption or inhibition of tumor growth. On the other hand, the use of phytoestrogens is frequently questioned regarding possible adverse effects associated with long-term consumption. In conclusion, we emphasize the implications of using 8-PN in future treatments of menopausal and post-menopausal symptoms, including the need for precise evidence and further investigations to define the safety risks related to its therapeutic use.

  12. Characterization of Hop-and-Sink Locomotion of Water Fleas

    Science.gov (United States)

    Skipper, A. N.; Murphy, D. W.; Webster, D. R.

    2017-11-01

    The freshwater crustacean Daphnia magna is a widely studied zooplankton in relation to food webs, predator-prey interactions, and other biological/ecological considerations; however, their locomotion is poorly quantified and understood. These water fleas utilize a hop-and-sink mechanism that consists of making quick, impulsive jumps by beating their antennae to propel themselves forward (roughly 1 body length). The animals then sink for a period, during which they stretch out their antennae to increase drag and thereby reduce their sinking velocity. Time-resolved three-dimensional flow fields surrounding the animals were quantified with a unique infrared tomographic particle image velocimetry (tomo-PIV) system. Three-dimensional kinematics data were also extracted from the image sequences. In the current work, we compared body kinematics and flow disturbance among organisms of size in the range of 1.3 to 2.8 mm. The stroke cycle averaged 150 +/- 20 ms, with each stroke cycle split nearly evenly between power and recovery strokes. The kinematics data collapsed onto a self-similar curve when properly nondimensionalized, and a general trend was shown to exist between the nondimensionalized peak body speed and body length. The fluid flow induced by each antennae consisted of a viscous vortex ring that demonstrated a slow decay in the wake. The viscous dissipation showed no clear dependence on body size, whereas the volume of fluid exceeding 5 mm/s (the speed near the sinking speed of the animal) decayed more slowly with increasing body size.

  13. El griot no ha muerto, viva el hip-hop

    Directory of Open Access Journals (Sweden)

    Fco. Javier González García-Mamely

    2015-11-01

    Full Text Available La oratura en África ha jugado un papel vital a lo largo de los milenios como un (único medio de preservar y transmitir la historia, la cultura y el imaginario de cada comunidad. El griot es un claro modelo de las artes orales, pero ha sufrido cambios drásticos en su modo de vida y en los recursos narrativos de los que dispone. Tras el mecenazgo de los grandes reyes y las sucesivas llegadas del islam, el colonialismo y los procesos de modernización y occidentalización, los griots se han tenido que adaptar a nuevos patrones, audiencias y medios de comunicación, convirtiéndose en políticos o en figuras del espectáculo. La aparición del rap y el hip-hop reclamando ser los “modernos griots” ha ocasionado una respuesta crítica y una atracción viral hacia el nuevo fenómeno, sea éste un nuevo género o una reinvención de la oratura del antiguo griot.

  14. Family-based hip-hop to health: outcome results.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Kong, Angela; Braunschweig, Carol L; Gomez-Perez, Sandra L; Odoms-Young, Angela; Van Horn, Linda; Christoffel, Katherine Kaufer; Dyer, Alan R

    2013-02-01

    This pilot study tested the feasibility of Family-Based Hip-Hop to Health, a school-based obesity prevention intervention for 3-5-year-old Latino children and their parents, and estimated its effectiveness in producing smaller average changes in BMI at 1-year follow-up. Four Head Start preschools administered through the Chicago Public Schools were randomly assigned to receive a Family-Based Intervention (FBI) or a General Health Intervention (GHI). Parents signed consent forms for 147 of the 157 children enrolled. Both the school-based and family-based components of the intervention were feasible, but attendance for the parent intervention sessions was low. Contrary to expectations, a downtrend in BMI Z-score was observed in both the intervention and control groups. While the data reflect a downward trend in obesity among these young Hispanic children, obesity rates remained higher at 1-year follow-up (15%) than those reported by the National Health and Nutrition Examination Survey (2009-2010) for 2-5-year-old children (12.1%). Developing evidence-based strategies for obesity prevention among Hispanic families remains a challenge. Copyright © 2012 The Obesity Society.

  15. Mineral-PET Kimberlite sorting by nuclear-medical technology

    CERN Document Server

    Ballestrero, S; Cafferty, L; Caveney, R; Connell, SH; Cook, M; Dalton, M; Gopal, H; Ives, N; Lee, C A; Mampe, W; Phoku, M; Roodt, A; Sibande, W; Sellschop, J P F; Topkin, J; Unwucholaa, D A

    2010-01-01

    A revolutionary new technology for diamond bearing rock sorting which has its roots in medical-nuclear physics has been taken through a substantial part of the R&D phase. This has led to the construction of the technology demonstrator. Experiments using the technology demonstrator and experiments at a hospital have established the scientific and technological viability of the project.

  16. Image processing. A system for the automatic sorting of chromosomes

    International Nuclear Information System (INIS)

    Najai, Amor

    1977-01-01

    The present paper deals with two aspects of the system: - an automata (specialized hardware) dedicated to image processing. Images are digitized, divided into sub-units and computations are carried out on their main parameters. - A software for the automatic recognition and sorting of chromosomes is implemented on a Multi-20 minicomputer, connected to the automata. (author) [fr

  17. System for sorting microscopic objects using electromagnetic radiation

    DEFF Research Database (Denmark)

    2013-01-01

    There is presented a system 10,100 for sorting microscopic objects 76, 78, 80, where the system comprises a fluid channel 66 with an inlet 68 and an outlet 70, where the fluid channel is arranged for allowing the fluid flow to be laminar. The system furthermore comprises a detection system 52 whi...

  18. Dielectrophoretic focusing integrated pulsed laser activated cell sorting

    Science.gov (United States)

    Zhu, Xiongfeng; Kung, Yu-Chun; Wu, Ting-Hsiang; Teitell, Michael A.; Chiou, Pei-Yu

    2017-08-01

    We present a pulsed laser activated cell sorter (PLACS) integrated with novel sheathless size-independent dielectrophoretic (DEP) focusing. Microfluidic fluorescence activated cell sorting (μFACS) systems aim to provide a fully enclosed environment for sterile cell sorting and integration with upstream and downstream microfluidic modules. Among them, PLACS has shown a great potential in achieving comparable performance to commercial aerosol-based FACS (>90% purity at 25,000 cells sec-1). However conventional sheath flow focusing method suffers a severe sample dilution issue. Here we demonstrate a novel dielectrophoresis-integrated pulsed laser activated cell sorter (DEP-PLACS). It consists of a microfluidic channel with 3D electrodes laid out to provide a tunnel-shaped electric field profile along a 4cmlong channel for sheathlessly focusing microparticles/cells into a single stream in high-speed microfluidic flows. All focused particles pass through the fluorescence detection zone along the same streamline regardless of their sizes and types. Upon detection of target fluorescent particles, a nanosecond laser pulse is triggered and focused in a neighboring channel to generate a rapidly expanding cavitation bubble for precise sorting. DEP-PLACS has achieved a sorting purity of 91% for polystyrene beads at a throughput of 1,500 particle/sec.

  19. Real-time implementation of a color sorting system

    Science.gov (United States)

    Srikanteswara, Srikathyanyani; Lu, Qiang O.; King, William; Drayer, Thomas H.; Conners, Richard W.; Kline, D. Earl; Araman, Philip A.

    1997-09-01

    Wood edge glued panels are used extensively in the furniture and cabinetry industries. They are used to make doors, tops, and sides of solid wood furniture and cabinets. Since lightly stained furniture and cabinets are gaining in popularity, there is an increasing demand to color sort the parts used to make these edge glued panels. The goal of the sorting processing is to create panels that are uniform in both color and intensity across their visible surface. If performed manually, the color sorting of edge-glued panel parts is very labor intensive and prone to error. This paper describes a complete machine vision system for performing this sort. This system uses two color line scan cameras for image input and a specially designed custom computing machine to allow real-time implementation. Users define the number of color classes that are to be used. An 'out' class is provided to handle unusually colored parts. The system removes areas of character mark, e.g., knots, mineral streak, etc., from consideration when assigning a color class to a part. The system also includes a better face algorithm for determining which part face would be the better to put on the side of the panel that will show. The throughput is two linear feet per second. Only a four inch between part spacing is required. This system has undergone extensive in plant testing and will be commercially available in the very near future. The results of this testing will be presented.

  20. A correctness proof of sorting by means of formal procedures

    NARCIS (Netherlands)

    Fokkinga, M.M.

    1987-01-01

    We consider a recursive sorting algorithm in which, in each invocation, a new variable and a new procedure (using the variable globally) are defined and the procedure is passed to recursive calls. This algorithm is proved correct with Hoare-style pre- and postassertions. We also discuss the same