WorldWideScience

Sample records for sorbitol macconkey agar

  1. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  2. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  3. A modified MacConkey agar for selective enumeration of necrotoxigenic E. coli O55 and probiotic E. coli Nissle 1917

    Czech Academy of Sciences Publication Activity Database

    Šplíchalová, Alla; Šplíchal, Igor; Sonnenborn, U.; Rada, V.

    2014-01-01

    Roč. 103, SEP 2014 (2014), s. 82-86 ISSN 0167-7012 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : MacConkey agar * E. coil O55 * NTEC Subject RIV: CE - Biochemistry Impact factor: 2.026, year: 2014

  4. Evaluation of Standard and Modified M-FC, MacConkey, and Teepol Media for Membrane Filtration Counting of Fecal Coliforms in Water

    OpenAIRE

    Grabow, W. O. K.; Hilner, C. A.; Coubrough, P.

    1981-01-01

    MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtai...

  5. Prevalence of sorbitol non-fermenting Shiga toxin-producing Escherichia coli in Black Bengal goats on smallholdings.

    Science.gov (United States)

    Das Gupta, M; Das, A; Islam, M Z; Biswas, P K

    2016-09-01

    A cross-sectional survey was carried out in Bangladesh with the sampling of 514 Black Bengal goats on smallholdings to determine the presence of sorbitol non-fermenting (SNF) Shiga toxin-producing E. coli (STEC). Swab samples collected from the recto-anal junction were plated onto cefixime and potassium tellurite added sorbitol MacConkey (CT-SMAC) agar, a selective medium for STEC O157 serogroup, where this serogroup and other SNF STEC produce colourless colonies. The SNF E. coli (SNF EC) isolates obtained from the survey were investigated by PCR for the presence of Shiga toxin-producing genes, stx1 and stx2, and two other virulence genes, eae and hlyA that code for adherence factor (intimin protein) and pore-forming cytolysin, respectively. The SNF EC isolates were also assessed for the presence of the rfbO157 gene to verify their identity to O157 serogroup. The results revealed that the proportions of goats carrying SNF EC isolates and stx1 and stx2 genes were 6·2% (32/514) [95% confidence interval (CI) 4·4-8·7)], 1·2% (95% CI 0·5-2·6) and 1·2% (95% CI 0·5-2·6), respectively. All the SNF STEC tested negative for rfbO157, hlyA and eae genes. The risk for transmission of STEC from Black Bengal goats to humans is low.

  6. Evaluation of standard and modified M-FC, MacConkey, and Teepol media for membrane filtration counting of fecal coliforms in water.

    Science.gov (United States)

    Grabow, W O; Hilner, C A; Coubrough, P

    1981-08-01

    MacConkey agar, standard M-FC agar, M-FC agar without rosolic acid, M-FC agar with a resuscitation top layer, Teepol agar, and pads saturated with Teepol broth, were evaluated as growth media for membrane filtration counting of fecal coliform bacteria in water. In comparative tests on 312 samples of water from a wide variety of sources, including chlorinated effluents, M-FC agar without rosolic acid proved the medium of choice because it generally yielded the highest counts, was readily obtainable, easy to prepare and handle, and yielded clearly recognizable fecal coliform colonies. Identification of 1,139 fecal coliform isolates showed that fecal coliform tests cannot be used to enumerate Escherichia coli because the incidence of E. coli among fecal coliforms varied from an average of 51% for river water to 93% for an activated sludge effluent after chlorination. The incidence of Klebsiella pneumoniae among fecal coliforms varied from an average of 4% for the activated sludge effluent after chlorination to 32% for the river water. The advantages of a standard membrane filtration procedure for routine counting of fecal coliforms in water using M-FC agar without rosolic acid as growth medium, in the absence of preincubation or resuscitation steps, are outlined.

  7. Development of selective and differential medium for Shigella sonnei using three carbohydrates (lactose, sorbitol, and xylose) and X-Gal.

    Science.gov (United States)

    Na, G N; Kim, S A; Kwon, O C; Rhee, M S

    2015-08-01

    The aim of this study was to develop a new selective and differential medium for isolating Shigella sonnei (designated 3SD medium). The new medium was based on three carbohydrates (lactose, sorbitol, and xylose) and a chromogenic substrate (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, X-Gal). S. sonnei cannot ferment lactose, sorbitol, or xylose, but can ferment X-Gal, which generates turquoise-blue colonies with rough edges. Other bacteria (54 strains of foodborne pathogens and spoilage bacteria) produced visually distinct colonies on 3SD medium (colorless or pink-violet colonies), or their growth was inhibited on 3SD medium. The optimum concentration of 50 mg/L X-Gal was selected because it yielded the highest level of morphological discrimination between S. sonnei and other bacteria, and this concentration was cost-effective. Bile salt concentration optimization was performed using healthy, heat-injured, and acid-injured S. sonnei. The recovery rate differed significantly depending on the bile salt concentration; media containing >1.0 g/L bile salt showed significantly lower recovery of stress-injured cells than medium containing 0.5 g/L bile salt (P<0.05). Growth of all Gram-positive bacteria was inhibited on medium containing 0.5 g/L bile salt; therefore, this concentration was used as the optimal concentration. Previous media used to isolate Shigella spp. (MacConkey, xylose lysine desoxycholate, and Salmonella-Shigella agar) showed poor performance when used to support the growth of injured S. sonnei cells, whereas 3SD medium supported a high growth rate of injured and healthy cells (equivalent to that obtained with nutrient-rich tryptic soy agar). To validate the performance of 3SD medium with real specimens, S. sonnei and other bacteria were spiked into samples such as untreated water, carrot, salad, and oyster. 3SD medium showed superior specificity (100%) and sensitivity (100%) for S. sonnei, and yielded no false-positive or false-negative results

  8. 21 CFR 184.1835 - Sorbitol.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sorbitol. 184.1835 Section 184.1835 Food and Drugs... Substances Affirmed as GRAS § 184.1835 Sorbitol. (a) Sorbitol is the chemical 1,2,3,4,5,6-hexanehexol.... Sorbitol is produced by the electrolytic reduction, or the transition metal catalytic hydrogenation of...

  9. 75 FR 39277 - Sorbitol From France; Determination

    Science.gov (United States)

    2010-07-08

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-44 (Third Review)] Sorbitol From France... U.S.C. 1675d(c)) (the Act), that revocation of the antidumping duty order on sorbitol from France... views of the Commission are contained in USITC Publication 4164 (June 2010), entitled Sorbitol from...

  10. 21 CFR 582.5835 - Sorbitol.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Sorbitol. 582.5835 Section 582.5835 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS... § 582.5835 Sorbitol. (a) Product. Sorbitol. (b) Conditions of use. This substance is generally...

  11. Occurrence and characterization of Shiga toxin-producing Escherichia coli O157:H7 and other non-sorbitol-fermenting E. coli in cattle and humans in urban areas of Morogoro, Tanzania.

    Science.gov (United States)

    Lupindu, Athumani M; Olsen, John E; Ngowi, Helena A; Msoffe, Peter L M; Mtambo, Madundo M; Scheutz, Flemming; Dalsgaard, Anders

    2014-07-01

    Escherichia coli strains such as Shiga toxin-producing E. coli (STEC), enteropathogenic E. coli, enterotoxigenic, attaching, and effacing E. coli, and enteroinvasive E. coli cause diarrhea in humans. Although other serotypes exist, the most commonly reported STEC in outbreaks is O157:H7. A cross-sectional study was conducted to isolate and characterize non-sorbitol-fermenting (NSF) E. coli O157:H7 from urban and periurban livestock settings of Morogoro, Tanzania. Human stool, cattle feces, and soil and water samples were collected. Observations and questionnaire interview studies were used to gather information about cattle and manure management practices in the study area. E. coli were isolated on sorbitol MacConkey agar and characterized by conventional biochemical tests. Out of 1049 samples, 143 (13.7%) yielded NSF E. coli. Serological and antimicrobial tests and molecular typing were performed to NSF E. coli isolates. These procedures detected 10 (7%) pathogenic E. coli including STEC (n=7), enteropathogenic E. coli (EPEC) (n=2), and attaching and effacing E. coli (A/EEC) (n=1) strains. The STEC strains had the ability to produce VT1 and different VT2 toxin subtypes that caused cytopathic effects on Vero cells. The prevalence of STEC in cattle was 1.6%, out of which 0.9% was serotype O157:H7 and the overall prevalence of diarrheagenic E. coli in cattle was 2.2%. The serotypes O157:H7, O142:H34, O113:H21, O+:H-, O+:H16, and O25:H4 were identified. One ESBL-producing isolate showed the MLST type ST131. To our knowledge, this is the first finding in Tanzania of this recently emerged worldwide pandemic clonal group, causing widespread antimicrobial-resistant infections, and adds knowledge of the geographical distribution of ST131. Cattle manure was indiscriminately deposited within residential areas, and there was direct contact between humans and cattle feces during manure handling. Cattle and manure management practices expose humans, animals, and the environment

  12. Sorbitol Can Fuel Mouse Sperm Motility and Protein Tyrosine Phosphorylation via Sorbitol Dehydrogenase1

    OpenAIRE

    Cao, Wenlei; Aghajanian, Haig K.; Haig-Ladewig, Lisa A.; Gerton, George L.

    2009-01-01

    Energy sources that can be metabolized to yield ATP are essential for normal sperm functions such as motility. Two major monosaccharides, sorbitol and fructose, are present in semen. Furthermore, sorbitol dehydrogenase (SORD) can convert sorbitol to fructose, which can then be metabolized via the glycolytic pathway in sperm to make ATP. Here we characterize Sord mRNA and SORD expression during mouse spermatogenesis and examine the ability of sorbitol to support epididymal sperm motility and t...

  13. Magnetic study of iron sorbitol

    Energy Technology Data Exchange (ETDEWEB)

    Lazaro, F.J. E-mail: osoro@posta.unizar.es; Larrea, A.; Abadia, A.R.; Romero, M.S

    2002-09-01

    A magnetic study of iron sorbitol, an iron-containing drug to treat the iron deficiency anemia is presented. Transmission electron microscopy reveals that the system contains nanometric particles with an average diameter of 3 nm whose composition is close to two-line ferrihydrite. The characterisation by magnetisation and AC susceptibility measurements indicates superparamagnetic behaviour with progressive magnetic blocking starting at 8 K. The quantitative analysis of the magnetic results indicates that the system consists of an assembly of very small magnetic moments, presumably originated by spin uncompensation of the antiferromagnetic nanoparticles, with Arrhenius type magnetic dynamics.

  14. 21 CFR 862.1670 - Sorbitol dehydrogenase test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Sorbitol dehydrogenase test system. 862.1670... Systems § 862.1670 Sorbitol dehydrogenase test system. (a) Identification. A sorbitol dehydrogenase test system is a device intended to measure the activity of the enzyme sorbitol dehydrogenase in serum...

  15. Sorbitol Can Fuel Mouse Sperm Motility and Protein Tyrosine Phosphorylation via Sorbitol Dehydrogenase1

    Science.gov (United States)

    Cao, Wenlei; Aghajanian, Haig K.; Haig-Ladewig, Lisa A.; Gerton, George L.

    2008-01-01

    Energy sources that can be metabolized to yield ATP are essential for normal sperm functions such as motility. Two major monosaccharides, sorbitol and fructose, are present in semen. Furthermore, sorbitol dehydrogenase (SORD) can convert sorbitol to fructose, which can then be metabolized via the glycolytic pathway in sperm to make ATP. Here we characterize Sord mRNA and SORD expression during mouse spermatogenesis and examine the ability of sorbitol to support epididymal sperm motility and tyrosine phosphorylation. Sord mRNA levels increased during the course of spermatogenic differentiation. SORD protein, however, was first detected at the condensing spermatid stage. By indirect immunofluorescence, SORD was present along the length of the flagella of caudal epididymal sperm. Furthermore, immunoelectron microscopy showed that SORD was associated with mitochondria and the plasma membranes of sperm. Sperm incubated with sorbitol maintained motility, indicating that sorbitol was utilized as an energy source. Sorbitol, as well as glucose and fructose, were not essential to induce hyperactive motility. Protein tyrosine phosphorylation increased in a similar manner when sorbitol was substituted for glucose in the incubation medium used for sperm capacitation. These results indicate that sorbitol can serve as an alternative energy source for sperm motility and protein tyrosine phosphorylation. PMID:18799757

  16. 75 FR 16839 - Sorbitol From France

    Science.gov (United States)

    2010-04-02

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-44 (Third Review)] Sorbitol From France AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject review. DATES: Effective Date: Date of Commission approval. FOR FURTHER INFORMATION CONTACT: Dana Lofgren (202...

  17. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  18. Comparison of Intermolecular Forces in Anhydrous Sorbitol and Solvent Cocrystals.

    Science.gov (United States)

    Dierks, Teresa M; Korter, Timothy M

    2017-08-03

    The hygroscopicity of solid sorbitol is important for its utilization as a sweetener in the pharmaceutical and food industries. The molecular foundations of sorbitol hydration characteristics are explored here using two solvated cocrystals, sorbitol-water and sorbitol-pyridine. In this work, solid-state density functional theory and terahertz time-domain spectroscopy were used to evaluate the relative stabilities of these cocrystals as compared to anhydrous sorbitol in terms of conformational and cohesive energies. The modification of the hydrogen-bonding network in crystalline sorbitol by solvent molecules gives new insight into the origins of the notable stability of sorbitol-water as compared to similar solids such as mannitol-water. In particular, the energy analysis reveals that the relative instability of the mannitol hydrate is based primarily in the lack of water-water interactions which provide considerable stabilization in the sorbitol-water crystal.

  19. Differentiation between Trichophyton mentagrophytes and T. rubrum by sorbitol assimilation.

    OpenAIRE

    Rezusta, A; Rubio, M C; Alejandre, M C

    1991-01-01

    Trichophyton rubrum was easily differentiated from T. mentagrophytes by its ability to assimilate sorbitol with an API 20C AUX strip. One hundred percent of 36 T. rubrum strains and none of 147 T. mentagrophytes strains assimilated sorbitol.

  20. The effects of urea, guanidinium chloride and sorbitol on porphyrin ...

    Indian Academy of Sciences (India)

    This paper compares the inhibition effect of porphyrin aggregation in the presence of urea, guanidinium chloride (Gdn) and sorbitol by molecular dynamics simulation. It demonstrates that porphyrin aggregation increases in sorbitol, but decreases towards addition of urea and Gdn. It shows that urea, Gdn and sorbitol can ...

  1. The metabolic fate of exogenous sorbitol in the rat

    International Nuclear Information System (INIS)

    Ertel, N.H.; Akgun, S.; Kemp, F.W.; Mittler, J.C.

    1983-01-01

    Dietary sorbitol is rapidly converted to fructose and other carbohydrates in the liver, but its metabolic fate has not been studied rigorously. Twenty-four rats were given 20.4 muCi [ 14 C]sorbitol with 100 mg of sorbitol, and groups of six were killed at 1, 3, 6, and 24 hours after sorbitol administration. Rats were also fed 6.9 muCi [ 14 C]sorbitol for 7 or 14 days. Serum, liver, and lens were analyzed for 14 C-labeled sorbitol, fructose, and glucose by using high-performance liquid chromatography. Negligible radioactivity (1.1%) was found in the gastrointestinal content at 24 hours indicating virtually complete absorption. Most of the radioactivity was recovered in the glucose fraction in serum, liver and lens. Glucose and fructose concentrations showed some decline by day 14 compared with day 7 in serum and liver. However, in the lens, sorbitol showed a peak value at the end of the 14th day (37.5 +/- 9.9 micrograms/pair). These findings suggest that: 1) after oral administration, sorbitol is completely absorbed, and 2) that there is a finite accumulation of sorbitol and fructose in the lens in 14 days. Although the radioactive label indicated the exogenous origin of these carbohydrates, it is not certain whether the sorbitol is converted to glucose before entering and accumulating in the lens

  2. Electron impact ionization of the gas-phase sorbitol

    Science.gov (United States)

    Chernyshova, Irina; Markush, Pavlo; Zavilopulo, Anatoly; Shpenik, Otto

    2015-03-01

    Ionization and dissociative ionization of the sorbitol molecule by electron impact have been studied using two different experimental methods. In the mass range of m/ z = 10-190, the mass spectra of sorbitol were recorded at the ionizing electron energies of 70 and 30 eV. The ion yield curves for the fragment ions have been analyzed and the appearance energies of these ions have been determined. The relative total ionization cross section of the sorbitol molecule was measured using monoenergetic electron beam. Possible fragmentation pathways for the sorbitol molecule were proposed.

  3. Lipase-Catalyzed Production of 6-O-cinnamoyl-sorbitol from D-sorbitol and Cinnamic Acid Esters.

    Science.gov (United States)

    Kim, Jung-Ho; Bhatia, Shashi Kant; Yoo, Dongwon; Seo, Hyung Min; Yi, Da-Hye; Kim, Hyun Joong; Lee, Ju Hee; Choi, Kwon-Young; Kim, Kwang Jin; Lee, Yoo Kyung; Yang, Yung-Hun

    2015-05-01

    To overcome the poor properties of solubility and stability of cinnamic acid, cinnamate derivatives with sugar alcohols were produced using the immobilized Candida antarctica lipase with vinyl cinnamate and D-sorbitol as substrate at 45 °C. Immobilized C. antarctica lipase was found to synthesize 6-O-cinnamoyl-sorbitol and confirmed by HPLC and (1)H-NMR and had a preference for vinyl cinnamate over other esters such as allyl-, ethyl-, and isobutyl cinnamate as co-substrate with D-sorbitol. Contrary to D-sorbitol, vinyl cinnamate, and cinnamic acid, the final product 6-O-cinnamoyl-sorbitol was found to have radical scavenging activity. This would be the first report on the biosynthesis of 6-O-cinnamoyl-sorbitol with immobilized enzyme from C. antarctica.

  4. Sorbitol dehydrogenase is a cytosolic protein required for sorbitol metabolism in Arabidopsis thaliana.

    Science.gov (United States)

    Aguayo, María Francisca; Ampuero, Diego; Mandujano, Patricio; Parada, Roberto; Muñoz, Rodrigo; Gallart, Marta; Altabella, Teresa; Cabrera, Ricardo; Stange, Claudia; Handford, Michael

    2013-05-01

    Sorbitol is converted to fructose in Rosaceae species by SORBITOL DEHYDROGENASE (SDH, EC 1.1.1.14), especially in sink organs. SDH has also been found in non-Rosaceae species and here we show that the protein encoded by At5g51970 in Arabidopsis thaliana (L.) Heynh. possesses the molecular characteristics of an SDH. Using a green fluorescent protein-tagged version and anti-SDH antisera, we determined that SDH is cytosolically localized, consistent with bioinformatic predictions. We also show that SDH is widely expressed, and that SDH protein accumulates in both source and sink organs. In the presence of NAD+, recombinant SDH exhibited greatest oxidative activity with sorbitol, ribitol and xylitol as substrates; other sugar alcohols were oxidized to a lesser extent. Under standard growth conditions, three independent sdh- mutants developed as wild-type. Nevertheless, all three exhibited reduced dry weight and primary root length compared to wild-type when grown in the presence of sorbitol. Additionally, under short-day conditions, the mutants were more resistant to dehydration stress, as shown by a reduced loss of leaf water content when watering was withheld, and a greater survival rate on re-watering. This evidence suggests that limitations in the metabolism of sugar alcohols alter the growth of Arabidopsis and its response to drought. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. Enhanced Sorbitol Production under Submerged Fermentation using Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Khan Nadiya Jan

    2017-04-01

    Full Text Available Background and Objective: Sorbitol is a non-toxic and slightly hygroscopic compound with different applications. Zymomonas mobiles produces sorbitol from sucrose or mixtures of glucose and fructose (formation is coupled with the dehydrogenation of glucose to glucono-δ- lactone. Recombinant Zymomonas mobilis may produce sorbitol and gluconic acid from glucose and fructose using different divalent metal ions with reduced the ethanol yield andsignificantly increased yield of sorbitol. Current study envisaged to alter the media components, physical process parameters and supplementation of amino acids for enhanced sorbitol production.Material and Methods: Several process variables were evaluated on sorbitol production including carbon sources (glucose, fructose, maltose, sucrose, carbon concentrations (5, 10, 20 and 25 g l-1, nitrogen sources (peptone, tryptone, yeast extract, beef extract and organic nitrogen mix, temperatures (25, 29, 33, 37, 41°C, pH (6, 6.5, 7 , 7.5 ,8, agitation rate (50, 100, 150, 200 rpm and amino acids (cysteine, cystine, tryptophanin batch cultivation ofLactobacillus plantarum NCIM 2912. Shake flask cultivation performed under optimum conditions like temperature 37°C, pH 7.0 and agitation rate of 150 rpm, resulted in enhanced sorbitol production. Comparative study of sorbitol production in solid state fermentation and submerged fermentation was also evaluated.Results and Conclusion: Batch cultivation under submerged conditions further performed in 7.5-l lab scale bioreactor (working volume 3.0-l under optimized conditions resulted in maximum cell biomass of 8.95±0.03 g g-1 and a sorbitol content of 9.78±0.04 g l-1 after 42.0 h of fermentation. Scale up study on bioreactor resulted in maximum sorbitol yield (Yp/x and productivity of 1.11 g g-1 and 0.50 g l-1 h under submerged fermentation, respectively.Conflict of interest: The authors declare no conflict of interest.

  6. 75 FR 51015 - Sorbitol From France: Notice of Rescission of Antidumping Duty Administrative Review

    Science.gov (United States)

    2010-08-18

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-427-001] Sorbitol From France: Notice... order on sorbitol from France. The review covers one producer/exporter of sorbitol, Syral S.A.S. (Syral... Products International (CP), domestic producers of sorbitol, we are now rescinding this administrative...

  7. Temperature-Dependent Fermentation of d-Sorbitol in Escherichia coli O157:H7

    OpenAIRE

    Bouvet, O. M. M.; Pernoud, S.; Grimont, P. A. D.

    1999-01-01

    The influence of growth temperature on the ability to ferment d-sorbitol was investigated in Escherichia coli O157:H7. It was found that O157:H7 strains have a temperature-sensitive sorbitol phenotype. d-Sorbitol transport and sorbitol-6-phosphate dehydrogenase activities were expressed in sorbitol-fermenting cells grown at 30°C but only at a low level at 40°C. Sorbitol-positive variants able to transport d-sorbitol were easily selected at 30°C from culture of Sor− E. coli O157:H7 strains.

  8. Pra Desain Pabrik Sorbitol dari Tepung Tapioka dengan Hidrogenasi Katalitik

    Directory of Open Access Journals (Sweden)

    Hellen Kartika Dewi

    2014-03-01

    Full Text Available Sorbitol yang dikenal juga sebagai glusitol, adalah suatu gula alkohol yang dimetabolisme lambat di dalam tubuh. Sorbitol banyak digunakan sebagai bahan baku untuk industri barang konsumsi dan makanan seperti pasta gigi, permen, kosmetika, farmasi, vitamin C, termasuk industri tekstil dan kulit. Pembuatan sorbitol dari bahan baku tepung tapioka. Pabrik sorbitol ini direncanakan akan didirikan di Propinsi Jawa Tengah tepatnya di Kabupaten Batang dengan kapasitas produksi 30.000 ton/tahun. Proses produksi Sorbitol menggunakan proses hidrogenasi katalitik. Pembuatan sorbitol dari bahan baku pati melalui dua tahap proses utama yaitu proses perubahan starch menjadi glukosa melalui hidrolisa double enzym. Enzim yang digunakan yaitu α-amylase dan glukoamylase. Proses hidrogenasi katalitik dilakukan dengan mereaksikan larutan dekstrose dan gas hidrogen bertekanan tinggi dengan menambahkan katalis nikel dalam reaktor (Reaktor Hidrogenasi. Gas hidrogen masuk dari bawah reaktor secara bubbling dan larutan dekstrose diumpankan dari atas reaktor sehingga kontak yang terjadi semakin baik. Sorbitol yang di hasilkan dalam pradesain pabrik sorbitol ini dengan konsentrasi 58,2%. Pendirian pabrik sorbitol memerlukan biaya investasi modal tetap (fixed capital sebesar Rp 168.801.192.952, modal kerja (working capital  Rp 29.788.445.815, investasi total Rp 198.589.638.767, Biaya produksi per tahun Rp 368.832.813.809 dan  hasil penjualan per tahun Rp 540.000.078.750. Dari analisa ekonomi didapatkan BEP sebesar 26,32%. ROI sesudah pajak 48,5 %, POT sesudah pajak 2,14 tahun. Dari segi teknis dan ekonomis, pabrik ini layak untuk didirikan.

  9. The Interaction of Sorbitol with Caffeine in Aqueous Solution

    OpenAIRE

    Tavagnacco, Letizia; Brady, John W.; Cesàro, Attilio

    2013-01-01

    Molecular dynamics simulations were carried out on a system of caffeine interacting with the sugar alcohol sorbitol. The system examined had a caffeine concentration 0.083 m and a sugar concentration 1.08 m. The trajectories of all molecules in the system were collected over a period of 80 ns and analyzed to determine whether there is any tendency for sorbitol to bind to caffeine, and if so, by what mechanism. The results show that the sorbitol molecules have an affinity for the caffeine mole...

  10. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  11. Malabsorption of fructose-sorbitol mixtures. Interactions causing abdominal distress

    DEFF Research Database (Denmark)

    Rumessen, J J; Gudmand-Høyer, E

    1987-01-01

    Hydrogen breath tests were performed on 10 healthy adults after they had ingested a mixture of sorbitol and fructose, in which these substances were present in amounts corresponding to the individual absorption capacities. A significant malabsorption of this mixture was evident in 7 of 10 subjects....... The mixture caused mild to severe gastrointestinal distress in five subjects. When the carbohydrates were given separately, symptoms were absent. There was a significant correlation between the individual absorption capacities of fructose and of sorbitol. A mixture containing a similar amount of fructose......, but given as sucrose, and a similar amount of sorbitol was further given to four of the seven subjects showing malabsorption of the fructose-sorbitol mixture. Malabsorption now failed to appear, and symptoms were absent. These findings are of potential importance for the understanding of the physiologic...

  12. Molecular, Serological And Microbiological Profiling Evidence Of ...

    African Journals Online (AJOL)

    All items that the boy had contact with including a laboratory coat, bunch of keys and shoes were swabbed. Finally samples of all the boy's food and drinks were taken. Microbiological, Serological and Polymerase Chain Reaction (PCR) Profiling Assays. l the samples were cultured on Sorbitol - MacConkey (SMAC) agar, ...

  13. Direct catalytic production of sorbitol from waste cellulosic materials.

    Science.gov (United States)

    Ribeiro, Lucília Sousa; Órfão, José J de Melo; Pereira, Manuel Fernando Ribeiro

    2017-05-01

    Cotton wool, cotton textile, tissue paper and printing paper, all potential waste cellulosic materials, were directly converted to sorbitol using a Ru/CNT catalyst in the presence of H 2 and using only water as solvent, without any acids. Conversions up to 38% were attained for the raw substrates, with sorbitol yields below 10%. Ball-milling of the materials disrupted their crystallinity, allowing reaching 100% conversion of cotton wool, cotton textile and tissue paper after 4h, with sorbitol yields around 50%. Mix-milling these materials with the catalyst greatly enhanced their conversion rate, and the materials were efficiently converted to sorbitol with a yield around 50% in 2h. However, ball- and mix-milled printing paper presented a conversion of only 50% after 5h, with sorbitol yields of 7%. Amounts of sorbitol of 0.525, 0.511 and 0.559g could be obtained from 1g of cotton wool, cotton textile and tissue paper, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Non-climacteric ripening and sorbitol homeostasis in plum fruits.

    Science.gov (United States)

    Kim, Ho-Youn; Farcuh, Macarena; Cohen, Yuval; Crisosto, Carlos; Sadka, Avi; Blumwald, Eduardo

    2015-02-01

    During ripening fruits undergo several physiological and biochemical modifications that influence quality-related properties, such as texture, color, aroma and taste. We studied the differences in ethylene and sugar metabolism between two genetically related Japanese plum cultivars with contrasting ripening behaviors. 'Santa Rosa' (SR) behaved as a typical climacteric fruit, while the bud sport mutant 'Sweet Miriam' (SM) displayed a non-climacteric ripening pattern. SM fruit displayed a delayed ripening that lasted 120 days longer than that of the climacteric fruit. At the full-ripe stage, both cultivars reached similar final size and weight but the non-climacteric fruits were firmer than the climacteric fruits. Fully ripe non-climacteric plum fruits, showed an accumulation of sorbitol that was 2.5 times higher than that of climacteric fruits, and the increase in sorbitol were also paralleled to an increase in sucrose catabolism. These changes were highly correlated with decreased activity and expression of NAD(+)-dependent sorbitol dehydrogenase and sorbitol oxidase and increased sorbitol-6-phosphate dehydrogenase activity, suggesting an enhanced sorbitol synthesis in non-climacteric fruits. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  16. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  17. The Interaction of Sorbitol with Caffeine in Aqueous Solution.

    Science.gov (United States)

    Tavagnacco, Letizia; Brady, John W; Cesàro, Attilio

    2013-09-01

    Molecular dynamics simulations were carried out on a system of caffeine interacting with the sugar alcohol sorbitol. The system examined had a caffeine concentration 0.083 m and a sugar concentration 1.08 m. The trajectories of all molecules in the system were collected over a period of 80 ns and analyzed to determine whether there is any tendency for sorbitol to bind to caffeine, and if so, by what mechanism. The results show that the sorbitol molecules have an affinity for the caffeine molecules and that the binding occurred by the interaction of the aliphatic hydrophobic protons of the sugar with the caffeine face. This intermolecular association via face-to-face stacking, as suggested by simulation studies, is similar to that found for sucrose and for D-glucose, which overwhelmingly exists in the pyranose ring chair form in aqueous solution, as well as for caffeine-caffeine association. The sorbitol molecules, however, exist as relatively extended chains and are, therefore, topologically quite different from the sugars sucrose and glucose. The comparison of the average conformation of sorbitol molecules bound to caffeine with that of molecules in the free state shows a substantial similarity.

  18. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  19. Skeletal Muscle Sorbitol Levels in Diabetic Rats with and without Insulin Therapy and Endurance Exercise Training

    Science.gov (United States)

    Sánchez, O. A.; Walseth, T. F.; Snow, L. M.; Serfass, R. C.; Thompson, L. V.

    2009-01-01

    Sorbitol accumulation is postulated to play a role in skeletal muscle dysfunction associated with diabetes. The purpose of this study was to determine the effects of insulin and of endurance exercise on skeletal muscle sorbitol levels in streptozotocin-induced diabetic rats. Rats were assigned to one experimental group (control sedentary, control exercise, diabetic sedentary, diabetic exercise, diabetic sedentary no-insulin). Diabetic rats received daily subcutaneous insulin. The exercise-trained rats ran on a treadmill (1 hour, 5X/wk, for 12 weeks). Skeletal muscle sorbitol levels were the highest in the diabetic sedentary no-insulin group. Diabetic sedentary rats receiving insulin had similar sorbitol levels to control sedentary rats. Endurance exercise did not significantly affect sorbitol levels. These results indicate that insulin treatment lowers sorbitol in skeletal muscle; therefore sorbitol accumulation is probably not related to muscle dysfunction in insulin-treated diabetic individuals. Endurance exercise did not influence intramuscular sorbitol values as strongly as insulin. PMID:20016800

  20. The metabolism of sorbitol and fructose in isolated chloroplasts of Santa Rosa plum leaves

    International Nuclear Information System (INIS)

    De Villiers, O.T.

    1979-01-01

    Aqueously as well as non-aqueously isolated chloroplasts from Santa Rosa plum leaves readily metabolised sorbitol- 14 C to fructose, glucose and sucrose. Likewise, fructose- 14 C was converted to sorbitol, glucose and sucrose [af

  1. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  2. Caloric utilization of sorbitol and isomalt in the rat

    International Nuclear Information System (INIS)

    Figdor, S.K.; Allingham, R.P.; Kita, D.A.; Hobbs, D.C.

    1987-01-01

    Sorbitol and isomalt are modified saccharides used to substitute for the physical properties of sucrose in various prepared foods. The merits of the various methods for determining caloric availability were reviewed. Balance and growth curve methods are inaccurate and inappropriate for determination of the caloric availability of these substances when present in diets at low concentrations, whereas the radiolabel disposition method is a direct and precise measure of utilization. Accordingly, the authors administered uniformly 14 C-labeled material to rats and collected excreta and expired air. The appearance of about half of the label in CO 2 indicated that, by comparison with labeled glucose, about 80% of the orally administered sorbitol and isomalt was calorically available to the rat. The high caloric availabilities of these materials were confirmed by the appearance in feces of only 14 and 12% of the administered label from sorbitol and isomalt, respectively

  3. Colon Necrosis Due to Sodium Polystyrene Sulfonate with and without Sorbitol: An Experimental Study in Rats.

    Science.gov (United States)

    Ayoub, Isabelle; Oh, Man S; Gupta, Raavi; McFarlane, Michael; Babinska, Anna; Salifu, Moro O

    2015-01-01

    Based on a single rat study by Lillemoe et al, the consensus has been formed to implicate sorbitol rather than sodium polystyrene sulfonate (SPS) as the culprit for colon necrosis in humans treated with SPS and sorbitol. We tested the hypothesis that colon necrosis by sorbitol in the experiment was due to the high osmolality and volume of sorbitol rather than its chemical nature. 26 rats underwent 5/6 nephrectomy. They were divided into 6 groups and given enema solutions under anesthesia (normal saline, 33% sorbitol, 33% mannitol, SPS in 33% sorbitol, SPS in normal saline, and SPS in distilled water). They were sacrificed after 48 hours of enema administration or earlier if they were very sick. The gross appearance of the colon was visually inspected, and then sliced colon tissues were examined under light microscopy. 1 rat from the sorbitol and 1 from the mannitol group had foci of ischemic colonic changes. The rats receiving SPS enema, in sorbitol, normal saline, distilled water, had crystal deposition with colonic necrosis and mucosal erosion. All the rats not given SPS survived until sacrificed at 48 h whereas 11 of 13 rats that received SPS in sorbitol, normal saline or distilled water died or were clearly dying and sacrificed sooner. There was no difference between sorbitol and mannitol when given without SPS. In a surgical uremic rat model, SPS enema given alone or with sorbitol or mannitol seemed to cause colon necrosis and high mortality rate, whereas 33% sorbitol without SPS did not.

  4. 40 CFR 180.1262 - Sorbitol octanoate; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Sorbitol octanoate; exemption from the... Exemptions From Tolerances § 180.1262 Sorbitol octanoate; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of sorbitol octanoate in or on all...

  5. 75 FR 42380 - Revocation of Antidumping Duty Order on Sorbitol From France

    Science.gov (United States)

    2010-07-21

    ... Duty Order on Sorbitol From France AGENCY: Import Administration, International Trade Administration... sunset review of the antidumping duty order on sorbitol from France. See Initiation of Five-year... the existing antidumping duty order on sorbitol from France would not be likely to lead to...

  6. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  7. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  8. Sorbitol dehydration into isosorbide in a molten salt hydrate medium

    NARCIS (Netherlands)

    Li, J.; Spina, A.; Moulijn, J.A.; Makkee, M.

    2013-01-01

    The sorbitol conversion in a molten salt hydrate medium (ZnCl2; 70 wt% in water) was studied. Dehydration is the main reaction, initially 1,4- and 3,6-anhydrosorbitol are the main products that are subsequently converted into isosorbide; two other anhydrohexitols, (1,5- and 2,5-), formed are in less

  9. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  10. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  11. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  13. Effect of sorbitol on dough rheology and quality of sugar replaced cookies

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Shariati

    2018-02-01

    Full Text Available A high amount of sugar is used in bakery products, which may cause diabetes, high blood glucose levels and obesity. Due to these reasons, sugar is being replaced with substitutes. There is different carbohydrate-based sugar substitutes (polyols that can efficiently replace sugar. Among polyols, sorbitol is an efficient replacer that can mimic sugar with minimal effects on cookie quality. Effects of different sorbitol levels (0 to 12.5% were seen on the dough rheology. Mixographic studies showed that peak height and mixing time reduced with the addition of sorbitol. Farinographic studies showed that water absorption and the mixing tolerance index of dough reduced with the supplementation of sorbitol, whereas dough development time, arrival time, dough stability time and softening of dough increased. Extensographic studies revealed that sorbitol substitution produced hard, cohesive, adhesive and elastic dough. Sugar in cookies formulations was reduced from 100 to 50% by replacing with sorbitol 0 to 50%. Physical analysis of sorbitol containing cookies showed that the diameter and spread factor of cookies decreased with higher levels of sorbitol, whereas thickness, color, hardness and water activity of cookies increased. The calorific value of cookies decreased with the increasing levels of sorbitol. At upto 20% replacement of sugar, other parameters of cookies were not affected. Sensory evaluation of the cookies showed that hedonic points for sensory evaluation parameters reduced with the increasing levels of sorbitol, T2 (20% replacement showed maximum overall acceptability. Normal 0 false false false EN-GB X-NONE AR-SA

  14. Selective electrocatalytic oxidation of sorbitol to fructose and sorbose.

    Science.gov (United States)

    Kwon, Youngkook; de Jong, Ed; van der Waal, Jan Kees; Koper, Marc T M

    2015-03-01

    A new electrocatalytic method for the selective electrochemical oxidation of sorbitol to fructose and sorbose is demonstrated by using a platinum electrode promoted by p-block metal atoms. By the studying a range of C4, C5 and C6 polyols, it is found that the promoter interferes with the stereochemistry of the polyol and thereby modifies its reactivity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Sorbitol counteracts high hydrostatic pressure-induced denaturation of inulin fructotransferase.

    Science.gov (United States)

    Li, Yungao; Miao, Ming; Liu, Miao; Jiang, Bo; Zhang, Tao; Chen, Xiangyin

    2014-09-01

    Inulin fructotransferase (IFTase), a novel hydrolase for inulin, was exposed to high hydrostatic pressure (HHP) at 400 and 600 MPa for 15 min in the presence or absence of sorbitol. Sorbitol protected the enzyme against HHP-induced activity loss. The relative residual activity increased nearly 3.1- and 3.8-fold in the presence of 3 mol/L sorbitol under 400 MPa and 600 MPa for 15 min, respectively. Circular dichroism results indicated that the original chaotic unfolding conformation of the enzyme under HHP shifted toward more ordered and impact with 3 mol/L sorbitol. Fluorescence and UV spectra results suggested that sorbitol prevented partially the unfolding of the enzyme and stabilized the conformation under high pressure. These results might be attributed to the binding of sorbitol on the surface of IFTase to rearrange and strengthen intra- and intermolecular hydrogen bonds. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. PRODUKSI ANTIBIOTIKA OLEH Bacillus subtilis M10 DALAM MEDIA UREA-SORBITOL

    Directory of Open Access Journals (Sweden)

    Supartono Supartono

    2012-04-01

    Full Text Available PRODUCTION OF ANTIBIOTICS BY Bacillus subtilis M10 IN UREA-SORBITOL MEDIUM. Infection diseases still become the main health problems that suffered by people in Indonesia. Besides, there were many pathogen bacteria found to be resistant to the some antibiotics. Therefore, the efforts to get a new antibiotic require to be done continuously. A new local strain of Bacillus subtilis BAC4 has been known producing an antibiotic that inhibit Serratia marcescens ATCC 27117 growth. To make efficient the local strain, mutation on Bacillus subtilis BAC4 was done by using acridine orange and a mutant cell of Bacillus subtilis M10 that overproduction for producing antibiotic was obtained. Nevertheless, the production kinetics of antibiotic by this mutant has not been reported. The objective of this research was to study the production kinetics of antibiotic by Bacillus subtilis M10 mutant. The production of antibiotic was conducted using batch fermentation and antibiotic assay was performed with agar absorption method using Serratia marcescens ATCC 27117 as bacteria assay. Research result provided that Bacillus subtilis M10 mutant with overproduction of antibiotic produced an antibiotic since 8th hour’s fermentation and optimum of it production was at 14th hours after inoculation.  Penyakit infeksi masih menjadi masalah yang utama diderita oleh masyarakat Indonesia. Di samping itu, banyak bakteri patogen yang ditemukan resisten terhadap beberapa antibiotika. Oleh karena itu, upaya-upaya untuk mendapatkan antibiotika baru perlu dilakukan secara terus-menerus. Suatu galur lokal baru Bacillus subtilis BAC4 teridentifikasi memproduksi senyawa antibiotika yang menghambat pertumbuhan Serratia marcescens ATCC27117. Untuk memberdayakan galur tersebut, terhadap Bacillus subtilis BAC4 dilakukan mutasi dengan larutan akridin oranye dan diperoleh mutan Bacillus subtilis M10 yang memproduksi antibiotika berlebihan. Namun, kinetika produksi antibiotika oleh Bacillus

  17. Efficacy of vinegar, sorbitol and sodium benzoate in mitigation of Salmonella contamination in betel leaf

    Directory of Open Access Journals (Sweden)

    Al Asmaul Husna

    2015-06-01

    Full Text Available The present study was undertaken to mitigate Salmonella from betel leaf in Mymensingh. A total of 35 betel leaf samples were collected from 2 baroujes and 5 local markets in Mymensingh. The samples were sub-divided into two groups: (i phosphate buffer solution (PBS washed, and (ii grinded sample. There was control and treated (with 1.5% vinegar, sorbitol, and sodium benzoate sub-groups in both groups. Mitigation of Salmonella was determined by comparing Total Viable Count (TVC and Total Salmonella Count (TSAC of control with treated groups. No bacterial growth was observed in the betel leaf samples collected directly from barouj level. At market level, when grinded, there was no growth of bacteria in Plate Count Agar (PCA and Salmonella- Shigella (SS or Xylose Lysine De-oxy-chocolate (XLD in both treated and untreated groups. But when the PBS washed samples were used, the TVC (mean log CFU±SD/mL of betel leaf ranged from 5.16±0.82 to 5.96±1.11, whereas the TSAC value ranged from 4.87±0.58 to 5.56±1.00 for untreated group. In vinegar, there was no growth, but when treated with sorbitol, the TVC (mean log CFU±SD/mL value reduced to 5.00±0.54 to 5.66±1.09, and TSAC (mean log CFU±SD/mL value reduced to 4.28±0.71 to 4.78±0.64. When treated with sodium benzoate, the TVC (mean log CFU±SD/mL value reduced to 5.06±0.53 to 5.75±1.02, and TSAC (mean log CFU±SD/mL value reduced to 4.34±0.79 to 4.92±0.64. Data of this study indicates that all the three chemicals were effective in terms of reducing bacterial load but vinegar (1.5% was found to be the most effective against Salmonella as well as some other bacteria when treated for 10 min.

  18. Molecular dynamics studies of the conformation of sorbitol

    Science.gov (United States)

    Lerbret, A.; Mason, P.E.; Venable, R.M.; Cesàro, A.; Saboungi, M.-L.; Pastor, R.W.; Brady, J.W.

    2009-01-01

    Molecular dynamics simulations of a 3 m aqueous solution of D-sorbitol (also called D-glucitol) have been performed at 300 K, as well as at two elevated temperatures to promote conformational transitions. In principle, sorbitol is more flexible than glucose since it does not contain a constraining ring. However, a conformational analysis revealed that the sorbitol chain remains extended in solution, in contrast to the bent conformation found experimentally in the crystalline form. While there are 243 staggered conformations of the backbone possible for this open-chain polyol, only a very limited number were found to be stable in the simulations. Although many conformers were briefly sampled, only eight were significantly populated in the simulation. The carbon backbones of all but two of these eight conformers were completely extended, unlike the bent crystal conformation. These extended conformers were stabilized by a quite persistent intramolecular hydrogen bond between the hydroxyl groups of carbon C-2 and C-4. The conformational populations were found to be in good agreement with the limited available NMR data except for the C-2–C-3 torsion (spanned by the O-2–O-4 hydrogen bond), where the NMR data supports a more bent structure. PMID:19744646

  19. Trehalose 6-phosphate signal is closely related to sorbitol in apple (Malus domestica Borkh. cv. Gala)

    Science.gov (United States)

    Zhang, Wen; Lunn, John E.; Feil, Regina; Wang, Yufei; Zhao, Jingjing; Tao, Hongxia; Zhao, Zhengyang

    2017-01-01

    ABSTRACT Trehalose-6-phosphate (Tre6P) is a precursor of trehalose, which is widespread in nature and greatly influences plant growth and development. Tre6P acts as a signal of carbon availability in many plants, but little is known about the function of Tre6P in rosaceous plants, which have specific sorbitol biosynthesis and transportation pathways. In the present study, Tre6P levels and Sorbitol:Tre6P ratios were analyzed in apple (Malus domestica, Borkh. cv. Gala). Tre6P levels were positively correlated with sorbitol content but negatively correlated with sucrose, glucose, and fructose content in developing fruit. However, under sorbitol-limited conditions, Tre6P levels were positively correlated with both sorbitol and sucrose. In the presence of different exogenous sugar supply, Tre6P levels increased corresponding with sorbitol, but this was not the case with sucrose. In addition, Tre6P content and sorbitol:Tre6P ratios were more highly correlated with ADP-glucose levels under sorbitol-limited conditions and fruit development stages, respectively. These results suggest that Tre6P is more closely related to sorbitol than other soluble sugars and has an important role in influencing carbon metabolism in apple. PMID:28069587

  20. Exposure to sorbitol during lactation causes metabolic alterations and genotoxic effects in rat offspring.

    Science.gov (United States)

    Cardoso, Felipe S; Araujo-Lima, Carlos F; Aiub, Claudia A F; Felzenszwalb, Israel

    2016-10-17

    Sorbitol is a polyol used by the food industry as a sweetener. Women are consuming diet and light products containing sorbitol during pregnancy and in the postnatal period to prevent themselves from excessive weight gain and maintain a slim body. Although there is no evidence for the genotoxicity of sorbitol in the perinatal period, this study focused on evaluating the effects of the maternal intake of sorbitol on the biochemical and toxicological parameters of lactating Wistar rat offspring after 14days of mother-to-offspring exposure. A dose-dependent reduction of offspring length was observed. An increase in sorbitol levels determined in the milk was also observed. However, we detected an inverse relationship between the exposition dose in milk fructose and triacylglycerols concentrations. There was an increase in the plasmatic levels of ALT, AST and LDLc and a decrease in proteins, cholesterol and glucose levels in the offspring. Sorbitol exposure caused hepatocyte genotoxicity, including micronuclei induction. Maternal sorbitol intake induced myelotoxicity and myelosuppression in their offspring. The Comet assay of the blood cells detected a dose-dependent genotoxic response within the sorbitol-exposed offspring. According to our results, sorbitol is able to induce important metabolic alterations and genotoxic responses in the exposed offspring. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Trehalose 6-phosphate signal is closely related to sorbitol in apple (Malus domestica Borkh. cv. Gala

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    2017-02-01

    Full Text Available Trehalose-6-phosphate (Tre6P is a precursor of trehalose, which is widespread in nature and greatly influences plant growth and development. Tre6P acts as a signal of carbon availability in many plants, but little is known about the function of Tre6P in rosaceous plants, which have specific sorbitol biosynthesis and transportation pathways. In the present study, Tre6P levels and Sorbitol:Tre6P ratios were analyzed in apple (Malus domestica, Borkh. cv. Gala. Tre6P levels were positively correlated with sorbitol content but negatively correlated with sucrose, glucose, and fructose content in developing fruit. However, under sorbitol-limited conditions, Tre6P levels were positively correlated with both sorbitol and sucrose. In the presence of different exogenous sugar supply, Tre6P levels increased corresponding with sorbitol, but this was not the case with sucrose. In addition, Tre6P content and sorbitol:Tre6P ratios were more highly correlated with ADP-glucose levels under sorbitol-limited conditions and fruit development stages, respectively. These results suggest that Tre6P is more closely related to sorbitol than other soluble sugars and has an important role in influencing carbon metabolism in apple.

  2. Humectancies of d-tagatose and d-sorbitol.

    Science.gov (United States)

    Lu, Y

    2001-06-01

    Most toothpastes contain either d-sorbitol or glycerin, or both, as humectants. Both compounds are about half as sweet as sucrose. This level of sweetness is not as intense as desired by most people when brushing teeth. Therefore, many brands of toothpaste add saccharin, a high-intensity sweetener, to increase product sweetness to acceptable levels. While this combination provides the required bulk, humectancy and sweetness, the last characteristic suffers from the widely perceived metallic, or bitter, aftertaste of saccharin. d-tagatose, a full-bulk, low-calorie, sucrose-like sweetener with about twice the sweetness of d-sorbitol, and which does not promote tooth decay, holds promise as a sole sweetener for toothpastes. The only untested aspect of this use of d-tagatose was its humectancy, the characteristic that retains the required level of moisture in toothpaste. The current study was made to investigate this important property, to make a direct comparison of the humectancies of d-tagatose and d-sorbitol as pure substances, and to determine whether the humectancy of d-tagatose is sufficient to counter the crystallizing potentiation of the abrasives used in toothpastes. The humectancies of d-tagatose and d-sorbitol were tested through measuring their water activity (a(w)) vs. water content. By comparing their desorption curves, d-tagatose was seen to have a humectancy equal to that of d-sorbitol when a(w) in the d-tagatose solution was above 0.62. d-Tagatose was then tested in toothpastes containing typical abrasives to determine whether the abrasives would induce crystallization of the sweetener. The addition of 20-25% wt/wt of d-tagatose to the Tom of Maine's toothpastes imparted a satisfactory sweetness. It was found that, within that range of concentration, d-tagatose retained its humectancy, and did not crystallize in the popular brands of commercial toothpastes tested. Thus, d-tagatose could be used as a humectant sweetener in toothpastes, although further

  3. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  4. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  5. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  6. Colonic necrosis due to calcium polystyrene sulfonate (Kalimate not suspended in sorbitol

    Directory of Open Access Journals (Sweden)

    María Dolores Castillo-Cejas

    2013-04-01

    Full Text Available Cation-exchange resins are used in the management of hyperkalemia, particularly in patients with end-stage renal disease. These resins were associated with gastrointestinal tract lesions, especially sodium polystyrene sulfonate (Kayexalate mixed with sorbitol. We present a case of colonic necrosis after the administration of calcium polystyrene sulfonate (Kalimate not suspended in sorbitol.

  7. The effects of xylitol and sorbitol on lysozyme- and peroxidase-related enzymatic and candidacidal activities.

    Science.gov (United States)

    Kim, Bum-Soo; Chang, Ji-Youn; Kim, Yoon-Young; Kho, Hong-Seop

    2015-07-01

    To investigate whether xylitol and sorbitol affect enzymatic and candidacidal activities of lysozyme, the peroxidase system, and the glucose oxidase-mediated peroxidase system. Xylitol and sorbitol were added to hen egg-white lysozyme, bovine lactoperoxidase, glucose oxidase-mediated peroxidase, and whole saliva in solution and on hydroxyapatite surfaces. The enzymatic activities of lysozyme, peroxidase, and glucose oxidase-mediated peroxidase were determined by the turbidimetric method, the NbsSCN assay, and production of oxidized o-dianisidine, respectively. Candidacidal activities were determined by comparing colony forming units using Candida albicans ATCC strains 10231, 11006, and 18804. While xylitol and sorbitol did not affect the enzymatic activity of hen egg-white lysozyme both in solution and on hydroxyapatite surfaces, they did inhibit the enzymatic activity of salivary lysozyme significantly in solution, but not on the surfaces. Xylitol and sorbitol enhanced the enzymatic activities of both bovine lactoperoxidase and salivary peroxidase significantly in a dose-dependent manner in solution, but not on the surfaces. Sorbitol, but not xylitol, inhibited the enzymatic activity of glucose oxidase-mediated peroxidase significantly. Both xylitol and sorbitol did not affect candidacidal activities of hen egg-white lysozyme, the bovine lactoperoxidase system, or the glucose oxidase-mediated bovine lactoperoxidase system. Xylitol and sorbitol inhibited salivary lysozyme activity, but enhanced both bovine lactoperoxidase and salivary peroxidase activities significantly in solution. Xylitol and sorbitol did not augment lysozyme- and peroxidase-related candidacidal activities. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Conductivity, work function, and environmental stability of PEDOT:PSS thin films treated with sorbitol

    NARCIS (Netherlands)

    Nardes, A.M.; Kemerink, M.; Kok, de M.M.; Vinken, E.; Maturova, K.; Janssen, R.A.J.

    2008-01-01

    The electrical properties of poly(3,4-ethylenedioxythiophene):poly(4-styrenesulfonate) (PEDOT:PSS) thin films deposited from aqueous dispersion using different concentrations of sorbitol have been studied in detail. Although it is well known that sorbitol enhances the conductivity of PEDOT:PSS thin

  9. EFFECT OF XYLITOL AND SORBITOL IN CHEWING-GUMS ON MUTANS STREPTOCOCCI, PLAQUE PH AND MINERAL LOSS OF ENAMEL

    NARCIS (Netherlands)

    WENNERHOLM, K; ARENDS, J; BIRKHED, D; RUBEN, J; EMILSON, CG; DIJKMAN, AG

    1994-01-01

    Seventeen subjects with more than 3 x 10(5) mutans streptococci per millilitre of saliva completed this randomised, cross-over study. Four different chewing-gums, containing: (1) 70% xylitol, (2) 35% xylitol + 35% sorbitol, (3) 17.5% xylitol + 52.5% sorbitol, and (4) 70% sorbitol, were tested. The

  10. Sorbitol dehydrogenase of Aspergillus niger, SdhA, is part of the oxido-reductive D-galactose pathway and essential for D-sorbitol catabolism.

    Science.gov (United States)

    Koivistoinen, Outi M; Richard, Peter; Penttilä, Merja; Ruohonen, Laura; Mojzita, Dominik

    2012-02-17

    In filamentous fungi D-galactose can be catabolised through the oxido-reductive and/or the Leloir pathway. In the oxido-reductive pathway D-galactose is converted to d-fructose in a series of steps where the last step is the oxidation of d-sorbitol by an NAD-dependent dehydrogenase. We identified a sorbitol dehydrogenase gene, sdhA (JGI53356), in Aspergillus niger encoding a medium chain dehydrogenase which is involved in D-galactose and D-sorbitol catabolism. The gene is upregulated in the presence of D-galactose, galactitol and D-sorbitol. An sdhA deletion strain showed reduced growth on galactitol and growth on D-sorbitol was completely abolished. The purified enzyme converted D-sorbitol to D-fructose with K(m) of 50±5 mM and v(max) of 80±10 U/mg. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  11. Direct sorbitol proton exchange membrane fuel cell using moderate catalyst loadings

    International Nuclear Information System (INIS)

    Oyarce, Alejandro; Gonzalez, Carlos; Lima, Raquel Bohn; Lindström, Rakel Wreland; Lagergren, Carina; Lindbergh, Göran

    2014-01-01

    Highlights: •The performance of a direct sorbitol fuel cell was evaluated at different temperatures. •The performance was compared to the performance of a direct glucose fuel cell. •The mass specific peak power density of the direct sorbitol fuel cell was 3.6 mW mg −1 totalcatalystloading at 80 °C. •Both sorbitol and glucose fuel cell suffer from deactivation. -- Abstract: Recent progress in biomass hydrolysis has made it interesting to study the use of sorbitol for electricity generation. In this study, sorbitol and glucose are used as fuels in proton exchange membrane fuel cells having 0.9 mg cm −2 PtRu/C at the anode and 0.3 mg cm −2 Pt/C at the cathode. The sorbitol oxidation was found to have slower kinetics than glucose oxidation. However, at low temperatures the direct sorbitol fuel cell shows higher performance than the direct glucose fuel cell, attributed to a lower degree of catalyst poisoning. The performance of both fuel cells is considerably improved at higher temperatures. High temperatures lower the poisoning, allowing the direct glucose fuel cell to reach a higher performance than the direct sorbitol fuel cell. The mass specific peak power densities of the direct sorbitol and direct glucose fuel cells at 65 °C was 3.2 mW mg −1 catalyst and 3.5 mW mg −1 catalyst , respectively. Both of these values are one order of magnitude larger than mass specific peak power densities of earlier reported direct glucose fuel cells using proton exchange membranes. Furthermore, both the fuel cells showed a considerably decrease in performance with time, which is partially attributed to sorbitol and glucose crossover poisoning the Pt/C cathode

  12. Effects of sorbitol on porcine oocyte maturation and embryo development in vitro.

    Science.gov (United States)

    Lin, Tao; Zhang, Jin Yu; Diao, Yun Fei; Kang, Jung Won; Jin, Dong-Il

    2015-04-01

    In the present study, a porcine system was supplemented with sorbitol during in vitro maturation (IVM) or in vitro culture (IVC), and the effects of sorbitol on oocyte maturation and embryonic development following parthenogenetic activation were assessed. Porcine immature oocytes were treated with different concentrations of sorbitol during IVM, and the resultant metaphase II stage oocytes were activated and cultured in porcine zygote medium-3 (PZM-3) for 7 days. No significant difference was observed in cumulus expansion and the nuclear maturation between the control and sorbitol-treated groups, with the exception of the 100 mM group, which showed significantly decreased nuclear maturation and cumulus expansion. There was no significant difference in the intracellular reactive oxygen species (ROS) levels between oocytes matured with 10 or 20 mM sorbitol and control groups, but 50 and 100 mM groups had significantly higher ROS levels than other groups. The 20 mM group showed significant increases in intracellular glutathione and subsequent blastocyst formation rates following parthenogenetic activation compared with the other groups. During IVC, supplementation with sorbitol significantly reduced blastocyst formation and increased the apoptotic index compared with the control. The apoptotic index of blastocysts from the sorbitol-treated group for entire culture period was significantly higher than those of the partially sorbitol-exposed groups. Based on these findings, it can be concluded that the addition of a low concentration of sorbitol (20 mM) during IVM of porcine oocytes benefits subsequent blastocyst development and improves embryo quality, whereas sorbitol supplement during IVC has a negative effect on blastocyst formation.

  13. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  14. Production of sorbitol and ethanol from Jerusalem artichokes by Saccharomyces cerevisiae ATCC 36859

    Energy Technology Data Exchange (ETDEWEB)

    Duvnjak, Z.; Duan, Z.D. (Ottawa Univ., ON (Canada). Dept. of Chemical Engineering); Turcotte, G. (Acadia Univ., Wolfville, NS (Canada). Dept. of Food Science)

    1991-09-01

    This study shows the possible use of Jerusalem artichokes for the production of sorbitol and ethanol by Saccharomyces cerevisiae ATCC 36859. Ethanol was produced from the beginning of the process, while sorbitol production started after glucose had been entirely consumed from Jerusalem artichoke (J.a.) juice. The importance of yeast extract and inoculum concentrations on the production of sorbitol from the above raw material was demonstrated. With a low initial biomass concentration sorbitol was not produced in pure J.a. juice. When the juice was supplemented with 3% yeast extract, the concentration of sorbitol was 4.6%. The sorbitol, ethanol and biomass yields (gram of product produced per gram of sugars consumed) were 0.259, 0.160 and 0.071 at the end of the process respectively. Adding glucose to increase its concentration to about 9% in the J.a. juice with 3% yeast extract had a positive effect on the production of ethanol, while commencement of the production of sorbitol was delayed and its final concentration was less than 50% of its concentration in the medium without added glucose. The effect of glucose was much stronger when it was added during the process than when added at the beginning of the process. (orig.).

  15. Effect of Sorbitol Plasticizer on the Structure and Properties of Melt Processed Polyvinyl Alcohol Films.

    Science.gov (United States)

    Tian, Huafeng; Liu, Di; Yao, Yuanyuan; Ma, Songbai; Zhang, Xing; Xiang, Aimin

    2017-12-01

    Poly (vinyl alcohol) (PVA) possesses wide applications as food packaging materials, but is difficult to melt process for its strong inter/intra hydrogen bonding. In this work, flexible PVA films with different content of sorbitol plasticizers were prepared by melt processing with the assistance of water. And the influence of sorbitol plasticizer content on the crystallinity, optical transparency, water-retaining capability, mechanical properties, thermal stability and oxygen and water permeability were investigated. The results indicated that sorbitol dramatically improved the melt processing ability of PVA. Sorbitol could interact with PVA to form strong hydrogen bonding interactions, which would decrease the original hydrogen bonding of the matrix, resulting in the decrease of crystallinity degrees. The glass transition, melting and crystallization peak temperatures decreased with the increase of sorbitol. All the films exhibited fine optical transparency. The water retaining capability were improved with the increase of sorbitol. Especially, an increase in elongation at break and decrease in Young's modulus and tensile strength were observed indicating good plasticizing effect of sorbitol on PVA films. In addition, the PVA films prepared in this work exhibited fine barrier properties against oxygen and water, suggesting wide application potential as packaging materials. © 2017 Institute of Food Technologists®.

  16. Sorbitol crystallization-induced aggregation in frozen mAb formulations.

    Science.gov (United States)

    Piedmonte, Deirdre Murphy; Hair, Alison; Baker, Priti; Brych, Lejla; Nagapudi, Karthik; Lin, Hong; Cao, Wenjin; Hershenson, Susan; Ratnaswamy, Gayathri

    2015-02-01

    Sorbitol crystallization-induced aggregation of mAbs in the frozen state was evaluated. The effect of protein aggregation resulting from sorbitol crystallization was measured as a function of formulation variables such as protein concentration and pH. Long-term studies were performed on both IgG1 and IgG2 mAbs over the protein concentration range of 0.1-120 mg/mL. Protein aggregation was measured by size-exclusion HPLC (SE-HPLC) and further characterized by capillary-electrophoresis SDS. Sorbitol crystallization was monitored and characterized by subambient differential scanning calorimetry and X-ray diffraction. Aggregation due to sorbitol crystallization is inversely proportional to both protein concentration and formulation pH. At high protein concentrations, sorbitol crystallization was suppressed, and minimal aggregation by SE-HPLC resulted, presumably because of self-stabilization of the mAbs. The glass transition temperature (Tg ') and fragility index measurements were made to assess the influence of molecular mobility on the crystallization of sorbitol. Tg ' increased with increasing protein concentration for both mAbs. The fragility index decreased with increasing protein concentration, suggesting that it is increasingly difficult for sorbitol to crystallize at high protein concentrations. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

  17. Ileocolic Perforation Secondary to Sodium Polystyrene Sulfonate in Sorbitol Use: A Case Report

    Directory of Open Access Journals (Sweden)

    Vincent Trottier

    2009-01-01

    Full Text Available Hyperkalemia is a common condition encountered in medical and surgical patients. It can lead to various complications including cardiac arrhythmias. Sodium polystyrene sulfonate (SPS in sorbitol is an ion-exchange resin that can be used to treat hyperkalemia. It can be used in enema or in oral form. The present article describes the case of an intensive care unit patient who experienced severe, diffuse, intestinal perforation induced by the use of SPS-sorbitol, requiring multiple laparotomies, followed by a brief review of the relevant literature and recommendations regarding the use of SPS-sorbitol.

  18. Ileocolic perforation secondary to sodium polystyrene sulfonate in sorbitol use: A case report

    Science.gov (United States)

    Trottier, Vincent; Drolet, Sébastien; Morcos, Mohib W

    2009-01-01

    Hyperkalemia is a common condition encountered in medical and surgical patients. It can lead to various complications including cardiac arrhythmias. Sodium polystyrene sulfonate (SPS) in sorbitol is an ion-exchange resin that can be used to treat hyperkalemia. It can be used in enema or in oral form. The present article describes the case of an intensive care unit patient who experienced severe, diffuse, intestinal perforation induced by the use of SPS-sorbitol, requiring multiple laparotomies, followed by a brief review of the relevant literature and recommendations regarding the use of SPS-sorbitol. PMID:19826644

  19. The effect of glicerol and sorbitol plasticizers toward disintegration time of phyto-capsules

    Science.gov (United States)

    Pudjiastuti, Pratiwi; Hendradi, Esti; Wafiroh, Siti; Harsini, Muji; Darmokoesoemo, Handoko

    2016-03-01

    The aim of research is determining the effect of glycerol and sorbitol toward the disintegration time of phyto-capsules, originated capsules from plant polysaccharides. Phyto-capsules were made from polysaccharides and 0.5% (v/v) of glycerol and sorbitol of each. The seven capsules of each were determined the disintegration time using Erweka disintegrator. The mean of disintegration time of phyto-capsules without plasticizers, with glycerol and sorbitol were 25'30"; 45'15" and 35'30" respectively. The color and colorless gelatin capsules showed the mean of disintegration time 7'30" and 2'35" respectively.

  20. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  1. Alternate economical starchy substrates for the production of 70% sorbitol

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyay, C.M. (Sarabhai Research Centre, Baroda (India). Industrial Enzymes Dept.); Nehete, P.N. (Sarabhai Research Centre, Baroda (India). Industrial Fermentation Div.); Shah, D.N. (GSFC Research and Development Centre, Fertilizernagar (India). Biotechnology Dept.); Shah, N.K. (Armour Chemicals Pvt. Ltd., Ankleshwar (India)); Shankar, V. (National Chemical Lab., Pune (India). Biochemistry Div.); Kothari, R.M. (Thapar Corporate Research and Development Centre, Patiala (India). Biotechnology Div.)

    1991-03-01

    In view of the soaring prices of corn and tapioca starch, use of their hydrolysate in the production of 70% sorbitol became less remunerative. Therefore, an economical alternative is explored by using hydrolysates of cereal flours, namely, rice (Oryzae sativa), wheat (Triticum aestivum), jowar (Sorghum vulgare) and bajra (Pennisetum typhoideum). A protocol is devised to (a) prepare their high DE hydrolysates, (b) purify it after saccharification, (c) monitor the chemical chracteristics of concentrated hydrolysate, as feedstock for Raney nickel catalyzed pressure hydrogenation and (d) finally prepare 70% sorbital. Merits and demerits of hydrolysates of these cereal flours are discussed in terms of operational limitations and percentage recovery, the governing factors for their industrial acceptability. Rice flour hydrolysate appears to be an alternative substrate, operationally and economically. (orig.).

  2. Theoretical investigation of interaction of sorbitol molecules with alcohol dehydrogenase in aqueous solution using molecular dynamics simulation.

    Science.gov (United States)

    Bahrami, Homayoon; Zahedi, Mansour; Moosavi-Movahedi, Ali Akbar; Azizian, Homa; Amanlou, Massoud

    2011-03-01

    The nature of protein-sorbitol-water interaction in solution at the molecular level, has been investigated using molecular dynamics simulations. In order to do this task, two molecular dynamics simulations of the protein ADH in solution at room temperature have been carried out, one in the presence (about 0.9 M) and another in the absence of sorbitol. The results show that the sorbitol molecules cluster and move toward the protein, and form hydrogen bonds with protein. Also, coating by sorbitol reduces the conformational fluctuations of the protein compared to the sorbitol-free system. Thus, it is concluded that at moderate concentration of sorbitol solution, sorbitol molecules interact with ADH via many H-bonds that prevent the protein folding. In fact, at more concentrated sorbitol solution, water and sorbitol molecules accumulate around the protein surface and form a continuous space-filling network to reduce the protein flexibility. Namely, in such solution, sorbitol molecules can stabilize a misfolded state of ADH, and prevent the protein from folding to its native structure.

  3. Effect of sugar alcohol sorbitol on in vitro shoot development of Dianthus serotinus Waldst. et Kit.

    Directory of Open Access Journals (Sweden)

    Marković Marija

    2014-01-01

    Full Text Available The aim of this study was to investigate the effect of different concentrations of sorbitol on the development of the in vitro culture of D. serotinus in the multiplication phase. The obtained results showed that sorbitol generally had a positive effect, depending on its concentration and explant type. In addition, the presence of sorbitol affected the change of pH value of the media after autoclaving and after 25 days of in vitro culture, which could affect the availability of certain ions to plants. Therefore, the obtained results indicate that sorbitol can be used as an energy source for the in vitro culture of D. serotinus, but this should be further investigated. [Projekat Ministarstva nauke Republike Srbije, br. 43007

  4. Effect of sorbitol in callus induction and plant regeneration in wheat

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-01

    Dec 1, 2009 ... Key words: Callus induction, plant regeneration, wheat, 2,4-D, sorbitol. INTRODUCTION ... regeneration is better on hormone-free medium or that .... AB (interaction). 15 ... element and creates osmotic stress as reported by.

  5. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  6. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  7. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  8. Reagentless D-sorbitol biosensor based on D-sorbitol dehydrogenase immobilized in a sol-gel carbon nanotubes-poly(methylene green) composite.

    Science.gov (United States)

    Wang, Zhijie; Etienne, Mathieu; Urbanova, Veronika; Kohring, Gert-Wieland; Walcarius, Alain

    2013-04-01

    A reagentless D-sorbitol biosensor based on NAD-dependent D-sorbitol dehydrogenase (DSDH) immobilized in a sol-gel carbon nanotubes-poly(methylene green) composite has been developed. It was prepared by durably immobilizing the NAD(+) cofactor with DSDH in a sol-gel thin film on the surface of carbon nanotubes functionalized with poly(methylene green). This device enables selective determination of D-sorbitol at 0.2 V with a sensitivity of 8.7 μA mmol(-1) L cm(-2) and a detection limit of 0.11 mmol L(-1). Moreover, this biosensor has excellent operational stability upon continuous use in hydrodynamic conditions.

  9. Thin layer chromatography of glucose and sorbitol on Cu(II)-impregnated silica gel plates

    Energy Technology Data Exchange (ETDEWEB)

    Hadzija, O. (Ruder Boskovic Inst., Zagreb (Croatia)); Spoljar, B. (Ruder Boskovic Inst., Zagreb (Croatia)); Sesartic, L. (Inst. of Immunology, Zagreb (Croatia))

    1994-04-01

    A thin-layer chromatographic (TLC) separation of glucose and sorbitol on CU(II)-impregnated silica gel plates with n-propanol: Water (4:1) v/v as developer and potassium permanganate as detecting reagent has been worked out. The new impregnant is completely insoluble in water and thus enables the use of an aqueous developer. The R[sub f]-values are 55 and 10 for glucose and sorbitol, respectively. (orig.)

  10. Improved cryopreservability of stallion sperm using a sorbitol-based freezing extender.

    Science.gov (United States)

    Pojprasath, T; Lohachit, C; Techakumphu, M; Stout, T; Tharasanit, T

    2011-06-01

    Cryopreservation of stallion semen is often associated with poor post-thaw sperm quality. Sugars are among the important components of a freezing extender and act as non-permeating cryoprotectants. This study aimed to compare the quality of stallion sperm frozen with glucose, fructose or sorbitol-containing freezing extenders. Semen was collected from six stallions of proven fertility and cryopreserved using a freezing extender containing different types of monosaccharide sugars (glucose, fructose or sorbitol). After thawing, the semen was examined for sperm motility, viability, acrosome integrity, plasma membrane functionality and sperm longevity. The fertility of semen frozen in the presence of sorbitol was also tested by artificial insemination. Sperm quality was significantly decreased following freezing and thawing (P sorbitol and glucose (P sorbitol-based extender when examined at 2 and 4 h post-thaw, all of these parameters plus plasma membrane functionality were improved for sperm frozen in the sorbitol extender than in the glucose extender when examined 10 min post-thaw. Two of four mares (50%) inseminated with semen frozen with a sorbitol-containing freezing extender became pregnant. It is concluded that different sugars have different abilities to protect against cryoinjury during freezing and thawing of stallion sperm. This study demonstrated that an extender containing sorbitol as primary sugar can be used to successfully cryopreserve equine sperm; moreover, the quality of frozen-thawed sperm appeared to be better than when glucose or fructose was the principle sugar in the freezing extender. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Translocation of sorbitol and other photosynthates in golden delicious apple shoots

    International Nuclear Information System (INIS)

    Steenkamp, J.; Terblanche, J.H.; De Villiers, O.T.

    1982-01-01

    This study was undertaken to determine to what extent sorbitol and other photosynthates are translocated in Golden Delicious apple shoots. The distribution of radioactivity in the different fractions, after the leaves had been exposed to radiocarbon, was found in segment of the shoots directly below the treatment leaves. The highest 14 C activity was in the carbohydrate fraction. The results indicate that sorbitol is the principal carbohydrate transported in Golden Delicious apple shoots

  12. Sorbitol treatment extends lifespan and induces the osmotic stress response in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Devon eChandler-Brown

    2015-10-01

    Full Text Available The response to osmotic stress is a highly conserved process for adapting to changing environmental conditions. Prior studies have shown that hyperosmolarity by addition of sorbitol to the growth medium is sufficient to increase both chronological and replicative lifespan in the budding yeast, Saccharomyces cerevisiae. Here we report a similar phenomenon in the nematode Caenorhabditis elegans. Addition of sorbitol to the nematode growth medium induces an adaptive osmotic response and increases C. elegans lifespan by about 35%. Lifespan extension from 5% sorbitol behaves similarly to dietary restriction in a variety of genetic backgrounds, increasing lifespan additively with mutation of daf-2(e1370 and independently of daf-16(mu86, sir-2.1(ok434, aak-2(ok524, and hif-1(ia04. Dietary restriction by bacterial deprivation or mutation of eat-2(ad1113 fails to further extend lifespan in the presence of 5% sorbitol. Two mutants with constitutive activation of the osmotic response, osm-5(p813 and osm-7(n1515, were found to be long-lived, and lifespan extension from sorbitol required the glycerol biosynthetic enzymes GPDH-1 and GPDH-2. Taken together, these observations demonstrate that exposure to sorbitol at levels sufficient to induce an adaptive osmotic response extends lifespan in worms and define the osmotic stress response pathway as a longevity pathway conserved between yeast and nematodes.

  13. Comparison of the effect of sorbitol and glucose on calcium absorption in postmenopausal women

    International Nuclear Information System (INIS)

    Francis, R.M.; Peacock, M.; Barkworth, S.A.; Marshall, D.H.

    1986-01-01

    It has been suggested that the oral administration of sorbitol promotes calcium absorption, while glucose has no effect. We have therefore compared the effect of oral sorbitol and glucose on the absorption of radiocalcium from low and high carrier loads in healthy postmenopausal women. In a control group of 20 women given neither sorbitol nor glucose, the mean +/- SEM fractional radiocalcium absorption rate from a low carrier load was 0.65 +/- 0.05 (fraction of dose/h). In a second group of 10 women the fractional absorption rate from the low carrier load was lower (p less than 0.05) with 10 g sorbitol (0.48 +/- 0.05) than with 10 g glucose (0.65 +/- 0.08). Fractional absorption of radiocalcium from a high carrier load measured in a third group of seven women using two isotopes (oral 45Ca, IV 47Ca) was also lower (p less than 0.001) with 10 g sorbitol (0.22 +/- 0.01, fraction/3 h) than with 10 g glucose (0.29 +/- 0.02). The results suggest that calcium absorption from a low carrier load is unaltered by glucose but that absorption of calcium from both low and high carrier loads is lower with sorbitol than with glucose

  14. Effect of Guar Gum with Sorbitol Coating on the Properties and Oil Absorption of French Fries.

    Science.gov (United States)

    Jia, Bo; Fan, Daming; Li, Jinwei; Duan, Zhenhua; Fan, Liuping

    2017-12-13

    This paper investigated the effects of guar gum with sorbitol coating on the oil absorption of French fries by combined dye oil methods, confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM). The results showed that pretreatment of blanching with calcium ions and coating with guar gum and sorbitol could significantly reduce the structural oil (STO) and penetrated surface oil (PSO) of French fries and have no negative effects on its texture and also effectively control the final moisture content ( p French fries with guar gum and sorbitol reduced by 50.8%, 33.1% and 30.6%, respectively. CLSM photographs confirmed that STO significantly reduced after coating with guar gum and sorbitol, followed by PSO. In the process of frying, the coatings of guar gum or guar gum with sorbitol could effectively prevent oil from infiltrating the potato tissue, which can be seen in the SEM photographs. The barrier properties of French fries were enhanced by coating guar gum, and sorbitol was added to avoid pores and cracks. Blanching with calcium ion can significantly reduce the final moisture content of coating French fries.

  15. Peranan sorbitol dalam mempertahankan kestabilan pH saliva pada proses pencegahan karies (The role of sorbitol in maintaining saliva’s pH to prevent caries process

    Directory of Open Access Journals (Sweden)

    Diana Soesilo

    2006-03-01

    Full Text Available People in Indonesia often consume food containing sucrose. If the sucrose consumed is in a large amount, it will decrease saliva’s pH and soon teeth destruction will happen. To avoid it, it is necessary to change sucrose consumption habit into another kind of sugar, namely sorbitol. Sorbitol is preferred to use, because it is cheaper and easier to get. Sorbitol is made from cassava, which is plentifully grown in Indonesia. Sorbitol is not good media for bacteria to grow. Because sorbitol has a diol, so it’s difficult to catalyst by glucosyltransferase enzyme, which is produced by bacteria Streptococcus mutans. The conclusion is that sorbitol is difficult to be fermented by Streptococcus mutans so it will not decrease saliva’s pH.

  16. An exploratory study; the therapeutic effects of premixed activated charcoal-sorbitol administration in patients poisoned with organophosphate pesticide.

    Science.gov (United States)

    Moon, Jeongmi; Chun, Byeongjo; Song, Kyounghwan

    2015-02-01

    The effects of activated charcoal (AC) mixed with cathartics for gastric decontamination in the management of organophosphate (OP) poisoning remain unknown due to limited clinical evidence. This exploratory study assessed the effectiveness of premixed AC-sorbitol as a treatment for OP poisoning. This retrospective observational case study included patients who either did not receive AC-sorbitol or received a single dose of AC-sorbitol within 24 h after OP ingestion. The patients were divided into three groups: no AC-sorbitol treatment, patients who received AC-sorbitol within 1 h of OP ingestion, and patients who received AC-sorbitol more than 1 h after OP ingestion. Mortality, the development of respiratory failure, and the duration of mechanical ventilation were used as outcome measurements for effectiveness, whereas aspiration pneumonia and electrolyte imbalance were employed as safety measurements. Among 262 patients with OP poisoning, 198 were included. Of these, 133 patients did not receive AC-sorbitol, whereas 14 and 51 patients received AC-sorbitol within 1 h or more than 1 h after ingestion, respectively. The time from ingestion to hospital arrival and time from ingestion to administration of atropine and pralidoxime differed among the groups, whereas other characteristics, including age, amount ingested, and type of ingested OP, were similar among the groups. Univariate and multivariate analysis demonstrated that the administration of AC-sorbitol was not associated with outcome measures for effectiveness and did not significantly increase either aspiration pneumonia or electrolyte imbalances during hospitalization. The administration of AC-sorbitol exerted neither beneficial nor harmful effects on the outcomes of OP-poisoned patients regardless of the time from OP ingestion to administration, compared with those of patients who did not receive AC-sorbitol. However, this study enrolled a small number of patients who received AC-sorbitol; further qualified

  17. A fiber-optic sorbitol biosensor based on NADH fluorescence detection toward rapid diagnosis of diabetic complications.

    Science.gov (United States)

    Gessei, Tomoko; Arakawa, Takahiro; Kudo, Hiroyuki; Mitsubayashi, Kohji

    2015-09-21

    Accumulation of sorbitol in the tissue is known to cause microvascular diabetic complications. In this paper, a fiber-optic biosensor for sorbitol which is used as a biomarker of diabetic complications was developed and tested. The biosensor used a sorbitol dehydrogenase from microorganisms of the genus Flavimonas with high substrate specificity and detected the fluorescence of reduced nicotinamide adenine dinucleotide (NADH) by the enzymatic reaction. An ultraviolet light emitting diode (UV-LED) was used as the excitation light source of NADH. The fluorescence of NADH was detected using a spectrometer or a photomultiplier tube (PMT). The UV-LED and the photodetector were coupled using a Y-shaped optical fiber. In the experiment, an optical fiber probe with a sorbitol dehydrogenase immobilized membrane was placed in a cuvette filled with a phosphate buffer containing the oxidized form of nicotinamide adenine dinucleotide (NAD(+)). The changes in NADH fluorescence intensity were measured after adding a standard sorbitol solution. According to the experimental assessment, the calibration range of the sorbitol biosensor systems using a spectrometer and a PMT was 5.0-1000 μmol L(-1) and 1.0-1000 μmol L(-1), respectively. The sorbitol biosensor system using the sorbitol dehydrogenase from microorganisms of the genus Flavimonas has high selectivity and sensitivity compared with that from sheep liver. The sorbitol biosensor allows for point-of-care testing applications or daily health care tests for diabetes patients.

  18. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  19. Increased sorbitol levels in the hypertrophic ligamentum flavum of diabetic patients with lumbar spinal canal stenosis.

    Science.gov (United States)

    Luo, Jiaquan; Huang, Lu; Chen, Zhuo; Zeng, Zhaoxun; Miyamoto, Takeshi; Wu, Hao; Zhang, Zhongzu; Pan, Zhimin; Fujita, Nobuyuki; Hikata, Tomohiro; Iwanami, Akio; Tsuji, Takashi; Ishii, Ken; Nakamura, Masaya; Matsumoto, Morio; Watanabe, Kota; Cao, Kai

    2017-05-01

    The pathomechanism of the ligamentum flavum (LF) hypertrophy in diabetic patients with lumbar spinal canal stenosis (LSCS) remains unclear. A cross-sectional study was undertaken to investigate the mechanism of LF hypertrophy in these patients. Twenty-four diabetic and 20 normoglycemic patients with LSCS were enrolled in the study. The structure of the LF in the study subjects was evaluated using histological and immunohistochemical methods, and the levels of sorbitol, pro-inflammatory cytokines, and the fibrogenic factor, TGF-β1, in the LF were analyzed. In vitro experiments were performed using NIH3T3 fibroblasts to evaluate the effect of high-glucose conditions and an aldose reductase inhibitor on the cellular production of sorbitol, pro-inflammatory factors, and TGF-β1. We found that the LF of diabetic patients exhibited significantly higher levels of sorbitol and pro-inflammatory cytokines, TGF-β1 and of CD68-positive staining than that of the normoglycemic subjects. The diabetic LF was significantly thicker than that of the controls, and showed evidence of degeneration. The high glucose-cultured fibroblasts exhibited significantly higher levels of sorbitol, pro-inflammatory factors, and TGF-β1 compared to the low glucose-cultured cells, and these levels were dose-dependently reduced by treatment with the aldose reductase inhibitor. Taken together, our data suggests that increased sorbitol levels in the LF of diabetic patients results in increased production of pro-inflammatory and fibrogenic factor, which contribute to LF hypertrophy, and could increase the susceptibility of diabetic patients to LSCS. Furthermore, aldose reductase inhibition effectively reduced the levels of sorbitol and sorbitol-induced pro-inflammatory factor expression in high glucose-cultured fibroblasts. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1058-1066, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  20. Synthesis of sorbitol by Zymomonas mobilis under high osmotic pressure Síntese de sorbitol por Zymomonas mobilis sob elevada pressão osmótica

    Directory of Open Access Journals (Sweden)

    Márcio de Barros

    2006-09-01

    Full Text Available The bacterium Zymomonas mobilis presents potential for sorbitol production when grown in culture medium with high sugar concentration. Sorbitol is produced and accumulated in the periplasma of the bacterium to protect the cells from the harmful effects of high osmotic pressure that results from the action of invertase on sucrose. The conversion of sucrose into glucose and fructose increases the osmolarity of the medium. However, an excessive increase in the osmotic pressure may decrease the sorbitol production. In this work Saccharomyces cerevisiae invertase was added two media containing sucrose 200 and 300 g.L-1. Sorbitol production in sucrose at 200 g.L-1 was 42.35 and 38.42 g.L-1, with and without the invertase treatment, respectively. In the culture medium with 300 g.L-1 sucrose, production reached 60.4 g.L-1 and with invertase treatment was 19.14 g.L-1. These results indicated that the excessive rise in osmotic pressure led to a significant decrease in sorbitol production by the Zymomonas mobilis bacterium in the sucrose medium treated with invertase.A bactéria Zymomonas mobilis, apresenta potencial para produção de sorbitol quando crescida em meio com alta concentração de açúcar. O sorbitol produzido é acumulado no periplasma da bactéria para conter os efeitos prejudiciais da elevada pressão osmótica, que resulta pela ação da enzima invertase, que promove hidrólise da sacarose. A conversão da sacarose em glicose e frutose aumentando a osmolaridade do meio. Entretanto, um aumento excessivo na pressão osmótica pode inibir a produção de sorbitol pela bactéria. Este trabalho empregou invertase de Saccharomyces cerevisiae nos meios de fermentação com sacarose a 200 e 300 g.L-1. A produção de sorbitol no meio com sacarose a 200 g.L-1 foi de 42,35 g.L-1 e 38,42 g.L-1 com e sem tratamento com invertase respectivamente. No meio com 300 g.L-1 sem tratamento, a produção foi de 60,42 e com tratamento 19,14 g.L-1. Estes

  1. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  2. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  3. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  4. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  5. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  7. Molecular evidence of sorbitol dehydrogenase in tomato, a non-Rosaceae plant.

    Science.gov (United States)

    Ohta, Kazuhiro; Moriguchi, Ryo; Kanahama, Koki; Yamaki, Shohei; Kanayama, Yoshinori

    2005-12-01

    The enzyme NAD-dependent sorbitol dehydrogenase (SDH) is well characterized in the Rosaceae family of fruit trees, which synthesizes sorbitol as a translocatable photosynthate. Expressed sequence tags of SDH-like sequences have also been generated from various non-Rosaceae species that do not synthesize sorbitol as a primary photosynthetic product, but the physiological roles of the encoded proteins in non-Rosaceae plants are unknown. Therefore, we isolated an SDH-like cDNA (SDL) from tomato (Lycopersicon esculentum Mill.). Genomic Southern blot analysis suggested that SDL exists in the tomato genome as a single-copy gene. Northern blot analysis showed that SDL is ubiquitously expressed in tomato plants. Recombinant SDL protein was produced and purified for enzymatic characterization. SDL catalyzed the interconversion of sorbitol and fructose with NAD (H). SDL showed highest activity for sorbitol among the several substrates tested. SDL showed no activity with NADP+. Thus, SDL was identified as a SDH, although the Km values and substrate specificity of SDL were significantly different from those of SDH purified from the Japanese pear (Pyrus pyrifolia), a Rosaceae fruit tree. In addition, tomato was transformed with antisense SDL to evaluate the contribution of SDL to SDH activity in tomato. The transformation decreased SDH activity to approximately 50% on average. Taken together, these results provide molecular evidence of SDH in tomato, and SDL was renamed LeSDH.

  8. Cellulase and Xylanase Production by Penicillium echinulatum in Submerged Media Containing Cellulose Amended with Sorbitol

    Directory of Open Access Journals (Sweden)

    Carla Eliana Todero Ritter

    2013-01-01

    Full Text Available The present work investigated the use of sorbitol as a soluble carbon source, in association with cellulose, to produce cellulases and xylanases in submerged cultures of Penicillium echinulatum 9A02S1. Because cellulose is an insoluble carbon source, in cellulase production, there are some problems with rheology and oxygen transfer. The submerged fermentations containing media composed of 0, 0.25, 0.5, 0.75, and 1% (w/v sorbitol and cellulose that were added at different times during the cultivation; 0.2% (w/v soy bran; 0.1% (w/v wheat bran; and a solution of salts. The highest filter paper activity (FPA ( IU·mL−1 was obtained on the seventh day in the medium containing 0.5% (w/v sorbitol and 0.5% (w/v cellulose added 24 h after the start of cultivation. However, the CMCases showed an activity peak on the sixth day ( IU·mL−1 in the medium containing 0.75% (w/v sorbitol and 0.75% (w/v cellulose added after 12 h of cultivation. The xylanases showed the highest activity in the medium with 0.75% (w/v sorbitol and 0.25% (w/v cellulose added 36 h after the start of cultivation. This strategy enables the reduction of the cellulose concentration, which in high concentrations can cause rheological and oxygen transfer problems.

  9. Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

    Science.gov (United States)

    Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

    2013-01-01

    Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

  10. Biosynthesis of sorbitol and other compounds in Golden Delicious apple leaves

    International Nuclear Information System (INIS)

    Steenkamp, J.; Terblanche, J.H.; De Villiers, O.T.

    1981-01-01

    The distribution of radioactivity in the principal alcohol-soluble fractions of Golden Delicious apple leaves after exposure to 14 CO 2 for periods from 5 s to 60 min showed that the main products of photosynthesis were located in the phosphorylated and sugar fractions. Although the phosphorylated fraction consistently contained the highest radioactivity, no attempt was made to separate and identify the different compounds. As the percentage activity in the sugar (and sorbitol) and phosphorylated fractions increased with time, that in the organic acid and amino acid fractions decreased. Since the sugar and sorbitol fraction contained 45% of the total radioactivity after 60 min exposure to 14 CO 2 , and since sorbitol contained 82% of the radioactivity in this fraction, it appears that sorbitol is the principal non-phosphorylated end-product of photosynthesis in Golden Delicious apple leaves. Similar results were obtained with plum and apricot leaves. Since after only 60 s of photosynthesis sorbitol contained the highest radioactivity, it is apparent that the formation of this compound is very rapid, plays a role in the metabolism of Golden Delicious apple leaves, and that it is probably associated with the chloroplasts, as was found for plum leaves. The fact that amino acids and other organic acids also contained an appreciable amount of radioactivity (especially after short periods of photosynthesis) indicates a close relationship between these compounds and the primary products of photosynthesis

  11. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  12. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  13. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  14. X-ray crystal structure and small-angle X-ray scattering of sheep liver sorbitol dehydrogenase

    DEFF Research Database (Denmark)

    Yennawar, Hemant; Møller, Magda; Gillilan, Richard

    2011-01-01

    The X-ray crystal structure of sheep liver sorbitol dehydrogenase (slSDH) has been determined using the crystal structure of human sorbitol dehydrogenase (hSDH) as a molecular-replacement model. slSDH crystallized in space group I222 with one monomer in the asymmetric unit. A conserved tetramer...

  15. Effect of sorbitol and glycerol on the stability of trypsin and difference between their stabilization effects in the various solvents.

    Science.gov (United States)

    Pazhang, Mohammad; Mehrnejad, Faramarz; Pazhang, Yaghub; Falahati, Hanieh; Chaparzadeh, Nader

    2016-01-01

    The effect of glycerol and sorbitol on the stability of porcine pancreas trypsin was investigated in this work. Molecular dynamics simulation and thermostability results showed that trypsin has two flexible regions, and polyols (sorbitol and glycerol) stabilize the enzyme by decreasing the flexibility of these regions. Radial distribution function results exhibited that sorbitol and glycerol were excluded from the first water layer of the enzyme, therefore decrease the flexibility of the regions by preferential exclusion. Also, results showed that the stabilization effect of sorbitol is more than glycerol. This observation could be because of the larger decrease in the fluctuations of trypsin in the presence of sorbitol. We also examined the role of solvent's hydrophobicity in enzyme stabilization by sorbitol and glycerol. To do so, the thermostability of trypsin was evaluated in the presence of solvents with different hydrophobicity (methanol, ethanol, isopropanol and n-propanol) in addition to the polyols. Our results depicted that glycerol is a better stabilizer than sorbitol in the presence of hydrophobic solvents (n-propanol), whereas sorbitol is a better stabilizer than glycerol in the presence of hydrophilic solvents (methanol). © 2015 International Union of Biochemistry and Molecular Biology, Inc.

  16. Modulation of δ-Aminolevulinic Acid Dehydratase Activity by the Sorbitol-Induced Osmotic Stress in Maize Leaf Segments.

    Science.gov (United States)

    Jain, M; Tiwary, S; Gadre, R

    2018-01-01

    Osmotic stress induced with 1 M sorbitol inhibited δ-aminolevulinic acid dehydratase (ALAD) and aminolevulinic acid (ALA) synthesizing activities in etiolated maize leaf segments during greening; the ALAD activity was inhibited to a greater extent than the ALA synthesis. When the leaves were exposed to light, the ALAD activity increased for the first 8 h, followed by a decrease observed at 16 and 24 h in both sorbitol-treated and untreated leaf tissues. The maximum inhibition of the enzyme activity was observed in the leaf segments incubated with sorbitol for 4 to 8 h. Glutamate increased the ALAD activity in the in vitro enzymatic preparations obtained from the sorbitol-treated leaf segments; sorbitol inhibited the ALAD activity in the preparations from both sorbitol-treated and untreated leaves. It was suggested that sorbitol-induced osmotic stress inhibits the enzyme activity by affecting the ALAD induction during greening and regulating the ALAD steady-state level of ALAD in leaf cells. The protective effect of glutamate on ALAD in the preparations from the sorbitol-treated leaves might be due to its stimulatory effect on the enzyme.

  17. Granule fraction inhomogeneity of calcium carbonate/sorbitol in roller compacted granules

    DEFF Research Database (Denmark)

    Bacher, Charlotte; Olsen, P.M.; Bertelsen, P.

    2008-01-01

    The granule fraction inhomogeneity of roller compacted granules was examined on mixtures of three different morphologic forms of calcium carbonate and three particle sizes of sorbitol. The granule fraction inhomogeneity was determined by the distribution of the calcium carbonate in each of the 10...... size fractions between 0 and 2000 µm and by calculating the demixing potential. Significant inhomogeneous occurrence of calcium carbonate in the size fractions was demonstrated, depending mostly on the particles sizes of sorbitol but also on the morphological forms of calcium carbonate......, the ability of the powder to agglomerate in the roller compactor was demonstrated to be related to the ability of the powder to be compacted into a tablet, thus the most compactable calcium carbonate and the smallest sized sorbitol improved the homogeneity by decreasing the demixing potential....

  18. Development of a promoter shutoff system in Aspergillus oryzae using a sorbitol-sensitive promoter.

    Science.gov (United States)

    Oda, Ken; Terado, Shiho; Toyoura, Rieko; Fukuda, Hisashi; Kawauchi, Moriyuki; Iwashita, Kazuhiro

    2016-09-01

    Promoter shutoff is a general method for analyzing essential genes, but in the fungus Aspergillus oryzae, no tightly repressed promoters have been reported. To overcome the current limitations of conditional promoters, we examined sorbitol- and galactose-responsive genes using microarrays to identify regulatable genes with only minor physiological and genetic effects. We identified two sorbitol-induced genes (designated as sorA and sorB), cloned their promoters, and built a regulated egfp and brlA expression system. Growth medium-dependent enhanced green fluorescence protein (EGFP) fluorescence and conidiation were confirmed for egfp and brlA under the control of their respective promoters. We also used this shutoff system to regulate the essential rhoA, which demonstrated the expected growth inhibition under repressed growth conditions. Our new sorbitol promoter shutoff system developed can serve as a valuable new tool for essential gene analyses of filamentous fungi.

  19. Isohexide and Sorbitol-Derived, Enzymatically Synthesized Renewable Polyesters with Enhanced Tg.

    Science.gov (United States)

    Gustini, Liliana; Lavilla, Cristina; de Ilarduya, Antxon Martínez; Muñoz-Guerra, Sebastián; Koning, Cor E

    2016-10-10

    Sugar-based polyesters derived from sorbitol and isohexides were obtained via solvent-free enzymatic catalysis. Pendant hydroxyl groups, coming from the sorbitol units, were present along the polyester backbone, whereas the two isohexides, namely, isomannide and isoidide dimethyl ester monomers, were selected to introduce rigidity into the polyester chains. The feasibility of incorporating isomannide as a diol compared to the isoidide dimethyl ester as acyl-donor via lipase-catalyzed polycondensation was investigated. The presence of bicyclic units resulted in enhanced T g with respect to the parent sorbitol-containing polyester lacking isohexides. The different capability of the two isohexides to boost the thermal properties confirmed the more flexible character provided by the isoidide diester derivative. Solvent-borne coatings were prepared by cross-linking the sugar-based polyester polyols with polyisocyanates. The increased rigidity of the obtained sugar-based polyester polyols led to an enhancement in hardness of the resulting coatings.

  20. Physicochemical, mechanical and thermal properties of chitosan films with and without sorbitol.

    Science.gov (United States)

    Liu, Mei; Zhou, Yibin; Zhang, Yang; Yu, Chen; Cao, Shengnan

    2014-09-01

    The effect of sorbitol on the physicochemical, mechanical and thermal properties of chitosan films with different degrees of deacetylation (DD; i.e., DD85% and DD95%) was investigated. The thickness, moisture content (MC), water solubility (WS) and water-vapor permeability (WVP) of the films were evaluated. Sorbitol addition reduced MC, increased WS and significantly (psorbitol increased the strain and decreased stress for both DD films, but DD95% could sustain higher strain and DD85% could sustain higher stress. Thermogravimetrics analysis and differential scanning calorimetry showed that sorbitol elicited a lower degradation temperature for both films, and that DD95% films exhibited higher thermal stability than DD85% films. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Chromatin-associated regulation of sorbitol synthesis in flower buds of peach.

    Science.gov (United States)

    Lloret, Alba; Martínez-Fuentes, Amparo; Agustí, Manuel; Badenes, María Luisa; Ríos, Gabino

    2017-11-01

    PpeS6PDH gene is postulated to mediate sorbitol synthesis in flower buds of peach concomitantly with specific chromatin modifications. Perennial plants have evolved an adaptive mechanism involving protection of meristems within specialized structures named buds in order to survive low temperatures and water deprivation during winter. A seasonal period of dormancy further improves tolerance of buds to environmental stresses through specific mechanisms poorly known at the molecular level. We have shown that peach PpeS6PDH gene is down-regulated in flower buds after dormancy release, concomitantly with changes in the methylation level at specific lysine residues of histone H3 (H3K27 and H3K4) in the chromatin around the translation start site of the gene. PpeS6PDH encodes a NADPH-dependent sorbitol-6-phosphate dehydrogenase, the key enzyme for biosynthesis of sorbitol. Consistently, sorbitol accumulates in dormant buds showing higher PpeS6PDH expression. Moreover, PpeS6PDH gene expression is affected by cold and water deficit stress. Particularly, its expression is up-regulated by low temperature in buds and leaves, whereas desiccation treatment induces PpeS6PDH in buds and represses the gene in leaves. These data reveal the concurrent participation of chromatin modification mechanisms, transcriptional regulation of PpeS6PDH and sorbitol accumulation in flower buds of peach. In addition to its role as a major translocatable photosynthate in Rosaceae species, sorbitol is a widespread compatible solute and cryoprotectant, which suggests its participation in tolerance to environmental stresses in flower buds of peach.

  2. Comparison of 3% sorbitol vs psyllium fibre as oral contrast agents in MR enterography.

    Science.gov (United States)

    Saini, Sidharth; Colak, Errol; Anthwal, Shalini; Vlachou, Paraskevi A; Raikhlin, Antony; Kirpalani, Anish

    2014-10-01

    To compare the degree of small bowel distension achieved by 3% sorbitol, a high osmolarity solution, and a psyllium-based bulk fibre as oral contrast agents (OCAs) in MR enterography (MRE). This retrospective study was approved by our institutional review board. A total of 45 consecutive normal MRE examinations (sorbitol, n = 20; psyllium, n = 25) were reviewed. The patients received either 1.5 l of 3% sorbitol or 2 l of 1.6 g kg(-1) psyllium prior to imaging. Quantitative small bowel distension measurements were taken in five segments: proximal jejunum, distal jejunum, proximal ileum, distal ileum and terminal ileum by two independent radiologists. Distension in these five segments was also qualitatively graded from 0 (very poor) to 4 (excellent) by two additional independent radiologists. Statistical analysis comparing the groups and assessing agreement included intraclass coefficients, Student's t-test and Mann-Whitney U-test. Small bowel distension was not significantly different in any of the five small bowel segments between the use of sorbitol and psyllium as OCAs in both the qualitative (p = 0.338-0.908) and quantitative assessments (p = 0.083-0.856). The mean bowel distension achieved was 20.1 ± 2.2 mm for sorbitol and 19.8 ± 2.5 mm for psyllium (p = 0.722). Visualization of the ileum was good or excellent in 65% of the examinations in both groups. Sorbitol and psyllium are not significantly different at distending the small bowel and both may be used as OCAs for MRE studies. This is the first study to directly compare the degree of distension in MRE between these two common, readily available and inexpensive OCAs.

  3. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  4. Structure-property relation in HPMC polymer films plasticized with Sorbitol

    Science.gov (United States)

    Prakash, Y.; Somashekarappa, H.; Mahadevaiah, Somashekar, R.

    2013-06-01

    A correlation study on physical and mechanical properties of Hydroxy propyl-methylcellulose (HPMC) polymer films plasticized with different weight ratio of Sorbitol, prepared using solution casting method, was carried out using wide angle X-ray technique and universal testing machine. It is found that the crystallanity decreases as the concentration of Sorbitol increases up to a certain concentration and there afterwards increases. Measured Physical Properties like tensile strength decreases and elongation (%) increases indicating increase in the flexibility of the films. These observations confirm the correlation between microstructal parameters and mechanical properties of films. These films are suitable for packaging food products.

  5. A physicochemical study of sugar palm (Arenga Pinnata) starch films plasticized by glycerol and sorbitol

    Science.gov (United States)

    Poeloengasih, Crescentiana D.; Pranoto, Yudi; Hayati, Septi Nur; Hernawan, Rosyida, Vita T.; Prasetyo, Dwi J.; Jatmiko, Tri H.; Apriyana, Wuri; Suwanto, Andri

    2016-02-01

    The present work explores the physicochemical characteristics of sugar palm starch film for a potential hard capsule purpose. Sugar palm (Arenga pinnata) starch films were plasticized with glycerol or sorbitol in various concentrations (30% up to 50% w/w starch). Their effects on physicochemical properties of the films were investigated. The results showed that sugar palm starch was successfully developed as the main material of film using casting method. Incorporation of both glycerol or sorbitol affected the properties of films in different ways. It was found that thickness and solubility increased as plasticizer concentration increased, whereas retraction ratio, swelling degree and swelling thickness decreased with the increased plasticizer concentration.

  6. Sorbitol-modified hyaluronic acid reduces oxidative stress, apoptosis and mediators of inflammation and catabolism in human osteoarthritic chondrocytes.

    Science.gov (United States)

    Mongkhon, John-Max; Thach, Maryane; Shi, Qin; Fernandes, Julio C; Fahmi, Hassan; Benderdour, Mohamed

    2014-08-01

    Our study was designed to elucidate the precise molecular mechanisms by which sorbitol-modified hyaluronic acid (HA/sorbitol) exerts beneficial effects in osteoarthritis (OA). Human OA chondrocytes were treated with increasing doses of HA/sorbitol ± anti-CD44 antibody or with sorbitol alone and thereafter with or without interleukin-1beta (IL-1β) or hydrogen peroxide (H2O2). Signal transduction pathways and parameters related to oxidative stress, apoptosis, inflammation, and catabolism were investigated. HA/sorbitol prevented IL-1β-induced oxidative stress, as measured by reactive oxygen species, p47-NADPH oxidase phosphorylation, 4-hydroxynonenal (HNE) production and HNE-metabolizing glutathione-S-transferase A4-4 expression. Moreover, HA/sorbitol stifled IL-1β-induced metalloproteinase-13, nitric oxide (NO) and prostaglandin E2 release as well as inducible NO synthase expression. Study of the apoptosis process revealed that this gel significantly attenuated cell death, caspase-3 activation and DNA fragmentation elicited by exposure to a cytotoxic H2O2 dose. Examination of signaling pathway components disclosed that HA/sorbitol prevented IL-1β-induced p38 mitogen-activated protein kinase and nuclear factor-kappa B activation, but not that of extracellular signal-regulated kinases 1 and 2. Interestingly, the antioxidant as well as the anti-inflammatory and anti-catabolic effects of HA/sorbitol were attributed to sorbitol and HA, respectively. Altogether, our findings support a beneficial effect of HA/sorbitol in OA through the restoration of redox status and reduction of apoptosis, inflammation and catabolism involved in cartilage damage.

  7. Cloning, Expression, and Characterization of Sorbitol Transporters from Developing Sour Cherry Fruit and Leaf Sink Tissues1

    Science.gov (United States)

    Gao, Zhifang; Maurousset, Laurence; Lemoine, Remi; Yoo, Sang-Dong; van Nocker, Steven; Loescher, Wayne

    2003-01-01

    The acyclic polyol sorbitol is a primary photosynthetic product and the principal photosynthetic transport substance in many economically important members of the family Rosaceace (e.g. almond [Prunus dulcis (P. Mill.) D.A. Webber], apple [Malus pumila P. Mill.], cherry [Prunus spp.], peach [Prunus persica L. Batsch], and pear [Pyrus communis]). To understand key steps in long-distance transport and particularly partitioning and accumulation of sorbitol in sink tissues, we have cloned two sorbitol transporter genes (PcSOT1 and PcSOT2) from sour cherry (Prunus cerasus) fruit tissues that accumulate large quantities of sorbitol. Sorbitol uptake activities and other characteristics were measured by heterologous expression of PcSOT1 and PcSOT2 in yeast (Saccharomyces cerevisiae). Both genes encode proton-dependent, sorbitol-specific transporters with similar affinities (Km sorbitol of 0.81 mm for PcSOT1 and 0.64 mm for PcSOT2). Analyses of gene expression of these transporters, however, suggest different roles during leaf and fruit development. PcSOT1 is expressed throughout fruit development, but especially when growth and sorbitol accumulation rates are highest. In leaves, PcSOT1 expression is highest in young, expanding tissues, but substantially less in mature leaves. In contrast, PcSOT2 is mainly expressed only early in fruit development and not in leaves. Compositional analyses suggest that transport mediated by PcSOT1 and PcSOT2 plays a major role in sorbitol and dry matter accumulation in sour cherry fruits. Presence of these transporters and the high fruit sorbitol concentrations suggest that there is an apoplastic step during phloem unloading and accumulation in these sink tissues. Expression of PcSOT1 in young leaves before completion of the transition from sink to source is further evidence for a role in determining sink activity. PMID:12692316

  8. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  9. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  10. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  11. Follow-up of coeliac disease with the novel one-hour 13C-sorbitol breath test versus the H2-sorbitol breath test.

    Science.gov (United States)

    Tveito, Kari; Hetta, Anne Kristine; Askedal, Mia; Brunborg, Cathrine; Sandvik, Leiv; Løberg, Else Marit; Skar, Viggo

    2011-07-01

    We recently developed a (13)C-sorbitol breath test ((13)C-SBT) as an alternative to the H(2)-sorbitol breath test (H(2)-SBT) for coeliac disease. In this study we compared the diagnostic properties of the H(2)-SBT and the (13)C-SBT in follow-up of coeliac disease. Twenty-seven coeliac patients on a gluten-free diet (GFD) performed the breath tests. All had been tested before treatment in the initial study of the (13)C-SBT, in which 39 untreated coeliac patients, 40 patient controls, and 26 healthy volunteers participated. Five gram sorbitol and 100 mg (13)C-sorbitol were dissolved in 250 ml tap water and given orally. H(2), CH(4) and (13)CO(2) were measured in end-expiratory breath samples every 30 min for 4 h. Increased H(2) concentration ≥20 ppm from basal values was used as cut-off for the H(2)-SBT. Sixty minutes values were used as diagnostic index in the (13)C-SBT. (13)CO(2) levels at 60 min increased in 20/26 treated coeliac patients (77%) after GFD, but were significantly lower than in control groups. Out of 20 patients who had a positive H(2)-SBT before GFD, 12 had a negative H(2)-SBT after GFD. Peak H(2) concentrations were not correlated with (13)C-SBT results. The study confirms the sensitivity of a one-hour (13)C-SBT for small intestinal malabsorption. The (13)C-SBT has superior diagnostic properties compared with the H(2)-SBT in follow-up of coeliac disease.

  12. A biopolymer-based carbon nanotube interface integrated with a redox shuttle and a D-sorbitol dehydrogenase for robust monitoring of D-sorbitol

    International Nuclear Information System (INIS)

    Sefcovicova, J.; Filip, J.; Gemeiner, P.; Bucko, M.; Magdolen, P.; Tkac, J.; Tomcik, P.

    2011-01-01

    We describe the preparation and characterization of a glassy carbon electrode modified with a bionanocomposite consisting of a hyaluronic acid, dispersed carbon nanotubes, and electrostatically bound toluidine blue. The electrode was used to detect NADH in the batch and flow-injection mode of operation. The electrode was further modified by immobilizing sorbitol dehydrogenase to result in biosensor for D-sorbitol that displays good operational stability, a sensitivity of 10.6 μA mM -1 cm -2 , a response time of 16 s, and detection limit in the low micromolar range. The biosensor was successfully applied to off-line monitoring of D-sorbitol during its bioconversion into L-sorbose (a precursor in the synthesis of vitamin C) by Gluconobacter oxydans. The sample assay precision is 2.5% (an average RSD) and the throughput is 65 h -1 if operated in the flow-injection mode. The validation of this biosensor against a reference HPLC method resulted in a slope of correlation of 1.021 ± 0.001 (R 2 = 0.99997). (author)

  13. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  14. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  15. Polyol specificity of recombinant Arabidopsis thaliana sorbitol dehydrogenase studied by enzyme kinetics and in silico modeling

    Directory of Open Access Journals (Sweden)

    María Francisca eAguayo

    2015-02-01

    Full Text Available Polyols are enzymatically-produced plant compounds which can act as compatible solutes during periods of abiotic stress. NAD+-dependent SORBITOL DEHYDROGENASE (SDH, E.C. 1.1.1.14 from Arabidopsis thaliana L. (AtSDH is capable of oxidizing several polyols including sorbitol, ribitol and xylitol. In the present study, enzymatic assays using recombinant AtSDH demonstrated a higher specificity constant for xylitol compared to sorbitol and ribitol, all of which are C2 (S and C4 (R polyols. Enzyme activity was reduced by preincubation with ethylenediaminetetraacetic acid (EDTA, indicating a requirement for zinc ions. In humans, it has been proposed that sorbitol becomes part of a pentahedric coordination sphere of the catalytic zinc during the reaction mechanism. In order to determine the validity of this pentahedric coordination model in a plant SDH, homology modeling and Molecular Dynamics simulations of AtSDH ternary complexes with the three polyols were performed using crystal structures of human and Bemisia argentifolii (Genn. (Hemiptera: Aleyrodidae SDHs as scaffolds. The results indicate that the differences in interaction with structural water molecules correlate very well with the observed enzymatic parameters, validate the proposed pentahedric coordination of the catalytic zinc ion in a plant SDH, and provide an explanation for why AtSDH shows a preference for polyols with a chirality of C2 (S and C4 (R.

  16. Advanced glycation end products and sorbitol in blood from differently compensated diabetic dogs.

    Science.gov (United States)

    Comazzi, S; Bertazzolo, W; Bonfanti, U; Spagnolo, V; Sartorelli, P

    2008-06-01

    Canine diabetes mellitus (DM) is a common metabolic disorder with long term complications, most of which are caused by glycosylation of structural proteins, decreases in antioxidant concentrations, altered osmotic balance and hypoxia due to impaired oxygen transport. Previous studies have demonstrated that under hyperglycemic conditions canine erythrocytes undergo swelling, probably due to activation of the polyol pathway. The present work aimed to assess the plasma concentration of advanced glycation end (AGE) products, stable Amadori-products generated by non-enzymatic glycosylation of proteins and the intracellular concentration of sorbitol, produced by the activation of polyol pathway in 34 blood samples from diabetic dogs and in 14 controls. AGE products were significantly higher (pdogs compared with control animals. The sorbitol concentration in erythrocytes was also significantly higher in diabetic dogs and, in particular, in poorly compensated animals and in dogs with ketonuria. In five cases that were analysed before and after clinical improvement, sorbitol concentration was found to correlate with improvement. These results suggest that non-specific glycosylation is increased and that the polyol pathway is activated in diabetic dogs in a manner that is proportionate to the severity of disease. Moreover, the concentration of AGE products and sorbitol may be useful for monitoring the onset of diabetic complications and assessing the most appropriate therapeutic approaches for management of canine DM.

  17. Carbon-coated ceramic membrane reactor for production of hydrogen via aqueous phase reforming of sorbitol

    NARCIS (Netherlands)

    Neira d'Angelo, M.F.; Ordomskiy, V.; Schouten, J.C.; Schaaf, van der J.; Nijhuis, T.A.

    2014-01-01

    Hydrogen was produced by aqueous-phase reforming (APR) of sorbitol in a carbon-on-alumina tubular membrane reactor (4 nm pore size, 7 cm long, 3 mm internal diameter) that allows the hydrogen gas to permeate to the shell side, whereas the liquid remains in the tube side. The hydrophobic nature of

  18. Simultaneous hydrolysis and hydrogenation of cellobiose to sorbitol in molten salt hydrate media

    NARCIS (Netherlands)

    Li, J.; Soares, H.S.M.P.; Moulijn, J.A.; Makkee, M.

    2013-01-01

    The hydrolysis and hydrogenation of cellobiose (4-O-b-D-glucopyranosyl-D-glucose) in ZnCl2_4H2O solvent was studied to optimize the conditions for conversion of lignocellulose (the most abundant renewable resource) into sorbitol (D-glucitol). Water at neutral pH does not allow hydrolysis of

  19. Sorbitol as an efficient reducing agent for laser-induced copper deposition

    Science.gov (United States)

    Kochemirovsky, V. A.; Logunov, L. S.; Safonov, S. V.; Tumkin, I. I.; Tver'yanovich, Yu. S.; Menchikov, L. G.

    2012-10-01

    We have pioneered in revealing the fact that sorbitol may be used as an efficient reducing agent in the process of laser-induced copper deposition from solutions; in this case, it is possible to obtain copper lines much higher quality than by using conventional formalin.

  20. Ordered Mesoporous NiCeAl Containing Catalysts for Hydrogenolysis of Sorbitol to Glycols

    Science.gov (United States)

    Zhou, Zhiwei; Zhang, Jiaqi; Qin, Juan; Li, Dong; Wu, Wenliang

    2018-03-01

    Cellulose-derived sorbitol is emerging as a feasible and renewable feedstock for the production of value-added chemicals. Highly active and stable catalyst is essential for sorbitol hydrogenolysis. Ordered mesoporous M- xNi yCeAl catalysts with different loadings of nickel and cerium species were successfully synthesized via one-pot evaporation-induced self-assembly strategy (EISA) and their catalytic performance were tested in the hydrogenolysis of sorbitol. The physical chemical properties for the catalysts were characterized by XRD, N2 physisorption, H2-TPR, H2 impulse chemisorption, ICP and TEM techniques. The results showed that the ordered mesopores with uniform pore sizes can be obtained and the Ni nanoparticles around 6 nm in size were homogeneously dispersed in the mesopore channels. A little amount of cerium species introduced would be beneficial to their textural properties resulting in higher Ni dispersion, metal area and smaller size of Ni nanoparticles. The M-10Ni2CeAl catalyst with Ni and Ce loading of 10.9 and 6.3 wt % shows better catalytic performance than other catalysts, and the yield of 1,2-PG and EG can reach 56.9% at 493 K and 6 MPa pressure for 8 h after repeating reactions for 12 times without obvious deterioration of physical and chemical properties. Ordered mesoporous M-NiCeAl catalysts are active and stable in sorbitol hydrogenolysis.

  1. Management of constipation in residents with dementia: sorbitol effectiveness and cost.

    Science.gov (United States)

    Volicer, Ladislav; Lane, Patricia; Panke, JoAnn; Lyman, Paul

    2004-01-01

    The objective of this report is to describe a cost-effective strategy for management of constipation in nursing home residents with dementia. We conducted a prospective observational quality improvement study of 41 residents with chronic constipation and receiving an osmotic laxative. Sorbitol was substituted for lactulose. The study was conducted at a dementia special care unit at a Veterans Administration hospital. We measured the number and amount of laxative use over a period of 4 weeks that were required to maintain regular bowel function. There was no difference in efficacy of lactulose and sorbitol. Use of additional laxatives was infrequent: Milk of Magnesia on approximately 10% of days/patient, bisacodyl suppository on 2% to 4% of days/patient, and Fleet enema only on 3 occasions. The cost of constipation management using routine administration of sorbitol and as-needed use of other laxatives was 27% to 55% lower than the cost of other constipation management strategies reported in the literature. Substitution of sorbitol for lactulose does not change efficacy of the treatment and decreases cost. Regular use of an osmotic laxative avoids the costs and discomforts of rectal laxatives.

  2. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  3. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  4. The relationship between sucrose hydrolysis, sorbitol formation and mineral ion concentration during bioethanol formation using Zymomonas mobilis 2716

    Energy Technology Data Exchange (ETDEWEB)

    Doelle, M.B.; Doelle, H.W. (Queensland Univ., St. Lucia (Australia). Dept. of Microbiology); Greenfield, P.F. (Queensland Univ., St. Lucia (Australia). Dept. of Chemical Engineering)

    1990-11-01

    Investigations into the relationship between sucrose hydrolysis, sorbitol formation and mineral ion concentration during bioethanol formation by Zymomonas mobilis 2716 revealed two distinct phenomena responsible for carbon flow diversion, a 'sucrose effect' and a 'salt effect'. Neither of the two phenomena affects sucrose hydrolysis, but they divert carbon flow of the fructose monomer leading to its own accumulation, sorbitol or oligosaccharide formation. Sucrose concentrations in excess of 15% (w/v) led to sorbitol formation, the level of which may exceed 2% (w/v) depending upon glucose accumulation during sucrose hydrolysis. Increasing mineral ion concentrations led initially to carbon losses and finally to fructose accumulation instead of sorbitol formation. This carbon loss can be corrected by the addition of invertase, which in turn leads to an increase in sorbitol, fructose and ethanol. Potassium and chloride are the dominant ions responsible for suppression of sorbitol formation and fructose uptake, encouraging oligosaccharide formation. These fructooligosaccharides must be of a type which can be converted to fructose, sorbitol and ethanol through the action of invertase. The requirement of invertase addition to prevent fructooligosaccharide formation is indirect evidence that Z. mobilis 2716 does not produce invertase. (orig.).

  5. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  6. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  7. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  8. Effect of Secondary Doping Using Sorbitol on Structure and Transport Properties of PEDOT-PSS Thin Films

    Science.gov (United States)

    Khasim, Syed; Pasha, Apsar; Roy, Aashish S.; Parveen, Ameena; Badi, Nacer

    2017-07-01

    Poly(3,4-ethylene dioxythiophene):poly(styrenesulphonate) (PEDOT-PSS) in the recent past has emerged as one of the most fascinating conducting polymers for many device applications. The unique feature of PEDOT-PSS is its transparency in the entire visible spectrum with excellent thermal stability. The PEDOT-PSS as prepared as an aqueous dispersion has very low conductivity, and it hinders the performance of a device. In this work we report the conductivity enhancement of PEDOT-PSS thin films through secondary doping using a polar organic solvent such as sorbitol. The mechanism of conductivity enhancement was studied through various physical and chemical characterizations. The effect of sorbitol concentration on structure and transport properties of PEDOT-PSS thin films was investigated in detail. The structural and morphological modifications in PEDOT-PSS due to the addition of sorbitol was studied through Fourier transform spectroscopy, Ultra Violet-visible spectroscopy, theromogravimetric analysis, scanning electron microscopy and atomic force microscopy. The interactions resulting from conformational changes of PEDOT chains that changes from coiled to linear structure due to the sorbitol treatment significantly improves the conductivity of PEDOT-PSS films. The secondary doping of sorbitol reduces the energy barrier that facilitates the charge carrier hopping leading to enhanced conductivity. We have observed that the conductivity of PEDOT-PSS thin films was increased by two fold due to sorbitol treatment when compared to conductivity of pure PEDOT-PSS. We have carried out detailed analysis of dielectric parameters of sorbitol-treated PEDOT-PSS films and found that sorbitol treatment has a significant effect on various dielectric attributes of PEDOT-PSS films. Hence, secondary doping using sorbitol could be a useful way to effectively tailor the conductivity and dielectric properties of PEDOT-PSS thin films that can be used as flexible electrodes in

  9. Differential response of nucleus pulposus intervertebral disc cells to high salt, sorbitol, and urea.

    Science.gov (United States)

    Mavrogonatou, Eleni; Kletsas, Dimitris

    2012-03-01

    Nucleus pulposus intervertebral disc cells are routinely confronted with high osmolality in their microenvironment and respond to this stress in vitro by regulating cell cycle progression and by activating a DNA repair machinery in order to counteract its genotoxic effect. In the present study, we attempted to identify the origin of this osmo-regulatory response, by using an ionic NaCl/KCl solution, the compatible osmolyte sorbitol, and the readily permeant urea. High salt and sorbitol were found to activate similar molecular pathways, including the p38 MAPK and the p53-p21(WAF1)-pRb axis, that were not stimulated by high urea. On the other hand, only high urea led to the phosphorylation of ERKs and JNKs. Furthermore, salt- and sorbitol-treated cells were able to phosphorylate histone H2A.X on Ser139, in contrast to cells exposed to urea, indicating a common mechanism for DNA repair, which was achieved by a p53-dependent activation of the G1 checkpoint by both solutes. DNA repair, as directly measured by a host cell reactivation assay, occurred under conditions of hyperosmolar salt and sorbitol, although to a lesser extent in sorbitol-treated cells than in cells exposed to high salinity. Taken as a whole, our findings suggest that the hyperosmolality-provoked DNA damage and the responses of nucleus pulposus cells induced by this genotoxic stress most probably originate from cell volume alterations mediated by hypertonicity and not from increased intracellular ionic concentration. Copyright © 2011 Wiley Periodicals, Inc.

  10. Children's acceptance of milk with xylitol or sorbitol for dental caries prevention

    Directory of Open Access Journals (Sweden)

    Castillo Ramon

    2005-07-01

    Full Text Available Abstract Background Xylitol, a polyol sugar, has been shown to reduce dental caries when mixed with food or chewing gum. This study examines the taste acceptability of xylitol in milk as a first step toward measuring the effectiveness of xylitol in milk for the reduction of dental caries in a public health program. Methods Three different types of milk (Ultra High Temperature (UHT, powder and evaporated were tested for acceptability by 75 Peruvian children (25 per milk group, ages 4 to 7 years. Each group evaluated xylitol and sorbitol in one type of milk. In the first phase, each child was presented with a tray of four plastic cups containing 50 ml of milk with 0.021 g/ml xylitol, 0.042 g/ml xylitol, 0.042 g/ml sorbitol or no sugar. Each child was asked to taste the samples in a self-selected order. After tasting each sample, the child placed the milk cup in front of one of three cartoon faces (smile, frown or neutral representing the child's response to the taste of each sample. In the second phase, the child was asked to rank order the milk samples within each category (smile, frown or neutral. Ranks within categories were then combined to obtain a rank ordering for all the test samples. Results The ranking from best to worst for the samples across categories (UHT, powder, evaporated was xylitol (0.0.042 g/ml, sorbitol (0.042 g/ml, xylitol (0.021 g/ml and milk alone (Friedman's ANOVA. Xylitol and sorbitol were preferred over milk alone, and xylitol (0.042 g/ml was preferred to sorbitol (0.042 g/ml(p Conclusion Milk sweetened with xylitol is well accepted by Peruvian children ages 4–7 years.

  11. Increased risk of cataract development in WNIN-obese rats due to accumulation of intralenticular sorbitol.

    Science.gov (United States)

    Reddy, Paduru Yadagiri; Giridharan, Nappan Veettil; Balakrishna, Nagalla; Validandi, Vakdevi; Pullakhandam, Raghu; Reddy, Geereddy Bhanuprakash

    2013-05-01

    Epidemiological studies have reported an association between obesity and increased incidence of ocular complications including cataract, yet the underlying biochemical and molecular mechanisms remained unclear. Previously we had demonstrated accumulation of sorbitol in the lens of obese rats (WNIN/Ob) and more so in a related strain with impaired glucose tolerance (WNIN/GR-Ob). However, only a few (15-20%) WNIN/Ob and WNIN/GR-Ob rats develop cataracts spontaneously with age. To gain further insights, we investigated the susceptibility of eye lens proteins of these obese rat strains to heat- and UV-induced aggregation in vitro, lens opacification upon glucose-mediated sorbitol accumulation ex vivo, and onset and progression of cataract was followed by galactose feeding and streptozotocin (STZ) injection. The results indicated increased susceptibility toward heat- or UV-induced aggregation of lens proteins in obese animals compared to their littermate lean controls. Further, in organ culture studies glucose-induced sorbitol accumulation was found to be higher and thus the lens opacification was faster in obese animals compared to their lean littermates. Also, the onset and progression of galactose- or STZ-induced cataractogenesis was faster in obese animals compared to lean control. These results together with our previous observations suggest that obesity status could lead to hyperaccumulation of sorbitol in eye lens, predisposing them to cataract, primarily by increasing their susceptibility to environmental and/or physiological factors. Further, intralenticular sorbitol accumulation beyond a threshold level could lead to cataract in WNIN/Ob and WNIN/GR-Ob rats. Copyright © 2013 International Union of Biochemistry and Molecular Biology, Inc.

  12. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  13. Effect of nonabsorbed amounts of a fructose-sorbitol mixture on small intestinal transit in healthy volunteers

    DEFF Research Database (Denmark)

    Madsen, Jan L; Linnet, Jan; Rumessen, Jüri J

    2006-01-01

    Although malabsorption of small amounts of fructose-sorbitol mixtures occurs frequently in healthy humans, insights into their effects on gastrointestinal motility are poor. The present study addresses the hypothesis that malabsorption of a fructose-sorbitol challenge changes the small intestinal...... transit rate. Eleven healthy volunteers participated in a double-blind crossover investigation. In random order, the subjects ingested 30 g glucose or a mixture of 25 g fructose and 5 g sorbitol as 10% solutions. As a radiolabeled marker, (99m)Tc-diethylenetriaminepentaacetic acid was added to each test...... solution. Breath hydrogen and methane concentrations and gastrointestinal progress of the radiolabeled marker were followed for the next 6-hr period. Malabsorption of small amounts of the fructose-sorbitol mixture was evident in all subjects. The area under the gastric radioactivity-time curve after...

  14. Simultaneous saccharification of inulin and starch using commercial glucoamylase and the subsequent bioconversion to high titer sorbitol and gluconic acid.

    Science.gov (United States)

    An, Kehong; Hu, Fengxian; Bao, Jie

    2013-12-01

    A new bioprocess for production of sorbitol and gluconic acid from two low-cost feedstocks, inulin and cassava starch, using a commercially available enzyme was proposed in this study. The commercial glucoamylase GA-L NEW from Genencor was found to demonstrate a high inulinase activity for hydrolysis of inulin into fructose and glucose. The glucoamylase was used to replace the expensive and not commercially available inulinase enzyme for simultaneous saccharification of inulin and starch into high titer glucose and fructose hydrolysate. The glucose and fructose in the hydrolysate were converted into sorbitol and gluconic acid using immobilized whole cells of the recombinant Zymomonas mobilis strain. The high gluconic acid concentration of 193 g/L and sorbitol concentration of 180 g/L with the overall yield of 97.3 % were obtained in the batch operations. The present study provided a practical production method of sorbitol and gluconic acid from low cost feedstocks and enzymes.

  15. Simultaneous catalytic conversion of cellulose and corncob xylan under temperature programming for enhanced sorbitol and xylitol production.

    Science.gov (United States)

    Ribeiro, Lucília Sousa; Órfão, José J de Melo; Pereira, Manuel Fernando Ribeiro

    2017-11-01

    Sorbitol and xylitol yields can be improved by converting cellulose and xylan simultaneously, due to a synergetic effect between both substrates. Furthermore, both yields can be greatly enhanced by simply adjusting the reaction conditions regarding the optimum for the production of each product, since xylitol (from xylan) and sorbitol (from cellulose) yields are maximized when the reaction is carried out at 170 and 205°C, respectively. Therefore, the combination of a simultaneous conversion of cellulose and xylan with a two-step temperature approach, which consists in the variation of the reaction temperature from 170 to 205°C after 2h, showed to be a good strategy for maximizing the production of sorbitol and xylitol directly from mixture of cellulose and xylan. Using this new and environmentally friendly approach, yields of sorbitol and xylitol of 75 and 77%, respectively, were obtained after 6h of reaction. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Effect of nonabsorbed amounts of a fructose-sorbitol mixture on small intestinal transit in healthy volunteers

    DEFF Research Database (Denmark)

    Madsen, Jan L; Linnet, Jan; Rumessen, Jüri J

    2006-01-01

    transit rate. Eleven healthy volunteers participated in a double-blind crossover investigation. In random order, the subjects ingested 30 g glucose or a mixture of 25 g fructose and 5 g sorbitol as 10% solutions. As a radiolabeled marker, (99m)Tc-diethylenetriaminepentaacetic acid was added to each test......Although malabsorption of small amounts of fructose-sorbitol mixtures occurs frequently in healthy humans, insights into their effects on gastrointestinal motility are poor. The present study addresses the hypothesis that malabsorption of a fructose-sorbitol challenge changes the small intestinal...... solution. Breath hydrogen and methane concentrations and gastrointestinal progress of the radiolabeled marker were followed for the next 6-hr period. Malabsorption of small amounts of the fructose-sorbitol mixture was evident in all subjects. The area under the gastric radioactivity-time curve after...

  17. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  19. Caloric restriction counteracts age-related changes in the activities of sorbitol metabolizing enzymes from mouse liver

    Science.gov (United States)

    Hagopian, Kevork; Ramsey, Jon J.; Weindruch, Richard

    2009-01-01

    The influence of caloric restriction (CR) on hepatic sorbitol-metabolizing enzyme activities was investigated in young and old mice. Aldose reductase and sorbitol dehydrogenase activities were significantly lower in old CR mice than in old controls. Young CR mice showed decreased aldose reductase activity and a trend towards decreased sorbitol dehydrogenase when compared to controls. Metabolites of the pathway, namely sorbitol, glucose and fructose were decreased by CR in young and old mice. Pyruvate levels were decreased by CR in both young and old mice, while lactate decreased only in old CR. Malate levels increased in old CR but remained unchanged in young CR, when compared with controls. Accordingly, the lactae/pyruvate and malate/pyruvate ratios in young and old CR mice were increased, indicating increased NADH/NAD and NADPH/NADP redox couples, respectively. The results indicate that decreased glucose levels under CR conditions lead to decreased sorbitol pathway enzyme activities and metabolite levels, and could contribute to the beneficial effects of long-term CR through decreased sorbitol levels and NADPH sparing. PMID:18953666

  20. A highly efficient sorbitol dehydrogenase from Gluconobacter oxydans G624 and improvement of its stability through immobilization.

    Science.gov (United States)

    Kim, Tae-Su; Patel, Sanjay K S; Selvaraj, Chandrabose; Jung, Woo-Suk; Pan, Cheol-Ho; Kang, Yun Chan; Lee, Jung-Kul

    2016-09-16

    A sorbitol dehydrogenase (GoSLDH) from Gluconobacter oxydans G624 (G. oxydans G624) was expressed in Escherichia coli BL21(DE3)-CodonPlus RIL. The complete 1455-bp codon-optimized gene was amplified, expressed, and thoroughly characterized for the first time. GoSLDH exhibited Km and kcat values of 38.9 mM and 3820 s(-1) toward L-sorbitol, respectively. The enzyme exhibited high preference for NADP(+) (vs. only 2.5% relative activity with NAD(+)). GoSLDH sequencing, structure analyses, and biochemical studies, suggested that it belongs to the NADP(+)-dependent polyol-specific long-chain sorbitol dehydrogenase family. GoSLDH is the first fully characterized SLDH to date, and it is distinguished from other L-sorbose-producing enzymes by its high activity and substrate specificity. Isothermal titration calorimetry showed that the protein binds more strongly to D-sorbitol than other L-sorbose-producing enzymes, and substrate docking analysis confirmed a higher turnover rate. The high oxidation potential of GoSLDH for D-sorbitol was confirmed by cyclovoltametric analysis. Further, stability of GoSLDH significantly improved (up to 13.6-fold) after cross-linking of immobilized enzyme on silica nanoparticles and retained 62.8% residual activity after 10 cycles of reuse. Therefore, immobilized GoSLDH may be useful for L-sorbose production from D-sorbitol.

  1. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    Science.gov (United States)

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  3. Erythritol Is More Effective Than Xylitol and Sorbitol in Managing Oral Health Endpoints

    Directory of Open Access Journals (Sweden)

    Peter de Cock

    2016-01-01

    Full Text Available Objective. To provide a comprehensive overview of published evidence on the impact of erythritol, a noncaloric polyol bulk sweetener, on oral health. Methods. A literature review was conducted regarding the potential effects of erythritol on dental plaque (biofilm, dental caries, and periodontal therapy. The efficacy of erythritol on oral health was compared with xylitol and sorbitol. Results. Erythritol effectively decreased weight of dental plaque and adherence of common streptococcal oral bacteria to tooth surfaces, inhibited growth and activity of associated bacteria like S. mutans, decreased expression of bacterial genes involved in sucrose metabolism, reduced the overall number of dental caries, and served as a suitable matrix for subgingival air-polishing to replace traditional root scaling. Conclusions. Important differences were reported in the effect of individual polyols on oral health. The current review provides evidence demonstrating better efficacy of erythritol compared to sorbitol and xylitol to maintain and improve oral health.

  4. Dose response of xylitol and sorbitol for epr retrospective dosimetry with applications to chewing gum

    International Nuclear Information System (INIS)

    Israelsson, A.; Gustafsson, H.; Lund, E.

    2013-01-01

    The purpose of this investigation was to study the radiation-induced electron paramagnetic resonance signal in sweeteners xylitol and sorbitol for use in retrospective dosimetry. For both sweeteners and chewing gum, the signal changed at an interval of 1-84 d after irradiation with minimal changes after 4-8 d. A dependence on storage conditions was noticed and the exposure of the samples to light and humidity was therefore minimised. Both the xylitol and sorbitol signals showed linearity with dose in the measured dose interval, 0-20 Gy. The dose-response measurements for the chewing gum resulted in a decision threshold of 0.38 Gy and a detection limit of 0.78 Gy. A blind test illustrated the possibility of using chewing gums as a retrospective dosemeter with an uncertainty in the dose determination of 0.17 Gy (1 SD). (authors)

  5. Fructose production by Zymomonas mobilis in fed-batch culture with minimal sorbitol formation

    Energy Technology Data Exchange (ETDEWEB)

    Edye, L A; Johns, M R; Ewings, K N

    1989-08-01

    Fed-batch cultures of Zymomonas mobilis (UQM 2864), a mutant unable to metabolise fructose, grown on diluted sugar cane syrup (200 g/l sucrose) achieved yields of 90.5 g/l fructose and 48.3 g/l ethanol with minimal sorbitol formation and complete utilization of the substrate. The effect of inoculum size on sorbitol formation in the batch stage of fed-batch fermentation are reported. Fermentation of sucrose (350 g/l) supplemented with nutrients yielded 142 g/l fructose and 76.5 g/l ethanol. Some fructose product loss at high fructose concentrations was observed. The fed-batch fermentation process offers a method for obtaining high concentrations of fructose and ethanol from sucrose materials. (orig.).

  6. Effects of sorbitol and glycerol on the structure, dynamics, and stability of Mycobacterium tuberculosis pyrazinamidase

    Directory of Open Access Journals (Sweden)

    Mehrnoosh Khajehzadeh

    2016-01-01

    Conclusion: It can be concluded that the native conformation of the enzyme was stabilized in the sorbitol and glycerol and tend to exclude from the PZase surface, forcing the enzyme to keep it in the compactly folded conformation. The glycerol molecules stabilized PZase by decreasing the loops flexibility and then compacting the enzyme structure. It appears that more stability of PZase in glycerol solution correlates with its amphiphilic orientation, which decreases the unfavorable interactions of hydrophobic regions.

  7. Effect of xylitol versus sorbitol: a quantitative systematic review of clinical trials.

    Science.gov (United States)

    Mickenautsch, Steffen; Yengopal, Veerasamy

    2012-08-01

    This study aimed to appraise, within the context of tooth caries, the current clinical evidence and its risk for bias regarding the effects of xylitol in comparison with sorbitol. Databases were searched for clinical trials to 19 March 2011. Inclusion criteria required studies to: test a caries-related primary outcome; compare the effects of xylitol with those of sorbitol; describe a clinical trial with two or more arms, and utilise a prospective study design. Articles were excluded if they did not report computable data or did not follow up test and control groups in the same way. Individual dichotomous and continuous datasets were extracted from accepted articles. Selection and performance/detection bias were assessed. Sensitivity analysis was used to investigate attrition bias. Egger's regression and funnel plotting were used to investigate risk for publication bias. Nine articles were identified. Of these, eight were accepted and one was excluded. Ten continuous and eight dichotomous datasets were extracted. Because of high clinical heterogeneity, no meta-analysis was performed. Most of the datasets favoured xylitol, but this was not consistent. The accepted trials may be limited by selection bias. Results of the sensitivity analysis indicate a high risk for attrition bias. The funnel plot and Egger's regression results suggest a low publication bias risk. External fluoride exposure and stimulated saliva flow may have confounded the measured anticariogenic effect of xylitol. The evidence identified in support of xylitol over sorbitol is contradictory, is at high risk for selection and attrition bias and may be limited by confounder effects. Future high-quality randomised controlled trials are needed to show whether xylitol has a greater anticariogenic effect than sorbitol. © 2012 FDI World Dental Federation.

  8. Rapid conversion of sorbitol to isosorbide in hydrophobic ionic liquids under microwave irradiation.

    Science.gov (United States)

    Kamimura, Akio; Murata, Kengo; Tanaka, Yoshiki; Okagawa, Tomoki; Matsumoto, Hiroshi; Kaiso, Kouji; Yoshimoto, Makoto

    2014-12-01

    Sorbitol was effectively converted to isosorbide by treatment with [TMPA][NTf2 ] in the presence of catalytic amounts of TsOH under microwave heating at 180 °C. The reaction completed within 10 min and isosorbide was isolated to about 60%. Ionic liquids were readily recovered by an extraction treatment and reused several times. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Preparation and Characterization of HPMC/PVP Blend Films Plasticized with Sorbitol

    OpenAIRE

    Somashekarappa, H.; Prakash, Y.; Hemalatha, K.; Demappa, T.; Somashekar, R.

    2013-01-01

    The aim of this present work is to investigate the effect of plasticizers like Sorbitol on microstructural and mechanical properties of hydroxypropyl methylcellulose (HPMC) and Polyvinylpyrrolidone (PVP) blend films. The pure blend and plasticized blend films were prepared by solution casting method and investigated using wide angle X-ray scattering (WAXS) method. WAXS analysis confirms that the plasticizers can enter into macromolecular blend structure and destroy the crystallinity of the f...

  10. Enhanced production of L-sorbose from D-sorbitol by improving the mRNA abundance of sorbitol dehydrogenase in Gluconobacter oxydans WSH-003.

    Science.gov (United States)

    Xu, Sha; Wang, Xiaobei; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2014-10-18

    Production of L-sorbose from D-sorbitol by Gluconobacter oxydans is the first step to produce L-ascorbic acid on industrial scale. The sldhAB gene, which encodes the sorbitol dehydrogenase (SLDH), was overexpressed in an industrial strain G. oxydans WSH-003 with a strong promoter, P tufB . To enhance the mRNA abundance, a series of artificial poly(A/T) tails were added to the 3'-terminal of sldhAB gene. Besides, their role in sldhAB overexpression and their subsequent effects on L-sorbose production were investigated. The mRNA abundance of the sldhAB gene could be enhanced in G. oxydans by suitable poly(A/T) tails. By self-overexpressing the sldhAB gene in G. oxydans WSH-003 with an optimal poly(A/T) tail under the constitutive promoter P tufB , the titer and the productivity of L-sorbose were enhanced by 36.3% and 25.0%, respectively, in a 1-L fermenter. Immobilization of G. oxydans-sldhAB6 cells further improved the L-sorbose titer by 33.7% after 20 days of semi-continuous fed-batch fermentation. The artificial poly(A/T) tails could significantly enhance the mRNA abundance of the sldhAB. Immobilized G. oxydans-sldhAB6 cells could further enlarge the positive effect caused by enhanced mRNA abundance of the sldhAB.

  11. Sensitization of glycine (spectrophotometric read-out) dosimetric system using sorbitol

    International Nuclear Information System (INIS)

    Shinde, S.H.; Mukherjee, T.

    2009-01-01

    Glycine spectrophotometric read-out systems have a useful dose range of 15-4000 Gy. An attempt was made to sensitize it using sorbitol as a sensitizer. Optimum compositions of aqueous acidic solutions of ferrous ammonium sulphate-xylenol orange (XO), i.e. FX and sorbitol-ferrous ammonium sulphate-xylenol orange, i.e. SFX, for 400 mg of glycine, which gives maximum dosimetric response for any given dose, were established. Molar absorption coefficient values of ferric-XO-glycine complex, i.e. ε-values, were determined for glycine system in FX and SFX. These values were found to be 8410 and 15,000 m 2 mol -1 respectively, indicating that an enhancement or sensitivity factor of about 1.78 can be achieved by sorbitol for glycine in SFX. This factor was further confirmed by measuring the gamma dose response of glycine in FX and in SFX for four different doses, viz. 37.8, 75.5, 151 and 302 Gy. It was observed that dose response of glycine in SFX is about 77% more than that of glycine in FX. The maximum variation observed in response of glycine in FX or SFX was found to be within ±1.5%.

  12. Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol

    Science.gov (United States)

    Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti

    2001-01-01

    Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

  13. The influence of sorbitol on the production of cellulases and xylanases in an airlift bioreactor.

    Science.gov (United States)

    Ritter, Carla Eliana Todero; Fontana, Roselei Claudete; Camassola, Marli; da Silveira, Maurício Moura; Dillon, Aldo José Pinheiro

    2013-11-01

    The production of cellulases and xylanases by Penicillium echinulatum in an airlift bioreactor was evaluated. In batch production, we tested media with isolated or associated cellulose and sorbitol. In fed-batch production, we tested cellulose addition at two different times, 30 h and 48 h. Higher liquid circulation velocities in the downcomer were observed in sorbitol 10 g L(-1) medium. In batch production, higher FPA (filter paper activity) and endoglucanase activities were obtained with cellulose (7.5 g L(-1)) and sorbitol (2.5 g L(-1)), 1.0 U mL(-1) (120 h) and 6.4 U m L(-1) (100 h), respectively. For xylanases, the best production condition was cellulose 10 g L(-1), which achieved 5.5 U mL(-1) in 64 h. The fed-batch process was favorable for obtaining xylanases, but not for FPA and endoglucanases, suggesting that in the case of cellulases, the inducer must be added early in the process. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Pt nanocatalysts supported on reduced graphene oxide for selective conversion of cellulose or cellobiose to sorbitol.

    Science.gov (United States)

    Wang, Ding; Niu, Wenqi; Tan, Minghui; Wu, Mingbo; Zheng, Xuejun; Li, Yanpeng; Tsubaki, Noritatsu

    2014-05-01

    Pt nanocatalysts loaded on reduced graphene oxide (Pt/RGO) were prepared by means of a convenient microwave-assisted reduction approach with ethylene glycol as reductant. The conversion of cellulose or cellobiose into sorbitol was used as an application reaction to investigate their catalytic performance. Various metal nanocatalysts loaded on RGO were compared and RGO-supported Pt exhibited the highest catalytic activity with 91.5 % of sorbitol yield from cellobiose. The catalytic performances of Pt nanocatalysts supported on different carbon materials or on silica support were also compared. The results showed that RGO was the best catalyst support, and the yield of sorbitol was as high as 91.5 % from cellobiose and 58.9 % from cellulose, respectively. The improvement of catalytic activity was attributed to the appropriate Pt particle size and hydrogen spillover effect of Pt/RGO catalyst. Interestingly, the size and dispersion of supported Pt particles could be easily regulated by convenient adjustment of the microwave heating temperature. The catalytic performance was found to initially increase and then decrease with increasing particle size. The optimum Pt particle size was 3.6 nm. These findings may offer useful guidelines for designing novel catalysts with beneficial catalytic performance for biomass conversion. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Subcellular localization and vacuolar targeting of sorbitol dehydrogenase in apple seed.

    Science.gov (United States)

    Wang, Xiu-Ling; Hu, Zi-Ying; You, Chun-Xiang; Kong, Xiu-Zhen; Shi, Xiao-Pu

    2013-09-01

    Sorbitol is the primary photosynthate and translocated carbohydrate in fruit trees of the Rosaceae family. NAD(+)-dependent sorbitol dehydrogenase (NAD-SDH, EC 1.1.1.14), which mainly catalyzes the oxidation of sorbitol to fructose, plays a key role in regulating sink strength in apple. In this study, we found that apple NAD-SDH was ubiquitously distributed in epidermis, parenchyma, and vascular bundle in developing cotyledon. NAD-SDH was localized in the cytosol, the membranes of endoplasmic reticulum and vesicles, and the vacuolar lumen in the cotyledon at the middle stage of seed development. In contrast, NAD-SDH was mainly distributed in the protein storage vacuoles in cotyledon at the late stage of seed development. Sequence analysis revealed there is a putative signal peptide (SP), also being predicated to be a transmembrane domain, in the middle of proteins of apple NAD-SDH isoforms. To investigate whether the putative internal SP functions in the vacuolar targeting of NAD-SDH, we analyzed the localization of the SP-deletion mutants of MdSDH5 and MdSDH6 (two NAD-SDH isoforms in apple) by the transient expression system in Arabidopsis protoplasts. MdSDH5 and MdSDH6 were not localized in the vacuoles after their SPs were deleted, suggesting the internal SP functions in the vacuolar targeting of apple NAD-SDH. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Sweet taste in apple: the role of sorbitol, individual sugars, organic acids and volatile compounds

    Science.gov (United States)

    Aprea, Eugenio; Charles, Mathilde; Endrizzi, Isabella; Laura Corollaro, Maria; Betta, Emanuela; Biasioli, Franco; Gasperi, Flavia

    2017-03-01

    Sweetness is one of the main drivers of consumer preference, and thus is given high priority in apple breeding programmes. Due to the complexity of sweetness evaluation, soluble solid content (SSC) is commonly used as an estimation of this trait. Nevertheless, it has been demonstrated that SSC and sweet taste are poorly correlated. Though individual sugar content may vary greatly between and within apple cultivars, no previous study has tried to investigate the relationship between the amount of individual sugars, or ratios of these, and apple sweetness. In this work, we quantified the major sugars (sucrose, glucose, fructose, xylose) and sorbitol and explored their influence on perceived sweetness in apple; we also related this to malic acid content, SSC and volatile compounds. Our data confirmed that the correlation between sweetness and SSC is weak. We found that sorbitol content correlates (similarly to SSC) with perceived sweetness better than any other single sugar or total sugar content. The single sugars show no differentiable importance in determining apple sweetness. Our predictive model based on partial least squares regression shows that after sorbitol and SSC, the most important contribution to apple sweetness is provided by several volatile compounds, mainly esters and farnesene.

  17. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  18. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  19. Control of glucokinase translocation in rat hepatocytes by sorbitol and the cytosolic redox state.

    Science.gov (United States)

    Agius, L

    1994-02-15

    In rat hepatocytes cultured in 5 mM glucose, glucokinase activity is present predominantly in a bound state, and during permeabilization of the cells with digitonin in the presence of Mg2+ less than 20% of glucokinase activity is released. However, incubation of hepatocytes with a higher [glucose] [concn. giving half-maximal activation (A50) 15 mM] or with fructose (A50 50 microM) causes translocation of glucokinase from its Mg(2+)-dependent binding site to an alternative site [Agius and Peak (1993) Biochem. J. 296, 785-796]. A comparison of various substrates showed that sorbitol (A50 8 microM) was 6-fold more potent than fructose at causing glucokinase translocation, whereas tagatose was as potent and mannitol was > 10-fold less potent (A50 550 microM). These substrates also stimulate glucose conversion into glycogen with a similar relative potency, suggesting that conversion of glucose into glycogen is dependent on the binding and/or location of glucokinase within the hepatocyte. Ethanol and glycerol inhibited the effects of fructose, sorbitol and glucose on glucokinase translocation, whereas dihydroxy-acetone had a small additive effect at sub-maximal substrate stimulation. The converse effects of glycerol and dihydroxy-acetone suggest a role for the cytosolic NADH/NAD+ redox state in controlling glucokinase translocation. Titrations with three competitive inhibitors of glucokinase did not provide evidence for involvement of glucokinase flux in glucose-induced glucokinase translocation: N-acetylglucosamine inhibited glucose conversion into glycogen, but not glucose-induced glucokinase translocation; glucosamine partially suppressed glucose-induced and fructose-induced glucokinase translocation, at concentrations that caused total inhibition of glucose conversion into glycogen; D-mannoheptulose increased glucokinase release and had an additive effect with glucose. 3,3'-Tetramethylene-glutaric acid (5 mM), an inhibitor of aldose reductase, inhibited glucokinase

  20. Pronounced microheterogeneity in a sorbitol-water mixture observed through variable temperature neutron scattering.

    Science.gov (United States)

    Chou, Shin G; Soper, Alan K; Khodadadi, Sheila; Curtis, Joseph E; Krueger, Susan; Cicerone, Marcus T; Fitch, Andrew N; Shalaev, Evgenyi Y

    2012-04-19

    In this study, the structure of concentrated d-sorbitol-water mixtures is studied by wide- and small-angle neutron scattering (WANS and SANS) as a function of temperature. The mixtures are prepared using both deuterated and regular sorbitol and water at a molar fraction of sorbitol of 0.19 (equivalent to 70% by weight of regular sorbitol in water). Retention of an amorphous structure (i.e., absence of crystallinity) is confirmed for this system over the entire temperature range, 100-298 K. The glass transition temperature, Tg, is found from differential scanning calorimetry to be approximately 200 K. WANS data are analyzed using empirical potential structure refinement, to obtain the site-site radial distribution functions (RDFs) and coordination numbers. This analysis reveals the presence of nanoscaled water clusters surrounded by (and interacting with) sorbitol molecules. The water clusters appear more structured compared to bulk water and, especially at the lowest temperatures, resemble the structure of low-density amorphous ice (LDA). Upon cooling to 100 K the peaks in the water RDFs become markedly sharper, with increased coordination number, indicating enhanced local (nanometer-scale) ordering, with changes taking place both above and well below the Tg. On the mesoscopic (submicrometer) scale, although there are no changes between 298 and 213 K, cooling the sample to 100 K results in a significant increase in the SANS signal, which is indicative of pronounced inhomogeneities. This increase in the scattering is partly reversed during heating, although some hysteresis is observed. Furthermore, a power law analysis of the SANS data indicates the existence of domains with well-defined interfaces on the submicrometer length scale, probably as a result of the appearance and growth of microscopic voids in the glassy matrix. Because of the unusual combination of small and wide scattering data used here, the present results provide new physical insight into the

  1. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  2. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  3. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  4. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  5. Dietary sorbitol and mannitol: food content and distinct absorption patterns between healthy individuals and patients with irritable bowel syndrome.

    Science.gov (United States)

    Yao, C K; Tan, H-L; van Langenberg, D R; Barrett, J S; Rose, R; Liels, K; Gibson, P R; Muir, J G

    2014-04-01

    Sorbitol and mannitol are naturally-occurring polyol isomers. Although poor absorption and induction of gastrointestinal symptoms by sorbitol are known, the properties of mannitol are poorly described. We aimed to expand data on food composition of these polyols, and to compare their absorptive capacities and symptom induction in patients with irritable bowel syndrome (IBS) and healthy individuals. Food samples were analysed for sorbitol and mannitol content. The degree of absorption measured by breath hydrogen production and gastrointestinal symptoms (visual analogue scales) was evaluated in a randomised, double-blinded, placebo-controlled study in 21 healthy and 20 IBS subjects after challenges with 10 g of sorbitol, mannitol or glucose. Certain fruits and sugar-free gum contained sorbitol, whereas mannitol content was higher in certain vegetables. Similar proportions of patients with IBS (40%) and healthy subjects (33%) completely absorbed sorbitol, although more so with IBS absorbed mannitol (80% versus 43%; P = 0.02). Breath hydrogen production was similar in both groups after lactulose but was reduced in patients with IBS after both polyols. No difference in mean (SEM) hydrogen production was found in healthy controls after sorbitol [area-under-the-curve: 2766 (591) ppm 4 h(-1) ] or mannitol [2062 (468) ppm 4 h(-1) ] but, in patients with IBS, this was greater after sorbitol [1136 (204) ppm 4 h(-1) ] than mannitol [404 (154) ppm 4 h(-1) ; P = 0.002]. Overall gastrointestinal symptoms increased significantly after both polyols in patients with IBS only, although they were independent of malabsorption of either of the polyols. Increased and discordant absorption of mannitol and sorbitol occurs in patients with IBS compared to that in healthy controls. Polyols induced gastrointestinal symptoms in patients with IBS independently of their absorptive patterns, suggesting that the dietary restriction of polyols may be efficacious. © 2013 The

  6. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  7. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  8. Fructose and/or Sorbitol Intolerance in a Subgroup of Lactose Intolerant Patients

    Directory of Open Access Journals (Sweden)

    SR Mishkin

    1994-01-01

    Full Text Available The diagnosis and treatment of lactose intolerance often does not resolve all the symptoms of postcibal bloating and flatulence. Included in this study were 104 lactose intolerant patients (71 female, 33 male who complained of residual postcibal discomfort in spite of adherence to and benefit from appropriate measures for their documented lactose intolerance (at least 20 ppm H2 after 25 g lactose as well as appropriate symptomatic discomfort. Clinical characteristics common to this group included: symptomatic diarrhea (12.5%, history of foreign travel (5.8%, endoscopic and pathological evidence of gastritis and helicobacter infection (19.2 and 8.7%, respectively, nonspecific abnormalities of small bowel follow-through (15.4%, Crohn’s disease (8.7% and colonic cliverticulosis (14.4%. Intolerance co fructose (at least 10 ppm H2 after 25 g fructose plus appropriate symptoms or sorbitol (at least 10 ppm H2 after 5 g sorbitol plus appropriate symptoms was documented in 17.3 and 18.3%, respectively. Intolerance to both fructose and sorbicol (administered as separate challenges, more than twice as common as intolerance to either one alone, occurred in 41.4% and was independent of sex. In conclusion, additional carbohydrate intolerances contribute to postcibal discomfort in more than 75% of lactose intolerant patients who remain symptomatic in spite of adherence to appropriate measures for this condition. While 62% of all patients had benefited significantly (greater than 50% from appropriate dietary measures and enzyme replacement for lactose intolerance, only 40% of those who were also fructose intolerant and 47% who were sorbitol intolerant benefited (greater than 50% from appropriate dietary measures (no enzyme replacement yet available for intolerance to these sugars.

  9. One-pot aqueous phase catalytic conversion of sorbitol to gasoline over nickel catalyst

    International Nuclear Information System (INIS)

    Weng, Yujing; Qiu, Songbai; Xu, Ying; Ding, Mingyue; Chen, Lungang; Zhang, Qi; Ma, Longlong; Wang, Tiejun

    2015-01-01

    Highlights: • Directly production gasoline (C5–C12 alkanes) from biomass-derived sugar alcohol sorbitol. • Temperature of STG (553–593 K) was lower than that of traditional methanol to gasoline (MTG) (623–773 K). • Gasoline yield of 46.9% and C7–C12 hydrocarbons reached up to 45.5% in the gasoline products. - Abstract: The carbon chain extension and hydrodeoxygenation steps play critical roles in the high-energy-density hydrocarbons production. In this paper, a systematic study had been carried out to investigate one-pot aqueous phase catalytic conversion of sorbitol to gasoline (STG) over bifunctional Ni-based catalysts. Characterization technologies of N 2 physisorption, X-ray diffraction (XRD), Scanning electron microscopy (SEM), transmission electron microscopy (TEM) and NH 3 temperature-programmed desorption (NH 3 -TPD) were used to study the textural properties, phase compositions, acid behavior and morphologies of the catalysts. The catalytic performances were tested in a fixed bed reactor. It was found that the physically mixed Ni/HZSM-5 and Ni/silica-gel (mesoporous SG) catalyst realized the carbon chain extension and exhibited excellent performances on hydrodeoxygenation (HDO) reaction (46.9% of gasoline (C5–C12) yield and 45.5% of C7–C12 hydrocarbons in the gasoline products). Especially, the temperature of STG (553–593 K) was lower obviously than that of the traditional methanol to gasoline (MTG) process (623–773 K). It provided a novel transformation of sorbitol to long-chain alkanes by one-pot process over the bifunctional catalyst (Ni@HZSM-5/SG), wherein hydrodeoxygenation, ketonization and aldol condensation steps were integrated

  10. A mannitol/sorbitol receptor stimulates dietary intake in Tribolium castaneum.

    Science.gov (United States)

    Takada, Tomoyuki; Sato, Ryoichi; Kikuta, Shingo

    2017-01-01

    In insects, perception of chemical stimuli is involved in the acceptance or rejection of food. Gustatory receptors (Grs) that regulate external signals in chemosensory organs have been found in many insects. Tribolium castaneum, a major pest of stored products, possesses over 200 Gr genes. An expanded repertoire of Gr genes appears to be required for diet recognition in species that are generalist feeders; however, it remains unclear whether T. castaneum recognizes a suite of chemicals common to many products or whether its feeding is activated by specific chemicals, and whether its Grs are involved in feeding behavior. It is difficult to determine the food preferences of T. castaneum based on dietary intake due to a lack of appropriate methodology. This study established a novel dietary intake estimation method using gypsum, designated the TribUTE (Tribolium Urges To Eat) assay. For this assay, T. castaneum adults were fed a gypsum block without added organic compounds. Sweet preference was determined by adding sweeteners and measuring the amount of gypsum in the excreta. Mannitol was the strongest activator of T. castaneum dietary intake. In a Xenopus oocyte expression, TcGr20 was found to be responsible for mannitol and sorbitol responses, but not for responses to other tested non-volatile compounds. The EC50 values of TcGr20 for mannitol and sorbitol were 72.6 mM and 90.6 mM, respectively, suggesting that TcGr20 is a feasible receptor for the recognition of mannitol at lower concentrations. We used RNAi and the TribUTE assay to examine whether TcGr20 expression was involved in mannitol recognition. The amounts of excreta in TcGr20 dsRNA-injected adults decreased significantly, despite the presence of mannitol, compared to control adults. Taken together, our results indicate that T. castaneum adults recognized mannitol/sorbitol using the TcGr20 receptor, thereby facilitating the dietary intake of these compounds.

  11. Simultaneous separation and determination of fructose, sorbitol, glucose and sucrose in fruits by HPLC-ELSD.

    Science.gov (United States)

    Ma, Chunmei; Sun, Zhen; Chen, Changbao; Zhang, Lili; Zhu, Shuhua

    2014-02-15

    A high-performance liquid chromatography (HPLC) method with evaporative light scattering detection (ELSD) was optimised for simultaneous determination of fructose, sorbitol, glucose and sucrose in fruits. The analysis was carried out on a Phenomenex Luna 5u NH₂ 100A column (250 mm × 4.60mm, 5 micron) with isocratic elution of acetonitrile:water (82.5:17.5, v/v). Drift tube temperature of the ELSD system was set to 82 °C and nitrogen flow rate was 2.0 L min⁻¹. The regression equation revealed good linear relationship (R = 0.9967-0.9989) within test ranges. The limits of detection (LOD) and quantification (LOQ) for four analytes (peach, apple, watermelon, and cherry fruits) were in the range of 0.07-0.27 and 0.22-0.91 mg L⁻¹, respectively. The proposed HPLC-ELSD method was validated for quantification of sugars in peach, apple, watermelon, and cherry fruits, and the results were satisfactory. The results showed that the contents of the four sugars varied among fruits. While fructose (5.79-104.01 mg g⁻¹) and glucose (9.25-99.62 mg g⁻¹) emerged as common sugars in the four fruits, sorbitol (8.70-19.13 mg g⁻¹) were only found in peach, apple and cherry fruits, and sucrose (15.82-106.39 mg g⁻¹) were in peach, apple and watermelon. There was not detectable sorbitol in watermelon and sucrose in cherry fruits, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Solvent-Free Polymerization of L-Aspartic Acid in the Presence of D-Sorbitol to Obtain Water Soluble or Network Copolymers

    Science.gov (United States)

    L-aspartic acid was thermally polymerized in the presence of D-sorbitol with the goal of synthesizing new, higher molecular weight water soluble and absorbent copolymers. No reaction occurred when aspartic acid alone was heated at 170 or 200 degrees C. In contrast, heating sorbitol and aspartic ac...

  13. Efeito da sacarose e sorbitol na conservação in vitro de Passiflora giberti N. E. Brown Sucrose and sorbitol effect in the in vitro conservation of Passiflora giberti N. E. Brown

    Directory of Open Access Journals (Sweden)

    Gláucia Amorim Faria

    2006-08-01

    Full Text Available Este trabalho teve como objetivo estudar o efeito da sacarose e do sorbitol na conservação in vitro de um acesso de Passiflora giberti N. E. Brown. Para isso, foi instalado um experimento no delineamento inteiramente casualizado, em que foi comparado o tratamento-testemunha (MS padrão com o meio MS suplementado com três concentrações de sacarose (0; 15 e 30 g L-1 em combinação com três concentrações de sorbitol (10; 20 e 40 g L-1. As avaliações foram realizadas aos 30; 60; 90 e 120 dias de incubação, observando-se o comprimento das brotações (cm, número de raízes, número e coloração das folhas. Os resultados mostram ser possível conservar sob crescimento lento, por quatro meses, microplantas de maracujazeiro em meio de cultura MS suplementado com 10 ou 20 g L-1 de sorbitol, na ausência de sacarose, e mantidas sob condições de fotoperíodo de 16 h (22 µE m-2s-1 e temperatura de 27 ± 1 ºC. A sacarose promoveu maior desenvolvimento de microplantas. A rizogênese é afetada pelo sorbitol na concentração de 40 g L-1 e pela ausência de sacarose no meio de cultura.This work objectified the study of sucrose and sorbitol effect in the in vitro conservation for Passiflora giberti N. E. Brown, access. Therefore, an experiment was conducted in a completely randomized design to compare control treatment (standard MS to MS medium supplemented with three sucrose concentrations (0, 15 and 30 g L-1 combined with three sorbitol concentrations (10, 20 and 40 g L-1, in a total of 10 treatments with 20 replicas. The experiment evaluation was carried out at 30, 60, 90 and 120 days of incubation, whereas the height of shoots (cm, number of roots, number and color of leaves were observed. The results showed the possibility to maintain passion-fruit microplants for a four months period under slow growth in MS medium supplemented with 10 or 20 g L-1 of sorbitol, without sucrose, and kept under 16 hours photoperiod (22 µ E m-2 s-1 and

  14. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  15. Consistent evidence to support the use of xylitol- and sorbitol-containing chewing gum to prevent dental caries

    DEFF Research Database (Denmark)

    Twetman, Svante

    2009-01-01

    DATA SOURCES: Studies were identified using searches with Medline, the Cochrane Library and Google Scholar. STUDY SELECTION: Studies were screened independently and were included if they evaluated the effect of one or more chewing gums containing at least one polyol (xylitol, sorbitol, mannitol...... randomised controlled trials (RCT) of which four were cluster RCT, nine controlled clinical trials (CCT) and four cohort studies]. Two RCT had a Jadad score of three or higher. The mean preventive fraction for the four main gum types are shown in the table 1, results of all except the sorbitol -mannitol...... blend were statistically significant. Sensitivity analyses confirmed the robustness of the findings. CONCLUSIONS: Although research gaps exist, particularly on optimal dosing and relative polyol efficacy, there is consistent evidence to support the use of xylitol- and sorbitol-containing chewing gum...

  16. Cryopreservation of boar semen by egg yolk-based extenders containing lactose or fructose is better than sorbitol.

    Science.gov (United States)

    Chanapiwat, Panida; Kaeoket, Kampon; Tummaruk, Padet

    2012-03-01

    The present study determined the effect of different types of sugars (lactose, fructose, glucose and sorbitol) used in egg yolk-based extender on the post-thawed boar semen quality. Twenty-two ejaculates from 6 fertility-proven Yorkshire boars were cryopreserved by liquid nitrogen vapor method. Sperm motility, viability, acrosome integrity and intact functional plasma membrane were determined at 0, 2 and 4 hr after thawing. It was found that the lactose-based extender resulted in a higher percentage of post-thawed sperm motility, viability, intact acrosome and functional plasma membrane than sorbitol-based extender (Pextender yielded a higher post-thawed sperm motility and viability than sorbitol-based extender (Pboar semen.

  17. Best combination of promoter and micellar catalyst for the rapid conversion of sorbitol to glucose

    Science.gov (United States)

    Mukherjee, Kakali; Ghosh, Aniruddha; Saha, Rumpa; Sar, Pintu; Malik, Susanta; Saha, Bidyut

    2014-03-01

    Kinetic data for oxidation of D-sorbitol to glucose by hexavalent chromium in aqueous medium and aqueous surfactant medium (SDS, TX-100) have been reported. Effect of promoter such as PA, bipy and phenanthroline on the reaction has been investigated. The reaction is performed under pseudo first order condition with an excess of substrate over the oxidant. The reaction is first order with respect to substrate and oxidant. The micelles have a catalytic effect on the reaction. Combination of phen and TX-100 produces almost twelve times increase in rate of oxidation.

  18. Edible Film from Polyblend of Ginger Starch, Chitosan, and Sorbitol as Plasticizer

    Science.gov (United States)

    Sariningsih, N.; Putra, Y. P.; Pamungkas, W. P.; Kusumaningsih, T.

    2018-03-01

    Polyblend ginger starch/chitosan based edible film has been succesfully prepared and characterized. The purpose of this research was to produce edible film from polyblend of ginger starch, chitosan, and sorbitol as plasticizer. The resulted edible film were characterized by using FTIR, TGA and UTM. Edible film of ginger starch had OH vibration (3430 cm-1). Besides, edible film had elongation up to 15.63%. The thermal degradation of this material reached 208°C indicating high termal stability. The water uptake of the edible film was 42.85%. It concluded that edible film produce in this research has potential as a packaging.

  19. Activation of sorbitol pathway in metabolic syndrome and increased susceptibility to cataract in Wistar-Obese rats.

    Science.gov (United States)

    Reddy, Paduru Yadagiri; Giridharan, Nappan Veettil; Reddy, Geereddy Bhanuprakash

    2012-01-01

    Obesity is a major public health problem worldwide, and of late, epidemiological studies indicate a preponderance of cataracts under obesity conditions. Although cataract is a multifactorial disorder and various biochemical mechanisms have been proposed, the influence of obesity on cataractogenesis has yet to be investigated. In such a scenario, a suitable animal model that develops cataract following the onset of obesity will be a welcome tool for biomedical research. Therefore, we investigated the molecular and biochemical basis for predisposition to cataract in the obese mutant rat models established in our institute because 15%-20% of these rats develop cataracts spontaneously as they reach 12-15 months of age. We analyzed the major biochemical pathways in the normal lenses of different age groups of our obese mutant rat strains, Wistar/Obese (WNIN/Ob) and WNIN/GR-Ob, the former with euglycemia and the latter with an additional impaired glucose tolerance trait. In addition, sorbitol levels were estimated in the cataractous lenses of the obese rats. Except for the polyol pathway, all the principal pathways of the lens remained unaltered. Therefore, sorbitol levels were found to be high in the normal eye lenses of obese rats (WNIN/Ob and WNIN/GR-Ob) compared to their lean controls from three months of age onwards. Between WNIN/Ob and WNIN/GR-Ob, the levels of sorbitol were higher in the latter, suggesting a synergistic effect of impaired glucose tolerance along with obesity in the activation of the sorbitol pathway. Either way, an elevated sorbitol pathway seemed to be the predisposing factor responsible for cataract formation in these mutant rats. Activation of the sorbitol pathway indeed enhances the risk of cataract development in conditions such as metabolic syndrome. These rat models thus may be valuable tools for investigating obesity-associated cataract and for developing intervention strategies, based on these findings.

  20. FORMULA OPTIMATION OF SENGGUGU ROOT BARK EXTRACT LOZENGES (Clerodendrum serratum (L. Moon. AS MUCOLYTIC AGENT WITH LACTOSE – SORBITOL FILLER COMBINATION

    Directory of Open Access Journals (Sweden)

    Wahyono Wahyono

    2015-11-01

    Full Text Available Senggugu root bark has mucolytic activity and has been used empirically, so it needs to be formulated as lozengeswhich can be used practically and comfortable for the patients. Senggugu root bark powder was extracted by maceration using aethanol 70%. Lozenges was optimized using lactose-sorbitol filler mix through three formulas, formula A ( 100% lactose, formula B (100% sorbitol, formula C (50% lactose-50% sorbitol. Lozenges was made by wet granulation method. The optimum formula was obtained from theresults of physical granul test and lozenges using SLD, and analyzed by its granul flow, hardness, dissolution time, and taste responsiveness, and also qualitative and quantitative analysis. The results show that lactose-sorbitol filler mix can increase hardness and taste responsiveness, decrease granul flow and dissolution time. The oprimum formula from this research is 100% sorbitol:0% lactose.

  1. Substrate inhibition: Oxidation of D-sorbitol and D-mannitol by potassium periodate in alkaline medium

    Science.gov (United States)

    Lakshman Kumar, Y.; Venkata Nadh, R.; Radhakrishnamurti, P. S.

    2014-05-01

    In the oxidation of D-sorbitol and D-mannitol by potassium periodate in alkaline media, substrate inhibition was observed with both substrates, i.e., a decrease in the rate of the reaction was observed with an increase in the concentration of substrate. The substrate inhibition was attributed to the formation of stable complex between the substrate and periodate. The reactions were found to be first order in case of periodate and a positive fractional order with hydroxide ions. Arrhenius parameters were calculated for the oxidation of sorbitol and mannitol by potassium periodate in alkali media.

  2. Production of liquid alkanes by controlling reactivity of sorbitol hydrogenation with a Ni/HZSM-5 catalyst in water

    International Nuclear Information System (INIS)

    Zhang, Qing; Wang, Tiejun; Xu, Ying; Zhang, Qi; Ma, Longlong

    2014-01-01

    Graphical abstract: MCM-41-modified Ni/HZSM-5 catalyst was developed by impregnation method with high catalytic performance for sorbitol hydrogenation in water. Appropriate amount of MCM-41 addition can distinctly promote the improvement in the surface structure and modulation of acidic sites of the catalyst. The scission of C–O bond in the sorbitol molecule into liquid alkanes was easily carried out on the catalyst containing more Lewis acidic sites. - Highlights: • Ni/HZSM-5 promoted with MCM-41 is active for sorbitol hydrogenation to liquid alkanes. • Lewis acidic sites of Ni/HZSM-5 can be modulated by pure silica MCM-41. • MCM-41 added can distinctly decrease carbon deposition on the catalyst surface. - Abstract: Liquid fuels derived from renewable biomass are of great importance on the potential substitution for diminishing fossil fuels. The conversion of sorbitol (a product of biomass-derived glucose hydrogenation) into liquid alkanes such as pentane and hexane over the Ni/HZSM-5 catalysts with or without MCM-41 addition was investigated in the presence of hydrogen in water medium. The production distribution of sorbitol hydrogenation can be controlled by adjusting the acidity of the catalyst. The scission of C–C bond in the sorbitol molecule into light C 1 –C 4 alkanes was mainly carried out over Ni/HZSM-5 containing strong Brønsted acid sites, while C–O bond scission into heavier alkanes was dominated over the catalysts added by MCM-41 containing weak Lewis acid sites. The sorbitol conversion and total liquid alkanes selectivity were found to be 67.1% and 98.7% over 2%Ni/HZSM-5 modified by 40 wt% of MCM-41, whereas the corresponding value was 40% and 35.6% over 2%Ni/HZSM-5 in the absence of MCM-41. The effect of MCM-41 on the structure, acidity, and reducibility of Ni/HZSM-5 was investigated by using XRD, Py-IR, IR, and H 2 -TPR. Meanwhile, the resistance of carbon deposition over the catalyst modified by MCM-41 was studied by using TG

  3. Plasma glucagon-like peptide 1 and peptide YY levels are not altered in symptomatic fructose-sorbitol malabsorption

    DEFF Research Database (Denmark)

    Valeur, Jørgen; Øines, Eliann; Morken, Mette Helvik

    2008-01-01

    consecutive patients with functional abdominal complaints, referred to our clinic for investigation of self-reported food hypersensitivity, were included in the study and compared with 15 healthy volunteers. All subjects ingested a mixture of 25 g fructose and 5 g sorbitol. Pulmonary hydrogen and methane...... excretion and plasma glucagon-like peptide 1 (GLP-1) and peptide YY (PYY) levels were measured during the next 3 h. Both habitual and post-test symptoms were assessed. RESULTS: Malabsorption of fructose and sorbitol was present in 61% of the patients and 73% of the controls. Nevertheless, the patients...

  4. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  5. Aging of the Johari-Goldstein relaxation in the glass-forming liquids sorbitol and xylitol

    Science.gov (United States)

    Yardimci, Hasan; Leheny, Robert L.

    2006-06-01

    Employing frequency-dependent dielectric susceptibility we characterize the aging in two supercooled liquids, sorbitol and xylitol, below their calorimetric glass transition temperatures. In addition to the alpha relaxation that tracks the structural dynamics, the susceptibility of both liquids possesses a secondary Johari-Goldstein relaxation at higher frequencies. Following a quench through the glass transition, the susceptibility slowly approaches the equilibrium behavior. For both liquids, the magnitude of the Johari-Goldstein relaxation displays a dependence on the time since the quench, or aging time, that is quantitatively very similar to the age dependence of the alpha peak frequency. The Johari-Goldstein relaxation time remains constant during aging for sorbitol while it decreases slightly with age for xylitol. Hence, one cannot sensibly assign a fictive temperature to the Johari-Goldstein relaxation. This behavior contrasts with that of liquids lacking distinct Johari-Goldstein peaks for which the excess wing of the alpha peak tracks the main part of the peak during aging, enabling the assignment of a single fictive temperature to the entire spectrum. The aging behavior of the Johari-Goldstein relaxation time further calls into question the possibility that the relaxation time possesses stronger temperature dependence in equilibrium than is observed in the out-of-equilibrium state below the glass transition.

  6. Structural characterization of the thermostable Bradyrhizobium japonicumD-sorbitol dehydrogenase.

    Science.gov (United States)

    Fredslund, Folmer; Otten, Harm; Gemperlein, Sabrina; Poulsen, Jens Christian N; Carius, Yvonne; Kohring, Gert Wieland; Lo Leggio, Leila

    2016-11-01

    Bradyrhizobium japonicum sorbitol dehydrogenase is NADH-dependent and is active at elevated temperatures. The best substrate is D-glucitol (a synonym for D-sorbitol), although L-glucitol is also accepted, giving it particular potential in industrial applications. Crystallization led to a hexagonal crystal form, with crystals diffracting to 2.9 Å resolution. In attempts to phase the data, a molecular-replacement solution based upon PDB entry 4nbu (33% identical in sequence to the target) was found. The solution contained one molecule in the asymmetric unit, but a tetramer similar to that found in other short-chain dehydrogenases, including the search model, could be reconstructed by applying crystallographic symmetry operations. The active site contains electron density consistent with D-glucitol and phosphate, but there was not clear evidence for the binding of NADH. In a search for the features that determine the thermostability of the enzyme, the T m for the orthologue from Rhodobacter sphaeroides, for which the structure was already known, was also determined, and this enzyme proved to be considerably less thermostable. A continuous β-sheet is formed between two monomers in the tetramer of the B. japonicum enzyme, a feature not generally shared by short-chain dehydrogenases, and which may contribute to thermostability, as may an increased Pro/Gly ratio.

  7. Metabolic engineering of Escherichia coli to enhance shikimic acid production from sorbitol.

    Science.gov (United States)

    Liu, Xianglei; Lin, Jun; Hu, Haifeng; Zhou, Bin; Zhu, Baoquan

    2014-09-01

    Shikimic acid (SA) is the key synthetic material of Oseltamivir, which is an effective drug for the prevention and treatment of influenza. In this study, to block the downstream metabolic pathway of SA, the shikimate kinase isoenzyme genes aroK and aroL were deleted by Red recombination. Moreover, the key enzyme genes aroG, aroB, tktA and aroE of SA pathway were co-expressed by constructing the recombinant vector pETDuet-GBAE. As a result, SA production of E. coli BW25113 (∆aroL/aroK, DE3)/pETDuet-GBAE reached 1,077.6 mg/l when low amounts of sorbitol (5 g/l) were fed in shake flasks. The yield was 3.7 times that when glucose was used (P sorbitol was an optimized carbon source for the high efficient accumulation of SA for the first time, which was applicable to use in the industry for high yields and low consumption.

  8. Acoustic excitations in glassy sorbitol and their relation with the fragility and the boson peak

    Science.gov (United States)

    Ruta, B.; Baldi, G.; Scarponi, F.; Fioretto, D.; Giordano, V. M.; Monaco, G.

    2012-12-01

    We report a detailed analysis of the dynamic structure factor of glassy sorbitol by using inelastic X-ray scattering and previously measured light scattering data [B. Ruta, G. Monaco, F. Scarponi, and D. Fioretto, Philos. Mag. 88, 3939 (2008), 10.1080/14786430802317586]. The thus obtained knowledge on the density-density fluctuations at both the mesoscopic and macroscopic length scale has been used to address two debated topics concerning the vibrational properties of glasses. The relation between the acoustic modes and the universal boson peak (BP) appearing in the vibrational density of states of glasses has been investigated, also in relation with some recent theoretical models. Moreover, the connection between the elastic properties of glasses and the slowing down of the structural relaxation process in supercooled liquids has been scrutinized. For what concerns the first issue, it is here shown that the wave vector dependence of the acoustic excitations can be used, in sorbitol, to quantitatively reproduce the shape of the boson peak, supporting the relation between BP and acoustic modes. For what concerns the second issue, a proper study of elasticity over a wide spatial range is shown to be fundamental in order to investigate the relation between elastic properties and the slowing down of the dynamics in the corresponding supercooled liquid phase.

  9. Highly efficient red fluorescent organic light-emitting diodes by sorbitol-doped PEDOT:PSS

    Science.gov (United States)

    Zheng, Yan-Qiong; Yu, Jun-Le; Wang, Chao; Yang, Fang; Wei, Bin; Zhang, Jian-Hua; Zeng, Cheng-Hui; Yang, Yang

    2018-06-01

    This work shows a promising approach to improve device performance by optimizing the electron transport and hole injection layers for tetraphenyldibenzoperiflanthene (DBP):rubrene-based red fluorescent organic light-emitting diodes (OLEDs). We compared the effect of two electron transport layers (ETLs), and found that the rubrene/bathophenanthroline (Bphen) ETL-based OLED showed a much higher external quantum efficiency (EQE) (4.67%) than the Alq3 ETL-based OLED (EQE of 3.08%). The doping ratio of DBP in rubrene was tuned from 1.0 wt% to 4.5 wt%, and the 1.5 wt%-DBP:rubrene-based OLED demonstrated the highest EQE of 5.24% and lowest turn-on voltage of 2.2 V. Atomic force microscopy images indicated that 1.5 wt% DBP-doped rubrene film exhibited a regular strip shape, and this regular surface was favorable to the hole and electron recombination in the emitting layer. Finally, the sorbitol-doped poly(3, 4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) was used to further improve the EQE; doping with 6 wt% sorbitol achieved the highest current efficiency of 7.03 cd A‑1 and an EQE of 7.50%. The significantly enhanced performance implies that the hole injection is a limiting factor for DBP:rubrene-based red fluorescent OLEDs.

  10. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  11. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  12. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  13. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  14. Production of Starch Based Bioplastic from Cassava Peel Reinforced with Microcrystalline Celllulose Avicel PH101 Using Sorbitol as Plasticizer

    International Nuclear Information System (INIS)

    Maulida; Siagian, M; Tarigan, P

    2016-01-01

    The production of starch based bioplastics from cassava peel reeinforced with microcrystalline cellulose using sorbitol as plasticizer were investigated. Physical properties of bioplastics were determined by density, water uptake, tensile strength and Fourier Transform Infrared Spectroscopy. Bioplastics were prepared from cassava peel starch plasticized using sorbitol with variation of 20; 25; 30% (wt/v of sorbitol to starch) reinforced with microcrystalline celllulose (MCC) Avicel PH101 fillers with range of 0 to 6% (wt/wt of MCC to starch). The results showed improvement in tensile strength with higher MCC content up to 9, 12 mpa compared to non-reinforced bioplastics. This could be mainly attributed to the strong hydrogen bonds between MCC and starch. On the contrary, the addition of MCC decreased the elongation at break, density and water uptake. Fourier Transform Infrared Spectroscopy showed the functional groups of bioplastics, which the majority of O-H groups were found at the bioplastics with reinforcing filler MCC that represented substantial hydrogen bonds. The highest tensile strength value was obtained for bioplastic with MCC content 6% and sorbitol content 20%. With good adhesion between MCC and starch the production of bioplastics could be widely used as a substitute for conventional plastics with more benefits to the environment. (paper)

  15. Production of Starch Based Bioplastic from Cassava Peel Reinforced with Microcrystalline Celllulose Avicel PH101 Using Sorbitol as Plasticizer

    Science.gov (United States)

    Maulida; Siagian, M.; Tarigan, P.

    2016-04-01

    The production of starch based bioplastics from cassava peel reeinforced with microcrystalline cellulose using sorbitol as plasticizer were investigated. Physical properties of bioplastics were determined by density, water uptake, tensile strength and Fourier Transform Infrared Spectroscopy. Bioplastics were prepared from cassava peel starch plasticized using sorbitol with variation of 20; 25; 30% (wt/v of sorbitol to starch) reinforced with microcrystalline celllulose (MCC) Avicel PH101 fillers with range of 0 to 6% (wt/wt of MCC to starch). The results showed improvement in tensile strength with higher MCC content up to 9, 12 mpa compared to non-reinforced bioplastics. This could be mainly attributed to the strong hydrogen bonds between MCC and starch. On the contrary, the addition of MCC decreased the elongation at break, density and water uptake. Fourier Transform Infrared Spectroscopy showed the functional groups of bioplastics, which the majority of O-H groups were found at the bioplastics with reinforcing filler MCC that represented substantial hydrogen bonds. The highest tensile strength value was obtained for bioplastic with MCC content 6% and sorbitol content 20%. With good adhesion between MCC and starch the production of bioplastics could be widely used as a substitute for conventional plastics with more benefits to the environment.

  16. Hybrid neural network model for simulating sorbitol synthesis by glucose-fructose oxidoreductase in Zymomonas mobilis CP4

    Directory of Open Access Journals (Sweden)

    Bravo S.

    2004-01-01

    Full Text Available A hybrid neural network model for simulating the process of enzymatic reduction of fructose to sorbitol process catalyzed by glucose-fructose oxidoreductase in Zymomonas mobilis CP4 is presented. Data used to derive and validate the model was obtained from experiments carried out under different conditions of pH, temperature and concentrations of both substrates (glucose and fructose involved in the reaction. Sonicated and lyophilized cells were used as source of the enzyme. The optimal pH for sorbitol synthesis at 30º C is 6.5. For a value of pH of 6, the optimal temperature is 35º C. The neural network in the model computes the value of the kinetic relationship. The hybrid neural network model is able to simulate changes in the substrates and product concentrations during sorbitol synthesis under pH and temperature conditions ranging between 5 and 7.5 and 25 and 40º C, respectively. Under these conditions the rate of sorbitol synthesis shows important differences. Values computed using the hybrid neural network model have an average error of 1.7·10-3 mole.

  17. The effect of increasing chitosan on the characteristics of bioplastic from starch talas (Colocasia esculenta) using plasticizer sorbitol

    Science.gov (United States)

    Ginting, M. H. S.; Lubis, M.; Sidabutar, T.; Sirait, T. P.

    2018-03-01

    The aims of this research to determine the profile of starch gelatinization, bioplastic and the effect of increasing chitosan and sorbitol to the properties of tensile strength and elongation of break bioplastic. Preparation of bioplastics was used by casting method, that is 30% w/v solution of starch mixed with chitosan solution (0.5 w/v; 1 w/v; 1.5 w/v; 2 w/v; and 2.5 w/v) and plasticizer sorbitol (10 % w/w; 20 % w/w; 30 % w/w; 40 % w/w and 50 % w/w) were heated using a hotplate magnetic stirrer at 750C. The results of Rapid Visco Analyzer (RVA) obtained by starch and bioplastic gelatinization temperature of 72.94°C 77.72°C with peak viscosity 6632 cP and 3476 cP. Analysis of Fourier Transform Infrared (FTIR) and Scanning Electron Microscopy (SEM) obtained the change a functional group of bioplastic OH at wave number 3765 cm-1 and uneven chitosan distribution, and there is still an empty fraction. The addition of chitosan and sorbitol had an effect on tensile strength and elongation at break, tensile strength and elongation at break the highest of 8.36 MPa and 22.06% in starch composition 30%, 2.5 w/v chitosan and sorbitol 30% w/w.

  18. Trehalose and sorbitol alter the kinetic pattern of inactivation of glutamate dehydrogenase during drying in levitated microdroplets.

    Science.gov (United States)

    Lorenzen, Elke; Lee, Geoffrey

    2013-12-01

    A single-droplet acoustic levitator was used to determine the drying rate and the kinetics of inactivation of glutamate dehydrogenase in the presence of added trehalose or sorbitol. The solution was also spray dried under the same process condition of drying gas temperature on a bench-top machine. Both trehalose and sorbitol delay the point of onset of enzyme inactivation which lies after the critical point of drying. Both carbohydrates also reduce the apparent rate constant of inactivation calculated during the subsequent inactivation phase. The carbohydrates stabilise, therefore, the enzyme during droplet drying and particle formation mainly during the falling rate drying period. There is no difference between the stabilising effects of the two carbohydrates when examined as levitated single droplets. This suggests the importance of water replacement as a stabilising mechanism in the levitated droplets/particles. On spray drying, the trehalose stabilises the enzyme better than does the sorbitol at a drying gas (outlet) temperature of 60°C. This suggests glass formation with the trehalose but not the sorbitol during the very rapid drying process of small-atomised droplets in the spray dryer. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association.

  19. Fed-batch methanol feeding strategy for recombinant protein production by Pichia pastoris in the presence of co-substrate sorbitol.

    Science.gov (United States)

    Celik, Eda; Calik, Pinar; Oliver, Stephen G

    2009-09-01

    Batch-wise sorbitol addition as a co-substrate at the induction phase of methanol fed-batch fermentation by Pichia pastoris (Mut(+)) was proposed as a beneficial recombinant protein production strategy and the metabolic responses to methanol feeding rate in the presence of sorbitol was systematically investigated. Adding sorbitol batch-wise to the medium provided the following advantages over growth on methanol alone: (a) eliminating the long lag-phase for the cells and reaching 'high cell density production' at t = 24 h of the process (C(X) = 70 g CDW/l); (b) achieving 1.8-fold higher recombinant human erythropoietin (rHuEPO) (at t = 18 h); (c) reducing specific protease production 1.2-fold; (d) eliminating the lactic acid build-up period; (e) lowering the oxygen uptake rate two-fold; and (f) obtaining 1.4-fold higher overall yield coefficients. The maximum specific alcohol oxidase activity was not affected in the presence of sorbitol, and it was observed that sorbitol and methanol were utilized simultaneously. Thus, in the presence of sorbitol, 130 mg/l rHuEPO was produced at t = 24 h, compared to 80 mg/l rHuEPO (t = 24 h) on methanol alone. This work demonstrates not only the ease and efficiency of incorporating sorbitol to fermentations by Mut(+) strains of P. pastoris for the production of any bio-product, but also provides new insights into the metabolism of the methylotrophic yeast P. pastoris.

  20. Sorbitol increases muscle glucose uptake ex vivo and inhibits intestinal glucose absorption ex vivo and in normal and type 2 diabetic rats.

    Science.gov (United States)

    Chukwuma, Chika Ifeanyi; Islam, Md Shahidul

    2017-04-01

    Previous studies have suggested that sorbitol, a known polyol sweetener, possesses glycemic control potentials. However, the effect of sorbitol on intestinal glucose absorption and muscle glucose uptake still remains elusive. The present study investigated the effects of sorbitol on intestinal glucose absorption and muscle glucose uptake as possible anti-hyperglycemic or glycemic control potentials using ex vivo and in vivo experimental models. Sorbitol (2.5% to 20%) inhibited glucose absorption in isolated rat jejuna (IC 50 = 14.6% ± 4.6%) and increased glucose uptake in isolated rat psoas muscle with (GU 50 = 3.5% ± 1.6%) or without insulin (GU 50 = 7.0% ± 0.5%) in a concentration-dependent manner. Furthermore, sorbitol significantly delayed gastric emptying, accelerated digesta transit, inhibited intestinal glucose absorption, and reduced blood glucose increase in both normoglycemic and type 2 diabetic rats after 1 h of coingestion with glucose. Data of this study suggest that sorbitol exhibited anti-hyperglycemic potentials, possibly via increasing muscle glucose uptake ex vivo and reducing intestinal glucose absorption in normal and type 2 diabetic rats. Hence, sorbitol may be further investigated as a possible anti-hyperglycemic sweetener.

  1. Effects of olestra and sorbitol consumption on objective measures of diarrhea: impact of stool viscosity on common gastrointestinal symptoms.

    Science.gov (United States)

    McRorie, J; Zorich, N; Riccardi, K; Bishop, L; Filloon, T; Wason, S; Giannella, R

    2000-02-01

    The aim of this study was to determine the effects of olestra and sorbitol consumption on three accepted objective measures of diarrhea (stool output >250 g/day, liquid/watery stools, bowel movement frequency >3/day), and how stool composition influences reports of common gastrointestinal symptoms. A double-blind, placebo-controlled study compared the effects of sorbitol (40 g/day in candy), a poorly absorbed sugar-alcohol with known osmotic effects, with those of olestra (20 or 40 g/day in potato chips), a nonabsorbed fat, on objective measures of stool composition and GI symptoms. Sixty-six subjects resided on a metabolic ward for 12 days: 2 days lead-in, 4 days baseline, 6 days treatment. Sorbitol 40 g/day resulted in loose/liquid stools within 1-3 h of consumption. In contrast, olestra resulted in a dose-responsive stool softening effect after 2-4 days of consumption. Subjects reported "diarrhea" when mean stool apparent viscosity (peak force (PF), g) decreased from a perceived "normal" (mean +/- SE, 1355 +/- 224 g PF; firm stool) to loose (260 +/- 68 g PF) stool. Mean apparent viscosity of stool during treatment: placebo, 1363 +/- 280 g (firm); olestra 20 g/day 743 +/- 65 g (soft); olestra 40 g/day, 563 +/- 105 g (soft); and sorbitol 40 g/day, 249 +/- 53 g (loose). Of the 1098 stool samples collected, 38% (419/1098) were rated by subjects as "diarrhea," yet only 2% of treatment days (all in the sorbitol treatment group) met commonly accepted criteria for a clinical diarrhea. Sorbitol, but not olestra, increased the severity of abdominal cramping, urgency and nausea compared to placebo. Olestra consumption, at levels far in excess of normal snacking conditions, resulted in a gradual stool softening effect after several days of consumption, did not meet any of the three objective measures of diarrhea, and did not increase GI symptoms. Sorbitol consumption, at only 80% of the dose requiring a "laxative effect" information label, resulted in rapid onset loose

  2. A mannitol/sorbitol receptor stimulates dietary intake in Tribolium castaneum.

    Directory of Open Access Journals (Sweden)

    Tomoyuki Takada

    Full Text Available In insects, perception of chemical stimuli is involved in the acceptance or rejection of food. Gustatory receptors (Grs that regulate external signals in chemosensory organs have been found in many insects. Tribolium castaneum, a major pest of stored products, possesses over 200 Gr genes. An expanded repertoire of Gr genes appears to be required for diet recognition in species that are generalist feeders; however, it remains unclear whether T. castaneum recognizes a suite of chemicals common to many products or whether its feeding is activated by specific chemicals, and whether its Grs are involved in feeding behavior. It is difficult to determine the food preferences of T. castaneum based on dietary intake due to a lack of appropriate methodology. This study established a novel dietary intake estimation method using gypsum, designated the TribUTE (Tribolium Urges To Eat assay. For this assay, T. castaneum adults were fed a gypsum block without added organic compounds. Sweet preference was determined by adding sweeteners and measuring the amount of gypsum in the excreta. Mannitol was the strongest activator of T. castaneum dietary intake. In a Xenopus oocyte expression, TcGr20 was found to be responsible for mannitol and sorbitol responses, but not for responses to other tested non-volatile compounds. The EC50 values of TcGr20 for mannitol and sorbitol were 72.6 mM and 90.6 mM, respectively, suggesting that TcGr20 is a feasible receptor for the recognition of mannitol at lower concentrations. We used RNAi and the TribUTE assay to examine whether TcGr20 expression was involved in mannitol recognition. The amounts of excreta in TcGr20 dsRNA-injected adults decreased significantly, despite the presence of mannitol, compared to control adults. Taken together, our results indicate that T. castaneum adults recognized mannitol/sorbitol using the TcGr20 receptor, thereby facilitating the dietary intake of these compounds.

  3. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  4. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  5. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  6. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  8. Synergistic Inhibition of Protein Fibrillation by Proline and Sorbitol: Biophysical Investigations.

    Directory of Open Access Journals (Sweden)

    Sinjan Choudhary

    Full Text Available We report here interesting synergistic effects of proline and sorbitol, two well-known chemical chaperones, in the inhibition of fibrillation of two proteins, insulin and lysozyme. A combination of many biophysical techniques has been used to understand the structural morphology and modes of interaction of the chaperones with the proteins during fibrillation. Both the chaperones establish stronger polar interactions in the elongation and saturation stages of fibrillation compared to that in the native stage. However, when presented as a mixture, we also see contribution of hydrophobic interactions. Thus, a co-operative adjustment of polar and hydrophobic interactions between the chaperones and the protein surface seems to drive the synergistic effects in the fibrillation process. In insulin, this synergy is quantitatively similar in all the stages of the fibrillation process. These observations would have significant implications for understanding protein folding concepts, in general, and for designing combination therapies against protein fibrillation, in particular.

  9. Interfacial enhancement of polypropylene composites modified with sorbitol derivatives and siloxane-silsesquioxane resin

    Science.gov (United States)

    Dobrzyńska-Mizera, Monika; Dutkiewicz, Michał; Sterzyński, Tomasz; Di Lorenzo, Maria Laura

    2015-12-01

    Composites based on polypropylene (iPP) modified with a sorbitol derivative (NX8000) and siloxane-silsesquioxane resin (SiOPh) containing maleated polypropylene (MAPP) as compatibilizer were prepared by melt extrusion. Calorimetric investigations were carried out using differential scanning calorimetry (DSC), whereas the morphological and mechanical properties were investigated by scanning electron microscopy (SEM) and static tensile tests. DSC measurements revealed no influence of SiOPh and a slight effect of MAPP addition on the crystallization kinetics of polypropylene. Additionally, the introduction of MAPP into the iPP+NX8000+SiOPh composites increased plastic properties of the samples. All the above was attributed to the compatibilizing effect of MAPP which improved interfacial adhesion between iPP, NX8000 and SiOPh. This phenomenon was also confirmed by the SEM images illustrating more homogenous distribution of the filler in the compatibilized samples.

  10. Synergistic Inhibition of Protein Fibrillation by Proline and Sorbitol: Biophysical Investigations.

    Science.gov (United States)

    Choudhary, Sinjan; Save, Shreyada N; Kishore, Nand; Hosur, Ramakrishna V

    2016-01-01

    We report here interesting synergistic effects of proline and sorbitol, two well-known chemical chaperones, in the inhibition of fibrillation of two proteins, insulin and lysozyme. A combination of many biophysical techniques has been used to understand the structural morphology and modes of interaction of the chaperones with the proteins during fibrillation. Both the chaperones establish stronger polar interactions in the elongation and saturation stages of fibrillation compared to that in the native stage. However, when presented as a mixture, we also see contribution of hydrophobic interactions. Thus, a co-operative adjustment of polar and hydrophobic interactions between the chaperones and the protein surface seems to drive the synergistic effects in the fibrillation process. In insulin, this synergy is quantitatively similar in all the stages of the fibrillation process. These observations would have significant implications for understanding protein folding concepts, in general, and for designing combination therapies against protein fibrillation, in particular.

  11. Effective Production of Sorbitol and Mannitol from Sugars Catalyzed by Ni Nanoparticles Supported on Aluminium Hydroxide

    Directory of Open Access Journals (Sweden)

    Rodiansono Rodiansono

    2013-06-01

    Full Text Available Effective production of hexitols (sorbitol and mannitol was achieved from sugars by means of nickel nanoparticles supported on aluminium hydroxide (NiNPs/AlOH catalyst. NiNPs/AlOH catalyst was prepared by a simple and benign environmentally procedure using less amount of sodium hydroxide. ICP-AES and XRD analyses confirmed that the NiNPs/AlOH catalysts comprised a large amount of remained aluminium hydroxide (i.e. bayerite and gibbsite. The presence of aluminium hydroxide caused a high dispersion Ni metal species. The average Ni crystallite sizes that derived from the Scherrer`s equation for former R-Ni and NiNPs/AlOH were 8.6 nm and 4.1 nm, respectively. The catalyst exhibited high activity and selectivity both hydrogenolysis of disaccharides (sucrose and cellobiose and monosaccharides (glucose, fructose, and xylose at 403 K for 24 h. The NiNPs/AlOH catalyst was found to be reusable for at least five consecutive runs without any significant loss of activity and selectivity. © 2013 BCREC UNDIP. All rights reservedReceived: 21st December 2012; Revised: 7th February 2013; Accepted: 10th February 2013[How to Cite: Rodiansono, R., Shimazu, S. (2013. Effective Production of Sorbitol and Mannitol from Sug-ars Catalyzed by Ni Nanoparticles Supported on Aluminium Hydroxide. Bulletin of Chemical Reaction Engineering & Catalysis, 8 (1: 40-46. (doi:10.9767/bcrec.8.1.4290.40-46][Permalink/DOI: http://dx.doi.org/10.9767/bcrec.8.1.4290.40-46] | View in  |

  12. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  13. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  14. Proteins involved in difference of sorbitol fermentation rates of the toxigenic and nontoxigenic Vibrio cholerae El Tor strains revealed by comparative proteome analysis

    Science.gov (United States)

    2009-01-01

    Background The nontoxigenic V. cholerae El Tor strains ferment sorbitol faster than the toxigenic strains, hence fast-fermenting and slow-fermenting strains are defined by sorbitol fermentation test. This test has been used for more than 40 years in cholera surveillance and strain analysis in China. Understanding of the mechanisms of sorbitol metabolism of the toxigenic and nontoxigenic strains may help to explore the genome and metabolism divergence in these strains. Here we used comparative proteomic analysis to find the proteins which may be involved in such metabolic difference. Results We found the production of formate and lactic acid in the sorbitol fermentation medium of the nontoxigenic strain was earlier than of the toxigenic strain. We compared the protein expression profiles of the toxigenic strain N16961 and nontoxigenic strain JS32 cultured in sorbitol fermentation medium, by using fructose fermentation medium as the control. Seventy-three differential protein spots were found and further identified by MALDI-MS. The difference of product of fructose-specific IIA/FPR component gene and mannitol-1-P dehydrogenase, may be involved in the difference of sorbitol transportation and dehydrogenation in the sorbitol fast- and slow-fermenting strains. The difference of the relative transcription levels of pyruvate formate-lyase to pyruvate dehydrogenase between the toxigenic and nontoxigenic strains may be also responsible for the time and ability difference of formate production between these strains. Conclusion Multiple factors involved in different metabolism steps may affect the sorbitol fermentation in the toxigenic and nontoxigenic strains of V. cholerae El Tor. PMID:19589152

  15. Blending of soluble corn fiber with pullulan, sorbitol, or fructose attenuates glycemic and insulinemic responses in the dog and affects hydrolytic digestion in vitro.

    Science.gov (United States)

    de Godoy, M R C; Knapp, B K; Bauer, L L; Swanson, K S; Fahey, G C

    2013-08-01

    The objective of these experiments was to measure in vitro hydrolytic digestion and glycemic and insulinemic responses of select carbohydrate blends, all containing the novel carbohydrate soluble corn fiber (SCF). Two SCF that varied in their method of production were used to formulate the carbohydrate blends. One set of blends contained a SCF that was spray dried (SCFsd) and then blended with different amounts of either pullulan, sorbitol, or fructose. The other set of blends contained a SCF produced using longer evaporation time (SCF) and then blended with different ratios of pullulan, sorbitol, and fructose. Free sugar concentrations found in the individual SCFsd and SCF substrates were low but varied. Spray-dried soluble corn fiber had a reduced free sugar concentration compared with SCF (2.8 vs. 14.2%). Glucose was the main free sugar found in both SCFsd and SCF but at different concentrations (2.7 vs. 12.7%, respectively). The majority of the SCFsd blends were completely hydrolyzed to their monosaccharide components. Glucose accounted for most of the hydrolyzed monosaccharides for SCFsd and all the SCFsd blends. Hydrolyzed monosaccharide concentrations for the SCF:pullulan:sorbitol:fructose blends followed similar trends to the SCFsd blends where greater percentages of fructose and sorbitol resulted in decreased (P sorbitol. Total released monosaccharides were high in SCFsd blends containing either 50% fructose or sorbitol, but the combination resulted in reduced concentrations of glucose released (P sorbitol:fructose blends also had intermediate to high released monosaccharides as a result of in vitro hydrolytic digestion. All SCF blends resulted in decreased glycemic and insulinemic responses compared with the maltodextrin control (P sorbitol in the blends had the greatest impact on glycemic and insulinemic responses, even at concentrations as low as 5% of the blends. Overall, SCF and their blends may prove beneficial as components of low glycemic

  16. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  17. Putative metabolic pathway of mannitol and sorbitol and in sugarcane Provável via metabólica de manitol e sorbitol em cana-de-açúcar

    Directory of Open Access Journals (Sweden)

    Celso Luís Marino

    2003-12-01

    Full Text Available Until the mid 1950s, boron was believed to play an important role in the transport of sugars in plants. However, boron actually depends on sugar alcohols to be taken up by the plant. In some cases, the main sugars involved in this process are sorbitol and mannitol which form stable complexes with boron. In this study, the sequences of the SugarCane EST Genome Project (SUCEST database were searched for enzymes involved in the metabolism of these sugars by comparing them with enzymes from other organisms. Eighteen contigs from sugarcane (Saccharum sp. presented high similarity with 11 enzymes involved in the putative biosynthetic pathway of sorbitol and mannitol from fructose in sugarcane. Seven of these contigs had high homology with sequences deposited in GenBank.Até meados da década de 50 acreditava-se que o boro tinha uma importante função no transporte de açúcares em plantas. Na verdade, o boro depende de açúcares álcoois para serem mobilizados dentro da planta. Em alguns organismos os principais açúcares envolvidos neste processo são o sorbitol e o manitol, que formam complexos estáveis com o micronutriente. O objetivo deste estudo foi procurar seqüências no banco de dados SugarCane EST Genome Project (SUCEST que codificam enzimas participantes na via metabólica destes açúcares através da comparação de enzimas de outros organismos. Dezoito "contigs" de cana-de-açúcar (Saccharum sp. apresentaram similaridade com onze seqüências de enzimas que compõem a provável via metabólica de sorbitol e manitol a partir de frutose. Destes "contigs", sete apresentaram uma alta similaridade entre as seqüências depositadas no GenBank.

  18. D-sorbitol-induced phase control of TiO2 nanoparticles and its application for dye-sensitized solar cells

    Science.gov (United States)

    Shaikh, Shoyebmohamad F.; Mane, Rajaram S.; Min, Byoung Koun; Hwang, Yun Jeong; Joo, Oh-Shim

    2016-02-01

    Using a simple hydrothermal synthesis, the crystal structure of TiO2 nanoparticles was controlled from rutile to anatase using a sugar alcohol, D-sorbitol. Adding small amounts of D-sorbitol to an aqueous TiCl4 solution resulted in changes in the crystal phase, particle size, and surface area by affecting the hydrolysis rate of TiCl4. These changes led to improvements of the solar-to-electrical power conversion efficiency (η) of dye-sensitized solar cells (DSSC) fabricated using these nanoparticles. A postulated reaction mechanism concerning the role of D-sorbitol in the formation of rutile and anatase was proposed. Fourier-transform infrared spectroscopy, 13C NMR spectroscopy, and dynamic light scattering analyses were used to better understand the interaction between the Ti precursor and D-sorbitol. The crystal phase and size of the synthesized TiO2 nanocrystallites as well as photovoltaic performance of the DSSC were examined using X-ray diffraction, Raman spectroscopy, field-emission scanning electron microscopy, high-resolution transmission electron microscopy, and photocurrent density-applied voltage spectroscopy measurement techniques. The DSSC fabricated using the anatase TiO2 nanoparticles synthesized in the presence of D-sorbitol, exhibited an enhanced η (6%, 1.5-fold improvement) compared with the device fabricated using the rutile TiO2 synthesized without D-sorbitol.

  19. Determination of structural and mechanical properties, diffractometry, and thermal analysis of chitosan and hydroxypropylmethylcellulose (HPMC films plasticized with sorbitol

    Directory of Open Access Journals (Sweden)

    Jefferson Rotta

    2011-06-01

    Full Text Available In this work, the structural, mechanical, diffractometric, and thermal parameters of chitosan-hydroxypropylmethylcellulose (HPMC films plasticized with sorbitol were studied. Solutions of HPMC (2% w/v in water and chitosan (2% w/v in 2% acetic acid solution were prepared. The concentration of sorbitol used was 10% (w/w to both polymers. This solutions were mixed at different proportions (100/0; 70/30; 50/50; 30/70, and 0/100 of chitosan and HPMC, respectively, and 20 mL was cast in Petri dishes for further analysis of dried films. The miscibility of polymers was assessed by X-ray diffraction, scanning electronic microscopy (SEM, differential scanning calorimetry (DSC, and thermal gravimetric analysis (TGA. The results obtained indicate that the films are not fully miscible at a dry state despite the weak hydrogen bonding between the polymer functional groups.

  20. Conversion of biomass-derived sorbitol to glycols over carbon-materials supported Ru-based catalysts

    Science.gov (United States)

    Guo, Xingcui; Guan, Jing; Li, Bin; Wang, Xicheng; Mu, Xindong; Liu, Huizhou

    2015-11-01

    Ruthenium (Ru) supported on activated carbon (AC) and carbon nanotubes (CNTs) was carried out in the hydrogenolysis of sorbitol to ethylene glycol (EG) and 1,2-propanediol (1,2-PD) under the promotion of tungsten (WOx) species and different bases. Their catalytic activities and glycols selectivities strongly depended on the support properties and location of Ru on CNTs, owning to the altered metal-support interactions and electronic state of ruthenium. Ru located outside of the tubes showed excellent catalytic performance than those encapsulated inside the nanotubes. Additionally, the introduction of WOx into Ru/CNTs significantly improved the hydrogenolysis activities, and a complete conversion of sorbitol with up to 60.2% 1,2-PD and EG yields was obtained on RuWOx/CNTs catalyst upon addition of Ca(OH)2. Stability study showed that this catalyst was highly stable against leaching and poisoning and could be recycled several times.

  1. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  2. Intracellular trehalose and sorbitol synergistically promoting cell viability of a biocontrol yeast, Pichia anomala, for aflatoxin reduction.

    Science.gov (United States)

    Hua, Sui Sheng T; Hernlem, Bradley J; Yokoyama, Wallace; Sarreal, Siov Bouy L

    2015-05-01

    Pichia anomala (Wickerhamomyces anomalus) WRL-076 was discovered by a visual screening bioassay for its antagonism against Aspergillus flavus. The yeast was shown to significantly inhibit aflatoxin production and the growth of A. flavus. P. anomala is a potential biocontrol agent for reduction of aflatoxin in the food chain. Maintaining the viability of biocontrol agents in formulated products is a great challenge for commercial applications. Four media, NYG, NYGS, NYGT and NYGST are described which support good growth of yeast cells and were tested as storage formulations. Post growth supplement of 5 % trehalose to NYGST resulted in 83 % viable yeast cells after 12 months in cold storage. Intracellular sorbitol and trehalose concentrations were determined by HPLC analysis at the beginning of the storage and at the end of 12 month. Correlation of cell viability to both trehalose and sorbitol suggested a synergistic effect. Bonferroni (Dunn) t Test, Tukey's Studentized Range (HSD) Test and Duncan's Multiple Range Test, all showed that yeast cell viability in samples with both intracellular trehalose and sorbitol were significantly higher than those with either or none, at a 95 % confidence level. DiBAC4(5) and CFDA-AM were used as the membrane integrity fluorescent stains to create a two-color vital staining scheme with red and green fluorescence, respectively. Yeast cells stored in formulations NYG and NYGS with no detectable trehalose, displayed mostly red fluorescence. Yeast cells in NYGST+5T showed mostly green fluorescence.

  3. Freeze-dried snake antivenoms formulated with sorbitol, sucrose or mannitol: comparison of their stability in an accelerated test.

    Science.gov (United States)

    Herrera, María; Tattini, Virgilio; Pitombo, Ronaldo N M; Gutiérrez, José María; Borgognoni, Camila; Vega-Baudrit, José; Solera, Federico; Cerdas, Maykel; Segura, Alvaro; Villalta, Mauren; Vargas, Mariángela; León, Guillermo

    2014-11-01

    Freeze-drying is used to improve the long term stability of pharmaceutical proteins. Sugars and polyols have been successfully used in the stabilization of proteins. However, their use in the development of freeze-dried antivenoms has not been documented. In this work, whole IgG snake antivenom, purified from equine plasma, was formulated with different concentrations of sorbitol, sucrose or mannitol. The glass transition temperatures of frozen formulations, determined by Differential Scanning Calorimetry (DSC), ranged between -13.5 °C and -41 °C. In order to evaluate the effectiveness of the different stabilizers, the freeze-dried samples were subjected to an accelerated stability test at 40 ± 2 °C and 75 ± 5% relative humidity. After six months of storage at 40 °C, all the formulations presented the same residual humidity, but significant differences were observed in turbidity, reconstitution time and electrophoretic pattern. Moreover, all formulations, except antivenoms freeze-dried with mannitol, exhibited the same potency for the neutralization of lethal effect of Bothrops asper venom. The 5% (w:v) sucrose formulation exhibited the best stability among the samples tested, while mannitol and sorbitol formulations turned brown. These results suggest that sucrose is a better stabilizer than mannitol and sorbitol in the formulation of freeze-dried antivenoms under the studied conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Modulating β-lactoglobulin nanofibril self-assembly at pH 2 using glycerol and sorbitol.

    Science.gov (United States)

    Dave, Anant C; Loveday, Simon M; Anema, Skelte G; Jameson, Geoffrey B; Singh, Harjinder

    2014-01-13

    β-Lactoglobulin (β-lg) forms fibrils when heated at 80 °C, pH 2, and low ionic strength (sorbitol (0-50% w/v) on β-lg self-assembly at pH 2. Glycerol and sorbitol stabilize native protein structure and modulate protein functionality by preferential exclusion. In our study, both polyols decreased the rate of β-lg self-assembly but had no effect on the morphology of fibrils. The mechanism of these effects was studied using circular dichroism spectroscopy and SDS-PAGE. Sorbitol inhibited self-assembly by stabilizing β-lg against unfolding and hydrolysis, resulting in fewer fibrillogenic species, whereas glycerol inhibited nucleation without inhibiting hydrolysis. Both polyols increased the viscosity of the solutions, but viscosity appeared to have little effect on fibril assembly, and we believe that self-assembly was not diffusion-limited under these conditions. This is in agreement with previous reports for other proteins assembling under different conditions. The phenomenon of peptide self-assembly can be decoupled from protein hydrolysis using glycerol.

  5. Molecular motions in sucrose-PVP and sucrose-sorbitol dispersions-II. Implications of annealing on secondary relaxations.

    Science.gov (United States)

    Bhattacharya, Sisir; Bhardwaj, Sunny P; Suryanarayanan, Raj

    2014-10-01

    To determine the effect of annealing on the two secondary relaxations in amorphous sucrose and in sucrose solid dispersions. Sucrose was co-lyophilized with either PVP or sorbitol, annealed for different time periods and analyzed by dielectric spectroscopy. In an earlier investigation, we had documented the effect of PVP and sorbitol on the primary and the two secondary relaxations in amorphous sucrose solid dispersions (1). Here we investigated the effect of annealing on local motions, both in amorphous sucrose and in the dispersions. The average relaxation time of the local motion (irrespective of origin) in sucrose, decreased upon annealing. However, the heterogeneity in relaxation time distribution as well as the dielectric strength decreased only for β1- (the slower relaxation) but not for β2-relaxations. The effect of annealing on β2-relaxation times was neutralized by sorbitol while PVP negated the effect of annealing on both β1- and β2-relaxations. An increase in local mobility of sucrose brought about by annealing could be negated with an additive.

  6. X-ray crystal structure and small-angle X-ray scattering of sheep liver sorbitol dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Yennawar, Hemant [Pennsylvania State University, 8 Althouse Laboratory, University Park, PA 16802 (United States); Møller, Magda [Cornell High Energy Synchrotron Source, Ithaca, NY 14853 (United States); University of Copenhagen, DK-2100 Copenhagen (Denmark); Gillilan, Richard [Cornell High Energy Synchrotron Source, Ithaca, NY 14853 (United States); Yennawar, Neela, E-mail: nhy1@psu.edu [Pennsylvania State University, 8 Althouse Laboratory, University Park, PA 16802 (United States)

    2011-05-01

    The X-ray crystal structure and a small-angle X-ray scattering solution structure of sheep liver sorbitol dehydrogenase have been determined. The details of the interactions that enable the tetramer scaffold to be the functional biological unit have been analyzed. The X-ray crystal structure of sheep liver sorbitol dehydrogenase (slSDH) has been determined using the crystal structure of human sorbitol dehydrogenase (hSDH) as a molecular-replacement model. slSDH crystallized in space group I222 with one monomer in the asymmetric unit. A conserved tetramer that superposes well with that seen in hSDH (despite belonging to a different space group) and obeying the 222 crystal symmetry is seen in slSDH. An acetate molecule is bound in the active site, coordinating to the active-site zinc through a water molecule. Glycerol, a substrate of slSDH, also occupies the substrate-binding pocket together with the acetate designed by nature to fit large polyol substrates. The substrate-binding pocket is seen to be in close proximity to the tetramer interface, which explains the need for the structural integrity of the tetramer for enzyme activity. Small-angle X-ray scattering was also used to identify the quaternary structure of the tetramer of slSDH in solution.

  7. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  8. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  9. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  10. Sorbitol-based osmotic diarrhea: possible causes and mechanism of prevention investigated in rats.

    Science.gov (United States)

    Islam, Md Shahidul; Sakaguchi, Ei

    2006-12-21

    To study the possible causes of sorbitol (S)-based diarrhea and its mechanism of reduction by rice gruel (RG) in cecectomized rats. S was dissolved either in distilled water or in RG (50 g/L) and ingested as a single oral dose (1.2 g/kg body mass, containing 0.5 g/L phenol red as a recovery marker) by S (control) and S + RG groups (n = 7), respectively. This dose is over the laxative dose for humans. Animals were sacrificed exactly 1 h after dose ingestion, without any access to drinking water. The whole gastro-intestinal tract was divided into seven segments and sampled to analyze the S and marker remaining in its contents. Gastric-emptying and intestinal transit were comparatively slower in the S + RG group. Also, the S absorption index in the 3(rd) and last quarter of the small intestine (24.85 +/- 18.88% vs 0.0 +/- 0.0% and 39.09 +/- 32.75% vs 0.0 +/- 0.0%, respectively, P osmotic diarrhea. Where RG enhanced the absorption of S through passive diffusion, the degree of diarrhea was reduced in cecectomized rats.

  11. Colitis induced by sodium polystyrene sulfonate in sorbitol: A report of six cases.

    Science.gov (United States)

    Jacob, Sheba S K; Parameswaran, Ashok; Parameswaran, Sarojini Ashok; Dhus, Ubal

    2016-03-01

    Drug-related injury has been noted in virtually all organ systems, and recognition of the patterns of injury associated with medication enables modification of treatment and reduces the morbidity associated with the side effects of drugs. With the large number of new drugs being developed, documentation of the morphology of the changes seen as an adverse effect becomes important to characterize the pattern of injury. The pathologist is often the first to identify these abnormalities and correlate them with a particular drug. Kayexalate or sodium polystyrene sulfonate (SPS), a linear polymer derived from polystyrene containing sulfonic acid and sulfonate functional groups is used to treat hyperkalemia. It is usually administered with an osmotic laxative sorbitol orally or as retention enema. This combination has been implicated in causing damage to different parts of the gastrointestinal (GI) tract especially the colon and causes an established pattern of injury, recognizable by the presence of characteristic crystals, is presented to create a greater awareness of the Kayexalate colitis. This entity should be included in the differential diagnosis of lower GI mucosal injury in a setting of uremia and hyperkalemia.

  12. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  13. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  14. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  15. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  16. Incidence of bacteraemia following teeth extraction at the dental ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... genital or acquired heart disease, or those fitted with a valvular prosthesis ... ments published reports on the prevalence, aetiologic agents and risk ... cultured onto plates of blood agar, chocolate agar and MacConkey agar.

  17. Effects of dormancy progression and low-temperature response on changes in the sorbitol concentration in xylem sap of Japanese pear during winter season.

    Science.gov (United States)

    Ito, Akiko; Sugiura, Toshihiko; Sakamoto, Daisuke; Moriguchi, Takaya

    2013-04-01

    In order to elucidate which physiological event(s) are involved in the seasonal changes of carbohydrate dynamics during winter, we examined the effects of different low temperatures on the carbohydrate concentrations of Japanese pear (Pyrus pyrifolia (Burm.) Nakai). For four winter seasons, large increases in the sorbitol concentration of shoot xylem sap occurred during mid- to late December, possibly due to the endodormancy completion and low-temperature responses. When trees were kept at 15 °C from 3 November to 3 December in order to postpone the initiation and completion of chilling accumulation that would break endodormancy, sorbitol accumulation in xylem sap was always higher from trees with sufficient chilling accumulation than from trees that received insufficient chilling. However, an additional increase in xylem sap sorbitol occurred around late December in trees regardless of whether their chilling accumulation naturally progressed or was postponed. To examine different temperature effects more closely, we compared the carbohydrate concentrations of trees subjected to either 6 or 0 °C treatment. The sorbitol concentration in xylem sap tremendously increased at 0 °C treatment compared with 6 °C treatment. However, an additional increase in xylem sap sorbitol occurred at both the temperatures when sufficient chilling accumulated with a peak coinciding with the peak expression in shoots of the sorbitol transporter gene (PpSOT2). Interestingly, the total carbohydrate concentration of shoots tremendously increased with exposure to 0 °C compared with exposure to 6 °C, but was not affected by the amount of accumulated chilling. Instead, as chilling accumulated the ratio of sorbitol to total soluble sugars in shoots increased. We presumed that carbohydrates in the shoot tissues may be converted to sorbitol and loaded into the xylem sap so that the sorbitol accumulation patterns were synchronized with the progression of dormancy, whereas the total

  18. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  19. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  2. Vancomycin-resistant Enterococcus faecium bacteraemia as a complication of Kayexalate (sodium polystyrene sulfonate, SPS) in sorbitol-induced ischaemic colitis.

    Science.gov (United States)

    Cerrud-Rodriguez, Roberto Christian; Alcaraz-Alvarez, Diego; Chiong, Brian Bobby; Ahmed, Abdurhman

    2017-11-09

    We present the case report of an 80-year-old woman with chronic kidney disease stage G5 admitted to the hospital with fluid overload and hyperkalaemia. Sodium polystyrene sulfonate (SPS, Kayexalate) in sorbitol suspension was given orally to treat her hyperkalaemia, which precipitated an episode of SPS in sorbitol-induced ischaemic colitis with the subsequent complication of vancomycin-resistant Enterococcus (VRE) bacteraemia. SPS (Kayexalate) in sorbitol suspension has been implicated in the development of intestinal necrosis. Sorbitol, which is added as a cathartic agent to decrease the chance of faecal impaction, may be primarily responsible through several proposed mechanisms. The gold standard of diagnosis is the presence of SPS crystals in the colon biopsy. On a MEDLINE search, no previous reports of a VRE bacteraemia as a complication of biopsy-confirmed SPS in sorbitol ischaemic colitis were found. To the best of our knowledge, ours would be the first such case ever reported. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  3. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  4. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  5. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  6. Role of pH in oxidase variability of Aeromonas hydrophila.

    OpenAIRE

    Hunt, L K; Overman, T L; Otero, R B

    1981-01-01

    Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

  7. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  8. Effect of sorbitol, single, and multidose activated charcoal administration on carprofen absorption following experimental overdose in dogs.

    Science.gov (United States)

    Koenigshof, Amy M; Beal, Matthew W; Poppenga, Robert H; Jutkowitz, L Ari

    2015-01-01

    To compare the effectiveness of single dose activated charcoal, single dose activated charcoal with sorbitol, and multidose activated charcoal in reducing plasma carprofen concentrations following experimental overdose in dogs. Randomized, four period cross-over study. University research setting. Eight healthy Beagles. A 120 mg/kg of carprofen was administered orally to each dog followed by either (i) a single 2 g/kg activated charcoal administration 1 hour following carprofen ingestion (AC); (ii) 2 g/kg activated charcoal with 3.84 g/kg sorbitol 1 hour following carprofen ingestion (ACS); (iii) 2 g/kg activated charcoal 1 hour after carprofen ingestion and repeated every 6 hours for a total of 4 doses (MD); (iv) no treatment (control). Plasma carprofen concentrations were obtained over a 36-hour period following carprofen ingestion for each protocol. Pharmacokinetic modeling was performed and time versus concentration, area under the curve, maximum plasma concentration, time to maximum concentration, and elimination half-life were calculated and compared among the groups using ANOVA followed by Tukey's multiple comparisons test. Activated charcoal, activated charcoal with sorbitol (ACS), and multiple-dose activated charcoal (MD) significantly reduced the area under the curve compared to the control group. AC and MD significantly reduced the maximum concentration when compared to the control group. MD significantly reduced elimination half-life when compared to ACS and the control group. There were no other significant differences among the treatment groups. Activated charcoal and ACS are as effective as MD in reducing serum carprofen concentrations following experimental overdose in dogs. Prospective studies are warranted to evaluate the effectiveness of AC, ACS, and MD in the clinical setting. © Veterinary Emergency and Critical Care Society 2015.

  9. Conversion of cellulose and cellobiose into sorbitol catalyzed by ruthenium supported on a polyoxometalate/metal-organic framework hybrid.

    Science.gov (United States)

    Chen, Jinzhu; Wang, Shengpei; Huang, Jing; Chen, Limin; Ma, Longlong; Huang, Xing

    2013-08-01

    Cellulose and cellobiose were selectively converted into sorbitol over water-tolerant phosphotungstic acid (PTA)/metal- organic-framework-hybrid-supported ruthenium catalysts, Ru-PTA/MIL-100(Cr), under aqueous hydrogenation conditions. The goal was to investigate the relationship between the acid/metal balance of bifunctional catalysts Ru-PTA/MIL-100(Cr) and their performance in the catalytic conversion of cellulose and cellobiose into sugar alcohols. The control of the amount and strength of acid sites in the supported PTA/MIL-100(Cr) was achieved through the effective control of encapsulated-PTA loading in MIL-100(Cr). This design and preparation method led to an appropriately balanced Ru-PTA/MIL-100(Cr) in terms of Ru dispersion and hydrogenation capacity on the one hand, and acid site density of PTA/MIL-100(Cr) (responsible for acid-catalyzed hydrolysis) on the other hand. The ratio of acid site density to the number of Ru surface atoms (nA /nRu ) of Ru-PTA/MIL-100(Cr) was used to monitor the balance between hydrogenation and hydrolysis functions; the optimum balance between the two catalytic functions, that is, 8.84sorbitol of 57.9% at complete conversion of cellulose, and 97.1% yield in hexitols with a selectivity for sorbitol of 95.1% at complete conversion of cellobiose) were obtained using a Ru-PTA/MIL-100(Cr) catalyst with loadings of 3.2 wt % for Ru and 16.7 wt % for PTA. This research thus opens new perspectives for the rational design of acid/metal bifunctional catalysts for biomass conversion. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  11. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  12. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  13. Photosystem I shows a higher tolerance to sorbitol-induced osmotic stress than photosystem II in the intertidal macro-algae Ulva prolifera (Chlorophyta).

    Science.gov (United States)

    Gao, Shan; Zheng, Zhenbing; Gu, Wenhui; Xie, Xiujun; Huan, Li; Pan, Guanghua; Wang, Guangce

    2014-10-01

    The photosynthetic performance of the desiccation-tolerant, intertidal macro-algae Ulva prolifera was significantly affected by sorbitol-induced osmotic stress. Our results showed that photosynthetic activity decreased significantly with increases in sorbitol concentration. Although the partial activity of both photosystem I (PS I) and photosystem II (PS II) was able to recover after 30 min of rehydration, the activity of PS II decreased more rapidly than PS I. At 4 M sorbitol concentration, the activity of PS II was almost 0 while that of PS I was still at about one third of normal levels. Following prolonged treatment with 1 and 2 M sorbitol, the activity of PS I and PS II decreased slowly, suggesting that the effects of moderate concentrations of sorbitol on PS I and PS II were gradual. Interestingly, an increase in non-photochemical quenching occurred under these conditions in response to moderate osmotic stress, whereas it declined significantly under severe osmotic stress. These results suggest that photoprotection in U. prolifera could also be induced by moderate osmotic stress. In addition, the oxidation of PS I was significantly affected by osmotic stress. P700(+) in the thalli treated with high concentrations of sorbitol could still be reduced, as PS II was inhibited by 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU), but it could not be fully oxidized. This observation may be caused by the higher quantum yield of non-photochemical energy dissipation in PS I due to acceptor-side limitation (Y(NA)) during rehydration in seawater containing DCMU. © 2014 Scandinavian Plant Physiology Society.

  14. Utilization starch of jackfruit seed (Artocarpus heterophyllus) as raw material for bioplastics manufacturing using sorbitol as plasticizer and chitosan as filler

    Science.gov (United States)

    Lubis, M.; Harahap, M. B.; Manullang, A.; Alfarodo; Ginting, M. H. S.; Sartika, M.

    2017-01-01

    Starch is a natural polymer that can be used for the production of bioplastics because its source is abundant, renewable and easily degraded. Jackfruit seeds can be used as raw material for bioplastics because its contains starch. The aim of this study to determine the characteristics of jackfruit seeds and determine the effect of chitosan and sorbitol on the physicochemical properties of bioplastics from jackfruit seeds. Starch is extracted from jackfruit seeds were then characterized to determine its chemical composition. In the manufacture of bioplastics starch composition jackfruit seeds - chitosan used was 7: 3, 8: 2 and 9: 1 (g/g), while the concentration of sorbitol used was 20%, 25%, 30%, 35%, and 40% by weight dry ingredients. From the analysis of jackfruit seed starch obtained water content of 6.04%, ash content of 1.08%, the starch content of 70.22%, 16.39% amylose content, amylopectin content of 53.83%, 4.68% protein content, fat content 0.54%. The best conditions of starch bioplastics jackfruit seeds obtained at a ratio of starch: chitosan (w/w) = 8: 2 and the concentration of plasticizer sorbitol 25% with tensile strength 13.524 MPa. From the results of FT-IR analysis indicated an increase for the OH group and the group NH on bioplastics due to the addition of chitosan and sorbitol. The results of mechanical tests is further supported by analysis of scanning electron microscopy (SEM) showing jackfruit seed starch has a small granule size with the size of 7.6 μm and in bioplastics with chitosan filler and plasticizer sorbitol their fracture surface is smooth and slightly hollow compared bioplastics without fillers chitosan and plasticizer sorbitol.

  15. Analysis of Coliform Bacteria in WSPs at ALSCON Using Macconkey ...

    African Journals Online (AJOL)

    Two methods where used for this analysis namely: the membrane Filtration Technique (MFT) and the Multiple Tube Technique (MTT). The MFT was more precise, simple and faster in enumerating coliofrm bacteria per 100ml as compared with the MTT method. The two methods (MTT and MFT) was used to determine the ...

  16. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  17. Functional assignment of gene AAC16202.1 from Rhodobacter capsulatus SB1003: new insights into the bacterial SDR sorbitol dehydrogenases family.

    Science.gov (United States)

    Sola-Carvajal, Agustín; García-García, María Inmaculada; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2012-11-01

    Short-chain dehydrogenases/reductases (SDR) constitute one of the largest enzyme superfamilies with over 60,000 non-redundant sequences in the database, many of which need a correct functional assignment. Among them, the gene AAC16202.1 (NCBI) from Rhodobacter capsulatus SB1003 has been assigned in Uniprot both as a sorbitol dehydrogenase (#D5AUY1) and, as an N-acetyl-d-mannosamine dehydrogenase (#O66112), both enzymes being of biotechnological interest. When the gene was overexpressed in Escherichia coli Rosetta (DE3)pLys, the purified enzyme was not active toward N-acetyl-d-mannosamine, whereas it was active toward d-sorbitol and d-fructose. However, the relative activities toward xylitol and l-iditol (0.45 and 6.9%, respectively) were low compared with that toward d-sorbitol. Thus, the enzyme could be considered sorbitol dehydrogenase (SDH) with very low activity toward xylitol, which could increase its biotechnological interest for determining sorbitol without the unspecific cross-determination of added xylitol in food and pharma compositions. The tetrameric enzyme (120 kDa) showed similar catalytic efficiency (2.2 × 10(3) M(-1) s(-1)) to other sorbitol dehydrogenases for d-sorbitol, with an optimum pH of 9.0 and an optimum temperature of 37 °C. The enzyme was also more thermostable than other reported SDH, ammonium sulfate being the best stabilizer in this respect, increasing the melting temperature (T(m)) up to 52.9 °C. The enzyme can also be considered as a new member of the Zn(2+) independent SDH family since no effect on activity was detected in the presence of divalent cations or chelating agents. Finally, its in silico analysis enabled the specific conserved sequence blocks that are the fingerprints of bacterial sorbitol dehydrogenases and mainly located at C-terminal of the protein, to be determined for the first time. This knowledge will facilitate future data curation of present databases and a better functional assignment of newly described

  18. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  19. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  20. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  2. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  3. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  4. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  5. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  6. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  7. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  8. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  9. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  10. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  11. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  12. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  13. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  14. Autodisplay of active sorbitol dehydrogenase (SDH) yields a whole cell biocatalyst for the synthesis of rare sugars.

    Science.gov (United States)

    Jose, Joachim; von Schwichow, Steffen

    2004-04-02

    Whole cell biocatalysts are attractive technological tools for the regio- and enantioselective synthesis of products, especially from substrates with several identical reactive groups. In the present study, a whole cell biocatalyst for the synthesis of rare sugars from polyalcohols was constructed. For this purpose, sorbitol dehydrogenase (SDH) from Rhodobacter sphaeroides, a member of the short-chain dehydrogenase/reductase (SDR) family, was expressed on the surface of Escherichia coli using Autodisplay. Autodisplay is an efficient surface display system for Gram-negative bacteria and is based on the autotransporter secretion pathway. Transport of SDH to the outer membrane was monitored by SDS-PAGE and Western blotting of different cell fractions. The surface exposure of the enzyme could be verified by immunofluorescence microscopy and fluorescence activated cell sorting (FACS). The activity of whole cells displaying SDH at the surface was determined in an optical test. Specific activities were found to be 12 mU per 3.3 x 10(8) cells for the conversion of D-glucitol (sorbitol) to D-fructose, 7 mU for the conversion D-galactitol to D-tagatose, and 17 mU for the conversion of L-arabitol to L-ribulose. The whole cell biocatalyst obtained by surface display of SDH could also produce D-glucitol from D-fructose (29 mU per 3.3 x 10(8) cells).

  15. Real-time monitoring of sucrose, sorbitol, d-glucose and d-fructose concentration by electromagnetic sensing.

    Science.gov (United States)

    Harnsoongnoen, Supakorn; Wanthong, Anuwat

    2017-10-01

    Magnetic sensing at microwave frequencies for real-time monitoring of sucrose, sorbitol, d-glucose and d-fructose concentrations is reported. The sensing element was designed based on a coplanar waveguide (CPW) loaded with a split ring resonator (SRR), which was fabricated on a DiClad 880 substrate with a thickness of 1.6mm and relative permittivity (ε r ) of 2.2. The magnetic sensor was connected to a Vector Network Analyzer (VNA) and the electromagnetic interaction between the samples and sensor was analyzed. The magnitude of the transmission coefficient (S 21 ) was used as an indicator to detect the solution sample concentrations ranging from 0.04 to 0.20g/ml. The experimental results confirmed that the developed system using microwaves for the real-time monitoring of sucrose, sorbitol, d-glucose and d-fructose concentrations gave unique results for each solution type and concentration. Moreover, the proposed sensor has a wide dynamic range, high linearity, fast operation and low-cost. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Small Intestinal Bacterial Overgrowth May Increase the Likelihood of Lactose and Sorbitol but not Fructose Intolerance False Positive Diagnosis.

    Science.gov (United States)

    Perets, Tsachi Tsadok; Hamouda, Dalal; Layfer, Olga; Ashorov, Olga; Boltin, Doron; Levy, Sigal; Niv, Yaron; Dickman, Ram

    2017-08-01

    Small intestinal bacterial overgrowth (SIBO) is defined as a bacterial count of more than 10 5 colony-forming units per milliliter in duodenal aspirate. It shares many symptoms with carbohydrate intolerance, which makes the clinical distinction of the disorders difficult. The aim of the study was to examine the relationship between a positive carbohydrate breath test and the presence of SIBO suggested by a positive lactulose hydrogen breath test. The electronic database of the gastroenterology laboratory of a tertiary medical center was searched for all patients clinically tested for SIBO in 2012-2013 for whom previous results for lactose, fructose, and/or sorbitol breath test were available. The correlation between positive findings for carbohydrate intolerance and for SIBO was statistically analyzed. The study group included 349 patients, 231 female and 118 male, of mean age 53±19 years. All had symptoms of abdominal bloating and gas. There was a statistically significant difference in rates of a positive breath test for lactose and sorbitol at ≤90 minutes between patients who were positive and negative for SIBO [χ 2 (1)=12.8, p <0.01 and χ 2 (1)=9.5, p <0.01 respectively]. Findings for fructose were not significant. There was no effect of age or gender. SIBO may represent an important reversible cause of carbohydrate intolerance. It may be especially prudent to exclude SIBO patients with an early peak (≤90 minutes) in H 2 excretion. © 2017 by the Association of Clinical Scientists, Inc.

  17. Molecular Characterization of Human Atypical Sorbitol-Fermenting Enteropathogenic Escherichia coli O157 Reveals High Diversity.

    Science.gov (United States)

    Kossow, Annelene; Zhang, Wenlan; Bielaszewska, Martina; Rhode, Sophie; Hansen, Kevin; Fruth, Angelika; Rüter, Christian; Karch, Helge; Mellmann, Alexander

    2016-05-01

    Alongside the well-characterized enterohemorrhagic Escherichia coli (EHEC) O157:H7, serogroup O157 comprises sorbitol-fermenting typical and atypical enteropathogenic E. coli (EPEC/aEPEC) strains that carry the intimin-encoding gene eae but not Shiga toxin-encoding genes (stx). Since little is known about these pathogens, we characterized 30 clinical isolates from patients with hemolytic uremic syndrome (HUS) or uncomplicated diarrhea with respect to their flagellin gene (fliC) type and multilocus sequence type (MLST). Moreover, we applied whole-genome sequencing (WGS) to determine the phylogenetic relationship with other eae-positive EHEC serotypes and the composition of the rfbO157 region. fliC typing resulted in five fliC types (H7, H16, H34, H39, and H45). Isolates of each fliC type shared a unique ST. In comparison to the 42 HUS-associated E. coli (HUSEC) strains, only the stx-negative isolates with fliCH7 shared their ST with EHEC O157:H7/H(-) strains. With the exception of one O157:H(-) fliCH16 isolate, HUS was exclusively associated with fliCH7. WGS corroborated the separation of the fliCH7 isolates, which were closely related to the EHEC O157:H7/H(-) isolates, and the diverse group of isolates exhibiting different fliC types, indicating independent evolution of the different serotypes. This was also supported by the heterogeneity within the rfbO157 region that exhibited extensive recombinations. The genotypic subtypes and distribution of clinical symptoms suggested that the stx-negative O157 strains with fliCH7 were originally EHEC strains that lost stx The remaining isolates form a distinct and diverse group of atypical EPEC isolates that do not possess the full spectrum of virulence genes, underlining the importance of identifying the H antigen for clinical risk assessment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  19. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  20. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  1. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  3. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  4. A Novel Aqueous Micellar Two-Phase System Composed of Surfactant and Sorbitol for Purification of Pectinase Enzyme from Psidium guajava and Recycling Phase Components

    Science.gov (United States)

    Murshid, Fara Syazana; Manap, Mohd Yazid; Hussin, Muhaini

    2015-01-01

    A novel aqueous two-phase system composed of a surfactant and sorbitol was employed for the first time to purify pectinase from Psidium guajava. The influences of different parameters, including the type and concentration of the surfactant and the concentration and composition of the surfactant/sorbitol ratio, on the partitioning behavior and recovery of pectinase were investigated. Moreover, the effects of system pH and the crude load on purification fold and the yield of purified pectinase were studied. The experimental results indicated that the pectinase was partitioned into surfactant-rich top phase, and the impurities were partitioned into the sorbitol-rich bottom phase with the novel method involving an ATPS composed of 26% (w/w) Triton X-100 and 23% (w/w) sorbitol at 54.2% of the TLL crude load of 20% (w/w) at pH 6.0. The enzyme was successfully recovered by this method with a high purification factor of 15.2 and a yield of 98.3%, whereas the phase components were also recovered and recycled at rates above 96%. This study demonstrated that this novel ATPS method can be used as an efficient and economical alternative to the traditional ATPS for the purification and recovery of the valuable enzyme. PMID:25756051

  5. The vapour pressure of water as a function of solute concentration above aqueous solutions of fructose, sucrose, raffinose, erythritol, xylitol, and sorbitol

    DEFF Research Database (Denmark)

    Cooke, S.A.; Jonsdottir, Svava Osk; Westh, Peter

    2002-01-01

    The vapour pressure of water above an aqueous solution of sucrose at T = 298.06 K has been measured for 9 sucrose mole fractions up to 0.12. Vapour pressure measurements have also been made on aqueous solutions of meso-erythritol, xylitol, sorbitol, fructose, and raffinose at T = 317.99 K...

  6. A novel aqueous micellar two-phase system composed of surfactant and sorbitol for purification of pectinase enzyme from Psidium guajava and recycling phase components.

    Science.gov (United States)

    Amid, Mehrnoush; Murshid, Fara Syazana; Manap, Mohd Yazid; Hussin, Muhaini

    2015-01-01

    A novel aqueous two-phase system composed of a surfactant and sorbitol was employed for the first time to purify pectinase from Psidium guajava. The influences of different parameters, including the type and concentration of the surfactant and the concentration and composition of the surfactant/sorbitol ratio, on the partitioning behavior and recovery of pectinase were investigated. Moreover, the effects of system pH and the crude load on purification fold and the yield of purified pectinase were studied. The experimental results indicated that the pectinase was partitioned into surfactant-rich top phase, and the impurities were partitioned into the sorbitol-rich bottom phase with the novel method involving an ATPS composed of 26% (w/w) Triton X-100 and 23% (w/w) sorbitol at 54.2% of the TLL crude load of 20% (w/w) at pH 6.0. The enzyme was successfully recovered by this method with a high purification factor of 15.2 and a yield of 98.3%, whereas the phase components were also recovered and recycled at rates above 96%. This study demonstrated that this novel ATPS method can be used as an efficient and economical alternative to the traditional ATPS for the purification and recovery of the valuable enzyme.

  7. Foodborne transmission of sorbitol-fermenting Escherichia coli O157:[H7] via ground beef: an outbreak in northern France, 2011.

    Science.gov (United States)

    King, L A; Loukiadis, E; Mariani-Kurkdjian, P; Haeghebaert, S; Weill, F-X; Baliere, C; Ganet, S; Gouali, M; Vaillant, V; Pihier, N; Callon, H; Novo, R; Gaillot, O; Thevenot-Sergentet, D; Bingen, E; Chaud, P; de Valk, H

    2014-12-01

    Sorbitol-fermenting Escherichia coli O157:[H7] is a particularly virulent clone of E. coli O157:H7 associated with a higher incidence of haemolytic uraemic syndrome and a higher case fatality rate. Many fundamental aspects of its epidemiology remain to be elucidated, including its reservoir and transmission routes and vehicles. We describe an outbreak of sorbitol-fermenting E. coli O157:[H7] that occurred in France in 2011. Eighteen cases of paediatric haemolytic uraemic syndrome with symptom onset between 6 June and 15 July 2011 were identified among children aged 6 months to 10 years residing in northern France. A strain of sorbitol-fermenting E. coli O157:[H7] stx2a eae was isolated from ten cases. Epidemiological, microbiological and trace-back investigations identified multiply-contaminated frozen ground beef products bought in a supermarket chain as the outbreak vehicle. Strains with three distinct pulsotypes that were isolated from patients, ground beef preparations recovered from patients' freezers and from stored production samples taken at the production plant were indistinguishable upon molecular comparison. This investigation documents microbiologically confirmed foodborne transmission of sorbitol-fermenting of E. coli O157 via beef and could additionally provide evidence of a reservoir in cattle for this pathogen. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  8. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  9. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  10. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  11. Contrasting dynamics of fragile and non-fragile polyalcohols through the glass, and dynamical, transitions: A comparison of neutron scattering and dielectric relaxation data for sorbitol and glycerol.

    Science.gov (United States)

    Migliardo, F; Angell, C A; Magazù, S

    2017-01-01

    Glycerol and sorbitol are glass-forming hydrogen-bonded systems characterized by intriguing properties which make these systems very interesting also from the applications point of view. The goal of this work is to relate the hydrogen-bonded features, relaxation dynamics, glass transition properties and fragility of these systems, in particular to seek insight into their very different liquid fragilities. The comparison between glycerol and sorbitol is carried out by collecting the elastic incoherent neutron scattering (EINS) intensity as a function of temperature and of the instrumental energy resolution. Intensity data vs temperature and resolution are analyzed in terms of thermal restraint and Resolution Elastic Neutron Scattering (RENS) approaches. The number of OH groups, which are related to the connecting sites, is a significant parameter both in the glass transition and in the dynamical transition. On the other hand, the disordered nature of sorbitol is confirmed by the existence of different relaxation processes. From the applications point of view, glycerol and sorbitol have remarkable bioprotectant properties which make these systems useful in different technological and industrial fields. Furthermore, polyols are rich in glassforming liquid phenomenology and highly deserving of study in their own right. The comparison of EINS and calorimetric data on glycerol and sorbitol helps provide a connection between structural relaxation, dynamical transition, glass transition, and fragility. The evaluation of the inflection point in the elastic intensity behavior as a function of temperature and instrumental energy resolution provides a confirmation of the validity of the RENS approach. This article is part of a Special Issue entitled "Science for Life" Guest Editor: Dr. Austen Angell, Dr. Salvatore Magazù and Dr. Federica Migliardo. Copyright © 2016. Published by Elsevier B.V.

  12. Lactase Non-Persistence Genotyping: Comparison of Two Real-Time PCR Assays and Assessment of Concomitant Fructose/Sorbitol Malabsorption Rates.

    Science.gov (United States)

    Enko, Dietmar; Pollheimer, Verena; Németh, Stefan; Pühringer, Helene; Stolba, Robert; Halwachs-Baumann, Gabriele; Kriegshäuser, Gernot

    2016-01-01

    Genetic testing is a standard technique for the diagnosis of primary adult-type hypolactasia, also referred to as lactase non-persistence. The aim of this study was to compare the lactase gene (LCT) C/T-13910 polymorphism genotyping results of two commercially available real-time (RT)-PCR assays in patients referred to our outpatient clinic for primary lactose malabsorption testing. Furthermore, concomitant conditions of fructose/sorbitol malabsorption were assessed. Samples obtained from 100 patients were tested in parallel using the LCT T-13910C ToolSet for Light Cycler (Roche, Rotkreuz, Switzerland) and the LCT-13910C>T RealFast Assay (ViennaLab Diagnostics GmbH, Vienna, Austria). Additionally, patients were also screened for the presence of fructose/sorbitol malabsorption by functional hydrogen (H2)/methane (CH4) breath testing (HMBT). Cohen's Kappa (κ) was used to calculate the agreement between the two genotyping methods. The exact Chi-Square test was performed to compare fructose/sorbitol HMBT with LCT genotyping results. Twenty-one (21.0%) patients had a LCT C/C-13910 genotype suggestive of lactase non-persistence, and 79 (79.0%) patients were identified with either a LCT T/C-13910 or T/T-13910 genotype (i.e., lactase persistence). In all genotype groups, concordance between the two RT-PCR assays was 100%. Cohen's κ demonstrated perfect observed agreement (p sorbitol malabsorption was observed in 13/100 (13.0%) and 25/100 (25.0%) individuals, respectively. Both RT-PCR assays are robust and reliable LCT genotyping tools in a routine clinical setting. Concomitant fructose and/or sorbitol malabsorption should be considered in individuals with suspected lactase-non-persistence. However, standardization of clinical interpretation of laboratory HMBT results is required.

  13. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  14. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  15. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  16. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  17. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  18. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  19. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  20. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  1. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  2. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  3. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  4. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  5. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  6. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  7. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  8. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  9. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  10. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  11. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  12. Analise térmica e microscópica de laminados biodegradáveis obtidos a partir de farinha de mandioca, sorbitol e poli (butileno adipato co-tereftalato PBAT. Thermal and microscopic analysis of biodegradable laminates made from cassava flour, sorbitol and poly (butylene adipate-co-terephthalate PBAT - doi: 10.4025/actascitechnol.v35i4.13183

    Directory of Open Access Journals (Sweden)

    Henrique Tirolli Rett

    2013-10-01

    Full Text Available O objetivo deste trabalho foi desenvolver blendas de materiais laminados biodegradáveis, utilizando farinha de mandioca como fonte de amido, fibras naturais, sorbitol como plastificante e PBAT. Primeiro obteve-se peletes de três formulações diferentes e a partir destes, utilizou-se a termoprensagem a alta temperatura como alternativa na formação dos laminados. A caracterização foi feita através de microscopia eletrônica de varredura (MEV e calorimetria diferencia de varredura (CDV. A quantidade se sorbitol que melhor se ajustou à extrusão foi a de 15% (peso/peso; a formulação do laminado mais homogêneo, observada pela microscopia, foi de 55:40:15 (farinha/sorbitol/PBAT. As fibras ficaram dispersas por toda a superfície nos três tratamentos estudados, porém, por dentre eles, observaram-se zonas dispersas das fibras. Conforme se aumentou o teor de farinha, houve aumento no ponto de fusão dos laminados em comparação ao PBAT puro.Blends of biodegradable laminated materials were developed using cassava flour as starch and natural fibers source, sorbitol as a plasticizer and PBAT as a biodegradable polyester. After obtaining pellets from three different formulations, high temperature thermopressure was used to form laminates. The characterization was performed by scanning electron microscopy (SEM and by differential scanning calorimetry (DSC. The amount of sorbitol for the best extrusion process was 15% (weight/weight and the formulation of the best homogeneity observed by microscopy was 55:40:15 (flour/sorbitol/PBAT. Although fibers were dispersed throughout the surface in the three treatments, scattered areas of fibers could be found among them. As rates of flour increased, an increase in the melting point of the laminates occurred when compared to pure PBAT.  

  13. Primary double contrast study of the colon with citrate-sorbitol-barium suspension in the diagnosis of chronic colitis

    International Nuclear Information System (INIS)

    Sidorov, V.S.

    1991-01-01

    X-ray investigation of the colon was conducted in 292 patients with clinically diagnosed chronic colitis: standard 3-phase irrigoscopy-in 189 patients and a primary double contrast study of the colon with citrate-sorbitol-barium suspenzion - in 103. Basing on X-ray and morphological findings, the diagnosis was confirmed in 128 patients of the 1st group (68.2 %) and in 89 patients of the 2nd group (86 %). The primary double contrast study of the colon was found more effective as it permitted the detection of elements of the mucosal microcontours: transversal strips, not coinciding with haustration, focal granularity, diffuse granularity, small barium suspension depots or niches, nodular granularity. It permitted the recommendation of the method for a wide clinical use

  14. Copper-zinc electrodeposition in alkaline-sorbitol medium: Electrochemical studies and structural, morphological and chemical composition characterization

    Science.gov (United States)

    de Almeida, M. R. H.; Barbano, E. P.; de Carvalho, M. F.; Tulio, P. C.; Carlos, I. A.

    2015-04-01

    The galvanostatic technique was used to analyze the electrodeposition of Cu-Zn on to AISI 1010 steel electrode from an alkaline-sorbitol bath with various proportions of the metal ions in the bath: Cu70/Zn30, Cu50/Zn50 and Cu30/Zn70. Coloration of Cu-Zn films were whitish golden, light golden, golden/gray depending on the Cu2+/Zn2+ ratios in the electrodeposition bath, deposition current density (jdep) and charge density (qdep). The highest current efficiency was ∼54.0%, at jdep -1.0 mA cm-2 and qdep 0.40 C cm-2 in the Cu70/Zn30 bath. Energy dispersive spectroscopy indicated that electrodeposits produced from the bath Cu70/Zn30 showed higher Cu content at lower jdep. Also, for same jdep the Cu content increased with qdep. Scanning electron microscopy showed that Cu-Zn electrodeposits of high quality were obtained from the Cu70/Zn30 bath, since the films were fine-grained, except the obtained at jdep -20.0 mA cm-2 and qdep 10.0 C cm-2. Also, these electrodeposits did not present cracks. X-ray analysis of the Cu-Zn electrodeposits obtained at jdep -8.0, -20.0 and -40.0 mA cm-2, in each case, with qdep 2.0 and 10.0 C cm-2, in the Cu70/Zn30 bath, suggested the occurrence of a mixture of the following phases, CuZn, CuZn5 and Cu5Zn8. Galvanostatic electrodeposits of Cu-Zn obtained from sorbitol-alkaline baths exhibited whitish golden color, with good prospects for industrial applications, especially for decorative purposes.

  15. Association study of sorbitol dehydrogenase -888G>C polymorphism with type 2 diabetic retinopathy in Caucasian-Brazilians.

    Science.gov (United States)

    Ferreira, Fábio Netto; Crispim, Daisy; Canani, Luís Henrique; Gross, Jorge Luiz; dos Santos, Kátia Gonçalves

    2013-10-01

    Diabetic retinopathy (DR) is a common chronic complication of diabetes and remains the leading cause of blindness in working-aged people. Hyperglycemia increases glucose flux through the polyol pathway, in which aldose reductase converts glucose into intracellular sorbitol, which is subsequently converted to fructose by sorbitol dehydrogenase (SDH). The accelerated polyol pathway triggers a cascade of events leading to retinal vascular endothelial dysfunction and the eventual development of DR. Polymorphisms in the gene encoding aldose reductase have been consistently associated with DR. However, only two studies have analyzed the relationship between polymorphisms in the gene encoding SDH (SORD) and DR. In this case-control study, we investigated whether the -888G > C polymorphism (rs3759890) in the SORD gene is associated with the presence or severity of DR in 446 Caucasian-Brazilians with type 2 diabetes (241 subjects with and 205 subjects without DR). The -888G > C polymorphism was also examined in 105 healthy Caucasian blood donors, and the genotyping of this polymorphism was carried out by real-time PCR. The genotype and allele frequencies of the -888G > C polymorphism in patients with type 2 diabetes were similar to those of blood donors (G allele frequency = 0.16 in both groups of subjects). Similarly, the genotype and allele frequencies in patients with DR or the proliferative form of DR were similar to those of patients without this complication (P > 0.05 for all comparisons). Thus, our findings suggest that the -888G > C polymorphism in the SORD gene is not involved in the pathogenesis of DR in type 2 diabetes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  17. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  18. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  19. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  20. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  1. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  2. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  3. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  4. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  5. Structure and equilibria of Ca 2+-complexes of glucose and sorbitol from multinuclear ( 1H, 13C and 43Ca) NMR measurements supplemented with molecular modelling calculations

    Science.gov (United States)

    Pallagi, A.; Dudás, Cs.; Csendes, Z.; Forgó, P.; Pálinkó, I.; Sipos, P.

    2011-05-01

    Ca 2+-complexation of D-glucose and D-sorbitol have been investigated with the aid of multinuclear ( 1H, 13C and 43Ca) NMR spectroscopy and ab initio quantum chemical calculations. Formation constants of the forming 1:1 complexes have been estimated from one-dimensional 13C NMR spectra obtained at constant ionic strength (1 M NaCl). Binding sites were identified from 2D 1H- 43Ca NMR spectra. 2D NMR measurements and ab initio calculations indicated that Ca 2+ ions were bound in a tridentate manner via the glycosidic OH, the ethereal oxygen in the ring and the OH on the terminal carbon for the α- and β-anomers of glucose and for sorbitol simultaneous binding of four hydroxide moieties (C1, C2, C4 and C6) was suggested.

  6. Isolation and molecular identification of a Serratia strain from ...

    African Journals Online (AJOL)

    ONOS

    2010-04-05

    Apr 5, 2010 ... family Tupaiidae, mainly found in Southern China, India and Southeast Asia. The 17 known species of tree shrews ... for pathogenic coccus cultivation and nutrient agar culture dish and. MacConkey agar for pathogenic rod ...

  7. Molar concentrations of sorbitol and polyethylene glycol inhibit the Plasmodium aquaglyceroporin but not that of E. coli: involvement of the channel vestibules.

    Science.gov (United States)

    Song, Jie; Almasalmeh, Abdulnasser; Krenc, Dawid; Beitz, Eric

    2012-05-01

    The aquaglyceroporins of Escherichia coli, EcGlpF, and of Plasmodium falciparum, PfAQP, are probably the best characterized members of the solute-conducting aquaporin (AQP) subfamily. Their crystal structures have been elucidated and numerous experimental and theoretical analyses have been conducted. However, opposing reports on their rates of water permeability require clarification. Hence, we expressed EcGlpF and PfAQP in yeast, prepared protoplasts, and compared water and glycerol permeability of both aquaglyceroporins in the presence of different osmolytes, i.e. sucrose, sorbitol, PEG300, and glycerol. We found that water permeability of PfAQP strongly depends on the external osmolyte, with full inhibition by sorbitol, and increasing water permeability when glycerol, PEG300, and sucrose were used. EcGlpF expression did not enhance water permeability over that of non-expressing control protoplasts regardless of the osmolyte. Glycerol permeability of PfAQP was also inhibited by sorbitol, but to a smaller extent, whereas EcGlpF conducted glycerol independently of the osmolyte. Mixtures of glycerol and urea passed PfAQP equally well under isosmotic conditions, whereas under hypertonic conditions in a countercurrent with water, glycerol was clearly preferred over urea. We conclude that PfAQP has high and EcGlpF low water permeability, and explain the inhibiting effect of sorbitol on PfAQP by its binding to the extracellular vestibule. The preference for glycerol under hypertonic conditions implies that in a physiological setting, PfAQP mainly acts as a water/glycerol channel rather than a urea facilitator. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Polar silica-based stationary phases. Part II- Neutral silica stationary phases with surface bound maltose and sorbitol for hydrophilic interaction liquid chromatography.

    Science.gov (United States)

    Rathnasekara, Renuka; El Rassi, Ziad

    2017-07-28

    Two neutral polyhydroxylated silica bonded stationary phases, namely maltose-silica (MALT-silica) and sorbitol-silica (SOR-silica), have been introduced and chromatographically characterized in hydrophilic interaction liquid chromatography (HILIC) for a wide range of polar compounds. The bonding of the maltose and sorbitol to the silica surface was brought about by first converting bare silica to an epoxy-activated silica surface via reaction with γ-glycidoxypropyltrimethoxysilane (GPTMS) followed by attaching maltose and sorbitol to the epoxy surface in the presence of the Lewis acid catalyst BF 3 .ethereate. Both silica based columns offered the expected retention characteristics usually encountered for neutral polar surface. The retention mechanism is majorly based on solute' differential partitioning between an organic rich hydro-organic mobile phase (e.g., ACN rich mobile phase) and an adsorbed water layer on the surface of the stationary phase although additional hydrogen bonding was also responsible in some cases for solute retention. The MALT-silica column proved to be more hydrophilic and offered higher retention, separation efficiency and resolution than the SOR-silica column among the tested polar solutes such as derivatized mono- and oligosaccharides, weak phenolic acids, cyclic nucleotide monophosphate and nucleotide-5'-monophosphates, and weak bases, e.g., nucleobases and nucleosides. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Improving Performance and Operational Stability of Porcine Interferon-α Production by Pichia pastoris with Combinational Induction Strategy of Low Temperature and Methanol/Sorbitol Co-feeding.

    Science.gov (United States)

    Gao, Min-Jie; Zhan, Xiao-Bei; Gao, Peng; Zhang, Xu; Dong, Shi-Juan; Li, Zhen; Shi, Zhong-Ping; Lin, Chi-Chung

    2015-05-01

    Various induction strategies were investigated for effective porcine interferon-α (pIFN-α) production by Pichia pastoris in a 10 L fermenter. We found that pIFN-α concentration could be significantly improved with the strategies of low-temperature induction or methanol/sorbitol co-feeding. On this basis, a combinational strategy of induction at lower temperature (20 °C) with methanol/sorbitol co-feeding has been proposed for improvement of pIFN-α production. The results reveal that maximal pIFN-α concentration and antiviral activity reach the highest level of 2.7 g/L and 1.8 × 10(7) IU/mg with the proposed induction strategy, about 1.3-2.1 folds higher than those obtained with other sub-optimal induction strategies. Metabolic analysis and online multi-variable measurement results indicate that energy metabolic enrichment is responsible for the performance enhancement of pIFN-α production, as a large amount of ATP could be simultaneously produced from both formaldehyde oxidation pathway in methanol metabolism and tricarboxylic acid (TCA) cycle in sorbitol metabolism. In addition, the proposed combinational induction strategy enables P. pastoris to be resistant to high methanol concentration (42 g/L), which conceivably occur associating with the error-prone methanol over-feeding. As a result, the proposed combinational induction strategy simultaneously increased the targeted protein concentration and operational stability leading to significant improvement of pIFN-α production.

  10. The effect of the addition of sorbitol and glycerol towards the edible film characteristics of the belitung taro starch and the lime leaves as antimicrobial

    Science.gov (United States)

    Asria, Merry; Elizarni, Samah, dan Selfa Dewati

    2015-12-01

    Plastics have been generally used for food packaging, but plastics using causing environmental problem for as non biodegradable. Resolving the problem need another alternative packaging that environmental friendly such as the edible film as biodegradable packing material. This research intend to determination the effects of sorbitol and glycerol (concentration of 1%, 2%, 3%, and 4%) as addition to the edible film characteristics from the belitung taro starch (Xanthosoma sagitifolium). Lime leaves (Citrus aurantifolia) extract used as an antimicrobial film (2%, 4%, 6%, 8%, and 10% respectively). From the research obtained that using sorbitol has given more rigid and hard film texture, while glycerol provides more elastic and flexible texture. Sorbitol give best performance at 2% where thickness 0.17 mm; tensile strength 41.60 MPa; yield strength 34.28 MPa; modulus of elasticity 7983.71 MPa; and maximum strain 29,8%. While, glycerol (2%) provides thickness 0.18 mm; tensile strength 35.72 MPa; yield strength 30.78 MPa; modulus of elasticity 9065.90 MPa; and maximum strain 14.4% for best performance. SEM and FTIR analysis applied to determine film surface morphology's characterization and determine the functional groups of the film materials. The addition of lime leaves extract as antimicrobial gives the growth inhibition activity against the Staphylococcus aureus bacteria.

  11. JNK signaling pathway regulates sorbitol-induced Tau proteolysis and apoptosis in SH-SY5Y cells by targeting caspase-3.

    Science.gov (United States)

    Olivera Santa-Catalina, Marta; Caballero Bermejo, Montaña; Argent, Ricardo; Alonso, Juan C; Centeno, Francisco; Lorenzo, María J

    2017-12-15

    Growing evidence suggests that Diabetes Mellitus increases the risk of developing Alzheimer's disease. It is well known that hyperglycemia, a key feature of Diabetes Mellitus, may induce plasma osmolarity disturbances. Both hyperglycemia and hyperosmolarity promote the altered post-translational regulation of microtubule-associated protein Tau. Interestingly, abnormal hyperphosphorylation and cleavage of Tau have been proven to lead to the genesis of filamentous structures referred to as neurofibrillary tangles, the main pathological hallmark of Alzheimer's disease. We have previously described that hyperosmotic stress induced by sorbitol promotes Tau proteolysis and apoptosis in SH-SY5Y cells via caspase-3 activation. In order to gain insights into the regulatory mechanisms of such processes, in this work we explored the intracellular signaling pathways that regulate these events. We found that sorbitol treatment significantly enhanced the activation of conventional families of MAPK in SH-SY5Y cells. Tau proteolysis was completely prevented by JNK inhibition but not affected by either ERK1/2 or p38 MAPK blockade. Moreover, inhibition of JNK, but not ERK1/2 or p38 MAPK, efficiently prevented sorbitol-induced apoptosis and caspase-3 activation. In summary, we provide evidence that JNK signaling pathway is an upstream regulator of hyperosmotic stress-induced Tau cleavage and apoptosis in SH-SY5Y through the control of caspase-3 activation. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Fractal aspects of the flow and shear behaviour of free-flowable particle size fractions of pharmaceutical directly compressible excipient sorbitol.

    Science.gov (United States)

    Hurychová, Hana; Lebedová, Václava; Šklubalová, Zdenka; Dzámová, Pavlína; Svěrák, Tomáš; Stoniš, Jan

    Flowability of powder excipients is directly influenced by their size and shape although the granulometric influence of the flow and shear behaviour of particulate matter is not studied frequently. In this work, the influence of particle size on the mass flow rate through the orifice of a conical hopper, and the cohesion and flow function was studied for four free-flowable size fractions of sorbitol for direct compression in the range of 0.080-0.400 mm. The particles were granulometricaly characterized using an optical microscopy; a boundary fractal dimension of 1.066 was estimated for regular sorbitol particles. In the particle size range studied, a non-linear relationship between the mean particle size and the mass flow rate Q10 (g/s) was detected having amaximum at the 0.245mm fraction. The best flow properties of this fraction were verified with aJenike shear tester due to the highest value of flow function and the lowest value of the cohesion. The results of this work show the importance of the right choice of the excipient particle size to achieve the best flow behaviour of particulate material.Key words: flowability size fraction sorbitol for direct compaction Jenike shear tester fractal dimension.

  13. A comparative study on cellulose nanocrystals extracted from bleached cotton and flax and used for casting films with glycerol and sorbitol plasticisers.

    Science.gov (United States)

    Csiszár, Emilia; Nagy, Sebestyén

    2017-10-15

    Cellulose nanocrystals (CNCs) were released from bleached cotton and flax by a sulphuric acid hydrolysis with about 40 and 34% yield, respectively. The rod-like cotton-CNC particles were slightly longer and wider and had a less pronounced aggregation ability in aqueous suspension than the flax-CNC ones. Films were cast from the CNC suspensions with sorbitol and glycerol plasticisers. The concept behind this research was to explore how the plasticisers - with similar structure but different molecular weight - and their concentrations affect the perceptible and measured properties of CNC films. Results revealed that the type of plasticiser determined the morphology and the optical and tensile properties of films. The best quality CNC film with an averaged thickness of 50μm was obtained with 20% sorbitol from cotton-CNC. It was proved that behaviour of sorbitol and glycerol plasticisers in CNC films was very similar to that reported previously for starch films. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  16. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  18. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  19. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  20. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  1. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  4. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  5. Efecto del sorbitol sobre la relajación estructural en películas de gelatina en estado vítreo

    Directory of Open Access Journals (Sweden)

    Paulo Díaz-Calderón

    2015-12-01

    Full Text Available El objetivo de este trabajo fue evaluar el efecto del sorbitol sobre la cinética de relajación estructural de películas de gelatina almacenadas bajo la temperatura de transición vítrea (Tg. Películas de gelatina de bovino y sorbitol fueron preparadas mediante casting en frío. El sorbitol fue agregado en fracciones en peso (Qs de 0,0, 0,06 y 0,10. Las películas fueron acondicionadas en un ambiente de humedad relativa constante (44% utilizando una solución saturada de carbonato de potasio, obteniéndose fracciones de contenido de humedad en peso (Qw de 0,18, 0,16 y 0,18 respectivamente. La entalpía de relajación (∆H fue determinada mediante Calorimetría Diferencial de Barrido (DSC. Las muestras utilizadas en este estudio presentaron valores de Tg de 48ºC (Qs=0,0, 35ºC (Qs=0,06 y 30ºC (Qs=0,10. Luego de eliminar el historial térmico (30ºC sobre Tg, 15min, las muestras fueron almacenadas isotérmicamente a 10ºC bajo Tgonset entre 2 y 80 horas. La adición de sorbitol produjo una reducción signifi cativa (p<0,05 en la cinética de relajación estructural. La linealización del valor de entalpía de relajación (∆H en función del logaritmo del tiempo de almacenamiento mostró una reducción de la pendiente en las muestras plastifi cadas con sorbitol. La reducción en la cinética de relajación estaría relacionada con el efecto de empaquetamiento molecular asociado a la presencia de polioles en matrices en estado vítreo recientemente reportada mediante espectroscopía de positrones (PALS

  6. Jet-Fuel Range Hydrocarbons from Biomass-Derived Sorbitol over Ni-HZSM-5/SBA-15 Catalyst

    Directory of Open Access Journals (Sweden)

    Yujing Weng

    2015-12-01

    Full Text Available Aromatics and cyclic-hydrocarbons are the significant components of jet fuel with high energy-density. However, conventional technologies for bio-fuel production cannot produce these products without further aromatization and isomerization. In this work, renewable liquid fuel with high content of aromatics and cyclic-hydrocarbons was obtained through aqueous catalytic conversion of biomass sorbitol over Ni-HZSM-5/SBA-15 catalyst. Texture characteristics of the catalyst were determined by physisorption of N2, which indicated its bimodal pore structures were microporous (HZSM-5, pore width: 0.56 nm and mesoporous (SBA-15, pore width: 8 nm. The surface acidity included weak and strong acid sites, predominantly Lewis type, and was further confirmed by the NH3-TPD and Py-IR analysis. The catalytic performances were tested in a fixed-bed reactor under the conditions of 593 K, WHSV of 0.75 h−1, GHSV of 2500 h−1 and 4.0 MPa of hydrogen pressure, whereby oil yield of 40.4 wt. % with aromatics and cyclic-hydrocarbons content of 80.0% was obtained.

  7. Carbon-coated ceramic membrane reactor for the production of hydrogen by aqueous-phase reforming of sorbitol.

    Science.gov (United States)

    Neira D'Angelo, M F; Ordomsky, V; Schouten, J C; van der Schaaf, J; Nijhuis, T A

    2014-07-01

    Hydrogen was produced by aqueous-phase reforming (APR) of sorbitol in a carbon-on-alumina tubular membrane reactor (4 nm pore size, 7 cm long, 3 mm internal diameter) that allows the hydrogen gas to permeate to the shell side, whereas the liquid remains in the tube side. The hydrophobic nature of the membrane serves to avoid water loss and to minimize the interaction between the ceramic support and water, thus reducing the risks of membrane degradation upon operation. The permeation of hydrogen is dominated by the diffusivity of the hydrogen in water. Thus, higher operation temperatures result in an increase of the flux of hydrogen. The differential pressure has a negative effect on the flux of hydrogen due to the presence of liquid in the larger pores. The membrane was suitable for use in APR, and yielded 2.5 times more hydrogen than a reference reactor (with no membrane). Removal of hydrogen through the membrane assists in the reaction by preventing its consumption in undesired reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Influence of sorbitol on mechanical and physico-chemical properties of soy protein-based bioplastics processed by injection molding

    Directory of Open Access Journals (Sweden)

    Manuel Felix

    Full Text Available Abstract Soy Protein Isolate (SPI has been evaluated as useful candidate for the development of protein-based bioplastic materials processed by injection molding. The influence of sorbitol (SB as plasticizer in mechanical properties and water uptake capacity was evaluated in SPI-based bioplastics. A mixing rheometer that allows monitoring torque and temperature during mixing and a small-scale-plunger-type injection molding machine were used to obtain SPI/Plasticizer blends and SPI-based bioplastics, respectively. Dynamic measurements were carried out to obtain mechanical spectra of different bioplastics. Moreover, the mechanical characterization was supplemented with uniaxial tensile tests. Additionally, the influence of SB in water uptake capacity was also evaluated. The introduction of SB leads to increase the rigidity of bioplastics as well as the water uptake capacity after 24h, however it involves a decrease in strain at break. Final bioplastics are plastic materials with both adequate properties for the substitution of conventional petroleum plastics and high biodegradability.

  9. Severe Outbreak of Sorbitol-Fermenting Escherichia coli O157 via Unpasteurized Milk and Farm Visits, Finland 2012.

    Science.gov (United States)

    Jaakkonen, A; Salmenlinna, S; Rimhanen-Finne, R; Lundström, H; Heinikainen, S; Hakkinen, M; Hallanvuo, S

    2017-09-01

    Shiga toxin-producing, sorbitol-fermenting Escherichia coli O157 (SF O157) has emerged as a cause of severe human illness. Despite frequent human findings, its transmission routes and reservoirs remain largely unknown. Foodborne transmission and reservoir in cattle have been suspected, but with limited supporting evidence. This study describes the outbreak of SF O157 that occurred in Finland in 2012. The outbreak originated from a recreational farm selling unpasteurized milk, as revealed by epidemiologic and microbiological investigations, and involved six hospitalized children and two asymptomatic adults with culture-confirmed infection. An identical strain of SF O157 was isolated from patients, cattle and the farm environment, and epidemiologic analysis suggested unpasteurized milk as the vehicle of transmission. This study reports the first milkborne outbreak of SF O157, provides supporting evidence of cattle as a reservoir and highlights the health risks related to the consumption of unpasteurized milk. © 2017 The Authors. Zoonoses and Public Health Published by Blackwell Verlag GmbH.

  10. Free fatty acid suppositories are as effective as docusate sodium and sorbitol enemas in treating constipation in children.

    Science.gov (United States)

    Ormarsson, Orri Thor; Asgrimsdottir, Gudrun Marta; Loftsson, Thorsteinn; Stefansson, Einar; Lund, Sigrun Helga; Bjornsson, Einar Stefan

    2016-06-01

    A well-documented, clinically proven per rectum treatment for childhood constipation is needed. This phase two clinical trial evaluated the efficacy of suppositories containing free fatty acids (FFA) compared with Klyx docusate sodium and sorbitol enemas. A randomised, controlled, single-blind study was undertaken on 77 children aged between one and 17 who presented to an emergency department in Iceland and were diagnosed with constipation. In stage one, 23 patients were randomised to receive lower dose FFA suppositories or Klyx (n = 33). In stage two, 21 different patients were randomised to receive higher dose suppositories and compared with the same Klyx control subjects. The suppositories were effective at bowel emptying in 39% of the group who received the lower FFA doses and 81% of the group receiving higher doses, compared with 88% in the Klyx control group. Symptom relief was obtained in 30% of the group receiving the lower doses and 71% of the group receiving the higher doses, compared with 73% in the control group. The higher dose FFA suppositories were as effective as the Klyx enemas with regard to bowel emptying and symptom relief and might provide an important and less invasive alternative for childhood constipation. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  11. 1,2,3,4-bis(p-methylbenzylidene sorbitol) accelerates crystallization and improves hole mobility of poly(3-hexylthiophene)

    Science.gov (United States)

    Yuan, Nana; Huo, Hong

    2016-02-01

    The addition of 1,2,3,4-bis(p-methylbenzylidene sorbitol) (MDBS) does not change the nucleation mechanism or the crystal form of poly(3-hexylthiophene) (P3HT), but its presence increases the crystallization temperature (T c) of P3HT, decreases the crystallization half-time (t 1/2) and accelerates P3HT crystallization, which indicates that MDBS is an effective nucleating agent for P3HT. An acceleration of P3HT crystallization by the addition of MDBS decreases the crystalline size and crystallinity of P3HT, and enhances the connectivity between ordered regions of P3HT, leading to the hole mobility rising from 1.99 × 10-6 to 7.57 × 10-5 cm2 V-1s-1 in P3HT:PCBM blend based hole-only devices with sandwich configurations. Our results suggest that accelerating P3HT crystallization by adding a nucleating agent might be an important factor to improve the hole mobility and balance the electron and hole mobility in a photovoltaic blend.

  12. Green Synthesis of Silver Nanoparticles Using Polyalthia longifolia Leaf Extract along with D-Sorbitol: Study of Antibacterial Activity

    Directory of Open Access Journals (Sweden)

    S. Kaviya

    2011-01-01

    Full Text Available Synthesis of silver nanoparticles (AgNPs using Polyalthia longifolia leaf extract as reducing and capping agent along with D-sorbitol used to increase the stability of the nanoparticles has been reported. The reaction is carried out at two different concentrations (10−3 M and 10−4 M of silver nitrate, and the effect of temperature on the synthesis of AgNPs is investigated by stirring at room temperature (25°C and at 60°C. The UV-visible spectra of NPs showed a blue shift with increasing temperature at both concentrations. FT-IR analysis shows that the biomoites played an important role in the reduction of Ag+ ions and the growth of AgNPs. TEM results were utilized for the determination of the size and morphology of nanoparticles. The synthesized silver nanoparticles are found to be highly toxic against Gram-positive bacteria than Gram-negative bacteria.

  13. Chitin hydrolysis assisted by cell wall degrading enzymes immobilized of Thichoderma asperellum on totally cinnamoylated D-sorbitol beads

    International Nuclear Information System (INIS)

    Fernandes, Kátia F.; Cortijo-Triviño, David; Batista, Karla A.; Ulhoa, Cirano J.; García-Ruiz, Pedro A.

    2013-01-01

    In this study, cell wall degrading enzymes produced by Thrichoderma asperellum (TCWDE) were immobilized on totally cinnamoylated D-sorbitol (TCNSO) beads and used for chitin hydrolysis. In order to optimize immobilization efficiency, the reaction time was varied from 2 to 12 h and reactions were conducted in the presence or absence of Na 2 SO 4 . Immobilized enzymes were analysed concerning to thermal and operational stability. Immobilization in presence of Na 2 SO 4 was 54% more efficient than immobilization in absence of salt. After optimization, 32% of the total enzyme offered was immobilized, with 100% of bounding efficiency, measured as the relation between protein and enzyme immobilized. Free and TCNSO–TCWDE presented very similar kinetics with maximum hydrolysis reached at 90 min of reaction. Thermal stability of both free and TCNSO–TCWDE was similar, with losses in activity after 55 °C. Moreover, free and TCNSO–TCWDE retained 100% activity after 3 h incubation at 55 °C. TCNSO–TCWDE were used in a bath-wise reactor during 14 cycles, producing 1825 μg of N-acetylglucosamine (NAG) maintaining 83% of initial activity. - Highlights: • TCWDE immobilized on TCNSO, a support with highly hydrophobic character • New immobilization strategy for immobilization on a hydrophobic support • TCNSO–TCWDE were retained during washes and during incubation at 55 °C for 3 h

  14. Chitin hydrolysis assisted by cell wall degrading enzymes immobilized of Thichoderma asperellum on totally cinnamoylated D-sorbitol beads

    Energy Technology Data Exchange (ETDEWEB)

    Fernandes, Kátia F., E-mail: katia@icb.ufg.br [Departamento de Bioquímica e Biologia Molecular, Instituo de Ciências Biológicas, Universidade Federal de Goiás, Cx. Postal 131, 74001-970 Goiânia, GO (Brazil); Grupo de Química de Carbohidratos y Biotecnología de Alimentos (QCBA), Departamento de Química Orgánica, Facultad de Química, Universidad de Murcia, E-30100 Espinardo, Murcia (Spain); Cortijo-Triviño, David [Grupo de Química de Carbohidratos y Biotecnología de Alimentos (QCBA), Departamento de Química Orgánica, Facultad de Química, Universidad de Murcia, E-30100 Espinardo, Murcia (Spain); Batista, Karla A.; Ulhoa, Cirano J. [Departamento de Bioquímica e Biologia Molecular, Instituo de Ciências Biológicas, Universidade Federal de Goiás, Cx. Postal 131, 74001-970 Goiânia, GO (Brazil); García-Ruiz, Pedro A. [Grupo de Química de Carbohidratos y Biotecnología de Alimentos (QCBA), Departamento de Química Orgánica, Facultad de Química, Universidad de Murcia, E-30100 Espinardo, Murcia (Spain)

    2013-07-01

    In this study, cell wall degrading enzymes produced by Thrichoderma asperellum (TCWDE) were immobilized on totally cinnamoylated D-sorbitol (TCNSO) beads and used for chitin hydrolysis. In order to optimize immobilization efficiency, the reaction time was varied from 2 to 12 h and reactions were conducted in the presence or absence of Na{sub 2}SO{sub 4}. Immobilized enzymes were analysed concerning to thermal and operational stability. Immobilization in presence of Na{sub 2}SO{sub 4} was 54% more efficient than immobilization in absence of salt. After optimization, 32% of the total enzyme offered was immobilized, with 100% of bounding efficiency, measured as the relation between protein and enzyme immobilized. Free and TCNSO–TCWDE presented very similar kinetics with maximum hydrolysis reached at 90 min of reaction. Thermal stability of both free and TCNSO–TCWDE was similar, with losses in activity after 55 °C. Moreover, free and TCNSO–TCWDE retained 100% activity after 3 h incubation at 55 °C. TCNSO–TCWDE were used in a bath-wise reactor during 14 cycles, producing 1825 μg of N-acetylglucosamine (NAG) maintaining 83% of initial activity. - Highlights: • TCWDE immobilized on TCNSO, a support with highly hydrophobic character • New immobilization strategy for immobilization on a hydrophobic support • TCNSO–TCWDE were retained during washes and during incubation at 55 °C for 3 h.

  15. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  16. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  17. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  18. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  19. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  20. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  2. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  3. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  4. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  5. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  6. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  7. Variações do conteúdo de glucose, frutose e sorbitol em gemas e ramos de macieira durante a dormência Variations of glucose, frutose and sorbitol content in buds and stems of apple tree during the dormancy period

    Directory of Open Access Journals (Sweden)

    Ruy Inacio Neiva de Carvalho

    2006-12-01

    Full Text Available O objetivo deste trabalho foi determinar as variações do conteúdo de glucose, frutose e sorbitol em gemas e ramos de um ano de macieira durante o período de dormência. Os ramos da cultivar "Imperial Gala" foram coletados em Porto Amazonas-PR, em intervalos de 21 dias, de abril a agosto (19/04, 10/05, 31/05, 21/06, 12/07, 02/08 e 23/08, e receberam ou não tratamento com frio suplementar de 1.440 horas à temperatura de 4 a 7°C. As análises dos carboidratos foram realizadas em gemas e porções de ramos adjacentes às primeiras por cromatografia líquida de alta eficiência (HPLC. Ocorreu um acúmulo de glucose, frutose e sorbitol nas gemas de macieira durante a dormência. O acúmulo de glucose e frutose nos ramos aconteceu até o início de agosto quando, em seguida, houve redução, enquanto o sorbitol decresceu até junho e, em seguida, elevou-se até o final de agosto. O tratamento com frio ao longo da dormência modificou as variações dos conteúdos de carboidratos nas gemas e ramos de macieira.This research was aimed at evaluating the variations of glucose, frutose and sorbitol content in one year old buds and stems of apple trees during the dormancy period. The stems of cv. Imperial Gala were collected in Porto Amazonas, Parana State, Brazil, at intervals of 21 days from April to August (April 19th, May 10th, May 31st, June 21st, July 12th, August 2nd and August 23rd and were treated or not with 1,440 hours of chill (4 to 7°C. The carbohydrates were analysed in buds and stem tissues close to buds by high performance liquid chromatography (HPLC. There was an increase of glucose, frutose and sorbitol content in apple tree buds during the dormancy. An increase of glucose and frutose content in stems occured until August 2nd followed by a significative reduction, while the sorbitol content decreased until June 21st followed by an increase until August 31st. The chill treatment during the dormancy period modified the variations of

  8. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  9. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  10. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  11. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  12. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  13. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  14. Effect of cephalandra indica against advanced glycation end products, sorbitol accumulation and aldose reductase activity in homoeopathic formulation

    Directory of Open Access Journals (Sweden)

    Lalit Kishore

    2018-01-01

    Full Text Available Background: Extreme generation of free radicals leads to oxidative stress which has been apprehensive in several disease processes such as diabetic complications and vascular and neurodegenerative diseases. Objective: The present study was designed to evaluate the potential of homoeopathic preparations of Cephalandra indica L. against oxidative stress. Materials and Methods: Potencies of Cephalandra indica (mother tincture, 6C and 30C were procured from Dr. Willmar Schwabe India Pvt. Ltd. The antioxidant activity of Cephalandra indica was evaluated by employing various in vitro antioxidant methods. Results: The total phenol content was found to be 1905, 849 and 495 mg/g gallic acid equivalents in mother tincture, 6C and 30C of Cephalandra indica and total antioxidant capacity was found to be 2710, 759 and 510 μM/g ascorbic acid equivalents, respectively. Mother tincture, 6C and 30C of Cephalandra indica was found to have strong reducing power, 2,2-diphenyl-1-picrylhydrazyl radical, hydrogen peroxide, nitric oxide and superoxide radical scavenging activity. Percentage inhibition of AGEs formation by mother tincture, 6C and 30C of Cephalandra indica (10–50 μl was found to be 30.34%–91.77%, 29.98%–65.71% and 33.05%–57.75%, respectively. Mother tincture, 6C and 30C of Cephalandra indica showed inhibitory effect against sorbitol accumulation with IC50value of 26.12 μl, 203.10 μl and 897.3 μl, respectively, whereas, in aldose reductase inhibition assay, the IC50value was 32.54 μl, 175.02 μl and 834.34 μl, respectively. Conclusion: The results revealed that homoeopathic preparations of Cephalandra indica exhibit protective effect against oxidative stress.

  15. Influence of methanol/sorbitol co-feeding rate on pAOX1 induction in a Pichia pastoris Mut+ strain in bioreactor with limited oxygen transfer rate.

    Science.gov (United States)

    Carly, F; Niu, H; Delvigne, F; Fickers, P

    2016-04-01

    High Pichia pastoris biomass density could be obtained using high co-feeding rate of methanol and sorbitol in a fed-batch or continuous culture, while further higher feeding rate finally leads to oxygen limitation in bioreactor. In the literature, there is lack of report about AOX1 promoter regulation with regard to dissolved oxygen level (DO). Therefore, in this work, chemostat cultures were performed to investigate the cell growth, metabolism and regulation of the AOX1 promoter (pAOX1) regarding co-feeding rate of optimized methanol/sorbitol mixture (methanol fraction 0.60 C-mol/C-mol) using a P. pastoris Mut+/pAOX1-lacZ strain. The oxygen transfer rates (OTR) in bioreactor were kept in the range of typical values of large bioreactor, i.e., 4-8 g/(L h) if DO equals 30 % saturation or 5-10 g/(L h) if DO nears zero. For DO >0, an increase of the carbon fed led to an increase of pAOX1 induction. By contrast, when dissolved oxygen was completely depleted, methanol accumulated, causing a 30 % decrease of pAOX1 induction. However, this decrease is more likely to be lined to methanol accumulation than to low level of dissolved oxygen (sorbitol co-feeding allowed cells to adapt to oxygen transient limitations that often occur at industrial scale with reduced effect on pAOX1 induction. The optimal feeding rate tested here was 6.6 mmol C (DCW h)(-1) at an OTR of 8.28 g O2(L h)(-1) with over fivefold pAOX1 induction (probably directly associated with target protein productivity) compared with previous work.

  16. Preparation and properties of 1-tetradecanol/1,3:2,4-di-(3,4-dimethyl) benzylidene sorbitol gelatinous form-stable phase change materials

    International Nuclear Information System (INIS)

    Tian, Tuo; Song, Jian; Niu, Libo; Feng, Rongxiu

    2013-01-01

    Graphical abstract: The 1,3:2,4-di-(3,4-dimethyl) benzylidene sorbitol can self-assemble to form three-dimensional network and immobilized the 1-tetradecanol. As a result, the gel-to-sol transition temperature of the composite PCM increased and the 1-tetradecanol leakage decreased. Highlights: ► First used of 1,3:2,4-di-(3,4-dimethyl) benzylidene sorbitol in alcohol-based PCMs. ► A new method of doping with exfoliated graphite is presented. ► A possible mechanism for decreasing leakage has been proposed based on SEM results. ► The prepared composite PCMs showed a high-energy storage density. ► The addition of exfoliated graphite enhanced the thermal conductivity of the PCMs. - Abstract: A 1-tetradecanol (TD)/1,3:2,4-di-(3,4-dimethyl) benzylidene sorbitol (DMDBS) composite was prepared as a novel form-stable phase change material (PCM), and the properties of the composites such as the gel-to-sol transition temperature, the latent heat, the microstructure and the thermal storage performance were characterized. The composite was prepared by impregnating DMDBS into TD and the maximum feasible weight percentage of TD was determined to be 94.2 wt%. The gel-to-sol transition temperature of the composite PCM was 158.3–180.0 °C, which is well above the melting point of 1-tetradecanol. Differential scanning calorimeter (DSC) was used to determine the melting and freezing enthalpies of 1-tetradecanol in the composite PCM and the values are 218.5 and 215.3 J g −1 , respectively. Scanning electron microscopy (SEM) results showed that 1-tetradecanol dispersed in the three-dimensional network formed by DMDBS. The relationship between the amount of DMDBS additive and the leakage was also discussed. The thermal conductivity of the composite PCM was improved by doping with exfoliated graphite

  17. Association of prescription of oral sodium polystyrene sulfonate with sorbitol in an inpatient setting with colonic necrosis: a retrospective cohort study.

    Science.gov (United States)

    Watson, Maura A; Baker, Thomas P; Nguyen, Annie; Sebastianelli, Mary E; Stewart, Heather L; Oliver, David K; Abbott, Kevin C; Yuan, Christina M

    2012-09-01

    Colonic necrosis has been reported after sodium polystyrene sulfonate (SPS)/sorbitol use, but the incidence and relative risk (RR) are not established. Retrospective cohort study. 123,391 adult inpatients at a tertiary medical center. Receipt of SPS prescriptions (exposed) or a prescription other than SPS (unexposed internal comparison group) between September 1, 2001, and October 31, 2010. The main outcome measure was tissue-confirmed diagnosis of colonic necrosis, considered SPS-associated if SPS was prescribed 30 or fewer days before tissue accession date. Demographics, serum chemistry test results, hospital location, and International Classification of Diseases, Ninth Revision diagnostic codes. SPS was prescribed to 2,194 inpatients. 82 inpatient colonic necrosis cases were identified. 3 received oral SPS (1 gram per 4 milliliters of 33% sorbitol) 30 or fewer days before the colonic necrosis accession date (3.7% of inpatient colonic necrosis cases). The data were linked with 123,391 individuals who received inpatient prescriptions between the same dates. Colonic necrosis incidence was 0.14% (95% CI, 0.03%-0.40%) in those prescribed SPS versus 0.07% (95% CI, 0.05-0.08%) in those not prescribed SPS (RR, 2.10; 95% CI, 0.68-6.48; P = 0.2). The number needed to harm was 1,395 (95% CI, 298-5,100). Subgroup analysis (age >65 years; estimated glomerular filtration rate, sorbitol prescription was not associated significantly with an increased RR of colonic necrosis in this retrospective cohort analysis. Multivariate analysis would require retrospective clinical cohorts from larger or more than one hospital system(s). Published by Elsevier Inc.

  18. MATHEMATICAL MODELING, AUTOMATION AND CONTROL OF THE BIOCONVERSION OF SORBITOL TO SORBOSE IN THE VITAMIN C PRODUCTION PROCESS I. MATHEMATICAL MODELING

    Directory of Open Access Journals (Sweden)

    A. Bonomi

    1997-12-01

    Full Text Available In 1990, the Biotechnology and the Control Systems Groups of IPT started developing a system for the control and automation of fermentation processes, applied to the oxidation of sorbitol to sorbose by the bacteria Gluconobacter oxydans, the microbial step of the vitamin C production process, that was chosen as a case study. Initially, a thirteen-parameter model was fitted to represent the batch operation of the system utilizing a nonlinear regression analysis, the flexible polyhedron method. Based on these results, a model for the continuous process (with the same kinetic equations was constructed and its optimum operating point obtained

  19. A quantitative study of methanol/sorbitol co-feeding process of a Pichia pastoris Mut⁺/pAOX1-lacZ strain.

    Science.gov (United States)

    Niu, Hongxing; Jost, Laurent; Pirlot, Nathalie; Sassi, Hosni; Daukandt, Marc; Rodriguez, Christian; Fickers, Patrick

    2013-04-08

    One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Transient continuous cultures with a dilution rate of 0.023 h(-1) at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and heterologous protein productivities

  20. A quantitative study of methanol/sorbitol co-feeding process of a Pichia pastoris Mut+/pAOX1-lacZ strain

    Science.gov (United States)

    2013-01-01

    Background One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Results Transient continuous cultures with a dilution rate of 0.023 h-1 at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. Conclusion This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and

  1. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  2. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  3. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  4. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  6. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  8. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  9. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  11. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akgül, Oncü; Cerikçioğlu, Nilgün

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  12. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  13. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  14. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  15. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  16. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  18. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  19. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  20. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  1. Radiolysis of carbohydrates as studied by ESR and spin-trapping—II. Glycerol- d8 xylitol, dulcitol, d-sorbitol and d-mannitol

    Science.gov (United States)

    Kuwabara, M.; Zhang, Z.-Y.; Inanami, O.; Yoshii, G.

    Studies concerning the radicals produced in glycerol by reactions with OH radicals have been carried out by investigating deuterated glycerol (glycerol-d 8) by spin-trapping with 2-methyl-2-nitrosopropane. Free radicals produced in linear carbohydrates such as xylitol, dulcitol, D-sorbitol and D-mannitol by reactions with OH radicals as well as by direct γ-radiolysis have been also investigated by spin-trapping. The ESR spectra of the spin-trapped radicals were analysed on the basis of the results from ESR and spin-trapping experiments on glycerol and deuterated glycerol, and the formation of three radical species, CHO-CH-, CH 2-CO- and HO-CH-, due to both OH reactions and direct γ-radiolysis was confirmed for all compounds. The presence of a radical, -CO-CH-, was detected for xylitol, D-sorbitol and D-mannitol. General reactions processes induced by OH reactions or γ-radiolysis in the solid state are discussed.

  2. Determination of mannitol sorbitol and myo-inositol in olive tree roots and rhizospheric soil by gas chromatography and effect of severe drought conditions on their profiles.

    Science.gov (United States)

    Mechri, Beligh; Tekaya, Meriem; Cheheb, Hechmi; Hammami, Mohamed

    2015-01-01

    This study reports a method for the analysis of mannitol, sorbitol and myo-inositol in olive tree roots and rhizospheric soil with gas chromatography. The analytical method consists of extraction with a mixture of dichloromethane:methanol (2:1, v/v) for soil samples and a mixture of ethanol:water (80:20) for root samples, silylation using pyridine, hexamethyldisilazane (HMDS) and trimethylchlorosilane (TMCS). The recovery of mannitol sorbitol and myo-inositol (for extraction and analysis in dichloromethane:methanol and ethanol:water) was acceptable and ranged from 100.3 to 114.7%. The time of analysis was <24 min. Among identified polyols extracted from rhizosphere and roots of olive plants, mannitol was the major compound. A marked increase in mannitol content occurred in rhizosphere and roots of water-stressed plants, suggesting a much broader role of mannitol in stress response based on its ability to act as a compatible solute. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Hyperglycemia Promotes Schwann Cell De-differentiation and De-myelination via Sorbitol Accumulation and Igf1 Protein Down-regulation.

    Science.gov (United States)

    Hao, Wu; Tashiro, Syoichi; Hasegawa, Tomoka; Sato, Yuiko; Kobayashi, Tami; Tando, Toshimi; Katsuyama, Eri; Fujie, Atsuhiro; Watanabe, Ryuichi; Morita, Mayu; Miyamoto, Kana; Morioka, Hideo; Nakamura, Masaya; Matsumoto, Morio; Amizuka, Norio; Toyama, Yoshiaki; Miyamoto, Takeshi

    2015-07-10

    Diabetes mellitus (DM) is frequently accompanied by complications, such as peripheral nerve neuropathy. Schwann cells play a pivotal role in regulating peripheral nerve function and conduction velocity; however, changes in Schwann cell differentiation status in DM are not fully understood. Here, we report that Schwann cells de-differentiate into immature cells under hyperglycemic conditions as a result of sorbitol accumulation and decreased Igf1 expression in those cells. We found that de-differentiated Schwann cells could be re-differentiated in vitro into mature cells by treatment with an aldose reductase inhibitor, to reduce sorbitol levels, or with vitamin D3, to elevate Igf1 expression. In vivo DM models exhibited significantly reduced nerve function and conduction, Schwann cell de-differentiation, peripheral nerve de-myelination, and all conditions were significantly rescued by aldose reductase inhibitor or vitamin D3 administration. These findings reveal mechanisms underlying pathological changes in Schwann cells seen in DM and suggest ways to treat neurological conditions associated with this condition. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Enhanced porcine circovirus Cap protein production by Pichia pastoris with a fuzzy logic DO control based methanol/sorbitol co-feeding induction strategy.

    Science.gov (United States)

    Ding, Jian; Zhang, Chunling; Gao, Minjie; Hou, Guoli; Liang, Kexue; Li, Chunhua; Ni, Jianping; Li, Zhen; Shi, Zhongping

    2014-05-10

    Porcine circovirus Cap protein production by P. pastoris with strong AOX promoter suffered with the problems with traditional pure methanol induction: (1) inefficient methanol metabolism; (2) extensive oxygen supply load; (3) difficulty in stable DO control; (4) low protein titer. In this study, based on the difference of DO change patterns in response to methanol and sorbitol additions, a novel fuzzy control system was proposed to automatically regulate the co-feeding rates of methanol and sorbitol for efficient Cap protein induction. With aid of the proposed control system when setting DO control level at 10%, overall fermentation performance was significantly improved: (1) DO could be stably controlled under mild aeration condition; (2) methanol consumption rate could be restricted at moderate level and the major enzymes involved with methanol metabolism were largely activated; (3) Cap protein concentration reached a highest level of 198mg/L, which was about 64% increase over the best one using the pure methanol induction strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Hyperglycemia Promotes Schwann Cell De-differentiation and De-myelination via Sorbitol Accumulation and Igf1 Protein Down-regulation*

    Science.gov (United States)

    Hao, Wu; Tashiro, Syoichi; Hasegawa, Tomoka; Sato, Yuiko; Kobayashi, Tami; Tando, Toshimi; Katsuyama, Eri; Fujie, Atsuhiro; Watanabe, Ryuichi; Morita, Mayu; Miyamoto, Kana; Morioka, Hideo; Nakamura, Masaya; Matsumoto, Morio; Amizuka, Norio; Toyama, Yoshiaki; Miyamoto, Takeshi

    2015-01-01

    Diabetes mellitus (DM) is frequently accompanied by complications, such as peripheral nerve neuropathy. Schwann cells play a pivotal role in regulating peripheral nerve function and conduction velocity; however, changes in Schwann cell differentiation status in DM are not fully understood. Here, we report that Schwann cells de-differentiate into immature cells under hyperglycemic conditions as a result of sorbitol accumulation and decreased Igf1 expression in those cells. We found that de-differentiated Schwann cells could be re-differentiated in vitro into mature cells by treatment with an aldose reductase inhibitor, to reduce sorbitol levels, or with vitamin D3, to elevate Igf1 expression. In vivo DM models exhibited significantly reduced nerve function and conduction, Schwann cell de-differentiation, peripheral nerve de-myelination, and all conditions were significantly rescued by aldose reductase inhibitor or vitamin D3 administration. These findings reveal mechanisms underlying pathological changes in Schwann cells seen in DM and suggest ways to treat neurological conditions associated with this condition. PMID:25998127

  6. A comparative study of glycerol and sorbitol as co-substrates in methanol-induced cultures of Pichia pastoris: temperature effect and scale-up simulation.

    Science.gov (United States)

    Berrios, Julio; Flores, María-Olga; Díaz-Barrera, Alvaro; Altamirano, Claudia; Martínez, Irene; Cabrera, Zaida

    2017-03-01

    The production of recombinant proteins by Pichia pastoris under AOX1 promoter is usually performed using methanol together with either glycerol or sorbitol as co-substrate. Although both co-substrates have been widely used, comparative studies are scarce. In addition, these comparisons have been performed at different specific growth rate (µ) that it is well known that has an important effect on productivity. Thus, the effect of using these co-substrates on the production of Rhyzopus oryzae lipase (ROL) by P. pastoris was compared in continuous cultures growing at the same µ at either 22 or 30 °C. Results show that using glycerol as co-substrate led to higher volumetric productivities, and lower specific and volumetric methanol consumption rates. Scale-up simulation with 10-10,000 L bioreactor sizes indicated that glycerol produced the highest volumetric productivity of ROL with lower aeration requirements. Therefore, glycerol rises as a better option than sorbitol in ROL production.

  7. Protein crowding in solution, frozen and freeze-dried states: small-angle neutron and X-ray scattering study of lysozyme/sorbitol/water systems

    Science.gov (United States)

    Krueger, Susan; Khodadadi, Sheila; Clark, Nicholas; McAuley, Arnold; Cristiglio, Viviana; Theyencheri, Narayanan; Curtis, Joseph; Shalaev, Evgenyi

    2015-03-01

    For effective preservation, proteins are often stored as frozen solutions or in glassy states using a freeze-drying process. However, aggregation is often observed after freeze-thaw or reconstitution of freeze-dried powder and the stability of the protein is no longer assured. In this study, small-angle neutron and X-ray scattering (SANS and SAXS) have been used to investigate changes in protein-protein interaction distances of a model protein/cryoprotectant system of lysozyme/sorbitol/water, under representative pharmaceutical processing conditions. The results demonstrate the utility of SAXS and SANS methods to monitor protein crowding at different stages of freezing and drying. The SANS measurements of solution samples showed at least one protein interaction peak corresponding to an interaction distance of ~ 90 Å. In the frozen state, two protein interaction peaks were observed by SANS with corresponding interaction distances at 40 Å as well as 90 Å. On the other hand, both SAXS and SANS data for freeze-dried samples showed three peaks, suggesting interaction distances ranging from ~ 15 Å to 170 Å. Possible interpretations of these interaction peaks will be discussed, as well as the role of sorbitol as a cryoprotectant during the freezing and drying process.

  8. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  9. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  10. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  11. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  12. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  13. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  14. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ­ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 µg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 µg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 µg/ml to FCZ and three (10.3% were resistant (MIC value >64 µg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 µg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  16. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  17. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 µm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 °C (optimum, 42 °C). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) ( = JCM 19592(T) =KCTC 4143(T)). © 2015 IUMS.

  18. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  19. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  20. Microbial handflora of nursing services workers in a Nigerian ...

    African Journals Online (AJOL)

    The samples were inoculated onto dried Blood agar, MacConkey agar, Mannitol salt agar and Muellar-Hinton agar plates and incubated aerobically at 37°C for 18-24 hours. Overall, 38% of the cultures yielded growth, while 52% of the nurses yielded growth as against 75% of the ward-maids. The bacterial isolates are ...

  1. A single amino acid change (Y318F) in the L-arabitol dehydrogenase (LadA) from Aspergillus niger results in a significant increase in affinity for D-sorbitol

    Science.gov (United States)

    2009-01-01

    Background L-arabitol dehydrogenase (LAD) and xylitol dehydrogenase (XDH) are involved in the degradation of L-arabinose and D-xylose, which are among the most abundant monosaccharides on earth. Previous data demonstrated that LAD and XDH not only differ in the activity on their biological substrate, but also that only XDH has significant activity on D-sorbitol and may therefore be more closely related to D-sorbitol dehydrogenases (SDH). In this study we aimed to identify residues involved in the difference in substrate specificity. Results Phylogenetic analysis demonstrated that LAD, XDH and SDH form 3 distinct groups of the family of dehydrogenases containing an Alcohol dehydrogenase GroES-like domain (pfam08240) and likely have evolved from a common ancestor. Modelling of LadA and XdhA of the saprobic fungus Aspergillus niger on human SDH identified two residues in LadA (M70 and Y318), that may explain the absence of activity on D-sorbitol. While introduction of the mutation M70F in LadA of A. niger resulted in a nearly complete enzyme inactivation, the Y318F resulted in increased activity for L-arabitol and xylitol. Moreover, the affinity for D-sorbitol was increased in this mutant. Conclusion These data demonstrates that Y318 of LadA contributes significantly to the substrate specificity difference between LAD and XDH/SDH. PMID:19674460

  2. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  3. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  4. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  5. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  6. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  7. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  8. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  9. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  10. Comparative study of efficacy, tolerability and compliance of oral iron preparations (iron edetate, iron polymatose complex) and intramuscular iron sorbitol in iron deficiency anaemia in children

    International Nuclear Information System (INIS)

    Afzal, M.; Qureshi, S.M.; Lutafullah, M.

    2009-01-01

    To compare the efficacy, tolerability and compliance of oral iron preparations(iron edetate and Iron polymaltose complex) with each other and with intramuscular iron sorbitol in iron deficiency anaemia in children. A Randomized Controlled Trial (RCT) was carried out at the Paediatric Department of Combined Military Hospital (CMH) from January 2006 to December 2007. In total 146 children, up to 12 years age having haemoglobin (Hb%) less than 8 gm% were included. They were randomly distributed into three groups. Group A(64 cases) received oral sodium iron edetate (SIE), Group B (40 cases) received oral iron polymaltose complex (IPC) and group C (42 cases) received intramuscular iron sorbitol (IS) in recommended dosages. Rise in Hb%>10 gm% was kept as desired target. Maximum duration of treatment planned was 2 weeks for parenteral iron (group C) and 12 weeks for oral iron (groups A and B). Haematological parameters- Hb%, mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), mean corpuscular haemoglobin concentration (MCHC) were measured at induction followed at 2 weeks, 4 weeks, 8 weeks and 12 weeks after start of treatment. Compliance and drop out rates were determined on each visit. Data was analyzed using SPSS version 10. ANOVA was used to analyze difference in rise in Hb% at various intervals. Statistically significant increase in mean Hb%, MCV, MCHC after 02 weeks was observed in group C (IS). Rise in these parameters became significant in group A (SIE) and B (IPC) after 04 weeks. Persistent rise was observed in oral groups at 08 and 12 weeks. Rise in Hb% was much faster in group C (IS). It took 2 weeks to achieve mean Hb% > 10 gm% and compliance rate was 40.5%, while to achieve same target, duration required was 8 weeks in group A (SIE) and 12 weeks in group B (IPC) and compliance rate was 39% and 30% respectively. Adverse effects were much more common with group A (SIE) as compared to other two groups. Intramuscular iron sorbitol is a reliable and

  11. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  13. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  14. Stepwise metabolic engineering of Gluconobacter oxydans WSH-003 for the direct production of 2-keto-L-gulonic acid from D-sorbitol.

    Science.gov (United States)

    Gao, Lili; Hu, Yudong; Liu, Jie; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2014-07-01

    2-Keto-L-gulonic acid (2-KLG), the direct precursor of vitamin C, is currently produced by a two-step fermentation route from D-sorbitol. However, this route involves three bacteria, making the mix-culture system complicated and redundant. Thus, replacement of the conventional two-step fermentation process with a one-step process could be revolutionary in vitamin C industry. In this study, different combinations of five L-sorbose dehydrogenases (SDH) and two L-sorbosone dehydrogenases (SNDH) from Ketogulonicigenium vulgare WSH-001 were introduced into Gluconobacter oxydans WSH-003, an industrial strain used for the conversion of d-sorbitol to L-sorbose. The optimum combination produced 4.9g/L of 2-KLG. In addition, 10 different linker peptides were used for the fusion expression of SDH and SNDH in G. oxydans. The best recombinant strain (G. oxydans/pGUC-k0203-GS-k0095) produced 32.4g/L of 2-KLG after 168h. Furthermore, biosynthesis of pyrroloquinoline quinine (PQQ), a cofactor of those dehydrogenases, was enhanced to improve 2-KLG production. With the stepwise metabolic engineering of G. oxydans, the final 2-KLG production was improved to 39.2g/L, which was 8.0-fold higher than that obtained using independent expression of the dehydrogenases. These results bring us closer to the final one-step industrial-scale production of vitamin C. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  15. INTERPLAY OF SORBITOL PATHWAY OF GLUCOSE METABOLISM, 12/15-LIPOXYGENASE, AND MITOGEN-ACTIVATED PROTEIN KINASES IN THE PATHOGENESIS OF DIABETIC PERIPHERAL NEUROPATHY

    Science.gov (United States)

    Stavniichuk, Roman; Shevalye, Hanna; Hirooka, Hiroko; Nadler, Jerry L.; Obrosova, Irina G.

    2012-01-01

    The interactions among multiple pathogenetic mechanisms of diabetic peripheral neuropathy largely remain unexplored. Increased activity of aldose reductase, the first enzyme of the sorbitol pathway, leads to accumulation of cytosolic Ca++, essentially required for 12/15-lipoxygenase activation. The latter, in turn, causes oxidative-nitrosative stress, an important trigger of MAPK phosphorylation. This study therefore evaluated the interplay of aldose reductase, 12/15-lipoxygenase, and MAPKs in diabetic peripheral neuropathy. In experiment 1, male control and streptozotocin-diabetic mice were maintained with or without the aldose reductase inhibitor fidarestat, 16 mg kg−1 d−1, for 12 weeks. In experiment 2, male control and streptozotocin-diabetic wild-type (C57Bl6/J) and 12/15-lipoxygenase-deficient mice were used. Fidarestat treatment did not affect diabetes-induced increase in glucose concentrations, but normalized sorbitol and fructose concentrations (enzymatic spectrofluorometric assays) as well as 12(S) hydroxyeicosatetraenoic concentration (ELISA), a measure of 12/15-lipoxygenase activity, in the sciatic nerve and spinal cord. 12/15-lipoxygenase expression in these two tissues (Western blot analysis) as well as dorsal root ganglia (immunohistochemistry) was similarly elevated in untreated and fidarestat-treated diabetic mice. 12/15-lipoxygenase gene deficiency prevented diabetesassociated p38 MAPK and ERK, but not SAPK/JNK, activation in the sciatic nerve (Western blot analysis) and all three MAPK activation in the dorsal root ganglia (immunohistochemistry). In contrast, spinal cord p38 MAPK, ERK, and SAPK/JNK were similarly activated in diabetic wild-type and 12/15-lipoxygenase−/− mice. These findings identify the nature and tissue specificity of interactions among three major mechanisms of diabetic peripheral neuropathy, and suggest that combination treatments, rather than monotherapies, can sometimes be an optimal choice for its management. PMID

  16. Efeito de soluções fluoretadas contendo xilitol e sorbitol no número de estreptococos do grupo mutans na saliva de seres humanos

    Directory of Open Access Journals (Sweden)

    Gonçalves Nilza Cristina Lopes Afonso de Valor

    2001-01-01

    Full Text Available O objetivo do estudo foi avaliar o efeito de soluções de fluoreto de sódio a 0,05% contendo 2,5% ou 12,5% de xilitol no número de estreptococos do grupo mutans presentes na saliva. Participaram do estudo duplo cego, do tipo cruzado, 50 meninos entre 8 e 16 anos, distribuídos aleatoriamente em quatro grupos. Destes, 33 finalizaram o estudo. As soluções utilizadas foram: solução placebo; solução de fluoreto de sódio a 0,05%; solução de fluoreto de sódio a 0,05% + 2,5% xilitol + 2% sorbitol; solução de fluoreto de sódio a 0,05% + 12,5% xilitol + 2% sorbitol. Os indivíduos utilizaram 20 mL de uma das soluções, duas vezes ao dia. Cada solução foi utilizada por um período experimental de 28 dias. Os períodos experimentais foram intercalados por períodos de descanso de 10 dias. As soluções contendo xilitol a 2,5% e 12,5% não apresentaram diferença significativa (P = 0,32 em termos do logaritmo do número de estreptococos do grupo mutans. No entanto, a diferença foi significativa quando essas soluções foram comparadas às soluções de fluoreto de sódio e placebo (P < 0,001. Os resultados sugerem que a solução de fluoreto de sódio a 0,05% com adição de xilitol a 2,5% ou 12,5% reduziu significativamente o número de estreptococos do grupo mutans.

  17. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  18. High internal phase agar hydrogel dispersions in cocoa butter and chocolate as a route towards reducing fat content.

    Science.gov (United States)

    Skelhon, Thomas S; Olsson, Patrik K A; Morgan, Adam R; Bon, Stefan A F

    2013-09-01

    Reducing the fat content of chocolate formulations is a major challenge for the confectionery industry. We report the suspension of aqueous microgel agar particles of up to 80% v/v within sunflower oil, cocoa butter, and ultimately chocolate. The optimised emulsification process involves a shear-cooling step. We demonstrate the versatility of our method when applied to white, milk, and dark chocolate formulations, whilst preserving the desired polymorph V of the cocoa butter matrix. In addition, we show that this technology can be used as a strategy to disperse alcoholic beverages into chocolate confectionery.

  19. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is

  20. Fluconazole-containing agar Sabouraud dextrose plates are not useful when screening for susceptibility in Candida albicans.

    Science.gov (United States)

    Bordallo-Cardona, M A; Marcos-Zambrano, L J; Gómez G de la Pedrosa, E; Escribano, P; Bouza, E; Guinea, J; Cantón, R

    2017-04-01

    Fluconazole is an alternative for candidemic patients who are not critically ill. Fluconazole is mainly fungistatic and does not completely inhibit visual Candida albicans growth. We studied the usefulness of fluconazole-containing Sabouraud dextrose agar plates for detecting susceptibility to fluconazole in C. albicans. Adjusted inocula of 19 isolates were transferred directly onto fluconazole-containing Sabouraud dextrose plates (concentrations ranging from 0.125 mg/L to 128 mg/L). The fluconazole MIC in fresh isolates and after growth on the fluconazole-containing plate at 128 mg/L was recorded following the EUCAST EDef 7.2 guidelines. Then isolates were classified according to their degree of trailing production, based on microdilution procedure. All isolates were able to grow on all fluconazole-containing plates, even those isolates susceptible to fluconazole. In fact, we selected isolates with different degrees of trailing based on microdilution procedures. 50% of isolates classified as heavy trailers, 35.71% as moderate trailers, and 14.28% as slight trailers. The use of fluconazole-containing Sabouraud dextrose agar plates was not a reliable method to detect fluconazole susceptibility in C. albicans isolates; growth of the isolates was a trailing effect rather than true resistance.

  1. In vitro fermentation and prebiotic potential of novel low molecular weight polysaccharides derived from agar and alginate seaweeds.

    Science.gov (United States)

    Ramnani, Priya; Chitarrari, Roberto; Tuohy, Kieran; Grant, John; Hotchkiss, Sarah; Philp, Kevin; Campbell, Ross; Gill, Chris; Rowland, Ian

    2012-02-01

    Fermentation properties and prebiotic potential of novel low molecular weight polysaccharides (LMWPs) derived from agar and alginate bearing seaweeds was investigated. Ten LMWPs were supplemented to pH, temperature controlled anaerobic batch cultures inoculated with human feces from three donors, in triplicate. Microbiota changes were monitored using Fluorescent in-situ hybridization and short chain fatty acids, the fermentation end products were analysed using gas chromatography. Of the ten LMWPs tested, Gelidium seaweed CC2253 of molecular weight 64.64 KDa showed a significant increase in bifidobacterial populations from log(10) 8.06 at 0 h to log(10) 8.55 at 24 h (p = 0.018). For total bacterial populations, alginate powder CC2238 produced a significant increase from log(10) 9.01 at 0 h to log(10) 9.58 at 24 h (p = 0.032). No changes were observed in the other bacterial groups tested viz. Bacteroides, Lactobacilli/Enterococci, Eubacterium rectale/Clostridium coccoides and Clostridium histolyticum. The polysaccharides also showed significant increases in total SCFA production, particularly acetic and propionic acids, indicating that they were readily fermented. In conclusion, some LMWPs derived from agar and alginate bearing seaweeds were fermented by gut bacteria and exhibited potential to be used a novel source of prebiotics. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Determination of in vitro synergy for dual antimicrobial therapy against resistant Neisseria gonorrhoeae using Etest and agar dilution.

    Science.gov (United States)

    Wind, Carolien M; de Vries, Henry J C; van Dam, Alje P

    2015-03-01

    In response to antimicrobial resistance of Neisseria gonorrhoeae to last-resort extended-spectrum cephalosporins, combination therapy of azithromycin+ceftriaxone is now recommended. Dual therapy can be effective to treat monoresistant strains as well as multidrug-resistant strains, preferably employing the effect of in vitro synergy. As reports on in vitro synergy of azithromycin+ceftriaxone in N. gonorrhoeae are conflicting, in this study an evaluation of this combination was performed using a cross-wise Etest method and agar dilution. Synergy was defined as a fractional inhibitory concentration index (FICI) of ≤0.5. To identify other dual treatment options for gonorrhoea, in vitro synergy was evaluated for 65 dual antimicrobial combinations using Etest. Azithromycin, cefixime, ceftriaxone, colistin, ertapenem, fosfomycin, gentamicin, minocycline, moxifloxacin, rifampicin, spectinomycin and tigecycline were screened for synergy in all possible combinations. No synergy or antagonism was found for any of the 65 combinations. The geometric mean FICI ranged from 0.82 to 2.00. The mean FICI of azithromycin+ceftriaxone was 1.18 (Etest) and 0.55 (agar dilution). The difference between both methods did not result in a difference in interpretation of synergy. Ceftriaxone-resistant strain F89 was tested in all combinations and no synergy was found for any of them. Most importantly, the ceftriaxone minimum inhibitory concentration of F89 was not decreased below the breakpoint with any concentration of azithromycin. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  3. Asymptomatic Vaginal Disease In Pregnancy

    African Journals Online (AJOL)

    1974-04-17

    Apr 17, 1974 ... Eight patients (1,4%) had asymptomatic gonorrhoea. Clinical features ... MacConkey's agar (for identification of Escherichia coli,. Proteus and other .... Another interesting observation was the error in the clinical diagnosis of ...

  4. Short Communication

    African Journals Online (AJOL)

    pond was drained and left empty for two weeks to dry and then lime was added .... using inoculating wire loop and cultured on Blood and MacConkey agar and ... and temperate zones causing Ichthyophthiriasis or 'white spot disease' (Scholz,.

  5. Evaluación de los efectos en las propiedades fisicoquímicas, sensoriales y texturales de polidextrosa, fructosa y sorbitol como sustitutos de azúcar en la elaboración de arequipe

    OpenAIRE

    Valencia García, Francia Elena; Millán Cardona, Leonidas de Jesús; Ramírez Herrera, Nathalia

    2008-01-01

    Introduction. The concern on the excessive consumption of sugar in the diet has provoked a modification of traditional products to reduce their sucrose content and, at the same time, keep their sensorial and physical-chemical characteristics similar to those of other products made with normal sucrose content. Objective. To evaluate the effects of sugar substitutes such as polydextrose, fructose and sorbitol in the physical, chemical, sensorial and textural propertie...

  6. Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H- Isolates from Czech Patients with Novel Plasmid Composition Not Previously Seen in German Isolates.

    Science.gov (United States)

    Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge; Mellmann, Alexander; Bielaszewska, Martina

    2017-12-01

    Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H - strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly , etp , and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H - strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins ( stx 2a and the cdtV -ABC operon) and adhesins ( eae -γ, efa1 , lpfA O157OI-141 , and lpfA O157OI-154 ) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H - strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H - strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H - (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic

  7. Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H− Isolates from Czech Patients with Novel Plasmid Composition Not Previously Seen in German Isolates

    Science.gov (United States)

    Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge

    2017-01-01

    ABSTRACT Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H− strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly, etp, and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H− strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins (stx2a and the cdtV-ABC operon) and adhesins (eae-γ, efa1, lpfAO157OI-141, and lpfAO157OI-154) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H− strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H− strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H− (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic

  8. Structure elucidation and quantification of impurities formed between 6-aminocaproic acid and the excipients citric acid and sorbitol in an oral solution using high-resolution mass spectrometry and nuclear magnetic resonance spectroscopy

    DEFF Research Database (Denmark)

    Schou-Pedersen, Anne Marie V; Cornett, Claus; Nyberg, Nils

    2015-01-01

    Concentrated solutions containing 6-aminocaproic acid and the excipients citric acid and sorbitol have been studied at temperatures of 50 °C, 60 °C, 70 °C and 80 °C as well as at 20 °C. It has previously been reported that the commonly employed citric acid is a reactive excipient, and it is there......Concentrated solutions containing 6-aminocaproic acid and the excipients citric acid and sorbitol have been studied at temperatures of 50 °C, 60 °C, 70 °C and 80 °C as well as at 20 °C. It has previously been reported that the commonly employed citric acid is a reactive excipient...... and cyclized 6-aminocaproic acid, i.e., caprolactam. No reaction products between d-sorbitol and 6-aminocaproic acid could be observed. 3-Hydroxy-3,4-dicarboxy-butanamide-N-hexanoic acid, dimer and caprolactam were also observed after storage at 20 °C for 3 months. The findings imply that an oral solution of 6...

  9. Self-assembly mechanism of 1,3:2,4-di(3,4-dichlorobenzylidene)-D-sorbitol and control of the supramolecular chirality.

    Science.gov (United States)

    Li, Jingjing; Fan, Kaiqi; Guan, Xidong; Yu, Yingzhe; Song, Jian

    2014-11-11

    Dibenzylidene-D-sorbitol (DBS) and its derivatives are known to form gels in organic solvents; however, the mechanism of the gel formation has been a subject of much debate. The present work is undertaken to elucidate the organization mechanism of a DBS derivative, 1,3:2,4-di(3,4-dichlorobenzylidene)-D-sorbitol (DCDBS), by taking into account the solvent effects and comparing the experiment data with theoretical calculation. These molecules form smooth nonhelical fibers with a rest circular dichroism (CD) signal in polar solvents, in contrast to rope-liked left-helical fibers with a strong negative CD signal observed in nonpolar solvents. The molecular complexes thus formed were characterized by means of Fourier transform infrared spectra, ultraviolet-visible spectra, X-ray diffraction patterns, static contact angles, and theoretical calculations. It was proposed that the interactions between the gelator and the solvents could subtly change the stacking of the molecules and hence their self-assembled nanostructures. In nonpolar solvents, the gelator molecules appear as a distorted T-shaped structure with the 6-OH forming intermolecular hydrogen bonds with the acetal oxygens of adjacent gelator molecule. In addition, because of differential stacking interactions on both sides of the 10-member ring skeleton of the gelator, the oligomers may assemble in a helix fashion to minimize the energy, leading to helical fibers. In polar solvents, however, the gelator molecules show a rigid planelike structure and thus stack on top of each other because of strong parallel-displaced π interactions. The balanced driving force on both sides of the 10-member ring skeleton made it difficult for the dimers to bend, thus resulting in nonhelical nanostructure. As expected from the mechanisms proposed here, twisted ribbon fibers with a medium strength CD signal were obtained when solvents of different polarities were mixed. Thus, solvent effects revealed in this work represent an

  10. Inactivation of pathogenic bacteria inoculated onto a Bacto™ agar model surface using TiO2-UVC photocatalysis, UVC and chlorine treatments.

    Science.gov (United States)

    Yoo, S; Ghafoor, K; Kim, S; Sun, Y W; Kim, J U; Yang, K; Lee, D-U; Shahbaz, H M; Park, J

    2015-09-01

    The aim of this study was to study inactivation of different pathogenic bacteria on agar model surface using TiO2-UV photocatalysis (TUVP). A unified food surface model was simulated using Bacto(™) agar, a routinely used microbial medium. The foodborne pathogenic bacteria Escherichia coli K12 (as a surrogate for E. coli O157:H7), Salmonella Typhimurium, Staphylococcus aureus and Listeria monocytogenes were inoculated onto the agar surface, followed by investigation of TUVP-assisted inactivation and morphological changes in bacterial cells. The TUVP process showed higher bacterial inactivation, particularly for Gram-negative bacteria, than UVC alone and a control (dark reaction). A TUVP treatment of 17·2 mW cm(-2) (30% lower than the UVC light intensity) reduced the microbial load on the agar surface by 4·5-6·0 log CFU cm(-2). UVC treatment of 23·7 mW cm(-2) caused 3·0-5·3 log CFU cm(-2) reduction. The use of agar model surface is effective for investigation of bacterial disinfection and TUVP is a promising nonthermal technique. The results showing effects of photocatalysis and other treatments for inactivation of bacterial pathogens on model surface can be useful for applying such processes for disinfection of fruit, vegetables and other similar surfaces. © 2015 The Society for Applied Microbiology.

  11. Biomimetic synthesis of hollow calcium carbonate with the existence of the agar matrix and bovine serum albumin

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Jianhua, E-mail: fjh2008@126.com; Wu, Gang; Qing, Chengsong

    2016-01-01

    Proteins play important roles in the process of biomineralization. Vaterite and calcite have been synthesized by the reaction of Na{sub 2}CO{sub 3} and CaCl{sub 2} in the bovine serum albumin (BSA) and agar system. The samples have been characterized by Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). The shape of CaCO{sub 3} crystal has been analyzed by scanning electronic microscopy (SEM). The results show that calcite is a single product in the absence of BSA, but the product is a mixture of calcite and vaterite in the presence of BSA. The spheral shell of CaCO{sub 3} crystal was obtained when the concentration of BSA increased to 9.0 mg/mL. - Highlights: • Biomimetic synthesis of hollow calcium carbonate • Calcification mechanisms in the presence of both protein and polysaccharides • Biomineralization under the action of protein and polysaccharides.

  12. In vitro susceptibility of filamentous fungi to copper nanoparticles assessed by rapid XTT colorimetry and agar dilution method.

    Science.gov (United States)

    Ghasemian, E; Naghoni, A; Tabaraie, B; Tabaraie, T

    2012-12-01

    Metal nanoparticles and their uses in various aspects have recently drawn a great deal of attention. One of the major applications is that it can be used as an antimicrobial agent. They can be considered in approaches targeted to decrease the harms caused by microorganisms, specifically fungi, threatening the medical and industrial areas. The aim of this study was to investigate the antifungal activity of synthesized copper nanoparticles (CuNPs) against four filamentous fungi including Alternaria alternata, Aspergillus flavus, Fusarium solani, and Penicillium chrysogenum. Zerovalent copper nanoparticles of mean size 8nm were synthesized by inert gas condensation (IGC) method. The antifungal activity of these synthesized copper nanoparticles was measured against selected fungi by using two different techniques including agar dilution method and XTT reduction assay. The minimal inhibitory concentrations (MICs) for copper nanoparticles by agar dilution method were less or equal to 40mg/L for P. chrysogenum, less or equal to 60mg/L for A. alternata, less or equal to 60mg/L for F. solani, and less or equal to 80mg/L for A. flavus. And also MICs obtained by XTT reduction assay ranged from 40 to 80mg/L. Our data demonstrated that the copper nanoparticles inhibited fungal growth, but the fungal sensitivity to copper nanoparticles varies depending on the fungal species. Therefore, it is advisable that the minimal inhibitory concentrations (MICs) be examined before using these compounds. It is hoped that, in future, copper nanoparticles could replace some antifungal agents, making them applicable to many different medical devices and antimicrobial control system. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  13. Equilibrium and kinetic modelling of Cd(II) biosorption by algae Gelidium and agar extraction algal waste.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2006-01-01

    In this study an industrial algal waste from agar extraction has been used as an inexpensive and effective biosorbent for cadmium (II) removal from aqueous solutions. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction. Equilibrium data follow both Langmuir and Redlich-Peterson models. The parameters of Langmuir equilibrium model are q(max)=18.0 mgg(-1), b=0.19 mgl(-1) and q(max)=9.7 mgg(-1), b=0.16 mgl(-1), respectively for Gelidium and the algal waste. Kinetic experiments were conducted at initial Cd(II) concentrations in the range 6-91 mgl(-1). Data were fitted to pseudo-first- and second-order Lagergren models. For an initial Cd(II) concentration of 91 mgl(-1) the parameters of the pseudo-first-order Lagergren model are k(1,ads)=0.17 and 0.87 min(-1); q(eq)=16.3 and 8.7 mgg(-1), respectively, for Gelidium and algal waste. Kinetic constants vary with the initial metal concentration. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model. The model successfully predicts Cd(II) concentration profiles and provides significant insights on the biosorbents performance. The homogeneous diffusivity, D(h), is in the range 0.5-2.2 x10(-8) and 2.1-10.4 x10(-8)cm(2)s(-1), respectively, for Gelidium and algal waste.

  14. Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

    Science.gov (United States)

    Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

    2014-05-01

    A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

  15. Black-box modeling to estimate tissue temperature during radiofrequency catheter cardiac ablation: feasibility study on an agar phantom model

    International Nuclear Information System (INIS)

    Blasco-Gimenez, Ramón; Lequerica, Juan L; Herrero, Maria; Hornero, Fernando; Berjano, Enrique J

    2010-01-01

    The aim of this work was to study linear deterministic models to predict tissue temperature during radiofrequency cardiac ablation (RFCA) by measuring magnitudes such as electrode temperature, power and impedance between active and dispersive electrodes. The concept involves autoregressive models with exogenous input (ARX), which is a particular case of the autoregressive moving average model with exogenous input (ARMAX). The values of the mode parameters were determined from a least-squares fit of experimental data. The data were obtained from radiofrequency ablations conducted on agar models with different contact pressure conditions between electrode and agar (0 and 20 g) and different flow rates around the electrode (1, 1.5 and 2 L min −1 ). Half of all the ablations were chosen randomly to be used for identification (i.e. determination of model parameters) and the other half were used for model validation. The results suggest that (1) a linear model can be developed to predict tissue temperature at a depth of 4.5 mm during RF cardiac ablation by using the variables applied power, impedance and electrode temperature; (2) the best model provides a reasonably accurate estimate of tissue temperature with a 60% probability of achieving average errors better than 5 °C; (3) substantial errors (larger than 15 °C) were found only in 6.6% of cases and were associated with abnormal experiments (e.g. those involving the displacement of the ablation electrode) and (4) the impact of measuring impedance on the overall estimate is negligible (around 1 °C)

  16. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    Science.gov (United States)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  17. Bacteriology of chronic discharging ears in Port Harcourt, Nigeria ...

    African Journals Online (AJOL)

    Methods: Ear swabs of discharging ears aseptically collected from 102 patients of various age groups attending Ear, Nose, and Throat out-patient clinic at University of Port Harcourt Teaching Hospital were cultured for bacterial agents using blood agar, chocolate agar and MacConkey agar. Culture plates were incubated ...

  18. Effect of three-year consumption of erythritol, xylitol and sorbitol candies on various plaque and salivary caries-related variables.

    Science.gov (United States)

    Runnel, Riina; Mäkinen, Kauko K; Honkala, Sisko; Olak, Jana; Mäkinen, Pirkko-Liisa; Nõmmela, Rita; Vahlberg, Tero; Honkala, Eino; Saag, Mare

    2013-12-01

    The objective of the present paper is to report results from oral biologic studies carried out in connection with a caries study. Samples of whole-mouth saliva and dental plaque were collected from initially 7- to 8-year-old subjects who participated in a 3-year school-based programme investigating the effect of the consumption of polyol-containing candies on caries rates. The subjects were randomized in three cohorts, consumed erythritol, xylitol, or sorbitol candies. The daily polyol consumption from the candies was approximately 7.5 g. A significant reduction in dental plaque weight from baseline (psorbitol groups. Usage of polyol candies had no significant or consistent effect on the levels of plaque protein, glucose, glycerol, or calcium, determined yearly in connection with caries examinations. After three years, the plaque of erythritol-receiving subjects contained significantly (psorbitol. Lactic acid levels partly followed the same pattern. The consumption of erythritol was generally associated with significantly (psorbitol candies. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Self-assembled structures of 1,3:2,4-di(3,4-dimethylbenzylidene) sorbitol in hydrophobic polymer matrices prepared using different heat treatments

    Science.gov (United States)

    Lai, Wei-Chi; Tseng, Shen-Jhen; Huang, Po-Hsun

    2015-11-01

    We report a method for tuning the nanoarchitectures of 1,3:2,4-di(3,4-dimethylbenzylidene) sorbitol (DMDBS) with poly(vinylidene fluoride) (PVDF) polymer matrices. Hydrophobic PVDF facilitated the formation of nanofibrils during heating. The self-assembly behaviors of DMDBS were further tuned by altering the different heat treatments. When the samples were prepared with a rapid heating rate (shorter annealing time), smaller amounts of melted PVDF were excluded due to the shorter time for aggregation of DMDBS, leading to larger complex structures of DMDBS and PVDF. Therefore, longer and thicker nanofibrils (around 100 nm) were observed using scanning electron microscopy. As the samples were prepared with a slow heating rate (longer annealing time), DMDBS had more time to aggregate, and therefore, larger amounts of melted PVDF were excluded. Smaller complex structures of DMDBS and PVDF caused the formation of shorter and thinner nanofibrils (around 40 nm). In addition, small-angle X-ray scattering results indicated that the longer and thicker nanofibrils were mostly excluded outside the PVDF crystalline bundles after cooling because they were too large to be easily incorporated between the PVDF crystalline lamellae. However, a large portion of the smaller and thinner nanofibrils was trapped between the crystalline lamellae after cooling due to their smaller sizes. As expected, the PVDF spherulitic morphologies were affected, but the PVDF crystalline microstructures were not significantly altered by the addition of DMDBS, as shown by the results from polarized optical microscopy and Fourier transform infrared spectroscopy.

  20. Sorbitol-fermenting Bifidobacteria are indicators of very recent human faecal pollution in streams and groundwater habitats in urban tropical lowlands

    Science.gov (United States)

    2010-01-01

    Sorbitol-fermenting Bifidobacteria (SFB) proved to be an excellent indicator of very recent human faecal pollution (hours to days) in the investigated tropical stream and groundwater habitats. SFB were recovered from human faeces and sources potentially contaminated with human excreta. SFB were undetectable in animal faeces and environmental samples not contaminated with human faeces. Microcosm studies demonstrated a rapid die-off rate in groundwater (T90 value 0.6 days) and stream water (T90 value 0.9–1.7 days). Discrimination sensitivity analysis, including E. coli, faecal coliforms, total coliforms and Clostridium perfringens spores, revealed high ability of SFB to distinguish differing levels of faecal pollution especially for streams although high background levels of interfering bacteria can complicate its recovery on the used medium. Due to its faster die-off, as compared to many waterborne pathogens, SFB cannot replace microbiological standard parameters for routine water quality monitoring but it is highly recommendable as a specific and complementary tool when human faecal pollution has to be localized or verified. Because of its exclusive faecal origin and human specificity it seems also worthwhile to include SFB in future risk evaluation studies at tropical water resources in order to evaluate under which situations risks of infection may be indicated. PMID:20375476

  1. Simultaneous determination of glucose, fructose, sucrose and sorbitol in the leaf and fruit peel of different apple cultivars by the HPLC-RI optimized method.

    Science.gov (United States)

    Filip, Miuţa; Vlassa, Mihaela; Coman, Virginia; Halmagyi, Adela

    2016-05-15

    A high performance liquid chromatography method with refractive index detection (HPLC-RI), for simultaneous determination of glucose, fructose, sucrose and sorbitol in leaf and/or apple peel samples from nine apple (Malus domestica Borkh.) cultivars and rootstocks, originating from a germplasm collection, has been developed and validated. Box-Behnken design of response surface methodology was applied for the method optimization. The Carbosep Coregel 87H3 column was used under the optimum conditions predicted: mobile phase of H2SO4 0.005 mol L(-1) solution, flow rate of 0.3 mL min(-1) and column temperature of 35°C. The method was validated for linearity (R(2)>0.99), limits of detection (2.67-4.83 μg mL(-1)) and quantification (8.9-16.1 μg mL(-1)), precision (%RSD<5.05) and recovery (93.94-103.06%) and satisfactory results obtained. The sugars content varied across micropropagated plants in vitro, plants regenerated after cryostorage, growing trees in vivo, and fruit peel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. S-Mercuration of rat sorbitol dehydrogenase by methylmercury causes its aggregation and the release of the zinc ion from the active site.

    Science.gov (United States)

    Kanda, Hironori; Toyama, Takashi; Shinohara-Kanda, Azusa; Iwamatsu, Akihiro; Shinkai, Yasuhiro; Kaji, Toshiyuki; Kikushima, Makoto; Kumagai, Yoshito

    2012-11-01

    We previously developed a screening method to identify proteins that undergo aggregation through S-mercuration by methylmercury (MeHg) and found that rat arginase I is a target protein for MeHg (Kanda et al. in Arch Toxicol 82:803-808, 2008). In the present study, we characterized another S-mercurated protein from a rat hepatic preparation that has a subunit mass of 42 kDa, thereby facilitating its aggregation. Two-dimensional SDS-polyacrylamide gel electrophoresis and subsequent peptide mass fingerprinting using matrix-assisted laser desorption and ionization time-of-flight mass spectrometry revealed that the 42 kDa protein was NAD-dependent sorbitol dehydrogenase (SDH). With recombinant rat SDH, we found that MeHg is covalently bound to SDH through Cys44, Cys119, Cys129 and Cys164, resulting in the inhibition of its catalytic activity, release of zinc ions and facilitates protein aggregation. Mutation analysis indicated that Cys44, which ligates the active site zinc atom, and Cys129 play a crucial role in the MeHg-mediated aggregation of SDH. Pretreatment with the cofactor NAD, but not NADP or FAD, markedly prevented aggregation of SDH. Such a protective effect of NAD on the aggregation of SDH caused by MeHg is discussed.

  3. Survival of Escherichia coli O157:H7 in ground beef jerky assessed on two plating media.

    Science.gov (United States)

    Harrison, J A; Harrison, M A; Rose, R A

    1998-01-01

    Recent outbreaks of food-borne illness due to Salmonella spp. in beef jerky and Escherichia coli O157:H7 in venison jerky, coupled with the fact that a variety of preparation methods and dying procedures abound, raise concern over the safety of processed meat products made in the home. The potential of injured bacterial cells to regain the ability to cause illness is a particular threat with pathogens such as E. coli O157:H7, which is believed to have a low infectious dose. This study examined the efficacy of various methods of jerky preparation in reducing populations of E, coli O157:H7 in ground beef jerky and compared the recovery rate of E. coli O157:H7 on two selective plating media, modified sorbitol MacConkey agar (MSMA) and modified eosin methylene blue agar (MEMB). Populations of E. coli O157:H7 in both heated and unheated samples exhibited a greater decline during drying when a nitrite and salt cure mix was added during jerky preparation. When recovery of E. coli O157:H7 on MSMA and MEMB was compared, a trend toward slightly higher recovery rates with MEMB was observed. On the basis of these results, MEMB is a suitable alternative to MSMA for the recovery of E. coli O157:H7 from heated and dried meat samples similar to beef jerky.

  4. A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

    Science.gov (United States)

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

  5. Detection of group B streptococci in Lim broth by use of group B streptococcus peptide nucleic acid fluorescent in situ hybridization and selective and nonselective agars.

    Science.gov (United States)

    Montague, Naomi S; Cleary, Timothy J; Martinez, Octavio V; Procop, Gary W

    2008-10-01

    The sensitivity, specificity, and positive and negative predictive values for the detection of group B streptococci from Lim enrichment broth with sheep blood agar (SBA), with selective Streptococcus agar (SSA), and by a peptide nucleic acid fluorescent in situ hybridization (PNA FISH) assay were as follows: for culture on SBA, 68.4%, 100%, 100%, and 87.9%, respectively; for culture on SSA, 85.5%, 100%, 100%, and 94.1%, respectively; and for the PNA FISH assay, 97.4%, 98.3%, 96.1%, and 98.9%, respectively.

  6. Corrigendum to “Rheological properties of agar and carrageenan from Ghanaian red seaweeds” [Food Hydrocolloids 63 (2017) 50–58

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2018-01-01

    . G., Penninkhof, B., Rudolph, B., & De Ruiter, G. A. (1999). A novel high-performance anion-exchange chromatographic method for the analysis of carrageenans and agars containing 3,6-anhydrogalactose. Analytical Biochemistry, 268, 213-222. Table 3 Overview of seaweed type (hydrocolloid source......), hydrocolloid extraction method (direct water-extraction or after alkali treatment), hydrocolloid and monomer1 yields, and sulfate levels [data given as means ± SD]. Different roman superscript letters indicate significant differences (P agar yields, monosaccharides...

  7. A novel DTI-QA tool: Automated metric extraction exploiting the sphericity of an agar filled phantom.

    Science.gov (United States)

    Chavez, Sofia; Viviano, Joseph; Zamyadi, Mojdeh; Kingsley, Peter B; Kochunov, Peter; Strother, Stephen; Voineskos, Aristotle

    2018-02-01

    To develop a quality assurance (QA) tool (acquisition guidelines and automated processing) for diffusion tensor imaging (DTI) data using a common agar-based phantom used for fMRI QA. The goal is to produce a comprehensive set of automated, sensitive and robust QA metrics. A readily available agar phantom was scanned with and without parallel imaging reconstruction. Other scanning parameters were matched to the human scans. A central slab made up of either a thick slice or an average of a few slices, was extracted and all processing was performed on that image. The proposed QA relies on the creation of two ROIs for processing: (i) a preset central circular region of interest (ccROI) and (ii) a signal mask for all images in the dataset. The ccROI enables computation of average signal for SNR calculations as well as average FA values. The production of the signal masks enables automated measurements of eddy current and B0 inhomogeneity induced distortions by exploiting the sphericity of the phantom. Also, the signal masks allow automated background localization to assess levels of Nyquist ghosting. The proposed DTI-QA was shown to produce eleven metrics which are robust yet sensitive to image quality changes within site and differences across sites. It can be performed in a reasonable amount of scan time (~15min) and the code for automated processing has been made publicly available. A novel DTI-QA tool has been proposed. It has been applied successfully on data from several scanners/platforms. The novelty lies in the exploitation of the sphericity of the phantom for distortion measurements. Other novel contributions are: the computation of an SNR value per gradient direction for the diffusion weighted images (DWIs) and an SNR value per non-DWI, an automated background detection for the Nyquist ghosting measurement and an error metric reflecting the contribution of EPI instability to the eddy current induced shape changes observed for DWIs. Copyright © 2017 Elsevier

  8. Identification of non-streptococcal organisms from human dental plaque grown on the Streptococcus-selective medium mitis-salivarius agar.

    Science.gov (United States)

    Kim, Yeon-Hee; Lee, Si Young

    2015-02-01

    Mitis-salivarius (MS) agar has been used widely in microbial epidemiological studies because oral viridans streptococci can be selectively grown on this medium. Even though the previous findings reported the limited selecting power of MS agar for streptococcus strains, the identities of non-streptococcal strains from human oral samples which can grow on this medium are not clear yet. In this study, we identified non-streptococcal organisms grown on MS agar plates by polymerase chain reaction (PCR) amplification and sequencing of the 16S ribosomal RNA (rRNA) gene. Eighty bacterial colonies on MS plates were isolated from plaque samples, and bacterial identification was achieved with the rapid ID 32 Strep system and mini API reader. The bacterial colonies identified as non-streptococci by the API system were selected for further identification. The 16S rRNA gene was amplified by PCR and verified using DNA sequencing analysis for identification. Sequences were compared with those of reference organisms in the genome database of the National Center for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST). Among the 11 isolated non-streptococcal strains on MS plates, 3 strains were identified as Actinomyces naeslundii, 7 strains were identified as Actinomyces oris and 1 strain were identified as Actinomyces sp. using Blastn. In this study, we showed that some oral Actinomyces species can grow on Streptococcus-selective MS agar plates. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. A comparison of a new centrifuge sugar flotation technique with the agar method for the extraction of immature Culicoides (Diptera: Ceratopogonidae) life stages from salt marsh soils.

    Science.gov (United States)

    Two sampling techniques, agar extraction (AE) and centrifuge sugar flotation extraction (CSFE) were compared to determine their relative efficacy to recover immature stages of Culicoides spp from salt marsh substrates. Three types of samples (seeded with known numbers of larvae, homogenized field s...

  10. Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza

    2010-12-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.

  11. Development of edible films from tapioca starch and agar, enriched with red cabbage (Brassica oleracea) as a sausage deterioration bio-indicator

    Science.gov (United States)

    Aditya Wardana, Ata; Dewanti Widyaningsih, Tri

    2017-12-01

    Sausage spoilage has been identified as a cause of some food poisoning cases. Development of a bioindicator film is one of the alternative methods to detect sausage deterioration. The objectives of this paper were to develop a bioindicator edible films (BEF) from tapioca starch (TS), agar, and red cabbage juice (RC), and to evaluate its performance on sausage deterioration detection. The experiment had a 3x3 randomized factorial experimental design (agar: 3, 5, 7% by weight of TS; RC: 10, 15, 20% v/v based on 100% of suspension). Glycerol was used as the plasticizer. The results showed that the addition of agar into the film solution increased the thickness, elongation, and tensile strength, and decreased water vapour transmission rate (WVTR). While the addition of RC increased the thickness, but decreased elongation, tensile strength, and WVTR. BEF consisting of 2% tapioca starch, 7% (w/w) agar and 10 % (v/v) RC was chosen to apply on sausage. It could detect an increase in the microbial population and in the pH variations as result of sausage deterioration at 24, 48, and 72 h shown through color changes of BEF from bright purple at 0 h to light purple, dark purple-blue, and purple-green color respectively.

  12. Development of a D-amino acids electrochemical sensor based on immobilization of thermostable D-Proline dehydrogenase within agar gel membrane

    International Nuclear Information System (INIS)

    Tani, Yuji; Tanaka, Katsuhito; Yabutani, Tomoki; Mishima, Yuji; Sakuraba, Haruhiko; Ohshima, Toshihisa; Motonaka, Junko

    2008-01-01

    A novel biosensor for determination of D-amino acids (DAAs) in biological samples by using an electrode based on immobilization of a thermostable D-Proline dehydrogenase (D-Pro DH) within an agar gel membrane was developed. The electrode was simply prepared by spin-coating the agar solution with the D-Pro DH on a glassy carbon (GC) electrode. An electrocatalytic oxidation current of 2,6-dichloroindophenol (DCIP) was observed at -100 mV vs. Ag/AgCl with the addition of 5 and 20 mmol L -1 D-proline. The current response and its relative standard deviation were 0.15 μA and 7.6% (n = 3), respectively, when it was measured in a pH 8.0 phosphate buffer solution containing 10 mmol L -1 D-proline and 0.5 mmol L -1 DCIP at 50 deg. C. The current response of D-proline increased with increase of the temperature of the sample solution up to 70 deg. C. The electrocatalytic response at the D-Pro DH/agar immobilized electrode subsequently maintained for 80 days. Finally, the D-Pro DH/agar immobilized electrode was applied to determination of DAAs in a human urine sample. The determined value of DAAs in the human urine and its R.S.D. were 1.39 ± 0.12 mmol L -1 and 8.9% (n = 3), respectively

  13. Two-dimensional network formation of cardiac myocytes in agar microculture chip with 1480 nm infrared laser photo-thermal etching.

    Science.gov (United States)

    Kojima, Kensuke; Moriguchi, Hiroyuki; Hattori, Akihiro; Kaneko, Tomoyuki; Yasuda, Kenji

    2003-11-01

    We have developed a new method that enables agar microstructures to be used to cultivate cells and that allows cell network patterns to be controlled. The method makes use of non-contact three-dimensional photo-thermal etching with a 1480 nm infrared focused laser beam, which is strongly absorbed by water and agar gel, to form the shapes of agar microstructures. It allows microstructures to be easily formed in an agar layer within a few minutes, with cell-culture holes formed by the spot heating of a 100 mW laser and tunnels by the tracing of a 100 microm s(-1), 40 mW laser. We cultivated rat cardiac myocytes in adjacent microstructures and observed synchronized beating in them 90 min after they had made physical contact. Our results indicate that the system can make and use microstructures for cell-network cultivation in a minimal amount of time without any expensive microfabrication facilities or complicated procedures.

  14. Experimenting with a Visible Copper-Aluminum Displacement Reaction in Agar Gel and Observing Copper Crystal Growth Patterns to Engage Student Interest and Inquiry

    Science.gov (United States)

    Xu, Xinhua; Wu, Meifen; Wang, Xiaogang; Yang, Yangyiwei; Shi, Xiang; Wang, Guoping

    2016-01-01

    The reaction process of copper-aluminum displacement in agar gel was observed at the microscopic level with a stereomicroscope; pine-like branches of copper crystals growing from aluminum surface into gel at a constant rate were observed. Students were asked to make hypotheses on the pattern formation and design new research approaches to prove…

  15. Characterization of a novel alkaline arylsulfatase from Marinomonas sp. FW-1 and its application in the desulfation of red seaweed agar.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Xu, Jiachao; Gao, Xin; Fu, Xiaoting

    2015-10-01

    A bacterial strain capable of hydrolyzing sulfate ester bonds of p-nitrophenyl sulfate (pNPS) and agar was isolated from the coast area of Qingdao, China. It was identified as Marinomonas based on its 16S rRNA gene sequence and named as Marinomonas sp. FW-1. An arylsulfatase with a recovery of 13 % and a fold of 12 was purified to a homogeneity using ion exchange and gel filtration chromatographies. The enzyme was composed of a single polypeptide chain with the molecular mass of 33 kDa estimated using SDS-PAGE. The optimal pH and temperature of arylsulfatase were pH 9.0 and 45, respectively. Arylsulfatase was stable over pH 8-11 and at temperature below 55 °C. The K m and V max of this enzyme for the hydrolysis of pNPS were determined to be 13.73 and 270.27 μM/min, respectively. The desulfation ratio against agar from red seaweed Gelidium amansii and Gracilaria lemaneiformis were 86.11 and 89.61 %, respectively. There was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated G. amansii agar and that of the commercial agarose. Therefore, this novel alkaline arylsulfatase might have a great potential for application in enzymatic conversion of agar to agarose.

  16. Screening of tannin acyl hydrolase (E.C.3.1.1.20) producing tannery effluent fungal isolates using simple agar plate and SmF process.

    Science.gov (United States)

    Murugan, K; Saravanababu, S; Arunachalam, M

    2007-03-01

    Industrially important tannase producing fungi were isolated from tannery effluent using simple agar plate method. The isolates were screened by submerged fermentation using auto-controlled bioreactor. The colony diameter on the solid surface media shows high correlation with quantitative production of tannase. The isolate Aspergillus niger shows maximum production of both extracellular and intracellular enzyme.

  17. Tuning the self-assembled 1,3:2,4-di(3,4-dimethylbenzylidene) sorbitol nanoarchitectures using the phase inversion method

    Science.gov (United States)

    Lai, Wei-Chi; Tseng, Shen-Jhen

    2013-11-01

    1,3:2,4-Di(3,4-dimethylbenzylidene) sorbitol (DMDBS) molecules can self-assemble into nanoscaled structures in organic solvents and polymer melts. The nanofibril structures were the mostly found. In this study, we used two phase inversion methods, i.e., dry and wet methods, to obtain different DMDBS nanoarchitectures. Poly(vinylidene fluoride) (PVDF) was chosen as polymer matrix, and the DMDBS structures were tuned by the process of PVDF membrane formation (crystallization and liquid-liquid demixing). When the membrane was prepared using the dry method, the DMDBS structure is controlled by the PVDF crystallization. Fewer DMDBS nanofibrils formed on the surfaces, and no nanofibrils were found in the cross-sections. On the other hand, when the membrane was prepared using the wet method, the liquid-liquid demixing (nonsolvent induced phase separation) occurred simultaneously as PVDF crystallized, and thus influenced the aggregation of DMDBS molecules. DMDBS is an amphiphilic molecule with two hydrophilic hydroxyl groups. The addition of nonsolvent (water) caused a large number of DMDBS molecules to aggregate outside the hydrophobic PVDF. In addition, a new structure "nanomat" was found. The mat was composed of DMDBS nanofibrils with diameters of 10-20 nm, similar to those observed in the dry method membranes. Fourier transform infra-red spectroscopy indicates that the DMDBS molecules self-assembled (aggregated) mainly through intermolecular hydrogen bonding in the presence of PVDF. The more intermolecular hydrogen bonding between DMDBS existed, the more excessive amounts of DMDBS molecules were, leading to the formation of nanomats.

  18. Mutations in Arabidopsis thaliana genes involved in the tryptophan biosynthesis pathway affect root waving on tilted agar surfaces

    Science.gov (United States)

    Rutherford, R.; Gallois, P.; Masson, P. H.

    1998-01-01

    Arabidopsis thaliana roots grow in a wavy pattern upon a slanted surface. A novel mutation in the anthranilate synthase alpha 1 (ASA1) gene, named trp5-2wvc1, and mutations in the tryptophan synthase alpha and beta 1 genes (trp3-1 and trp2-1, respectively) confer a compressed root wave phenotype on tilted agar surfaces. When trp5-2wvc1 seedlings are grown on media supplemented with anthranilate metabolites, their roots wave like wild type. Genetic and pharmacological experiments argue that the compressed root wave phenotypes of trp5-2wvc1, trp2-1 and trp3-1 seedlings are not due to reduced IAA biosynthetic potential, but rather to a deficiency in L-tryptophan (L-Trp), or in a L-Trp derivative. Although the roots of 7-day-old seedlings possess higher concentrations of free L-Trp than the shoot as a whole, trp5-2wvc1 mutants show no detectable alteration in L-Trp levels in either tissue type, suggesting that a very localized shortage of L-Trp, or of a L-Trp-derived compound, is responsible for the observed phenotype.

  19. Comparison of agar gel immunodiffusion test, enzyme-linked immunosorbent assay and PCR in diagnostics of enzootic bovine leukosis

    Directory of Open Access Journals (Sweden)

    Malovrh Tadej

    2005-01-01

    Full Text Available Bovine leukaemia virus (BLV is a retrovirus that induces a chronic infection in cattle. Once infected, cattle remain virus carriers for life and start to show an antibody response within a few weeks after infection. Eradication and control of the disease are based on early diagnostics and segregation of the carriers. The choice of a diagnostic method depends on the eradication programme, money resources and characteristics of the herd to be analysed. The agar gel immunodiffusion (AGID test has been the serological test of choice for routine diagnosis of serum samples. Nevertheless, in more recent years, the enzyme-linked immunosorbent assay (ELISA has replaced the AGID for large scale testing. For this purpose, commercially available BLV-ELISA kits were compared to the AGID and to the polymerase chain reaction (PCR method performed with two sets of primers, amplifying env region. The ELISA kit based on the p24 core protein was found to be less specific and served as a screening test. The ELISA kit based on the envelope glycoprotein (gpSI served as a verification test and gave a good correlation with the AGID test and PCR method. However, ELISA showed a higher sensitivity than AGID. The p24 based ELiSA was useful for screening a large number of samples, whereas gp51 based ELISA, AGID and PCR were more important for detecting the antibody response against the individual BLV-proteins and therefore for verification of the infection with BLV.

  20. Thermal, mechanical, and physical properties of seaweed/sugar palm fibre reinforced thermoplastic sugar palm Starch/Agar hybrid composites.

    Science.gov (United States)

    Jumaidin, Ridhwan; Sapuan, Salit M; Jawaid, Mohammad; Ishak, Mohamad R; Sahari, Japar

    2017-04-01

    The aim of this research is to investigate the effect of sugar palm fibre (SPF) on the mechanical, thermal and physical properties of seaweed/thermoplastic sugar palm starch agar (TPSA) composites. Hybridized seaweed/SPF filler at weight ratio of 25:75, 50:50 and 75:25 were prepared using TPSA as a matrix. Mechanical, thermal and physical properties of hybrid composites were carried out. Obtained results indicated that hybrid composites display improved tensile and flexural properties accompanied with lower impact resistance. The highest tensile (17.74MPa) and flexural strength (31.24MPa) was obtained from hybrid composite with 50:50 ratio of seaweed/SPF. Good fibre-matrix bonding was evident in the scanning electron microscopy (SEM) micrograph of the hybrid composites' tensile fracture. Fourier transform infrared spectroscopy (FT-IR) analysis showed increase in intermolecular hydrogen bonding following the addition of SPF. Thermal stability of hybrid composites was enhanced, indicated by a higher onset degradation temperature (259°C) for 25:75 seaweed/SPF composites than the individual seaweed composites (253°C). Water absorption, thickness swelling, water solubility, and soil burial tests showed higher water and biodegradation resistance of the hybrid composites. Overall, the hybridization of SPF with seaweed/TPSA composites enhances the properties of the biocomposites for short-life application; that is, disposable tray, plate, etc. Copyright © 2017 Elsevier B.V. All rights reserved.