Watson's theorem and resonant pion photoproduction amplitude in the delta channel

International Nuclear Information System (INIS)

Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

1984-01-01

The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

Zweideutigkeit about "Zweideutigkeit": Sommerfeld, Pauli, and the methodological origins of quantum mechanics

Science.gov (United States)

Seth, Suman

In early 1925, Wolfgang Pauli (1900-1958) published the paper for which he is now most famous and for which he received the Nobel Prize in 1945. The paper detailed what we now know as his "exclusion principle." This essay situates the work leading up to Pauli's principle within the traditions of the "Sommerfeld School," led by Munich University's renowned theorist and teacher, Arnold Sommerfeld (1868-1951). Offering a substantial corrective to previous accounts of the birth of quantum mechanics, which have tended to sideline Sommerfeld's work, it is suggested here that both the method and the content of Pauli's paper drew substantially on the work of the Sommerfeld School in the early 1920s. Part One describes Sommerfeld's turn away from a faith in the power of model-based (modellmässig) methods in his early career towards the use of a more phenomenological emphasis on empirical regularities (Gesetzmässigkeiten) during precisely the period that both Pauli and Werner Heisenberg (1901-1976), among others, were his students. Part two delineates the importance of Sommerfeld's phenomenology to Pauli's methods in the exclusion principle paper, a paper that also eschewed modellmässig approaches in favour of a stress on Gesetzmässigkeiten. In terms of content, a focus on Sommerfeld's work reveals the roots of Pauli's understanding of the fundamental Zweideutigkeit (ambiguity) involving the quantum number of electrons within the atom. The conclusion points to the significance of these results to an improved historical understanding of the origin of aspects of Heisenberg's 1925 paper on the "Quantum-theoretical Reformulation (Umdeutung) of Kinematical and Mechanical Relations."

Weighted Watson-Crick automata

Energy Technology Data Exchange (ETDEWEB)

Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

2014-07-10

There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

Weighted Watson-Crick automata

International Nuclear Information System (INIS)

Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

2014-01-01

There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

The Sommerfeld precursor in photonic crystals

NARCIS (Netherlands)

Uitham, R; Hoenders, BJ

2006-01-01

We calculate the Sommerfeld precursor that results after transmission of a generic electromagnetic plane wave pulse with transverse electric polarization, through a one-dimensional rectangular N-layer photonic crystal with two slabs per layer. The shape of this precursor equals the shape of the

Closure properties of Watson-Crick grammars

Science.gov (United States)

Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

2015-12-01

In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

Bohr--Sommerfeld Lagrangians of moduli spaces of Higgs bundles

DEFF Research Database (Denmark)

Biswas, Indranil; Gammelgaard, Niels Leth; Logares, Marina

Let $X$ be a compact connected Riemann surface of genus at least two. Let $M_H(r,d)$ denote the moduli space of semistable Higgs bundles on $X$ of rank $r$ and degree $d$. We prove that the compact complex Bohr-Sommerfeld Lagrangians of $M_H(r,d)$ are precisely the irreducible components of the n......Let $X$ be a compact connected Riemann surface of genus at least two. Let $M_H(r,d)$ denote the moduli space of semistable Higgs bundles on $X$ of rank $r$ and degree $d$. We prove that the compact complex Bohr-Sommerfeld Lagrangians of $M_H(r,d)$ are precisely the irreducible components...

Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

Science.gov (United States)

Sternod, Latisha; French, Brian

2016-01-01

The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

Data Discovery with IBM Watson

Science.gov (United States)

Fessler, J.

2016-12-01

BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

Science.gov (United States)

Rilling, M

2000-01-01

Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

Analytic multi-Regge theory and the pomeron in QCD. 1

International Nuclear Information System (INIS)

White, A.R.

1991-01-01

This paper reports on the formalism of analytic multi-Regge theory developed as a basis for the study of abstract critical and super-critical pomeron high-energy behavior and for related studies of the Regge behavior of spontaneously broken gauge theories and the pomeron in QCD. Asymptotic domains of analyticity for multiparticle amplitudes are shown to follow from properties of field theory and S-matrix theory. General asymptotic dispersion relations are then derived for such amplitudes in which the spectral components are described by the graphical formalism of hexagraphs. Further consequences are distinct Sommerfeld-Watson representations for each hexagraph spectral component, together with a complete set of angular momentum plane unitarity equations which control the form of all multi-Regge amplitudes. Because of this constraint of reggeon unitarity the critical pomeron solution of the reggeon field theory gives the only known non-trivial unitary high-energy S-matrix. By exploiting the full structure of multi-Regge amplitudes as the pomeron becomes super-critical, one can study the simultaneous modification of hadrons and the pomeron. The result is a completely consistent description of the super-critical pomeron appearing in hadron scattering. Reggeon unitarity is satisfied in the super-critical phase by the appearance of a massive gluon (Reggeized vector particle) coupling pair-wise to the pomeron

Why has the bohr-sommerfeld model of the atom been ignoredby general chemistry textbooks?

Science.gov (United States)

Niaz, Mansoor; Cardellini, Liberato

2011-12-01

Bohr's model of the atom is considered to be important by general chemistry textbooks. A major shortcoming of this model was that it could not explain the spectra of atoms containing more than one electron. In order to increase the explanatory power of the model, Sommerfeld hypothesized the existence of elliptical orbits. This study has the following objectives: 1) Formulation of criteria based on a history and philosophy of science framework; and 2) Evaluation of university-level general chemistry textbooks based on the criteria, published in Italy and U.S.A. Presentation of a textbook was considered to be "satisfactory" if it included a description of the Bohr-Sommerfeld model along with diagrams of the elliptical orbits. Of the 28 textbooks published in Italy that were analyzed, only five were classified as "satisfactory". Of the 46 textbooks published in U.S.A., only three were classified as "satisfactory". This study has the following educational implications: a) Sommerfeld's innovation (auxiliary hypothesis) by introducing elliptical orbits, helped to restore the viability of Bohr's model; b) Bohr-Sommerfeld's model went no further than the alkali metals, which led scientists to look for other models; c) This clearly shows that scientific models are tentative in nature; d) Textbook authors and chemistry teachers do not consider the tentative nature of scientific knowledge to be important; e) Inclusion of the Bohr-Sommerfeld model in textbooks can help our students to understand how science progresses.

The 130 GeV gamma-ray line and Sommerfeld enhancements

International Nuclear Information System (INIS)

Chen, Jing; Zhou, Yu-Feng

2013-01-01

Recently, possible indications of line spectral features in the Fermi-LAT photon spectrum towards the galactic center have been reported. If the distinct line features arise from dark matter (DM) annihilation into γX(X = γ,Z 0 or h 0 ), the corresponding annihilation cross-section is unnaturally large for typical loop-induced radiative processes. On the other hand, it is still too small to be responsible for the observed DM relic density. We show that the mechanism of Sommerfeld enhancement with scalar force-carrier can provide a simple solution to these puzzles. The possibly large Sommerfeld enhancement of the cross-section for s-wave DM annihilation can significantly reduce the required effective couplings between DM and charged particles in typical loop diagrams. The DM particles necessarily annihilate into scalar force-carriers through tree-level p-wave process, which can dominate the total DM annihilation cross-section at freeze out, resulting in the correct thermal relic density, but has subdominant contributions to the DM annihilation today due to velocity suppression. We perform detailed analysis on the effects of p-wave Sommerfeld enhancement on freeze out. The results show that with the constraints from the thermal relic density, the required effective couplings can be reduced by an order of magnitude

Multi-head Watson-Crick automata

OpenAIRE

Chatterjee, Kingshuk; Ray, Kumar Sankar

2015-01-01

Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

International Nuclear Information System (INIS)

Fargher, H.E.; Roberts, M.J.

1983-01-01

Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

Did John B. Watson Really "Found" Behaviorism?

Science.gov (United States)

Malone, John C

2014-05-01

Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

Structure formation constraints on Sommerfeld-enhanced dark matter annihilation

International Nuclear Information System (INIS)

Armendariz-Picon, Cristian; Neelakanta, Jayanth T.

2012-01-01

We study the growth of cosmic structure in a ΛCDM universe under the assumption that dark matter self-annihilates with an averaged cross section times relative velocity that grows with the scale factor, an increase known as Sommerfeld-enhancement. Such an evolution is expected in models in which a light force carrier in the dark sector enhances the annihilation cross section of dark matter particles, and has been invoked, for instance, to explain anomalies in cosmic ray spectra reported in the past. In order to make our results as general as possible, we assume that dark matter annihilates into a relativistic species that only interacts gravitationally with the standard model. This assumption also allows us to test whether the additional relativistic species mildly favored by cosmic-microwave background data could originate from dark matter annihilation. We do not find evidence for Sommerfeld-enhanced dark matter annihilation and derive the corresponding upper limits on the annihilation cross-section

Arnold Sommerfeld science, life and turbulent times : 1868-1951

CERN Document Server

Eckert, Michael

2013-01-01

Arnold Sommerfeld (1868-1951) belongs with Max Planck (1858-1947), Albert Einstein (1879-1955) and Niels Bohr (1885-1962) among the founders of modern theoretical physics, a science that developed into a budding discipline during his lifetime. Sommerfeld witnessed many of the most dramatic scientific, cultural and political events of this era. His correspondence with his family offers a vivid testament to the challenges and joys of a life in science. This biography attempts to reconstruct Sommerfeld’s life and work not only from the perspective of his achievements in theoretical physics but also with the goal of portraying the career of a scientist within the social and political environment in which it evolved. It is based to a large extent on Sommerfeld’s voluminous correspondence, which sheds light both on his private and scientific life. Furthermore, it provides an authentic view on the circumstances that shaped Sommerfeld’s career in different places – Königsberg, Göttingen, Clausthal, Aachen, ...

Quantum graphs with the Bethe-Sommerfeld property

Czech Academy of Sciences Publication Activity Database

Exner, Pavel; Turek, Ondřej

2017-01-01

Roč. 8, č. 3 (2017), s. 305-309 ISSN 2220-8054 R&D Projects: GA ČR GA17-01706S Institutional support: RVO:61389005 Keywords : periodic quantum graphs * gap number * delta-coupling * rectangular lattice graph * scale-invariant coupling * Bethe-Sommerfeld conjecture * golden mean Subject RIV: BE - Theoretical Physics OBOR OECD: Atomic, molecular and chemical physics ( physics of atoms and molecules including collision, interaction with radiation, magnetic resonances, Mössbauer effect)

Continuum limit of discrete Sommerfeld problems on square lattice

Indian Academy of Sciences (India)

BASANT LAL SHARMA

Sommerfeld half-plane; crack; rigid ribbon; continuum limit; Wiener–Hopf; Toeplitz ... case of which, when it approaches zero, is called 'contin- .... etc, denote constants in expressions, inequalities, etc. The ..... The latter holds on a possibly weighted space, depending ..... where jj ء jj refers to the corresponding operator norm.

The Sommerfeld enhancement in the scotogenic model with large electroweak scalar multiplets

Energy Technology Data Exchange (ETDEWEB)

Chowdhury, Talal Ahmed [Department of Physics, University of Dhaka, P.O. Box 1000, Dhaka (Bangladesh); Nasri, Salah, E-mail: talal@du.ac.bd, E-mail: snasri@uaeu.ac.ae [Department of Physics, UAE University, P.O. Box 17551, Al-Ain (United Arab Emirates)

2017-01-01

We investigate the Sommerfeld enhancement (SE) in the generalized scotogenic model with large electroweak multiplets. We focus on scalar dark matter (DM) candidate of the model and compare DM annihilation cross sections to WW , ZZ , γγ and γ Z at present day in the galactic halo for scalar doublet and its immediate generalization, the quartet in their respective viable regions of parameter space. We find that larger multiplet has sizable Sommerfeld enhanced annihilation cross section compared to the doublet and because of that it is more likely to be constrained by the current H.E.S.S. results and future CTA sensitivity limits.

Making IBM's Computer, Watson, Human

Science.gov (United States)

Rachlin, Howard

2012-01-01

This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

Periodic quantum graphs from the Bethe-Sommerfeld perspective

Czech Academy of Sciences Publication Activity Database

Exner, Pavel; Turek, Ondřej

2017-01-01

Roč. 50, č. 45 (2017), č. článku 455201. ISSN 1751-8113 R&D Projects: GA ČR GA17-01706S Institutional support: RVO:61389005 Keywords : quantum graphs * Bethe-Sommerfeld conjecture * vertex coupling * Diophantine approximation * periodic structure Subject RIV: BE - Theoretical Physics OBOR OECD: Atomic, molecular and chemical physics ( physics of atoms and molecules including collision, interaction with radiation, magnetic resonances, Mössbauer effect) Impact factor: 1.857, year: 2016

The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

International Nuclear Information System (INIS)

Catalan, G.; Roberts, M.J.

1979-01-01

A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

Substructure boosts to dark matter annihilation from Sommerfeld enhancement

International Nuclear Information System (INIS)

Bovy, Jo

2009-01-01

The recently introduced Sommerfeld enhancement of the dark matter annihilation cross section has important implications for the detection of dark matter annihilation in subhalos in the Galactic halo. In addition to the boost to the dark matter annihilation cross section from the high densities of these subhalos with respect to the main halo, an additional boost caused by the Sommerfeld enhancement results from the fact that they are kinematically colder than the Galactic halo. If we further believe the generic prediction of the cold dark matter paradigm that in each subhalo there is an abundance of substructure which is approximately self-similar to that of the Galactic halo, then I show that additional boosts coming from the density enhancements of these small substructures and their small velocity dispersions enhance the dark matter annihilation cross section even further. I find that very large boost factors (10 5 to 10 9 ) are obtained in a large class of models. The implications of these boost factors for the detection of dark matter annihilation from dwarf spheroidal galaxies in the Galactic halo are such that, generically, they outshine the background gamma-ray flux and are detectable by the Fermi Gamma-ray Space Telescope.

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

Science.gov (United States)

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

78 FR 43198 - Watson Cogeneration Company; Notice of Filing

Science.gov (United States)

2013-07-19

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

The Sommerfeld enhancement for dark matter with an excited state

International Nuclear Information System (INIS)

Slatyer, Tracy R.

2010-01-01

We present an analysis of the Sommerfeld enhancement to dark matter annihilation in the presence of an excited state, where the interaction inducing the enhancement is purely off-diagonal, such as in models of exciting or inelastic dark matter. We derive a simple and accurate semi-analytic approximation for the s-wave enhancement, which is valid provided the mass splitting between the ground and excited states is not too large, and discuss the cutoff of the enhancement for large mass splittings. We reproduce previously derived results in the appropriate limits, and demonstrate excellent agreement with numerical calculations of the enhancement. We show that the presence of an excited state leads to generically larger values of the Sommerfeld enhancement, larger resonances, and shifting of the resonances to lower mediator masses. Furthermore, in the presence of a mass splitting the enhancement is no longer a monotonic function of velocity: the enhancement where the kinetic energy is close to that required to excite the higher state can be up to twice as large as the enhancement at zero velocity

Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

Directory of Open Access Journals (Sweden)

Luciane Favero

2009-01-01

producciones referidas al tema de estudio, que ella puede ser aplicada en los niveles de atención primaria, secundaria y terciaria y que el 64,7% de las producciones utilizan los factores de cuidado propuestos por Jean Watson en 1979. Surge la necesidad de perfeccionamiento de las investigaciones respecto a la transformación ocurrida en la Teoría del Cuidado Transpersonal, con abordaje del Proceso Clinical Caritas, no obstante como son escasos los estudios referentes a esta temática, dificultan su utilización práctica.This systematic review aimed to describe and analyze the use of Jean Watson's Theory of Human Caring in Brazilian studies in the last ten years. A literature search using MEDLINE (MEDLARS - Medical Literature Analysis and Retrieval System, LILACS (Latin American and Caribbean Health Science Literature BDENF (Nursing Database, and SciELO (Scientific Electronic Library Online databases was conducted. A sample of 34 publications met the systematic review inclusion criteria. The results showed that 61.8% of the studies were conducted in the south of Brazil, and these studies suggested that the Theory of Human Caring could be used in the three levels of care: primary, secondary, and tertiary. The majority of publications (64.7% used the carative factors proposed by Jean Watson in 1979. There is a need for research approaches in respect to changes occurred in the Theory of Human Caring that evolved into the clinical caritas processes. Few studies have tested these new processes. This fact makes difficulty to use them in clinical practice.

The multiple personalities of Watson and Crick strands.

Science.gov (United States)

Cartwright, Reed A; Graur, Dan

2011-02-08

In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

The multiple personalities of Watson and Crick strands

Directory of Open Access Journals (Sweden)

Graur Dan

2011-02-01

Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

Science.gov (United States)

Durgun Ozan, Yeter; Okumuş, Hülya

2017-06-01

Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

Impact of Sommerfeld enhancement on helium reionization via WIMP dark matter

Science.gov (United States)

Bandyopadhyay, Bidisha; Schleicher, Dominik R. G.

2018-03-01

Dark matter annihilation can have a strong impact on many astrophysical processes in the Universe. In the case of Sommerfeld-enhanced annihilation cross sections, the annihilation rates are enhanced at late times, thus enhancing the potential annihilation signatures. We here calculate the Sommerfeld-enhanced annihilation signatures during the epoch of helium reionization, the epoch where helium becomes fully ionized due to energetic photons. When considering the upper limits on the energy injection from the CMB, we find that the resulting abundance of He++ becomes independent of the dark matter particle mass. The resulting enhancement compared to a standard scenario is thus 1-2 orders of magnitude higher. For realistic scenarios compatible with CMB constraints, there is no significant shift in the epoch of helium reionization, which is completed between redshifts 3 and 4. While it is thus difficult to disentangle dark matter annihilation from astrophysical contributions (active galactic nuclei), a potential detection of dark matter particles and its interactions using the Large Hadron Collider (LHC) would allow one to quantify the dark matter contribution.

Fitting of Hadron Mass Spectra and Contributions to Perturbation Theory of Conformal Quantum Field Theory

Science.gov (United States)

Luna Acosta, German Aurelio

The masses of observed hadrons are fitted according to the kinematic predictions of Conformal Relativity. The hypothesis gives a remarkably good fit. The isospin SU(2) gauge invariant Lagrangian L(,(pi)NN)(x,(lamda)) is used in the calculation of d(sigma)/d(OMEGA) to 2nd-order Feynman graphs for simplified models of (pi)N(--->)(pi)N. The resulting infinite mass sums over the nucleon (Conformal) families are done via the Generalized-Sommerfeld-Watson Transform Theorem. Even though the models are too simple to be realistic, they indicate that if (DELTA)-internal lines were to be included, 2nd-order Feynman graphs may reproduce the experimental data qualitatively. The energy -dependence of the propagator and couplings in Conformal QFT is different from that of ordinary QFT. Suggestions for further work are made in the areas of ultra-violet divergences and OPEC calculations.

A bifurcation and symmetry discussion of the Sommerfeld effect

OpenAIRE

Clerkin, Eoin; Sampaio, Rubens

2017-01-01

The Arnold Sommerfeld effect is an intriguing resonance capture and release series of events originally demonstrated in 1902. A single event is studied using a two degree of freedom mathematical model of a motor with imbalance mounted to laterally restricted spring connected cart. For a certain power supplied, in general the motor rotates at a speed consistent with a motor on a rigid base. However at speeds close to the natural frequency of the cart, it seemingly takes on extra oscillations w...

Noncommutative nature of the addition of noncollinear velocities in special relativity and the geometric phase method (commemorating the publication centennial of A Sommerfeld's work)

International Nuclear Information System (INIS)

Malykin, Grigorii B

2010-01-01

In 1909, Arnold Sommerfeld used geometric calculations to show that the relativistic addition of two noncollinear velocities on an imaginary-radius sphere is a noncommutative operation. Sommerfeld was the first to use the geometric phase method to calculate the angle between the resulting velocities depending on the order in which they are added. For this, he related the value of this angle to the excess of the spherical triangle formed by the two original velocities and their sum. In 1931, Sommerfeld applied his method to analyze the Thomas precession. (from the history of physics)

Training IBM Watson using Automatically Generated Question-Answer Pairs

OpenAIRE

Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

2016-01-01

IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

Science.gov (United States)

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

OpenAIRE

Stojić, Igor

2016-01-01

Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

Relic density and CMB constraints on dark matter annihilation with Sommerfeld enhancement

International Nuclear Information System (INIS)

Zavala, Jesus; White, Simon D. M.; Vogelsberger, Mark

2010-01-01

We calculate how the relic density of dark matter particles is altered when their annihilation is enhanced by the Sommerfeld mechanism due to a Yukawa interaction between the annihilating particles. Maintaining a dark matter abundance consistent with current observational bounds requires the normalization of the s-wave annihilation cross section to be decreased compared to a model without enhancement. The level of suppression depends on the specific parameters of the particle model, with the kinetic decoupling temperature having the most effect. We find that the cross section can be reduced by as much as an order of magnitude for extreme cases. We also compute the μ-type distortion of the CMB energy spectrum caused by energy injection from such Sommerfeld-enhanced annihilation. Our results indicate that in the vicinity of resonances, associated with bound states, distortions can be large enough to be excluded by the upper limit |μ|≤9.0x10 -5 found by the FIRAS (Far Infrared Absolute Spectrophotometer) instrument on the COBE (Cosmic Background Explorer) satellite.

Impact parameter representation without high-energy, small-angle limitation

International Nuclear Information System (INIS)

Islam, M.M.

Using Watson-Sommerfeld transform the impact parameter representation of the scattering amplitude is shown to be valid for all physical energies and scattering angles. It is also shown how the direct channel Regge poles enter in the impact parameter amplitude [fr

Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

Science.gov (United States)

Cubero, Elena; Luque, F Javier; Orozco, Modesto

2006-02-01

A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

Science.gov (United States)

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2006-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

Replication infidelity via a mismatch with Watson-Crick geometry.

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

A Challenge to Watson

Science.gov (United States)

Detterman, Douglas K.

2011-01-01

Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

Ed Watson - 1940-2006

CERN Multimedia

2006-01-01

Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

Science.gov (United States)

Kidd, Gary R.

2004-05-01

Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

Science.gov (United States)

2013-03-20

... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

Science.gov (United States)

2013-10-25

... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

Classical quantum theory of wobbling modes

International Nuclear Information System (INIS)

Onishi, Naoki

1986-01-01

Wobbling modes are studied extensively in terms of time-dependent variational theory. Quantum states and their energies are determined by the Bohr-Sommerfeld rule of classical quantization. Numerical calculations are performed for states of 166 Er with vertical strokejvertical stroke=30-40 (h/2π). (orig.)

On the scaling limits of Galton Watson processes in varying environment

NARCIS (Netherlands)

Bansaye, V.; Simatos, F.

2011-01-01

Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

Science.gov (United States)

Digdon, Nancy; Powell, Russell A; Harris, Ben

2014-11-01

In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

OpenAIRE

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2005-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

Graham Watson: Eesti vajab enam riigi sekkumist majandusse

Index Scriptorium Estoniae

Watson, Graham

2009-01-01

18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

Oncologists partner with Watson on genomics.

Science.gov (United States)

2015-08-01

A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

Science.gov (United States)

Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

2007-01-01

In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

Science.gov (United States)

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2012-11-13

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2013-06-04

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

A history of the term radical behaviorism: From Watson to Skinner

Science.gov (United States)

Schneider, Susan M.; Morris, Edward K.

1987-01-01

This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

Directory of Open Access Journals (Sweden)

Lina Affifatusholihah

2017-04-01

In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

Watson's behaviorism: a comparison of the two editions (1925 and 1930).

Science.gov (United States)

Carpintero, Helio

2004-05-01

J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

Science.gov (United States)

Doyle-Lindrud, Susan

2015-02-01

IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

A conversation with Geoff Watson

OpenAIRE

Beran, R. J.; Fisher, N. I.

1998-01-01

Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

Indian Academy of Sciences (India)

IAS Admin

One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

Hydrogen atom as test field of theoretical models

International Nuclear Information System (INIS)

Baiquni, A.

1976-01-01

Semi classical theory, covering Bohr atom theory, Bohr Sommerfeld theory, Sommerfeld relativistic theory, and quantum theory such as particle and complementarity dualism, wave mechanics, approximation method, relativistic quantum mechanics, and hydrogen atom fine structure, are discussed. (SMN)

Relativistic generalisation of the Kroll-Watson formula

International Nuclear Information System (INIS)

Kaminski, J.Z.

1985-01-01

The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

Semiclassical methods in field theories

International Nuclear Information System (INIS)

Ventura, I.

1978-10-01

A new scheme is proposed for semi-classical quantization in field theory - the expansion about the charge (EAC) - which is developed within the canonical formalism. This method is suitable for quantizing theories that are invariant under global gauge transformations. It is used in the treatment of the non relativistic logarithmic theory that was proposed by Bialynicki-Birula and Mycielski - a theory we can formulate in any number of spatial dimensions. The non linear Schroedinger equation is also quantized by means of the EAC. The classical logarithmic theories - both, the non relativistic and the relativistic one - are studied in detail. It is shown that the Bohr-Sommerfeld quantization rule(BSQR) in field theory is, in many cases, equivalent to charge quantization. This rule is then applied to the massive Thirring Model and the logarithmic theories. The BSQR can be see as a simplified and non local version of the EAC [pt

Intrinsic irreversibility in quantum theory

International Nuclear Information System (INIS)

Prigogine, I.; Petrosky, T.Y.

1987-01-01

Quantum theory has a dual structure: while solutions of the Schroedinger equation evolve in a deterministic and time reversible way, measurement introduces irreversibility and stochasticity. This presents a contrast to Bohr-Sommerfeld-Einstein theory, in which transitions between quantum states are associated with spontaneous and induced transitions, defined in terms of stochastic processes. A new form of quantum theory is presented here, which contains an intrinsic form of irreversibility, independent of observation. This new form applies to situations corresponding to a continuous spectrum and to quantum states with finite life time. The usual non-commutative algebra associated to quantum theory is replaced by more general algebra, in which operators are also non-distributive. Our approach leads to a number of predictions, which hopefully may be verified or refuted in the next years. (orig.)

First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

Directory of Open Access Journals (Sweden)

Cláudio Ivan de Oliveira

Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

International Nuclear Information System (INIS)

Roberts, M.J.

1988-01-01

Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

The Game is aFoot, Watson: DeepQA systems and the future of HCI

OpenAIRE

Keates, Simeon; Varker, Philip

2012-01-01

In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

Discrete state perturbation theory via Green's functions

International Nuclear Information System (INIS)

Rubinson, W.

1975-01-01

The exposition of stationary-state perturbation theory via the Green's function method in Goldberger and Watson's Collision Theory is reworked in a way that makes explicit its mathematical basis. It is stressed that the theory consists of the construction of, and manipulations on, a mathematical identity. The perturbation series fall out of the identity almost immediately. The logical status of the method is commented on

A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

NARCIS (Netherlands)

Meijer, Rob R.

I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

Science.gov (United States)

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

Turbulent lubrication theory considering the surface roughness effects, 2

International Nuclear Information System (INIS)

Hashimoto, Hiromu; Wada, Sanae; Kobayashi, Toshinobu.

1990-01-01

This second paper describes an application of the generalized turbulent lubrication theory considering the surface roughness effects, which is developed in the previous paper, to the finite-width journal bearings. In the numerical analysis, the nonlinear equations for the modified turbulence coefficients are simplified to save a computation time within a satisfactory accuracy under the assumption that the shear flow is superior to the pressure flow in the turbulent lubrication films. The numerical results of pressure distribution, Sommerfeld number, attitude angle, friction coefficient and flow rate for the Reynolds number of Re=2000, 5000 and 10000 are indicated in graphic form for various values of relative roughness, and the effects of surface roughness on these static performance characteristics are discussed. Moreover, the eccentricity ratio and attitude angle of the journal bearings with homogeneous rough surface are obtained experimentally for a wide range of Sommerfeld number, and the experimental results are compared with theoretical results. (author)

Watson-Crick hydrogen bonding of unlocked nucleic acids

DEFF Research Database (Denmark)

Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

2015-01-01

We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

Watson, Skinner y Algunas Disputas dentro del Conductismo

Directory of Open Access Journals (Sweden)

RICARDO PELLÓN SUÁREZ DE PUGA

2013-01-01

Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

Science.gov (United States)

Chen, Ying; Elenee Argentinis, J D; Weber, Griff

2016-04-01

Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-01-01

Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

The theory of the top

CERN Document Server

Klein, Felix; Nagem, Raymond J; Sandri, Guido

The Theory of the Top. Volume IV. Technical Applications of the Theory of the Top is the fourth and final volume in a series of self-contained English translations of the classic and definitive treatment of rigid body motion. Key features: * Complete and unabridged presentation with recent advances and additional notes; * Annotations by the translators provide insights into the nature of science and mathematics in the late 19th century; * Each volume interweaves theory and applications. The Theory of the Top was originally presented by Felix Klein as an 1895 lecture at Göttingen University that was broadened in scope and clarified as a result of collaboration with Arnold Sommerfeld.  Graduate students and researchers interested in theoretical and applied mechanics will find this series of books a thorough and insightful account.  Other volumes in the series include Introduction to the Kinematics and Kinetics of the Top, Development of the Theory in the Case of the Heavy Symmetric Top, and Perturbation...

Anomalous field dependence of the Sommerfeld coefficient in the isotropic (K,Ba)BiO3 superconductor

International Nuclear Information System (INIS)

Klein, T.; Marcenat, C.; Bouquet, F.; Junod, A.; Blanchard, S.; Marcus, J.

2004-01-01

We report on specific heat measurements in high quality (K,Ba)BiO 3 single crystals (T c ∼31.5 K). A well defined specific heat jump is clearly visible at T C p (H) in the entire investigated field range (up to 13 T). However, the corresponding T C p (H) exhibits an anomalous positive curvature and the amplitude of the jump rapidly decreases with field suggesting a non-linear increase of the Sommerfeld coefficient (γ(H)). This anomalous behaviour is confirmed by low temperature measurements which show that γ(H)∝H α with α∼0.65

Arnold Sommerfeld

Indian Academy of Sciences (India)

IAS Admin

After another year for a teaching diploma, and then a year of military service, he moved in ... He gave the first ever courses on relativity and quantum theory as he was ... Hearty congratulations on your fine discovery and best regards, yours,.

Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

Science.gov (United States)

26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

Interview with Mark Watson

Directory of Open Access Journals (Sweden)

Katy Shaw

2016-04-01

Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

Watson: A new link in the IIE iron chain

Science.gov (United States)

Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

1994-01-01

Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

Science.gov (United States)

Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

2017-12-01

Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

Science.gov (United States)

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

Science.gov (United States)

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

DEFF Research Database (Denmark)

Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

2013-01-01

For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Using grounded theory as a method for rigorously reviewing literature

NARCIS (Netherlands)

Wolfswinkel, J.; Furtmueller-Ettinger, Elfriede; Wilderom, Celeste P.M.

2013-01-01

This paper offers guidance to conducting a rigorous literature review. We present this in the form of a five-stage process in which we use Grounded Theory as a method. We first probe the guidelines explicated by Webster and Watson, and then we show the added value of Grounded Theory for rigorously

Coulomb interaction in multiple scattering theory

International Nuclear Information System (INIS)

Ray, L.; Hoffmann, G.W.; Thaler, R.M.

1980-01-01

The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reaction cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+ 208 Pb elastic scattering and compared with experimental data

ODE/IM correspondence and the Argyres-Douglas theory

Science.gov (United States)

Ito, Katsushi; Shu, Hongfei

2017-08-01

We study the quantum spectral curve of the Argyres-Douglas theories in the Nekrasov-Sahashvili limit of the Omega-background. Using the ODE/IM correspondence we investigate the quantum integrable model corresponding to the quantum spectral curve. We show that the models for the A 2 N -type theories are non-unitary coset models ( A 1)1 × ( A 1) L /( A 1) L+1 at the fractional level L=2/2N+1-2 , which appear in the study of the 4d/2d correspondence of N = 2 superconformal field theories. Based on the WKB analysis, we clarify the relation between the Y-functions and the quantum periods and study the exact Bohr-Sommerfeld quantization condition for the quantum periods. We also discuss the quantum spectral curves for the D and E type theories.

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

Science.gov (United States)

Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

2016-10-11

We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

Anomalous field dependence of the Sommerfeld coefficient in the isotropic (K,Ba)BiO{sub 3} superconductor

Energy Technology Data Exchange (ETDEWEB)

Klein, T.; Marcenat, C.; Bouquet, F.; Junod, A.; Blanchard, S.; Marcus, J

2004-08-01

We report on specific heat measurements in high quality (K,Ba)BiO{sub 3} single crystals (T{sub c}{approx}31.5 K). A well defined specific heat jump is clearly visible at T{sub C{sub p(H)}} in the entire investigated field range (up to 13 T). However, the corresponding T{sub C{sub p(H)}} exhibits an anomalous positive curvature and the amplitude of the jump rapidly decreases with field suggesting a non-linear increase of the Sommerfeld coefficient ({gamma}(H)). This anomalous behaviour is confirmed by low temperature measurements which show that {gamma}(H){proportional_to}H{sup {alpha}} with {alpha}{approx}0.65.

Some Econometric Results for the Blanchard-Watson Bubble Model

DEFF Research Database (Denmark)

Johansen, Soren; Lange, Theis

The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

On the solution of two-point linear differential eigenvalue problems. [numerical technique with application to Orr-Sommerfeld equation

Science.gov (United States)

Antar, B. N.

1976-01-01

A numerical technique is presented for locating the eigenvalues of two point linear differential eigenvalue problems. The technique is designed to search for complex eigenvalues belonging to complex operators. With this method, any domain of the complex eigenvalue plane could be scanned and the eigenvalues within it, if any, located. For an application of the method, the eigenvalues of the Orr-Sommerfeld equation of the plane Poiseuille flow are determined within a specified portion of the c-plane. The eigenvalues for alpha = 1 and R = 10,000 are tabulated and compared for accuracy with existing solutions.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

A new and self-contained presentation of the theory of boundary operators for slit diffraction and their logarithmic approximations

Energy Technology Data Exchange (ETDEWEB)

Gorenflo, Norbert [Beuth Hochschule fuer Technik Berlin (Germany). Fachbereich II; Kunik, Matthias [Magdeburg Univ. (Germany). Inst. fuer Analysis und Numerik

2009-07-01

We present a new and self-contained theory for mapping properties of the boundary operators for slit diffraction occurring in Sommerfeld's diffraction theory, covering two different cases of the polarisation of the light. This theory is entirely developed in the context of the boundary operators with a Hankel kernel and not based on the corresponding mixed boundary value problem for the Helmholtz equation. For a logarithmic approximation of the Hankel kernel we also study the corresponding mapping properties and derive explicit solutions together with certain regularity results. (orig.)

The case of the missing fingerprints or Dr Watson's cosmology

International Nuclear Information System (INIS)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

Science.gov (United States)

Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

2018-01-01

Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

de Jean Watson

Directory of Open Access Journals (Sweden)

Thaís Schossler

2008-01-01

Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

OpenAIRE

Rao, B J; Radding, C M

1994-01-01

Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

Science.gov (United States)

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

Ed Watson 1940-2006

CERN Multimedia

2006-01-01

Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

Science.gov (United States)

Malone, John C; García-Penagos, Andrés

2014-07-25

Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-12-01

Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

On the extension of the Fermi-Watson Theorem to high energy diffraction

International Nuclear Information System (INIS)

Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

1995-12-01

The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

Science.gov (United States)

Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

2010-01-01

The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

"Elementary, my dear Watson". Per una falsa citazione

Directory of Open Access Journals (Sweden)

Irene Minella

2014-12-01

Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

Science.gov (United States)

Beck, Hall P.; Levinson, Sharman; Irons, Gary

2009-01-01

In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

Science.gov (United States)

Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

2018-04-24

A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

A chat with James Watson

CERN Multimedia

2011-01-01

On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

Case of the missing fingerprints or Dr. Watson's cosmology

Energy Technology Data Exchange (ETDEWEB)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

NARCIS (Netherlands)

Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

2000-01-01

Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

Building Watson: An Overview of the DeepQA Project

OpenAIRE

Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

2010-01-01

IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

DEFF Research Database (Denmark)

Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

2014-01-01

–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

Science.gov (United States)

Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

2018-02-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

Science.gov (United States)

IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

Theoretical study on instability mechanism of jet-induced sloshing. Model development using Orr-Sommerfeld equation generalized for non-parallel flow; Funryu reiki sloshing gensho no hassei kiko ni kansuru rironteki kenkyu. Hiheiko nagare ni ippankashita Orr-Sommerfeld hoteishiki wo mochiita model ka

Energy Technology Data Exchange (ETDEWEB)

Eguchi, Y. [Central Research Institute of Electric Power Industry, Tokyo (Japan)

1998-07-25

A theoretical model was developed to study the mechanism of free surface sloshing in a vessel induced by a steady vertical jet flow. In the model, jet deflection is calculated with eigen values of the generalized Orr-Sommerfeld equation which is applicable to slightly non-parallel jet. Instability criteria employed in the model are (1) resonace condition between sloshing and jet frequencies and (2) {pi} phase relation between jet displacement at an inlet and global jet deflection. Numerical results of the mathematical model have shown good agreement with experimental ones, which justifies that the inherent instability of free jet itself and edge tone feedback are the main causes of the self-excited sloshing. 9 refs., 10 figs.

The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

Science.gov (United States)

Caplan, R M

1982-06-01

The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

Science.gov (United States)

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

Science.gov (United States)

Hicks, R. E.; Southey, G. N.

1990-01-01

The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

Science.gov (United States)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2017-06-01

The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

Directory of Open Access Journals (Sweden)

Mei-Yu LEE

2014-11-01

Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

The McLean-Watson line strength formula and its implementation

International Nuclear Information System (INIS)

Hey, J D

2009-01-01

We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

James Watson's most inconvenient truth: race realism and the moralistic fallacy.

Science.gov (United States)

Rushton, J Philippe; Jensen, Arthur R

2008-11-01

Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

Science.gov (United States)

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

A Unified Theory of Interaction: Gravitation and Electrodynamics

Directory of Open Access Journals (Sweden)

Wagener P.

2008-10-01

Full Text Available A theory is proposed from which the basic equations of gravitation and electromagnetism are derived from a single Lagrangian. The total energy of an atom can be expressed in a power series of the fine structure constant, $alpha$. Specific selections of these terms yield the relativistic correction to the Bohr values of the hydrogen spectrum and the Sommerfeld-Dirac equation for the fine structure spectrum of the hydrogen atom. Expressions for the classical electron radius and some of the Large Number Coincidences are derived. A Lorentz-type force equation is derived for both gravitation and electrodynamics. Electron spin is shown to be an effect of fourth order in $alpha$.

Communication: Wigner functions in action-angle variables, Bohr-Sommerfeld quantization, the Heisenberg correspondence principle, and a symmetrical quasi-classical approach to the full electronic density matrix.

Science.gov (United States)

Miller, William H; Cotton, Stephen J

2016-08-28

It is pointed out that the classical phase space distribution in action-angle (a-a) variables obtained from a Wigner function depends on how the calculation is carried out: if one computes the standard Wigner function in Cartesian variables (p, x), and then replaces p and x by their expressions in terms of a-a variables, one obtains a different result than if the Wigner function is computed directly in terms of the a-a variables. Furthermore, the latter procedure gives a result more consistent with classical and semiclassical theory-e.g., by incorporating the Bohr-Sommerfeld quantization condition (quantum states defined by integer values of the action variable) as well as the Heisenberg correspondence principle for matrix elements of an operator between such states-and has also been shown to be more accurate when applied to electronically non-adiabatic applications as implemented within the recently developed symmetrical quasi-classical (SQC) Meyer-Miller (MM) approach. Moreover, use of the Wigner function (obtained directly) in a-a variables shows how our standard SQC/MM approach can be used to obtain off-diagonal elements of the electronic density matrix by processing in a different way the same set of trajectories already used (in the SQC/MM methodology) to obtain the diagonal elements.

The ϱ-ππ coupling constant in lattice gauge theory

Science.gov (United States)

Gottlieb, Steven; MacKenzie, Paul B.; Thacker, H. B.; Weingarten, Don

1984-01-01

We present a method for studying hadronic transitions in lattice gauge theory which requires computer time comparable to that required by recent hadron spectrum calculations. This method is applied to a calculation of the decay ϱ-->ππ. On leave from the Department of Physics, Indiana University, Bloomington, IN 47405, USA. Address after September 1, 1983: IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598, USA.

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Multidimensional periodic Schrödinger operator perturbation theory and applications

CERN Document Server

Veliev, Oktay

2015-01-01

The book describes the direct problems and the inverse problem of the multidimensional Schrödinger operator with a periodic potential. This concerns perturbation theory and constructive determination of the spectral invariants and finding the periodic potential from the given Bloch eigenvalues. The unique method of this book derives the asymptotic formulas for Bloch eigenvalues and Bloch functions for arbitrary dimension. Moreover, the measure of the iso-energetic surfaces in the high energy region is construct and estimated. It implies the validity of the Bethe-Sommerfeld conjecture for arbitrary dimensions and arbitrary lattices. Using the perturbation theory constructed in this book, the spectral invariants of the multidimensional operator from the given Bloch eigenvalues are determined. Some of these invariants are explicitly expressed by the Fourier coefficients of the potential. This way the possibility to determine the potential constructively by using Bloch eigenvalues as input data is given. In the ...

Entropy Spectrum of Black Holes of Heterotic String Theory via Adiabatic Invariance

Institute of Scientific and Technical Information of China (English)

Alexis Larra？ aga; Luis Cabarique; Manuel Londo？ o

2012-01-01

Using adiabatic invariance and the Bohr-Sommerfeld quantization rule we investigate the entropy spectroscopy of two black holes of heterotic string theory,the charged GMGHS and the rotating Sen solutions.It is shown that the entropy spectrum is equally spaced in both cases,identically to the spectrum obtained before for Schwarzschild,Reissner-Nordstr?m and Kerr black holes.Since the adiabatic invariance method does not use quasinormal mode analysis,there is no need to impose the small charge or small angular momentum limits and there is no confusion on whether the real part or the imaginary part of the modes is responsible for the entropy spectrum.

Illuminating the inner leadership journey by engaging intention and mindfulness as guided by caring theory.

Science.gov (United States)

Pipe, Teresa Britt

2008-01-01

Sustained, high-performance nursing leadership can be effectively guided by caring theory. While much of leadership performance is manifested by external behaviors, highly effective leaders are also grounded by internal work of self-reflection and growth. This article focuses primarily on the inward journey of leadership as guided by Jean Watson's Theory of Human Caring. Key elements of the theory are interpreted within the context of the emerging, urgent, high-stakes challenges of the current healthcare environment. The links between self-nurturance and caring-healing leadership of others are explored.

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

Science.gov (United States)

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

Science.gov (United States)

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

Creation of a longitudinally polarized subwavelength hotspot with an ultra-thin planar lens: vectorial Rayleigh–Sommerfeld method

International Nuclear Information System (INIS)

Ye, Huapeng; Qiu, Cheng-Wei; Huang, Kun; Yeo, Swee Ping; Teng, Jinghua; Luk’yanchuk, Boris

2013-01-01

This letter shows how a longitudinally polarized hotspot can be created by a planar ultra-thin lens that beats the diffraction limit. On the imaging plane, a subwavelength optical resolution 0.39λ with almost purely longitudinal electric component has been demonstrated in air ambient. This novel paradigm addresses simultaneously both longitudinal polarization and deep sub-diffraction imaging, by a planar lens composed of ultra-thin opaque concentric annuli. The vectorial Rayleigh–Sommerfeld (VRS) approach, offering the advantage of significant reduction in computation, has been developed for a particular optimization of a flat lens with full control of polarization. Empowered by the robustness of VRS in dealing with polarization states, the proposed roadmap may be universally and efficiently integrated with other optimization algorithms to design super-resolution imaging with controlled polarization states at any wavelength without luminescence of the object. The lens, which is empowered by the proposed method, opens an avenue for the first time toward a highly integrated imaging system with advanced functionalities in far-field super-imaging, tailored polarization states and flat ultra-thin geometry simultaneously. (letter)

Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

Directory of Open Access Journals (Sweden)

Roberta Maria Savieto

2016-03-01

Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

The Uniform geometrical Theory of Diffraction for elastodynamics: Plane wave scattering from a half-plane.

Science.gov (United States)

Djakou, Audrey Kamta; Darmon, Michel; Fradkin, Larissa; Potel, Catherine

2015-11-01

Diffraction phenomena studied in electromagnetism, acoustics, and elastodynamics are often modeled using integrals, such as the well-known Sommerfeld integral. The far field asymptotic evaluation of such integrals obtained using the method of steepest descent leads to the classical Geometrical Theory of Diffraction (GTD). It is well known that the method of steepest descent is inapplicable when the integrand's stationary phase point coalesces with its pole, explaining why GTD fails in zones where edge diffracted waves interfere with incident or reflected waves. To overcome this drawback, the Uniform geometrical Theory of Diffraction (UTD) has been developed previously in electromagnetism, based on a ray theory, which is particularly easy to implement. In this paper, UTD is developed for the canonical elastodynamic problem of the scattering of a plane wave by a half-plane. UTD is then compared to another uniform extension of GTD, the Uniform Asymptotic Theory (UAT) of diffraction, based on a more cumbersome ray theory. A good agreement between the two methods is obtained in the far field.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Asymmetric thermal-relic dark matter. Sommerfeld-enhanced freeze-out, annihilation signals and unitarity bounds

International Nuclear Information System (INIS)

Baldes, Iason; Petraki, Kalliopi

2017-03-01

Dark matter that possesses a particle-antiparticle asymmetry and has thermalised in the early universe, requires a larger annihilation cross-section compared to symmetric dark matter, in order to deplete the dark antiparticles and account for the observed dark matter density. The annihilation cross-section determines the residual symmetric component of dark matter, which may give rise to annihilation signals during CMB and inside haloes today. We consider dark matter with long-range interactions, in particular dark matter coupled to a light vector or scalar force mediator. We compute the couplings required to attain a final antiparticle-to-particle ratio after the thermal freeze-out of the annihilation processes in the early universe, and then estimate the late-time annihilation signals. We show that, due to the Sommerfeld enhancement, highly asymmetric dark matter with long-range interactions can have a significant annihilation rate, potentially larger than symmetric dark matter of the same mass with contact interactions. We discuss caveats in this estimation, relating to the formation of stable bound states. Finally, we consider the non-relativistic partial-wave unitarity bound on the inelastic cross-section, we discuss why it can be realised only by long-range interactions, and showcase the importance of higher partial waves in this regime of large inelasticity. We derive upper bounds on the mass of symmetric and asymmetric thermal-relic dark matter for s-wave and p-wave annihilation, and exhibit how these bounds strengthen as the dark asymmetry increases.

Asymmetric thermal-relic dark matter: Sommerfeld-enhanced freeze-out, annihilation signals and unitarity bounds

Energy Technology Data Exchange (ETDEWEB)

Baldes, Iason [DESY, Notkestraße 85, Hamburg, D-22607 Germany (Germany); Petraki, Kalliopi, E-mail: iason.baldes@desy.de, E-mail: kpetraki@lpthe.jussieu.fr [Laboratoire de Physique Théorique et Hautes Energies (LPTHE), UMR 7589 CNRS and UPMC, 4 Place Jussieu, Paris, F-75252 France (France)

2017-09-01

Dark matter that possesses a particle-antiparticle asymmetry and has thermalised in the early universe, requires a larger annihilation cross-section compared to symmetric dark matter, in order to deplete the dark antiparticles and account for the observed dark matter density. The annihilation cross-section determines the residual symmetric component of dark matter, which may give rise to annihilation signals during CMB and inside haloes today. We consider dark matter with long-range interactions, in particular dark matter coupled to a light vector or scalar force mediator. We compute the couplings required to attain a final antiparticle-to-particle ratio after the thermal freeze-out of the annihilation processes in the early universe, and then estimate the late-time annihilation signals. We show that, due to the Sommerfeld enhancement, highly asymmetric dark matter with long-range interactions can have a significant annihilation rate, potentially larger than symmetric dark matter of the same mass with contact interactions. We discuss caveats in this estimation, relating to the formation of stable bound states. Finally, we consider the non-relativistic partial-wave unitarity bound on the inelastic cross-section, we discuss why it can be realised only by long-range interactions, and showcase the importance of higher partial waves in this regime of large inelasticity. We derive upper bounds on the mass of symmetric and asymmetric thermal-relic dark matter for s -wave and p -wave annihilation, and exhibit how these bounds strengthen as the dark asymmetry increases.

Asymmetric thermal-relic dark matter. Sommerfeld-enhanced freeze-out, annihilation signals and unitarity bounds

Energy Technology Data Exchange (ETDEWEB)

Baldes, Iason [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Petraki, Kalliopi [Nationaal Instuut voor Kernfysica en Hoge-Energiefysica (NIKHEF), Amsterdam (Netherlands); UMR 7589 CNRS et UPMC, Paris (France). Laboratoire de Physique Theorique et Hautes Energies (LPTHE)

2017-03-15

Dark matter that possesses a particle-antiparticle asymmetry and has thermalised in the early universe, requires a larger annihilation cross-section compared to symmetric dark matter, in order to deplete the dark antiparticles and account for the observed dark matter density. The annihilation cross-section determines the residual symmetric component of dark matter, which may give rise to annihilation signals during CMB and inside haloes today. We consider dark matter with long-range interactions, in particular dark matter coupled to a light vector or scalar force mediator. We compute the couplings required to attain a final antiparticle-to-particle ratio after the thermal freeze-out of the annihilation processes in the early universe, and then estimate the late-time annihilation signals. We show that, due to the Sommerfeld enhancement, highly asymmetric dark matter with long-range interactions can have a significant annihilation rate, potentially larger than symmetric dark matter of the same mass with contact interactions. We discuss caveats in this estimation, relating to the formation of stable bound states. Finally, we consider the non-relativistic partial-wave unitarity bound on the inelastic cross-section, we discuss why it can be realised only by long-range interactions, and showcase the importance of higher partial waves in this regime of large inelasticity. We derive upper bounds on the mass of symmetric and asymmetric thermal-relic dark matter for s-wave and p-wave annihilation, and exhibit how these bounds strengthen as the dark asymmetry increases.

Asymmetric thermal-relic dark matter: Sommerfeld-enhanced freeze-out, annihilation signals and unitarity bounds

International Nuclear Information System (INIS)

Baldes, Iason; Petraki, Kalliopi

2017-01-01

Dark matter that possesses a particle-antiparticle asymmetry and has thermalised in the early universe, requires a larger annihilation cross-section compared to symmetric dark matter, in order to deplete the dark antiparticles and account for the observed dark matter density. The annihilation cross-section determines the residual symmetric component of dark matter, which may give rise to annihilation signals during CMB and inside haloes today. We consider dark matter with long-range interactions, in particular dark matter coupled to a light vector or scalar force mediator. We compute the couplings required to attain a final antiparticle-to-particle ratio after the thermal freeze-out of the annihilation processes in the early universe, and then estimate the late-time annihilation signals. We show that, due to the Sommerfeld enhancement, highly asymmetric dark matter with long-range interactions can have a significant annihilation rate, potentially larger than symmetric dark matter of the same mass with contact interactions. We discuss caveats in this estimation, relating to the formation of stable bound states. Finally, we consider the non-relativistic partial-wave unitarity bound on the inelastic cross-section, we discuss why it can be realised only by long-range interactions, and showcase the importance of higher partial waves in this regime of large inelasticity. We derive upper bounds on the mass of symmetric and asymmetric thermal-relic dark matter for s -wave and p -wave annihilation, and exhibit how these bounds strengthen as the dark asymmetry increases.

Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

International Nuclear Information System (INIS)

Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

2010-01-01

By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

Theory of superfluidity macroscopic quantum waves

International Nuclear Information System (INIS)

Ventura, I.

1978-10-01

A new description of superfluidity is proposed, based upon the fact that Bogoliubov's theory of superfluidity exhibits some so far unsuspected macroscopic quantum waves (MQWs), which have a topological nature and travel within the fluid at subsonic velocities. To quantize the bounded quasi-particles the field theoretic version of the Bohr-Sommerfeld quantization rule, is employed and also resort to a variational computation. In an instantaneous configuration the MQWs cut the condensate into blocks of phase, providing, by analogy with ferromagnetism, a nice explanation of what could be the lambda-transition. A crude estimate of the critical temperature gives T sub(c) approximately equal to 2-4K. An attempt is made to understand Tisza's two-fluid model in terms of the MQWs, and we rise the conjecture that they play an important role in the motion of second. We present also a qualitative prediction concerning to the behavior of the 'phononroton' peak below 1.0K, and propose two experiments to look for MQWs [pt

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

Science.gov (United States)

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

Science.gov (United States)

Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

2014-01-01

The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

Science.gov (United States)

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Extended low-frequency approximation for laser-modified electron scattering: Coulomb effects

International Nuclear Information System (INIS)

Mittleman, M.H.

1988-01-01

The Kroll-Watson [N.M. Kroll and K. M. Watson, Phys. Rev. A 8, 804 (1973)] theory for electron scattering in the field of a low-frequency laser has been extended by L. Rosenberg [Phys. Rev. A 23, 2283 (1981); 28, 2727 (1983)] to apply to higher intensities. That result is rederived in another way so as to make the correction second order. The correction terms are obtained and shown to be small in the high-intensity low-energy regime in which the original theory is weakest. The special case of a Coulomb potential is analyzed and shown to present special peculiarities in the extended theory just as in the original Kroll-Watson theory

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

Science.gov (United States)

Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

2014-01-01

In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Quantum field theory on a cone

International Nuclear Information System (INIS)

Dowker, J.S.

1977-01-01

The expressions derived by Sommerfeld (Proc. Lond. Math. Soc.; 28: 417 (1897)) and Carslaw (Proc. Lond. Math. Soc.; 20: 121 (1898), 8: 365 (1910), 18: 291 (1919)) for the Green functions and diffusion kernels in a wedge of arbitrary angle are shown to be useful in discussions of the Feynman Green function in Rindler (Am. J. Phys.; 34: 1174 (1966)) space and other space-time metrics. (author)

The Schroedinger equation and canonical perturbation theory

International Nuclear Information System (INIS)

Graffi, S.; Paul, T.

1987-01-01

Let T 0 (ℎ,ω)+εV be the Schroedinger operator corresponding to the classical Hamiltonian H 0 (ω)+εV, where H 0 (ω) is the d-dimensional harmonic oscillator with non-resonant frequencies ω=(ω 1 ..., ω d ) and the potential V(q 1 , ..., q d ) is an entire function of order (d+l) -1 . We prove that the algorithm of classical, canonical perturbation theory can be applied to the Schroedinger equation in the Bargmann representation. As a consequence, each term of the Rayleigh-Schroedinger series near any eigenvalue of T 0 (ℎ,ω) admits a convergent expansion in powers of ℎ of initial point the corresponding term of the classical Birkhoff expansion. Moreover if V is an even polynomial, the above result and the KAM theorem show that all eigenvalues λ n (ℎ,ε) of T 0 +εV such that nℎ coincides with a KAM torus are given, up to order ε ∞ , by a quantization formula which reduces to the Bohr-Sommerfeld one up to first order terms in ℎ. (orig.)

El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

Directory of Open Access Journals (Sweden)

Carme Ferré-Grau

2008-03-01

Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

The Towers Watson Approach to Improving Corporate Wellness.

Science.gov (United States)

Wootton, Adam

2012-06-01

Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

OpenAIRE

Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

2016-01-01

In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

[The impact of germ theory in the genesis of cancer. Consequences for surgical treatment in the victorian era].

Science.gov (United States)

Pereira Poza, A

1998-01-01

We use texts by preeminent figures in Victorian surgery at the end of the nineteenth century and information about their role in disseminating the germ theory to analyse the impact of this new etiologic element in the genesis of cancer. We trace the career of William Watson Cheyne (1852-1932), a disciple of Lister, and of many other surgeons of his generation, to outline the changes in the approach to treatment for cancer, the theoretical basis for these changes, and the role of a new conceptualization of cancer in the light of the microbial theory. This theory, among many other better-known factors, helped establish the foundation for radical surgery which became widespread in oncological treatment during the final decade of the nineteenth century.

Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

Directory of Open Access Journals (Sweden)

Ingrid Meireles Gomes

2013-09-01

Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

Science.gov (United States)

Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

2018-01-01

Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

Science.gov (United States)

Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

2018-04-01

Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

Applications of the Galton-Watson process to human DNA evolution and demography

CERN Document Server

Neves, A G M

2005-01-01

We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

Science.gov (United States)

Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

2013-11-01

William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

Transferring and practicing the correspondence principle in the old quantum theory: Franck, Hund and the Ramsauer effect

Energy Technology Data Exchange (ETDEWEB)

Jaehnert, Martin [MPIWG, Berlin (Germany)

2013-07-01

In 1922 Niels Bohr wrote a letter to Arnold Sommerfeld complaining that: ''[i]n the last years my attempts to develop the principles of quantum theory were met with very little understanding.'' Looking for the correspondence idea in publications, one finds that the principle was indeed hardly applied by physicists outside of Copenhagen. Only by 1922 physicists from wider research networks of quantum theory started to transfer the principle into their research fields, often far removed from its initial realm of atomic spectroscopy. How and why did physicists suddenly become interested in the idea that Bohr*s writings had been promoting since 1918? How was the correspondence principle transferred to these fields and how did its transfer affect these fields and likewise the correspondence principle itself? To discuss these questions, my talk focuses on the work of James Franck and Friedrich Hund on the Ramsauer effect in 1922 and follows the interrelation of the developing understanding of a newly found effect and the adaptation of the correspondence idea in a new conceptual and sociological context.

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

Science.gov (United States)

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

Science.gov (United States)

Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

PENGEMBANGAN TES BERPIKIR KRITIS DENGAN PENDEKATAN ITEM RESPONSE THEORY

Directory of Open Access Journals (Sweden)

Fajrianthi Fajrianthi

2016-06-01

Full Text Available Penelitian ini bertujuan untuk menghasilkan sebuah alat ukur (tes berpikir kritis yang valid dan reliabel untuk digunakan, baik dalam lingkup pendidikan maupun kerja di Indonesia. Tahapan penelitian dilakukan berdasarkan tahap pengembangan tes menurut Hambleton dan Jones (1993. Kisi-kisi dan pembuatan butir didasarkan pada konsep dalam tes Watson-Glaser Critical Thinking Appraisal (WGCTA. Pada WGCTA, berpikir kritis terdiri dari lima dimensi yaitu Inference, Recognition Assumption, Deduction, Interpretation dan Evaluation of arguments. Uji coba tes dilakukan pada 1.453 peserta tes seleksi karyawan di Surabaya, Gresik, Tuban, Bojonegoro, Rembang. Data dikotomi dianalisis dengan menggunakan model IRT dengan dua parameter yaitu daya beda dan tingkat kesulitan butir. Analisis dilakukan dengan menggunakan program statistik Mplus versi 6.11 Sebelum melakukan analisis dengan IRT, dilakukan pengujian asumsi yaitu uji unidimensionalitas, independensi lokal dan Item Characteristic Curve (ICC. Hasil analisis terhadap 68 butir menghasilkan 15 butir dengan daya beda yang cukup baik dan tingkat kesulitan butir yang berkisar antara –4 sampai dengan 2.448. Sedikitnya jumlah butir yang berkualitas baik disebabkan oleh kelemahan dalam menentukan subject matter experts di bidang berpikir kritis dan pemilihan metode skoring. Kata kunci: Pengembangan tes, berpikir kritis, item response theory   DEVELOPING CRITICAL THINKING TEST UTILISING ITEM RESPONSE THEORY Abstract The present study was aimed to develop a valid and reliable instrument in assesing critical thinking which can be implemented both in educational and work settings in Indonesia. Following the Hambleton and Jones’s (1993 procedures on test development, the study developed the instrument by employing the concept of critical thinking from Watson-Glaser Critical Thinking Appraisal (WGCTA. The study included five dimensions of critical thinking as adopted from the WGCTA: Inference, Recognition

Anomalies and the crisis of the Bohr-Sommerfeld atomic theory

DEFF Research Database (Denmark)

Kragh, Helge

2014-01-01

In: Scientific Cosmopolitanism and Local Cultures: Religions, Ideologies, Societies (5th ESHS Conference Proceedings, 2014), pp. 652-657.......In: Scientific Cosmopolitanism and Local Cultures: Religions, Ideologies, Societies (5th ESHS Conference Proceedings, 2014), pp. 652-657....

Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

Directory of Open Access Journals (Sweden)

Kevin Possin

2014-12-01

Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

Directory of Open Access Journals (Sweden)

Susilawati Susilawati

2016-06-01

Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

Principle-based concept analysis: intentionality in holistic nursing theories.

Science.gov (United States)

Aghebati, Nahid; Mohammadi, Eesa; Ahmadi, Fazlollah; Noaparast, Khosrow Bagheri

2015-03-01

This is a report of a principle-based concept analysis of intentionality in holistic nursing theories. A principle-based concept analysis method was used to analyze seven holistic theories. The data included eight books and 31 articles (1998-2011), which were retrieved through MEDLINE and CINAHL. Erickson, Kriger, Parse, Watson, and Zahourek define intentionality as a capacity, a focused consciousness, and a pattern of human being. Rogers and Newman do not explicitly mention intentionality; however, they do explain pattern and consciousness (epistemology). Intentionality has been operationalized as a core concept of nurse-client relationships (pragmatic). The theories are consistent on intentionality as a noun and as an attribute of the person-intentionality is different from intent and intention (linguistic). There is ambiguity concerning the boundaries between intentionality and consciousness (logic). Theoretically, intentionality is an evolutionary capacity to integrate human awareness and experience. Because intentionality is an individualized concept, we introduced it as "a matrix of continuous known changes" that emerges in two forms: as a capacity of human being and as a capacity of transpersonal caring. This study has produced a theoretical definition of intentionality and provides a foundation for future research to further investigate intentionality to better delineate its boundaries. © The Author(s) 2014.

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

Directory of Open Access Journals (Sweden)

Gerry Joseph Nagtzaam

2014-03-01

Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

Energy Technology Data Exchange (ETDEWEB)

Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

1994-09-01

The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Numerical methods for hydrodynamic stability problems

International Nuclear Information System (INIS)

Fujimura, Kaoru

1985-11-01

Numerical methods for solving the Orr-Sommerfeld equation, which is the fundamental equation of the hydrodynamic stability theory for various shear flows, are reviewed and typical numerical results are presented. The methods of asymptotic solution, finite difference methods, initial value methods and expansions in orthogonal functions are compared. (author)

Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

Science.gov (United States)

Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

2018-04-01

This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

Science.gov (United States)

Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

2017-12-20

This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

Science.gov (United States)

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

International Nuclear Information System (INIS)

Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

1988-01-01

The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Single determinantal reaction theory as a Schroedinger analog: the time-dependent S-matrix Hartree-Fock method

International Nuclear Information System (INIS)

Griffin, J.J.; Lichtner, P.C.; Dworzecka, M.; Kan, K.K.

1979-01-01

It is suggested that the TDHF method be viewed, not as an approximation to but as a model of the exact Schroedinger system; that is, as a gedanken many-body experiment whose analysis with digital computers provides data worthy in itself of theoretical study. From such a viewpoint attention is focused on the structural analogies of the TDHF system with the exact theory rather than upon its quantitative equivalence, and the TDHF many-body system is studied as a challenge of its own which, although much simpler than the realistic problem, may still offer complexity enough to educate theorists in the present state of knowledge. In this spirit, the TDHF description of continuum reactions can be restructured from an initial-value problem into a form analogous to the S-matrix version of the Schroedinger theory. The resulting TD-S-HF theory involves only self-consistent single determinantal solutions of the TDHF equations and invokes time averaging to obtain a consistent interpretation of the TDHF analogs of quantities which are constant in the exact theory, such as the S-matrix and the asymptotic reaction channel characteristics. Periodic solutions then play the role of stationary eigenstates in the construction of suitable asymptotic reaction channels. If these periodic channel states occur only at discrete energies, then the resulting channels are mutually orthogonal (on the time average) and the theory exhibits a structure fully analogous to the exact theory. In certain special cases where the periodic solutions are known to occur as an energy continuum, the requirement that the periodicity of the channel solutions be gauge invariant provides a natural requantization condition which (suggestively) turns out to be identical with the Bohr-Sommerfeld quantization rule. 11 references

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

Energy Technology Data Exchange (ETDEWEB)

Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

2016-03-15

Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

Large-angle theory for pion-nucleus scattering at high energies

International Nuclear Information System (INIS)

Hoock, D.W. Jr.

1978-01-01

An approximate solution for high-energy, projectile-nucleus, multiple scattering is developed from the exact Watson series and applied to pion scattering for 12 C and 4 He. Agreement with measured differential cross sections available from the literature for the range 150 to 260 MeV pion laboratory energies is surprisingly good. The approximation method expands the propagators of the Watson series about the transverse component of the momentum transfer. Contributions of each of the first two terms to double scattering from a Gaussian potential are compared to the exact solution. The purely plane-wave propagation produces a scattering amplitude that agrees to order (k 0 a) -1 with the exact solution at the forward and backward directions at high energies. The second (off-axis) propagation term produces an amplitude that is one order smaller at forward angles and two orders smaller at 180 0 than the exact amplitude. At intermediate angles it is of the same order. The general multiple-scattering series is approximated with selection of plane-wave propagation as the fundamental process at large and small angles. This model suggests that a single nucleon accepts most of the momentum transfer for backward scattering. The resulting multiple-scattering formula agrees with the well-known high-energy eikonal theory at small angles and the backward-angle scattering formula of Chen at exactly 180 0 . A lowest-order formula that includes off-axis propagation is also derived. Predicted differential cross sections are found to be sensitive to nucleon motion and binding. For 4 He the effect of the nuclear potential on the pion kinetic energy is also examined and found to produce significant changes in the predicted cross sections

Comparison of approximate methods for multiple scattering in high-energy collisions. II

International Nuclear Information System (INIS)

Nolan, A.M.; Tobocman, W.; Werby, M.F.

1976-01-01

The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

Directory of Open Access Journals (Sweden)

Gonzalo Martínez Fernández

2016-01-01

Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

Quantum-Classical Connection for Hydrogen Atom-Like Systems

Science.gov (United States)

Syam, Debapriyo; Roy, Arup

2011-01-01

The Bohr-Sommerfeld quantum theory specifies the rules of quantization for circular and elliptical orbits for a one-electron hydrogen atom-like system. This article illustrates how a formula connecting the principal quantum number "n" and the length of the major axis of an elliptical orbit may be arrived at starting from the quantum…

Arnold Sommerfeld

Indian Academy of Sciences (India)

IAS Admin

The German tradition in physics – as in music, philosophy and literature – has been an exceptional one over a very long period of time. Recall the likes of Gustav Kirchhoff, Hermann von Helmholtz, Heinrich Hertz and Wilhelm Röntgen during the 19th century; to be followed by Max Planck, Wilhelm Wien, Albert Einstein, ...

Quantization of Poisson Manifolds from the Integrability of the Modular Function

Science.gov (United States)

Bonechi, F.; Ciccoli, N.; Qiu, J.; Tarlini, M.

2014-10-01

We discuss a framework for quantizing a Poisson manifold via the quantization of its symplectic groupoid, combining the tools of geometric quantization with the results of Renault's theory of groupoid C*-algebras. This setting allows very singular polarizations. In particular, we consider the case when the modular function is multiplicatively integrable, i.e., when the space of leaves of the polarization inherits a groupoid structure. If suitable regularity conditions are satisfied, then one can define the quantum algebra as the convolution algebra of the subgroupoid of leaves satisfying the Bohr-Sommerfeld conditions. We apply this procedure to the case of a family of Poisson structures on , seen as Poisson homogeneous spaces of the standard Poisson-Lie group SU( n + 1). We show that a bihamiltonian system on defines a multiplicative integrable model on the symplectic groupoid; we compute the Bohr-Sommerfeld groupoid and show that it satisfies the needed properties for applying Renault theory. We recover and extend Sheu's description of quantum homogeneous spaces as groupoid C*-algebras.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Magnetized plasma kinetic theory

International Nuclear Information System (INIS)

Hassan, M.H.A.; Watson, C.J.H.

1977-01-01

The magnetized Balescu-Lenard Collision integral for a multi-species plasma in the form derived by Hassan and Watson (1976) is approximated by ignoring wave effects. The resulting collision integral is put in Fokker-Planck form and most of the integrals occurring in the coefficients are performed analytically. The remaining integral is evaluated approximately in various limits for ion-electron, electron-electron and electron-ion interactions. (author)

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Communication: Wigner functions in action-angle variables, Bohr-Sommerfeld quantization, the Heisenberg correspondence principle, and a symmetrical quasi-classical approach to the full electronic density matrix

International Nuclear Information System (INIS)

Miller, William H.; Cotton, Stephen J.

2016-01-01

It is pointed out that the classical phase space distribution in action-angle (a-a) variables obtained from a Wigner function depends on how the calculation is carried out: if one computes the standard Wigner function in Cartesian variables (p, x), and then replaces p and x by their expressions in terms of a-a variables, one obtains a different result than if the Wigner function is computed directly in terms of the a-a variables. Furthermore, the latter procedure gives a result more consistent with classical and semiclassical theory—e.g., by incorporating the Bohr-Sommerfeld quantization condition (quantum states defined by integer values of the action variable) as well as the Heisenberg correspondence principle for matrix elements of an operator between such states—and has also been shown to be more accurate when applied to electronically non-adiabatic applications as implemented within the recently developed symmetrical quasi-classical (SQC) Meyer-Miller (MM) approach. Moreover, use of the Wigner function (obtained directly) in a-a variables shows how our standard SQC/MM approach can be used to obtain off-diagonal elements of the electronic density matrix by processing in a different way the same set of trajectories already used (in the SQC/MM methodology) to obtain the diagonal elements.

Communication: Wigner functions in action-angle variables, Bohr-Sommerfeld quantization, the Heisenberg correspondence principle, and a symmetrical quasi-classical approach to the full electronic density matrix

Energy Technology Data Exchange (ETDEWEB)

Miller, William H., E-mail: millerwh@berkeley.edu; Cotton, Stephen J., E-mail: StephenJCotton47@gmail.com [Department of Chemistry and Kenneth S. Pitzer Center for Theoretical Chemistry, University of California, and Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

2016-08-28

It is pointed out that the classical phase space distribution in action-angle (a-a) variables obtained from a Wigner function depends on how the calculation is carried out: if one computes the standard Wigner function in Cartesian variables (p, x), and then replaces p and x by their expressions in terms of a-a variables, one obtains a different result than if the Wigner function is computed directly in terms of the a-a variables. Furthermore, the latter procedure gives a result more consistent with classical and semiclassical theory—e.g., by incorporating the Bohr-Sommerfeld quantization condition (quantum states defined by integer values of the action variable) as well as the Heisenberg correspondence principle for matrix elements of an operator between such states—and has also been shown to be more accurate when applied to electronically non-adiabatic applications as implemented within the recently developed symmetrical quasi-classical (SQC) Meyer-Miller (MM) approach. Moreover, use of the Wigner function (obtained directly) in a-a variables shows how our standard SQC/MM approach can be used to obtain off-diagonal elements of the electronic density matrix by processing in a different way the same set of trajectories already used (in the SQC/MM methodology) to obtain the diagonal elements.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

Directory of Open Access Journals (Sweden)

Gabriele Guidi

2016-07-01

Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

The birth and development of the DNA theory of inheritance: sixty years since the discovery of the structure of DNA.

Science.gov (United States)

Portin, Petter

2014-04-01

The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.

Rewards of bridging the divide between measurement and clinical theory: demonstration of a bifactor model for the Brief Symptom Inventory.

Science.gov (United States)

Thomas, Michael L

2012-03-01

There is growing evidence that psychiatric disorders maintain hierarchical associations where general and domain-specific factors play prominent roles (see D. Watson, 2005). Standard, unidimensional measurement models can fail to capture the meaningful nuances of such complex latent variable structures. The present study examined the ability of the multidimensional item response theory bifactor model (see R. D. Gibbons & D. R. Hedeker, 1992) to improve construct validity by serving as a bridge between measurement and clinical theories. Archival data consisting of 688 outpatients' psychiatric diagnoses and item-level responses to the Brief Symptom Inventory (BSI; L. R. Derogatis, 1993) were extracted from files at a university mental health clinic. The bifactor model demonstrated superior fit for the internal structure of the BSI and improved overall diagnostic accuracy in the sample (73%) compared with unidimensional (61%) and oblique simple structure (65%) models. Consistent with clinical theory, multiple sources of item variance were drawn from individual test items. Test developers and clinical researchers are encouraged to consider model-based measurement in the assessment of psychiatric distress.

On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

International Nuclear Information System (INIS)

Hey, J D

2014-01-01

As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

Behaviorism and Neuroscience.

Science.gov (United States)

Thompson, Richard F.

1994-01-01

The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

CERN Multimedia

Patrice Loiez

1999-01-01

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

2003-01-01

Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

Science.gov (United States)

Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

2016-03-16

We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

Role modeling excellence in clinical nursing practice.

Science.gov (United States)

Perry, R N Beth

2009-01-01

Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.

Numerical-analytic implementation of the higher-order canonical Van Vleck perturbation theory for the interpretation of medium-sized molecule vibrational spectra.

Science.gov (United States)

Krasnoshchekov, Sergey V; Isayeva, Elena V; Stepanov, Nikolay F

2012-04-12

Anharmonic vibrational states of semirigid polyatomic molecules are often studied using the second-order vibrational perturbation theory (VPT2). For efficient higher-order analysis, an approach based on the canonical Van Vleck perturbation theory (CVPT), the Watson Hamiltonian and operators of creation and annihilation of vibrational quanta is employed. This method allows analysis of the convergence of perturbation theory and solves a number of theoretical problems of VPT2, e.g., yields anharmonic constants y(ijk), z(ijkl), and allows the reliable evaluation of vibrational IR and Raman anharmonic intensities in the presence of resonances. Darling-Dennison and higher-order resonance coupling coefficients can be reliably evaluated as well. The method is illustrated on classic molecules: water and formaldehyde. A number of theoretical conclusions results, including the necessity of using sextic force field in the fourth order (CVPT4) and the nearly vanishing CVPT4 contributions for bending and wagging modes. The coefficients of perturbative Dunham-type Hamiltonians in high-orders of CVPT are found to conform to the rules of equality at different orders as earlier proven analytically for diatomic molecules. The method can serve as a good substitution of the more traditional VPT2.

Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

International Nuclear Information System (INIS)

Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

2000-01-01

This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

CERN Multimedia

Brice, Maximilien

2014-01-01

Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

International Nuclear Information System (INIS)

de Prunele, E.

1983-01-01

The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

[Considering body ethics in the healthcare profession].

Science.gov (United States)

Wang, Shin-Yun

2014-10-01

This article uses the theory of body phenomenology and Watson's caring theory to develop and apply body ethics to the clinical healthcare profession. This attempt is meant to facilitate deep, humanistic experiences for healthcare personnel. The analysis of body phenomenology reveals that the soul is banished from her familiar and comfortable "at-home" status when illness and pain invade the body. In such situations, the body becomes an external object that is self-alienated. This experience induces experiences such as solitude and violence. However, it also holds the potential to expose the original morality of the body. Additionally, this article discusses popular tools used in clinical ethics such as principalism and virtual-based ethics, which are based on moral reasoning and moral feeling. In contrast to these, body ethics seek a more profound and humble level of sensibility that is able to implant authenticity into the ethics. Finally, we offer some suggestions related to Watson's caring theory.

Minimal coupling schemes in N-body reaction theory

International Nuclear Information System (INIS)

Picklesimer, A.; Tandy, P.C.; Thaler, R.M.

1982-01-01

A new derivation of the N-body equations of Bencze, Redish, and Sloan is obtained through the use of Watson-type multiple scattering techniques. The derivation establishes an intimate connection between these partition-labeled N-body equations and the particle-labeled Rosenberg equations. This result yields new insight into the implicit role of channel coupling in, and the minimal dimensionality of, the partition-labeled equations

Beyond the Fourfold Gospel

DEFF Research Database (Denmark)

Omerzu, Heike

2014-01-01

, for instance, the extent to which Luke made use of Matthew or the existence of a Christian ‘Sayings Collection’ genre. It is argued that an explanation of the Synoptic Problem demands a more complex theory than the one sketched by Watson and that the question of manuscript transmission also needs...... to be integrated into that theory....

Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

Science.gov (United States)

Bandyopadhyay, D; Bhattacharyya, D

2006-10-15

It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

Observable gravitational and electromagnetic orbits and trajectories in discrete physics

International Nuclear Information System (INIS)

Noyes, H.P.; McGoveran, D.O.

1988-01-01

Our discrete and finite version of relativistic quantum mechanics provides an elementary particle physics consistent with the standard model of quarks and leptons. Our recent relativistic calculation of the bound state spectrum of hydrogen has allowed us to make a combinatorial correction to the first order estimate of 1/α = /Dirac h/c/e 2 = 137 derived from the combinatorial hierarchy and achieve agreement with experiment up to terms of order α 3 . The same theory requires that to first order /Dirac h/c/Gm/sub p/ 2 = 2 127 + 136 ≅ 1.7 /times/ 10 38 . Using the emission and absorption of spin 1 photons and spin 2 gravitons in this framework, we try to show that we can meet the three additional tests of general relativity---solar red shift, solar bending of light, and precession of the perihelion of Mercury. We predict that a macroscopic electromagnetic orbit would have four times the Sommerfeld precession for basically the same reason that Mercury has six times the Sommerfeld precession. 20 refs

Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

Directory of Open Access Journals (Sweden)

Siddharth Jain

Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

Reflections A Conversation About Solid State Physics

Indian Academy of Sciences (India)

the sort of thing, differential equations with eigenvalues, that Sommerfeld had loved for .... And I think it is very strange that the Russians found it difficult, .... all over the world, so in order to show that this was a serious book, Sommerfeld had to.

Effect of liquid surface tension on circular and linear hydraulic jumps; theory and experiments

Science.gov (United States)

Bhagat, Rajesh Kumar; Jha, Narsing Kumar; Linden, Paul F.; Wilson, David Ian

2017-11-01

The hydraulic jump has attracted considerable attention since Rayleigh published his account in 1914. Watson (1964) proposed the first satisfactory explanation of the circular hydraulic jump by balancing the momentum and hydrostatic pressure across the jump, but this solution did not explain what actually causes the jump to form. Bohr et al. (1992) showed that the hydraulic jump happens close to the point where the local Froude number equals to one, suggesting a balance between inertial and hydrostatic contributions. Bush & Aristoff (2003) subsequently incorporated the effect of surface tension and showed that this is important when the jump radius is small. In this study, we propose a new account to explain the formation and evolution of hydraulic jumps under conditions where the jump radius is strongly influenced by the liquid surface tension. The theory is compared with experiments employing liquids of different surface tension and different viscosity, in circular and linear configurations. The model predictions and the experimental results show excellent agreement. Commonwealth Scholarship Commission, St. John's college, University of Cambridge.

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Sadhana. BASANT LAL SHARMA. Articles written in Sadhana. Volume 42 Issue 5 May 2017 pp 713-728. Continuum limit of discrete Sommerfeld problems on square lattice · BASANT LAL SHARMA · More Details Abstract Fulltext PDF. A low-frequency approximation of the discrete Sommerfeld diffraction ...

B-DNA model systems in non-terran bio-solvents : Implications for structure, stability and replication

NARCIS (Netherlands)

Hamlin, Trevor A.; Poater, Jordi; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias

2017-01-01

We have computationally analyzed a comprehensive series of Watson-Crick and mismatched B-DNA base pairs, in the gas phase and in several solvents, including toluene, chloroform, ammonia, methanol and water, using dispersion-corrected density functional theory and implicit solvation. Our analyses

Macromolecules Vis-a-Vis the Traditions of Chemistry

Science.gov (United States)

Flory, Paul J.

1973-01-01

Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…

Problems which are well posed in a generalized sense with applications to the Einstein equations

International Nuclear Information System (INIS)

Kreiss, H-O; Winicour, J

2006-01-01

In the harmonic description of general relativity, the principal part of the Einstein equations reduces to a constrained system of ten curved space wave equations for the components of the spacetime metric. We use the pseudo- differential theory of systems which are strongly well posed in the generalized sense to establish the well posedness of constraint-preserving boundary conditions for this system when treated in a second-order differential form. The boundary conditions are of a generalized Sommerfeld type that is benevolent for numerical calculation

Toward an effective field theory approach to reheating

Science.gov (United States)

Özsoy, Ogan; Giblin, John T.; Nesbit, Eva; Şengör, Gizem; Watson, Scott

2017-12-01

We investigate whether effective field theory (EFT) approaches, which have been useful in examining inflation and dark energy, can also be used to establish a systematic approach to inflationary reheating. We consider two methods. First, we extend Weinberg's background EFT to the end of inflation and reheating. We establish when parametric resonance and decay of the inflaton occurs, but also find intrinsic theoretical limitations, which make it difficult to capture some reheating models. This motivates us to next consider Cheung et al.'s EFT approach, which instead focuses on perturbations and the symmetry breaking induced by the cosmological background. Adapting the latter approach to reheating implies some new and important differences compared to the EFT of inflation. In particular, there are new hierarchical scales, and we must account for inflaton oscillations during reheating, which lead to discrete symmetry breaking. Guided by the fundamental symmetries, we construct the EFT of reheating, and as an example of its usefulness we establish a new class of reheating models and the corresponding predictions for gravity wave observations. In this paper we primarily focus on the first stages of preheating. We conclude by discussing challenges for the approach and future directions. This paper builds on ideas first proposed in the paper [O. Ozsoy, G. Sengor, K. Sinha, and S. Watson, arXiv:1507.06651.].

Linear and nonlinear instability in vertical counter-current laminar gas-liquid flows

Science.gov (United States)

Schmidt, Patrick; Ó Náraigh, Lennon; Lucquiaud, Mathieu; Valluri, Prashant

2016-04-01

We consider the genesis and dynamics of interfacial instability in vertical gas-liquid flows, using as a model the two-dimensional channel flow of a thin falling film sheared by counter-current gas. The methodology is linear stability theory (Orr-Sommerfeld analysis) together with direct numerical simulation of the two-phase flow in the case of nonlinear disturbances. We investigate the influence of two main flow parameters on the interfacial dynamics, namely the film thickness and pressure drop applied to drive the gas stream. To make contact with existing studies in the literature, the effect of various density contrasts is also examined. Energy budget analyses based on the Orr-Sommerfeld theory reveal various coexisting unstable modes (interfacial, shear, internal) in the case of high density contrasts, which results in mode coalescence and mode competition, but only one dynamically relevant unstable interfacial mode for low density contrast. A study of absolute and convective instability for low density contrast shows that the system is absolutely unstable for all but two narrow regions of the investigated parameter space. Direct numerical simulations of the same system (low density contrast) show that linear theory holds up remarkably well upon the onset of large-amplitude waves as well as the existence of weakly nonlinear waves. For high density contrasts, corresponding more closely to an air-water-type system, linear stability theory is also successful at determining the most-dominant features in the interfacial wave dynamics at early-to-intermediate times. Nevertheless, the short waves selected by the linear theory undergo secondary instability and the wave train is no longer regular but rather exhibits chaotic motion. The same linear stability theory predicts when the direction of travel of the waves changes — from downwards to upwards. We outline the practical implications of this change in terms of loading and flooding. The change in direction of the

Linear and nonlinear instability in vertical counter-current laminar gas-liquid flows

International Nuclear Information System (INIS)

Schmidt, Patrick; Lucquiaud, Mathieu; Valluri, Prashant; Ó Náraigh, Lennon

2016-01-01

We consider the genesis and dynamics of interfacial instability in vertical gas-liquid flows, using as a model the two-dimensional channel flow of a thin falling film sheared by counter-current gas. The methodology is linear stability theory (Orr-Sommerfeld analysis) together with direct numerical simulation of the two-phase flow in the case of nonlinear disturbances. We investigate the influence of two main flow parameters on the interfacial dynamics, namely the film thickness and pressure drop applied to drive the gas stream. To make contact with existing studies in the literature, the effect of various density contrasts is also examined. Energy budget analyses based on the Orr-Sommerfeld theory reveal various coexisting unstable modes (interfacial, shear, internal) in the case of high density contrasts, which results in mode coalescence and mode competition, but only one dynamically relevant unstable interfacial mode for low density contrast. A study of absolute and convective instability for low density contrast shows that the system is absolutely unstable for all but two narrow regions of the investigated parameter space. Direct numerical simulations of the same system (low density contrast) show that linear theory holds up remarkably well upon the onset of large-amplitude waves as well as the existence of weakly nonlinear waves. For high density contrasts, corresponding more closely to an air-water-type system, linear stability theory is also successful at determining the most-dominant features in the interfacial wave dynamics at early-to-intermediate times. Nevertheless, the short waves selected by the linear theory undergo secondary instability and the wave train is no longer regular but rather exhibits chaotic motion. The same linear stability theory predicts when the direction of travel of the waves changes — from downwards to upwards. We outline the practical implications of this change in terms of loading and flooding. The change in direction of the

Coaxing an intimate public : Life narrative in digital storytelling

NARCIS (Netherlands)

Poletti, Anna

2011-01-01

This article considers the practice of digital storytelling in light of contemporary theories of autobiography and affect. Using the concept of coaxed life narrative developed by Sidonie Smith and Julia Watson, I analyse the role of digital storytelling in diversifying the voices in the public

Single-crystal study of the charge density wave metal LuNiC2

Science.gov (United States)

Steiner, S.; Michor, H.; Sologub, O.; Hinterleitner, B.; Höfenstock, F.; Waas, M.; Bauer, E.; Stöger, B.; Babizhetskyy, V.; Levytskyy, V.; Kotur, B.

2018-05-01

We report on single-crystal growth, single-crystal x-ray diffraction, physical properties, and density functional theory (DFT) electronic structure as well as Fermi surface calculations for two ternary carbides, LuCoC2 and LuNiC2. Electrical resistivity measurements reveal for LuNiC2 a charge density wave (CDW) transition at TCDW≃450 K and, for T >TCDW , a significant anisotropy of the electrical resistivity, which is lowest along the orthorhombic a axis. The analysis of x-ray superstructure reflections suggest a commensurate CDW state with a Peierls-type distortion of the Ni atom periodicity along the orthorhombic a axis. DFT calculations based on the CDW modulated monoclinic structure model of LuNiC2 as compared to results of the orthorhombic parent type reveal the formation of a partial CDW gap at the Fermi level which reduces the electronic density of states from N (EF)=1.03 states/eV f.u. without CDW to N (EF)=0.46 states/eV f.u. in the CDW state. The corresponding bare DFT Sommerfeld value of the latter, γDFTCDW=0.90 mJ/mol K2, reaches reasonable agreement with the experimental value γ =0.83 (5 ) mJ/mol K2 of LuNiC2. LuCoC2 displays a simple metallic behavior with neither CDW ordering nor superconductivity above 0.4 K. Its experimental Sommerfeld coefficient, γ =5.9 (1) mJ/mol K2, is in realistic correspondence with the calculated, bare Sommerfeld coefficient, γDFT=3.82 mJ/mol K2, of orthorhombic LuCoC2.

Alternative Watson-Crick Synthetic Genetic Systems.

Science.gov (United States)

Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

2016-11-01

In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

Computational Methods for Inviscid and Viscous Two-and-Three-Dimensional Flow Fields.

Science.gov (United States)

1975-01-01

Difference Equations Over a Network, Watson Sei. Comput. Lab. Report, 19U9. 173- Isaacson, E. and Keller, H. B., Analaysis of Numerical Methods...element method has given a new impulse to the old mathematical theory of multivariate interpolation. We first study the one-dimensional case, which

Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

Directory of Open Access Journals (Sweden)

María L. Román-Miranda

2013-01-01

Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

Multivariate and semiparametric kernel regression

OpenAIRE

Härdle, Wolfgang; Müller, Marlene

1997-01-01

The paper gives an introduction to theory and application of multivariate and semiparametric kernel smoothing. Multivariate nonparametric density estimation is an often used pilot tool for examining the structure of data. Regression smoothing helps in investigating the association between covariates and responses. We concentrate on kernel smoothing using local polynomial fitting which includes the Nadaraya-Watson estimator. Some theory on the asymptotic behavior and bandwidth selection is pro...

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Distribution of electron orbits having a definite angular momentum in a static magnetic field

International Nuclear Information System (INIS)

Olszewski, S.

1996-01-01

Electron orbits having a definite angular momentum in a static magnetic field are calculated with the aid of the Bohr-Sommerfeld quantization rules. The quantization gives that orbits are arranged along a straight line but the distance between the centers of two neighboring orbits decreases with increase of the absolute value of the angular momentum. With the energy correction equal to the zero-point energy of the harmonic oscillator, the distribution of orbits becomes identical to that obtained recently with the aid of a mixed semiclassical and quantum mechanical theory. 16 refs., 1 fig

What is physics problem solving competency?

DEFF Research Database (Denmark)

Niss, Martin

2018-01-01

on the nature of physics problem- solving competency. The first, Sommerfeld’s, is a “theory first, phenomenon second” approach. Here the relevant problems originate in one of the theories of physics and the job goal of the problem- solver is to make a mathematical analysis of the suitable equation......A central goal of physics education is to teach problem-solving competency, but the nature of this competency is not well-described in the literature. The present paperarticle uses recent historical scholarship on Arnold Sommerfeld and Enrico Fermi to identify and characterize two positions......(s) and then give a qualitative analysis of the phenomenon that arise from these mathematical results. Fermi’s position is a “phenomenon first, theory second” approach, where the starting point is a physical phenomenon that is analyzed and then brought into the realm of a physics theory. The two positions...

Conflicting Ideologies and Language Policy in Adult ESL: Complexities of Language Socialization in a Majority-L1 Classroom

Science.gov (United States)

Mori, Miki

2014-01-01

This study looks at how language ideologies affect and are revealed in language socialization practices in a majority-L1 adult ESL classroom, particularly looking at language use and policy. It draws on recent theories and critiques of language socialization (Bayley & Langman, 2011; Bronson & Watson-Gegeo, 2008; Garrett &…

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

Science.gov (United States)

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

Science.gov (United States)

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

Writing Assessment's "Debilitating Inheritance": Behaviorism's Dismissal of Experience

Science.gov (United States)

Wilson, Maja Joiwind

2013-01-01

In this project, I examine the legacy of behaviorism's dismissal of experience on contemporary writing assessment theory and practice within the field of composition studies. I use an archival study of John B. Watson's letters to Robert Mearns Yerkes to establish behaviorism's systematic denial of experience and its related constructs: mind,…

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

On the isobaric spin and the scattering matrix

International Nuclear Information System (INIS)

Hategan, Cornel

2002-01-01

The isobaric spin and the scattering matrix are fundamental nuclear physics concepts invented by Werner Heisenberg. The cardinal impact of the Heisenberg concepts on historical developpement of nuclear physics and other quantum and classical physics branches is discussed in this communication. Heisenberg in physics is synonymous to monumental scientific creations, namely: -'Creation of quantum mechanics' (Nobel Prize, 1932), -'Heisenberg relations', or 'Heisenberg inequalities' or 'Uncertainty principle' or 'Indeterminacy principle', - Basis for Copenhagen interpretation of Quantum Mechanics, -'world formula', - Project for a unitary theory representing all existing particles. Heisenberg does signify also important/cardinal contributions to many fields of physics as follows: - hydrodynamical theory of turbulence, (Dissertation, Sommerfeld); - theory of ferromagnetism; - study of cosmic rays; - nuclear physics. Heisenberg has invented two nuclear physics concepts, isobaric spin and scattering matrix which became cornerstones of the two main fields of the nuclear theory, namely, the nuclear structure (nuclear spectroscopy) and the nuclear reactions. This communication intends to illustrate the impact of the Heisenberg concepts on developpement of nuclear physics. (author)

Orbital classical solutions, non-perturbative phenomena and singularity at the zero coupling constant point

International Nuclear Information System (INIS)

Vourdas, A.

1982-01-01

We try to extend previous arguments on orbital classical solutions in non-relativistic quantum mechanics to the 1/4lambda vertical stroke phi vertical stroke 4 complex relativistic field theory. The single valuedness of the Green function in the semiclassical (Planksche Konstante → 0) limit leads to a Bohr-Sommerfeld quantization. A path integral formalism for the Green functions analogous to that in non-relativistic quantum mechanics is employed and a semiclassical approach which uses our classical solutions indicates non-perturbative effects. They reflect an esub(1/lambda) singularity at the zero coupling constant point. (orig.)

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

Competence and Performance in Belief-Desire Reasoning across Two Cultures: The Truth, the Whole Truth and Nothing but the Truth about False Belief?

Science.gov (United States)

Yazdi, Amir Amin; German, Tim P.; Defeyter, Margaret Anne; Siegal, Michael

2006-01-01

There is a change in false belief task performance across the 3-5 year age range, as confirmed in a recent meta-analysis [Wellman, H. M., Cross, D., & Watson, J. (2001). Meta-analysis of theory mind development: The truth about false-belief. "Child Development," 72, 655-684]. This meta-analysis identified several performance factors influencing…

On conjectures of Minkowski and Woods for n = 9

Indian Academy of Sciences (India)

Here we shall prove Conjecture II for n = 9, thereby proving Minkowski's Conjecture for n = 9. Woods [20 ... result that if hypothesis of Conjecture III holds, then any closed sphere in R9 of radius. √ ...... tures of Minkowski and Watson, Number Theory, Trends in Mathematics (2000) (Basel: ... Journal of the Indian Math. Soc.

Self-organization of physical fields and spin

International Nuclear Information System (INIS)

Pestov, I.B.

2008-01-01

The subject of the present investigation is the laws of intrinsic self-organization of fundamental physical fields. In the framework of the Theory of Self-Organization the geometrical and physical nature of spin phenomena is uncovered. The key points are spin symmetry (the fundamental realization of the concept of geometrical internal symmetry) and the spinning field (space of defining representation of spin symmetry). It is shown that the essence of spin is the bipolar structure of spin symmetry induced by the gravitational potentials. The bipolar structure provides natural violation of spin symmetry and leads to spinstatics (theory of spinning field outside the time) and spindynamics. The equations of spinstatics and spindynamics are derived. It is shown that Sommerfeld's formula can be derived from the equations of spindynamics and hence the correspondence principle is valid. This means that the Theory of Self-Organization provides the new understanding of spin phenomena

PREFACE: Lectures from the CERN Winter School on Strings, Supergravity and Gauge Theories, CERN, 9-13 February 2009 Lectures from the CERN Winter School on Strings, Supergravity and Gauge Theories, CERN, 9-13 February 2009

Science.gov (United States)

Uranga, A. M.

2009-11-01

physical systems described by quantum field theory, for instance in the context of a condensed matter system. The lectures by S Hartnoll provided an introduction to this recent development with an emphasis on the dual holographic description of superconductivity. Finally, ideas inspired by the AdS/CFT correspondence are yielding deep insights into fundamental questions of quantum gravity, like the entropy of black holes and its interpretation in terms of microstates. The lectures by S Mathur reviewed the black hole entropy and information paradox, and the proposal for its resolution in terms of `fuzzball' microstates. Further sets of lectures, not included in this special section, by F Zwirner and V Mukhanov, covered phenomenological aspects of high energy physics beyond the Standard Model and of cosmology. The coming experimental data in these two fields are expected to foster new developments in connecting string theory to the real world. The conference was financially supported by CERN and partially by the Arnold Sommerfeld Center for Theoretical Physics of the Ludwig Maximilians University of Munich. It is a great pleasure for us to warmly thank the Theory Unit of CERN for its very kind hospitality and for the high quality of the assistance and the infrastructures that it has provided. A M Uranga CERN, Switzerland Guest Editor

Boson exchange mechanisms, bounds and asymptotic limits

International Nuclear Information System (INIS)

Carbotte, J.P.; Marsiglio, F.

1989-01-01

BCS theory predicts universal laws for the normalized thermodynamic and other properties of superconductors. The only parameter in the theory, which models the pairing interaction, can be fit to the measured size of the critical temperature and everything else follows. For example, the ratio of twice the gap edge Δ o to the critical temperature is 3.54 while the specific heat jump at T c (ΔC(T c )) normalized to the normal state value of the electronic specific heat γ o T c (with γ o the Sommerfeld constant) is 1.43. Other universal numbers also apply. In real materials, deviations from BCS laws are observed 2 - 6 which carry information on details of the microscopic parameters involved that cannot be modeled well by a constant pairing potential approximation

Resilient Communication: A New Crisis Communication Strategy for Homeland Security

Science.gov (United States)

2012-03-01

communication theory. Author, Timothy Coombs , in Ongoing Crisis Communication , discusses the need for a crisis management 10 plan to prepare for potential... COMMUNICATION : A NEW CRISIS COMMUNICATION STRATEGY FOR HOMELAND SECURITY by Sharon L. Watson March 2012 Thesis Advisor: Christopher Bellavita...REPORT TYPE AND DATES COVERED Master’s Thesis 4. TITLE AND SUBTITLE Resilient Communication : A New Crisis Communication

James Moir as Organic Chemist

African Journals Online (AJOL)

NICO

James Moir (1874–1929) played an important role in the field of chemistry in South ... into the colour of organic compounds and the relationship be- tween colour ...... theory put forward by E.R.Watson,34 the depth of colour, or the displacement .... cover-glass, such as used in microscopy, to photograph absorp- tion bands ...

FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

Science.gov (United States)

Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

2018-01-01

The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

Gilligan's different voice: a perspective for nursing.

Science.gov (United States)

Cooper, M C

1989-01-01

This article proposes that Carol Gilligan's ethic of care provides for nursing a paradigm for moral deliberation that demonstrates compatibility with nursing's historical and philosophical traditions of relational caring and furnishes empirical support for the value of caring as a moral activity. The appropriateness of Gilligan's theory for nursing is further illustrated by an elucidation of the similarities between Gilligan's theory and nurse theorist Jean Watson's claims that caring constitutes both a necessary and a fundamental component of nursing. It is argued that Gilligan's theory of moral deliberation more faithfully reflects the nursing experience than Kohlberg's contractual, Kantian theory, which currently dominates the nursing literature.

Discrete complex images in modeling antennas over, below or penetrating the ground

International Nuclear Information System (INIS)

Arnautovski-Toseva, Vesna; Smokvarski, Aleksandar; Popovski, Borislav; Grcev, Leonid

2002-01-01

In this paper discrete complex images (DCI) are used to obtain approximate, efficient and fast solution of Sommerfeld integrals that appear in the analysis of vertical electric dipole (VED) in presence of air-ground half-space. The results are used to model vertical antenna above, below or penetrating the ground using the moment method technique with triangular expansion functions. Thus, the time consuming direct numerical evaluation of the Sommerfeld integrals is completely or partially avoided. (Author)

Antimetastatic Effects of a Novel Telomerase Inhibitor, GRN163L, on Human Prostate Cancer

Science.gov (United States)

2010-05-01

Human Papilloma Virus Type 18 (HPV-18) DNA. PZ-HPV-7 cells are generally considered as non-tumorigenic in subcutaneous xenograft animal models...6481. [39] H.J. Sommerfeld, A.K. Meeker, M.A. Piatyszek, G.S. Bova, J.W. Shay, D.S. Coffey, Telomerase activity: a prevalent marker of malignant human ...6:192–8. 31. Sommerfeld HJ, Meeker AK, Piatyszek MA, Bova GS, Shay JW, Coffey DS. Telomerase activity: a prevalent marker of malignant human prostate

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Improving the Knowledge Base in Teacher Education.

Science.gov (United States)

Rockler, Michael J.

Education in the United States for most of the last 50 years has built its knowledge base on a single dominating foundation--behavioral psychology. This paper analyzes the history of behaviorism. Syntheses are presented of the theories of Ivan P. Pavlov, J. B. Watson, and B. F. Skinner, all of whom contributed to the body of works on behaviorism.…

A proposal for re-defining the way the aetiology of schizophrenia ...

Indian Academy of Sciences (India)

2010-02-03

Feb 3, 2010 ... ``The two big problems – the nature of development and the nature of the mind – are being subdued. I don't know whether there will be beautiful, general theories to come out of this – something really nice like Watson and Crick's double helix – or whether there will be an accumulation of more and more ...

Principles of Optics

Science.gov (United States)

Born, Max; Wolf, Emil

1999-10-01

Principles of Optics is one of the classic science books of the twentieth century, and probably the most influential book in optics published in the past forty years. This edition has been thoroughly revised and updated, with new material covering the CAT scan, interference with broad-band light and the so-called Rayleigh-Sommerfeld diffraction theory. This edition also details scattering from inhomogeneous media and presents an account of the principles of diffraction tomography to which Emil Wolf has made a basic contribution. Several new appendices are also included. This new edition will be invaluable to advanced undergraduates, graduate students and researchers working in most areas of optics.

Modeling focusing characteristics of low Fnumber diffractive optical elements with continuous relief fabricated by laser direct writing.

Science.gov (United States)

Shan, Mingguang; Tan, Jiubin

2007-12-10

A theoretical model is established using Rayleigh-Sommerfeld diffraction theory to describe the diffraction focusing characteristics of low F-number diffractive optical elements with continuous relief fabricated by laser direct writing, and continuous-relief diffractive optical elements with a design wavelength of 441.6nm and a F-number of F/4 are fabricated and measured to verify the validity of the diffraction focusing model. The measurements made indicate that the spot size is 1.75mum and the diffraction efficiency is 70.7% at the design wavelength, which coincide well with the theoretical results: a spot size of 1.66mum and a diffraction efficiency of 71.2%.

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

International Nuclear Information System (INIS)

Gao, X.; Patel, D.J.

1988-01-01

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

Bodies at sea

DEFF Research Database (Denmark)

Pedersen, Michael Haldrup

Numerous are the signs and markers at museums and heritage sites instructing bodies to “stop, look and listen” (Ingold 2000: 243). Screens to be watched, gadgets and touch sensitive switches to be activated, films to be gazed at in silent concentration or interactive spectacles to participate in...... in tourism. Drawing in particular on performance based readings of heritage consumption and tourism (Haldrup and Larsen 2010; Waterton and Watson 2014; Haldrup and Bærenholdt 2015) as well as developments in non-representational theory and affect theory (Anderson and Harrison 2010; Massumi 2014; Timm Knudsen...

Toward a Model Based-Bayesian Theory for Estimating and Recognizing Parameterized 3-D Objects Using Two or More Images Taken from Different Positions

Science.gov (United States)

1989-10-01

Aires, and Philips Laboratory at Briarcliff, NY. B. Cernuschi-Frias is with Facultad de Ingenieria , Universidad de Buenos Aires, Buenos Aires... Ingenieria , Universidad de Buenos Aires, and from IBM (Thomas J. Watson Research Center). David B. Cooper (S’53-M’64) received the B.Sc. and Sc.M

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

Science.gov (United States)

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

Science.gov (United States)

Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

2017-10-01

In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

Richard Watson.

Science.gov (United States)

Wright, Ian; Bevin, William

2017-11-25

An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

Rydberg atoms in weak magnetic fields

International Nuclear Information System (INIS)

Kazantsev, A.P.; Pokrovsky, V.L.; Bergou, J.

1983-01-01

The quadratic Zeeman effect of Rydberg atoms in the framework of perturbation theory is dealt with and a special quasiclassical approximation scheme is applied. The Bohr-Sommerfeld quantization condition is given in terms of complete elliptic integrals. It is shown that part of the spectrum is doubly degenerate, the corresponding states are asymmetric with respect to the Coulomb centre and have a non-zero dipole moment; the rest of the spectrum is nondegenerate, the states are symmetric and their dipole-moment vanishes. The transition from the symmetric to the asymmetric region is similar to a phase transition and it gives an experimental possibility to distinguish between the two types of states. (author)

The practice of nurses caring for families of pediatric inpatients in light of Jean Watson

Directory of Open Access Journals (Sweden)

Maiara Rodrigues dos Santos

2014-08-01

Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.

Sleeping under the stars

Science.gov (United States)

Zirkel, Jack

Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

International Nuclear Information System (INIS)

Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

2011-01-01

Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

AN EDUCATIONAL THEORY MODEL--(SIGGS), AN INTEGRATION OF SET THEORY, INFORMATION THEORY, AND GRAPH THEORY WITH GENERAL SYSTEMS THEORY.

Science.gov (United States)

MACCIA, ELIZABETH S.; AND OTHERS

AN ANNOTATED BIBLIOGRAPHY OF 20 ITEMS AND A DISCUSSION OF ITS SIGNIFICANCE WAS PRESENTED TO DESCRIBE CURRENT UTILIZATION OF SUBJECT THEORIES IN THE CONSTRUCTION OF AN EDUCATIONAL THEORY. ALSO, A THEORY MODEL WAS USED TO DEMONSTRATE CONSTRUCTION OF A SCIENTIFIC EDUCATIONAL THEORY. THE THEORY MODEL INCORPORATED SET THEORY (S), INFORMATION THEORY…

String theory or field theory?

International Nuclear Information System (INIS)

Marshakov, Andrei V

2002-01-01

The status of string theory is reviewed, and major recent developments - especially those in going beyond perturbation theory in the string theory and quantum field theory frameworks - are analyzed. This analysis helps better understand the role and place of string theory in the modern picture of the physical world. Even though quantum field theory describes a wide range of experimental phenomena, it is emphasized that there are some insurmountable problems inherent in it - notably the impossibility to formulate the quantum theory of gravity on its basis - which prevent it from being a fundamental physical theory of the world of microscopic distances. It is this task, the creation of such a theory, which string theory, currently far from completion, is expected to solve. In spite of its somewhat vague current form, string theory has already led to a number of serious results and greatly contributed to progress in the understanding of quantum field theory. It is these developments which are our concern in this review. (reviews of topical problems)

String Theory and M-Theory

Science.gov (United States)

Becker, Katrin; Becker, Melanie; Schwarz, John H.

String theory is one of the most exciting and challenging areas of modern theoretical physics. This book guides the reader from the basics of string theory to recent developments. It introduces the basics of perturbative string theory, world-sheet supersymmetry, space-time supersymmetry, conformal field theory and the heterotic string, before describing modern developments, including D-branes, string dualities and M-theory. It then covers string geometry and flux compactifications, applications to cosmology and particle physics, black holes in string theory and M-theory, and the microscopic origin of black-hole entropy. It concludes with Matrix theory, the AdS/CFT duality and its generalizations. This book is ideal for graduate students and researchers in modern string theory, and will make an excellent textbook for a one-year course on string theory. It contains over 120 exercises with solutions, and over 200 homework problems with solutions available on a password protected website for lecturers at www.cambridge.org/9780521860697. Comprehensive coverage of topics from basics of string theory to recent developments Ideal textbook for a one-year course in string theory Includes over 100 exercises with solutions Contains over 200 homework problems with solutions available to lecturers on-line

String theory or field theory?

International Nuclear Information System (INIS)

Marshakov, A.V.

2002-01-01

The status of string theory is reviewed, and major recent developments - especially those in going beyond perturbation theory in the string theory and quantum field theory frameworks - are analyzed. This analysis helps better understand the role and place of experimental phenomena, it is emphasized that there are some insurmountable problems inherent in it - notably the impossibility to formulate the quantum theory of gravity on its basis - which prevent it from being a fundamental physical theory of the world of microscopic distances. It is this task, the creation of such a theory, which string theory, currently far from completion, is expected to solve. In spite of its somewhat vague current form, string theory has already led to a number of serious results and greatly contributed to progress in the understanding of quantum field theory. It is these developments, which are our concern in this review [ru

Simulation of high-resolution X-ray microscopic images for improved alignment

International Nuclear Information System (INIS)

Song Xiangxia; Zhang Xiaobo; Liu Gang; Cheng Xianchao; Li Wenjie; Guan Yong; Liu Ying; Xiong Ying; Tian Yangchao

2011-01-01

The introduction of precision optical elements to X-ray microscopes necessitates fine realignment to achieve optimal high-resolution imaging. In this paper, we demonstrate a numerical method for simulating image formation that facilitates alignment of the source, condenser, objective lens, and CCD camera. This algorithm, based on ray-tracing and Rayleigh-Sommerfeld diffraction theory, is applied to simulate the X-ray microscope beamline U7A of National Synchrotron Radiation Laboratory (NSRL). The simulations and imaging experiments show that the algorithm is useful for guiding experimental adjustments. Our alignment simulation method is an essential tool for the transmission X-ray microscope (TXM) with optical elements and may also be useful for the alignment of optical components in other modes of microscopy.

George Gamow: a most talented and creative scientist

International Nuclear Information System (INIS)

Yang Qingyu

2002-01-01

As one of the most prominent scientists of the 20th century, George Gamow made notable contributions to many fields of science in his life time. In nuclear physics he proposed the well known 'nuclear potential barrier channel effect' and the Gamow-Teller transition probability of beta decay. In cosmology he did his almost to advocate the 'big bang' theory. Through extraordinary intuition he proposed a theory about how genetic codes work in molecular biology, which was later verified by Watson, Crick and Nirenbery. Gamow's unique style of research and his spirit of bringing forth new ideas in interdisciplinary subjects has greatly benefited scientific research

Response to Yellman and Murray's comment on 'The meaning of probability in probabilistic risk analysis'

International Nuclear Information System (INIS)

Watson, Stephen R.

1995-01-01

In their comment on a recent contribution of mine, [Watson, S., The meaning of probability in probabilistic safety analysis. Reliab. Engng and System Safety, 45 (1994) 261-269.] Yellman and Murray assert that (1) I argue in favour of a realistic interpretation of probability for PSAs; (2) that the only satisfactory philosophical theory of probability is the relative frequency theory; (3) that I mean the same thing by the words 'uncertainty' and 'probability'; (4) that my argument can easily lead to the belief that the output of PSAs are meaningless. I take issue with all these points, and in this response I set out my arguments

On Fair Lotteries

OpenAIRE

STONE, PETER

2008-01-01

PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

Intelligence: Pre-Theory and Post-Theory

Directory of Open Access Journals (Sweden)

James R. Flynn

2014-02-01

Full Text Available Defining “intelligence” exemplifies a mistake that has historical precedent: confusing the role of pre-theory and post-theory definitions. In every area, pre-theory concepts give broad directions for investigation: are the movements of heavenly bodies affected by the existence of other heavenly bodies? Post-theory concepts add precision and predictability. The mistake occurs when a successful theory like Newton’s demands that its peculiar and precise theory-imbedded concept forbids competing theories: Einstein was impossible (warping of space so long as it was assumed that all theories must be in accord with Newton’s concept (attraction across space. In psychology, Arthur Jensen made the same mistake. He gave his theory-embedded concept of g the role of executioner: the significance of every phenomenon had to be interpreted by its compatibility with g; and thus trivialized the significance of IQ gains over time. This is only one instance of a perennial demand: give us a precise definition of “intelligence” to guide our research. However, precision comes after research has generated a theory and its very precision stifles competing research. Be happy with a broad definition on the pre-theory level that lets many competing theories bloom: pre-theory precision equals post-theory poverty.

Superconducting Qubit with Integrated Single Flux Quantum Controller Part I: Theory and Fabrication

Science.gov (United States)

Beck, Matthew; Leonard, Edward, Jr.; Thorbeck, Ted; Zhu, Shaojiang; Howington, Caleb; Nelson, Jj; Plourde, Britton; McDermott, Robert

As the size of quantum processors grow, so do the classical control requirements. The single flux quantum (SFQ) Josephson digital logic family offers an attractive route to proximal classical control of multi-qubit processors. Here we describe coherent control of qubits via trains of SFQ pulses. We discuss the fabrication of an SFQ-based pulse generator and a superconducting transmon qubit on a single chip. Sources of excess microwave loss stemming from the complex multilayer fabrication of the SFQ circuit are discussed. We show how to mitigate this loss through judicious choice of process workflow and appropriate use of sacrificial protection layers. Present address: IBM T.J. Watson Research Center.

First-principle Simulations of Heavy Fermion Materials

Science.gov (United States)

Dong, Ruanchen

Heavy fermion materials, one of the most challenging topics in condensed matter physics, pose a variety of interesting properties and have attracted extensive studies for decades. Although there has been great success in explaining many ground- state properties of solids, the well-known theoretical calculations based on density functional theory (DFT) in its popular local density approximation (LDA) fail to describe heavy fermion materials due to improper treatment of many-body correlation effects. Here with the implementations of dynamical mean-field theory (DMFT) and the Gutzwiller variational method, the computational simulation of the heavy fermion materials is explored further and better compared with experimental data. In this dissertation, first, the theoretical background of DMFT and LDA+G methods is described in detail. The rest is the application of these techniques and is basically divided into two parts. First, the continuous-time quantum Monte Carlo (CT-QMC) method combined with DMFT is used to calculate and compare both the periodic Anderson model (PAM) and the Kondo lattice model (KLM). Different parameter sets of both models are connected by the Schrieffer-Wolff transformation. For spin and orbital degeneracy N = 2 case, a special particle-hole symmetric case of PAM at half-filling which always fixes one electron per impurity site is compared with the results of the KLM. We find a good mapping between PAM and KLM in the limit of large on-site Hubbard interaction U for different properties like self-energy, quasiparticle residue and susceptibility. This allows us to extract quasiparticle mass renormalizations for the f-electrons directly from KLM. The method is further applied to higher degenerate cases and to the realistic heavy fermion system CeRhIn5 in which the estimate of the Sommerfeld coefficient is proven to be close to the experimental value. Second, a series of Cerium based heavy fermion materials is studied using a combination of local

M-Theory and Maximally Supersymmetric Gauge Theories

CERN Document Server

Lambert, Neil

2012-01-01

In this informal review for non-specalists we discuss the construction of maximally supersymmetric gauge theories that arise on the worldvolumes branes in String Theory and M-Theory. Particular focus is made on the relatively recent construction of M2-brane worldvolume theories. In a formal sense, the existence of these quantum field theories can be viewed as predictions of M-Theory. Their construction is therefore a reinforcement of the ideas underlying String Theory and M-Theory. We also briefly discuss the six-dimensional conformal field theory that is expected to arise on M5-branes. The construction of this theory is not only an important open problem for M-Theory but also a significant challenge to our current understanding of quantum field theory more generally.

The Radiation Problem from a Vertical Hertzian Dipole Antenna above Flat and Lossy Ground: Novel Formulation in the Spectral Domain with Closed-Form Analytical Solution in the High Frequency Regime

Directory of Open Access Journals (Sweden)

K. Ioannidi

2014-01-01

Full Text Available We consider the problem of radiation from a vertical short (Hertzian dipole above flat lossy ground, which represents the well-known “Sommerfeld radiation problem” in the literature. The problem is formulated in a novel spectral domain approach, and by inverse three-dimensional Fourier transformation the expressions for the received electric and magnetic (EM field in the physical space are derived as one-dimensional integrals over the radial component of wavevector, in cylindrical coordinates. This formulation appears to have inherent advantages over the classical formulation by Sommerfeld, performed in the spatial domain, since it avoids the use of the so-called Hertz potential and its subsequent differentiation for the calculation of the received EM field. Subsequent use of the stationary phase method in the high frequency regime yields closed-form analytical solutions for the received EM field vectors, which coincide with the corresponding reflected EM field originating from the image point. In this way, we conclude that the so-called “space wave” in the literature represents the total solution of the Sommerfeld problem in the high frequency regime, in which case the surface wave can be ignored. Finally, numerical results are presented, in comparison with corresponding numerical results based on Norton’s solution of the problem.

Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

Science.gov (United States)

2010-03-01

that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

Are there chromodyons

International Nuclear Information System (INIS)

Abouelsaood, A.

1983-01-01

The problem of the monopole infinite moments of inertia, and the related degeneracies in the dyon spectrum of a grand unified theory in the absence of light fermions is considered. A careful application to gauge theories of the method of collective coordinates is given in two different classes of gauges. A basic defect in the earlier treatments of the subject is pointed out. It is shown that the commonly accepted method, while giving reasonable qualitative results for the dyon spectrum in the SO(3) model, fails completely when applied to grand unified theories. The reason is simply that there is a contribution to the monopole moments of inertia that has so far been overlooked. This contribution is of the same order of magnitude as the already known one. The sum of the two contributions vanishes for these moments of inertia that have been thought to be infinite. This means that, in a grand unified theory without light fermions, dyon states transforming as definite color representations (chromodyons) do not exist if we believe this lowest-order analysis (which is almost all what one can do to show their existence). It is shown that applying the Bohr-Sommerfeld method to the classical dyon solutions leads to the same result. (orig.)

Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

Science.gov (United States)

Panczyk, Tomasz; Wolski, Pawel

2018-06-01

This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

Towards a theory of spacetime theories

CERN Document Server

Schiemann, Gregor; Scholz, Erhard

2017-01-01

This contributed volume is the result of a July 2010 workshop at the University of Wuppertal Interdisciplinary Centre for Science and Technology Studies which brought together world-wide experts from physics, philosophy and history, in order to address a set of questions first posed in the 1950s: How do we compare spacetime theories? How do we judge, objectively, which is the “best” theory? Is there even a unique answer to this question? The goal of the workshop, and of this book, is to contribute to the development of a meta-theory of spacetime theories. Such a meta-theory would reveal insights about specific spacetime theories by distilling their essential similarities and differences, deliver a framework for a class of theories that could be helpful as a blueprint to build other meta-theories, and provide a higher level viewpoint for judging which theory most accurately describes nature. But rather than drawing a map in broad strokes, the focus is on particularly rich regions in the “space of spaceti...

The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

Quantum mechanics in matrix form

CERN Document Server

Ludyk, Günter

2018-01-01

This book gives an introduction to quantum mechanics with the matrix method. Heisenberg's matrix mechanics is described in detail. The fundamental equations are derived by algebraic methods using matrix calculus. Only a brief description of Schrödinger's wave mechanics is given (in most books exclusively treated), to show their equivalence to Heisenberg's matrix  method. In the first part the historical development of Quantum theory by Planck, Bohr and Sommerfeld is sketched, followed by the ideas and methods of Heisenberg, Born and Jordan. Then Pauli's spin and exclusion principles are treated. Pauli's exclusion principle leads to the structure of atoms. Finally, Dirac´s relativistic quantum mechanics is shortly presented. Matrices and matrix equations are today easy to handle when implementing numerical algorithms using standard software as MAPLE and Mathematica.

Theoretical and computational studies in intermediate energy nuclear physics

International Nuclear Information System (INIS)

Elster, C.

1993-08-01

The research includes applications of many-body scattering theory to nuclear systems and studies of few-body systems described by effective hadronic field theories. Progress was made in bringing all first-order effects into the nonrelativistic elastic nucleon-nucleus scattering in a consistent fashion. This work is directed towards completely and reliably calculating the first-order term in a Watson expansion including a modification through the nulear medium. The research effort in few-body physics was concentrated on nucleon-nucleon (NN) scattering below pion production threshold, where recent measurements indicated that the backward-angle neutron-proton (np) differential cross section may show sensitivity to the size of the pion-nucleon coupling constant

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

Science.gov (United States)

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Dependence theory via game theory

NARCIS (Netherlands)

Grossi, D.; Turrini, P.

2011-01-01

In the multi-agent systems community, dependence theory and game theory are often presented as two alternative perspectives on the analysis of social interaction. Up till now no research has been done relating these two approaches. The unification presented provides dependence theory with the sort

Rationality, Theory Acceptance and Decision Theory

Directory of Open Access Journals (Sweden)

J. Nicolas Kaufmann

1998-06-01

Full Text Available Following Kuhn's main thesis according to which theory revision and acceptance is always paradigm relative, I propose to outline some possible consequences of such a view. First, asking the question in what sense Bayesian decision theory could serve as the appropriate (normative theory of rationality examined from the point of view of the epistemology of theory acceptance, I argue that Bayesianism leads to a narrow conception of theory acceptance. Second, regarding the different types of theory revision, i.e. expansion, contraction, replacement and residuals shifts, I extract from Kuhn's view a series of indications showing that theory replacement cannot be rationalized within the framework of Bayesian decision theory, not even within a more sophisticated version of that model. Third, and finally, I will point to the need for a more comprehensive model of rationality than the Bayesian expected utility maximization model, the need for a model which could better deal with the different aspects of theory replacement. I will show that Kuhn's distinction between normal and revolutionary science gives us several hints for a more adequate theory of rationality in science. I will also show that Kuhn is not in a position to fully articulate his main ideas and that he well be confronted with a serious problem concerning collective choice of a paradigm.

Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

Science.gov (United States)

Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

2013-12-01

Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

Bullying in a caring profession: reasons, results, and recommendations.

Science.gov (United States)

Broome, Barbara S; Williams-Evans, Shiphrah

2011-10-01

The theories of Florence Nightingale and Jean Watson provide a framework for the caring work of nurses. Ironically, this caring profession struggles with bullying. Bullying has both physiological and psychological ramifications for the person being bullied and a negative impact on the organization and patient care. Strategies to address bullying include education, developing codes of acceptable conduct for the workplace, and a zero-tolerance policy. Mental health nurses have a vital role in helping nurses return to roles of caring. Copyright 2011, SLACK Incorporated.

International business theory and marketing theory

OpenAIRE

Soldner, Helmut

1984-01-01

International business theory and marketing theory : elements for internat. marketing theory building. - In: Marketing aspects of international business / Gerald M. Hampton ... (eds.). - Boston u.a. : Kluwer, 1984. - S. 25-57

N=1 field theory duality from M theory

International Nuclear Information System (INIS)

Schmaltz, M.; Sundrum, R.

1998-01-01

We investigate Seiberg close-quote s N=1 field theory duality for four-dimensional supersymmetric QCD with the M-theory 5-brane. We find that the M-theory configuration for the magnetic dual theory arises via a smooth deformation of the M-theory configuration for the electric theory. The creation of Dirichlet 4-branes as Neveu-Schwarz 5-branes are passed through each other in type IIA string theory is given an elegant derivation from M theory. copyright 1998 The American Physical Society

Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

Science.gov (United States)

2010-10-01

DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

Science.gov (United States)

2011-10-01

or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

Science.gov (United States)

2012-07-01

like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

From chaos to unification: U theory vs. M theory

International Nuclear Information System (INIS)

Ye, Fred Y.

2009-01-01

A unified physical theory called U theory, that is different from M theory, is defined and characterized. U theory, which includes spinor and twistor theory, loop quantum gravity, causal dynamical triangulations, E-infinity unification theory, and Clifford-Finslerian unifications, is based on physical tradition and experimental foundations. In contrast, M theory pays more attention to mathematical forms. While M theory is characterized by supersymmetry string theory, U theory is characterized by non-supersymmetry unified field theory.

VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

Directory of Open Access Journals (Sweden)

M. R. Barrón-Yánez

2009-01-01

(Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

Effects of QCD bound states on dark matter relic abundance

Energy Technology Data Exchange (ETDEWEB)

Liew, Seng Pei [Department of Physics, The University of Tokyo,Bunkyo-ku, Tokyo 113-0033 (Japan); Luo, Feng [Kavli IPMU (WPI), UTIAS, The University of Tokyo,Kashiwa, Chiba 277-8583 (Japan)

2017-02-17

We study scenarios where there exists an exotic massive particle charged under QCD in the early Universe. We calculate the formation and dissociation rates of bound states formed by pairs of these particles, and apply the results in dark matter (DM) coannihilation scenarios, including also the Sommerfeld effect. We find that on top of the Sommerfeld enhancement, bound-state effects can further significantly increase the largest possible DM masses which can give the observed DM relic abundance, by ∼30–100% with respect to values obtained by considering the Sommerfeld effect only, for the color triplet or octet exotic particles we consider. In particular, it indicates that the Bino DM mass in the right-handed stop-Bino coannihilation scenario in the Minimal Supersymmetric extension of the Standard Model (MSSM) can reach ∼2.5 TeV, even though the potential between the stop and antistop prior to forming a bound state is repulsive. We also apply the bound-state effects in the calculations of relic abundance of long-lived or metastable massive colored particles, and discuss the implications on the BBN constraints and the abundance of a super-weakly interacting DM. The corrections for the bound-state effect when the exotic massive colored particles also carry electric charges, and the collider bounds are also discussed.

Generalizability theory and item response theory

OpenAIRE

Glas, Cornelis A.W.; Eggen, T.J.H.M.; Veldkamp, B.P.

2012-01-01

Item response theory is usually applied to items with a selected-response format, such as multiple choice items, whereas generalizability theory is usually applied to constructed-response tasks assessed by raters. However, in many situations, raters may use rating scales consisting of items with a selected-response format. This chapter presents a short overview of how item response theory and generalizability theory were integrated to model such assessments. Further, the precision of the esti...

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

Teaching Theory X and Theory Y in Organizational Communication

Science.gov (United States)

Noland, Carey

2014-01-01

The purpose of the activity described here is to integrate McGregor's Theory X and Theory Y into a group application: design a syllabus that embodies either Theory X or Theory Y tenets. Students should be able to differentiate between Theory X and Theory Y, create a syllabus based on Theory X or Theory Y tenets, evaluate the different syllabi…

Massive IIA string theory and Matrix theory compactification

International Nuclear Information System (INIS)

Lowe, David A.; Nastase, Horatiu; Ramgoolam, Sanjaye

2003-01-01

We propose a Matrix theory approach to Romans' massive Type IIA supergravity. It is obtained by applying the procedure of Matrix theory compactifications to Hull's proposal of the massive Type IIA string theory as M-theory on a twisted torus. The resulting Matrix theory is a super-Yang-Mills theory on large N three-branes with a space-dependent noncommutativity parameter, which is also independently derived by a T-duality approach. We give evidence showing that the energies of a class of physical excitations of the super-Yang-Mills theory show the correct symmetry expected from massive Type IIA string theory in a lightcone quantization

Theories of Career Development. A Comparison of the Theories.

Science.gov (United States)

Osipow, Samuel H.

These seven theories of career development are examined in previous chapters: (1) Roe's personality theory, (2) Holland's career typology theory, (3) the Ginzberg, Ginsburg, Axelrod, and Herma Theory, (4) psychoanalytic conceptions, (5) Super's developmental self-concept theory, (6) other personality theories, and (7) social systems theories.…

Strengthening primary healthcare through community involvement in ...

African Journals Online (AJOL)

Strengthening primary healthcare through community involvement in Cross River State, Nigeria: a descriptive study. Hilary Adie, Thomas Igbang, Akaninyene Otu, Ekanem Braide, Okpok Okon, Edet Ikpi, Charles Joseph, Alexander Desousa, Johannes Sommerfeld ...

Rayleigh-Sommerfield Diffraction vs Fresnel-Kirchhoff, Fourier Propagation and Poisson's Spot

National Research Council Canada - National Science Library

Lucke, Robert

2004-01-01

.... These problems are absent in the Rayleigh- Sommerfeld (RS) solution. The difference between RS and FK is in the inclination factor and is usually immaterial because the inclination factor is approximated by unity...

Resonance – Journal of Science Education | Indian Academy of ...

Indian Academy of Sciences (India)

. Articles written in Resonance – Journal of Science Education. Volume 20 Issue 5 May 2015 pp 472-475 Classics. Some Reminiscences of My Teaching Career · Arnold Sommerfeld · More Details Fulltext PDF ...

Supersymmetric gauge theories from string theory; Theorie de jauge supersymetrique de la theorie des cordes

Energy Technology Data Exchange (ETDEWEB)

Metzger, St

2005-12-15

This thesis presents various ways to construct four-dimensional quantum field theories from string theory. In a first part we study the generation of a supersymmetric Yang-Mills theory, coupled to an adjoint chiral superfield, from type IIB string theory on non-compact Calabi-Yau manifolds, with D-branes wrapping certain sub-cycles. Properties of the gauge theory are then mapped to the geometric structure of the Calabi-Yau space. Even if the Calabi-Yau geometry is too complicated to evaluate the geometric integrals explicitly, one can then always use matrix model perturbation theory to calculate the effective superpotential. The second part of this work covers the generation of four-dimensional super-symmetric gauge theories, carrying several important characteristic features of the standard model, from compactifications of eleven-dimensional supergravity on G{sub 2}-manifolds. If the latter contain conical singularities, chiral fermions are present in the four-dimensional gauge theory, which potentially lead to anomalies. We show that, locally at each singularity, these anomalies are cancelled by the non-invariance of the classical action through a mechanism called 'anomaly inflow'. Unfortunately, no explicit metric of a compact G{sub 2}-manifold is known. Here we construct families of metrics on compact weak G{sub 2}-manifolds, which contain two conical singularities. Weak G{sub 2}-manifolds have properties that are similar to the ones of proper G{sub 2}-manifolds, and hence the explicit examples might be useful to better understand the generic situation. Finally, we reconsider the relation between eleven-dimensional supergravity and the E{sub 8} x E{sub 8}-heterotic string. This is done by carefully studying the anomalies that appear if the supergravity theory is formulated on a ten-manifold times the interval. Again we find that the anomalies cancel locally at the boundaries of the interval through anomaly inflow, provided one suitably modifies the

A Future of Communication Theory: Systems Theory.

Science.gov (United States)

Lindsey, Georg N.

Concepts of general systems theory, cybernetics and the like may provide the methodology for communication theory to move from a level of technology to a level of pure science. It was the purpose of this paper to (1) demonstrate the necessity of applying systems theory to the construction of communication theory, (2) review relevant systems…

Gauge theory loop operators and Liouville theory

International Nuclear Information System (INIS)

Drukker, Nadav; Teschner, Joerg

2009-10-01

We propose a correspondence between loop operators in a family of four dimensional N=2 gauge theories on S 4 - including Wilson, 't Hooft and dyonic operators - and Liouville theory loop operators on a Riemann surface. This extends the beautiful relation between the partition function of these N=2 gauge theories and Liouville correlators found by Alday, Gaiotto and Tachikawa. We show that the computation of these Liouville correlators with the insertion of a Liouville loop operator reproduces Pestun's formula capturing the expectation value of a Wilson loop operator in the corresponding gauge theory. We prove that our definition of Liouville loop operators is invariant under modular transformations, which given our correspondence, implies the conjectured action of S-duality on the gauge theory loop operators. Our computations in Liouville theory make an explicit prediction for the exact expectation value of 't Hooft and dyonic loop operators in these N=2 gauge theories. The Liouville loop operators are also found to admit a simple geometric interpretation within quantum Teichmueller theory as the quantum operators representing the length of geodesics. We study the algebra of Liouville loop operators and show that it gives evidence for our proposal as well as providing definite predictions for the operator product expansion of loop operators in gauge theory. (orig.)

Fidelity Mechanisms of DNA Polymerase Alpha

Science.gov (United States)

2008-07-23

between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

Situation-specific theories from the middle-range transitions theory.

Science.gov (United States)

Im, Eun-Ok

2014-01-01

The purpose of this article was to analyze the theory development process of the situation-specific theories that were derived from the middle-range transitions theory. This analysis aims to provide directions for future development of situation-specific theories. First, transitions theory is concisely described with its history, goal, and major concepts. Then, the approach that was used to retrieve the situation-specific theories derived from transitions theory is described. Next, an analysis of 6 situation-specific theories is presented. Finally, 4 themes reflecting commonalities and variances in the theory development process are discussed with implications for future theoretical development.

Modal analysis of wave propagation in dispersive media

Science.gov (United States)

Abdelrahman, M. Ismail; Gralak, B.

2018-01-01

Surveys on wave propagation in dispersive media have been limited since the pioneering work of Sommerfeld [Ann. Phys. 349, 177 (1914), 10.1002/andp.19143491002] by the presence of branches in the integral expression of the wave function. In this article a method is proposed to eliminate these critical branches and hence to establish a modal expansion of the time-dependent wave function. The different components of the transient waves are physically interpreted as the contributions of distinct sets of modes and characterized accordingly. Then, the modal expansion is used to derive a modified analytical expression of the Sommerfeld precursor improving significantly the description of the amplitude and the oscillating period up to the arrival of the Brillouin precursor. The proposed method and results apply to all waves governed by the Helmholtz equations.

Thermal conductivity, electric resistivity, and Lorenz function for some transition metals measured by a direct electric heating technique

International Nuclear Information System (INIS)

Binkele, Ludolf

1985-01-01

The validity of the Wiedemann-Franz-Lorenz law in its standard form is disputed in the case of transition metals. However, normal behaviour could be demonstrated for the transition metals molybdenum, tantalum, and niobium by the application of an already tried and tested, and recently improved, modified Kohlrausch measuring method; that is, the high-temperature Lorenz number of these metals takes the Sommerfeld value, within measuring uncertainties of approx. 3%. In the case of tungsten, saturation was observed 16.7% above the Sommerfeld value. Even the Lorenz number of platinum seems to take on a saturation value at that level at temperatures above 1400 K. The lattice conductivity separated by various processes displays a temperature dependence describable by an exponential law for all the metals studied, in contrast to previous assumptions. (author)

Gauge theories as string theories: the first results

International Nuclear Information System (INIS)

Gorsky, Aleksandr S

2005-01-01

The gauge/string theory duality in curved space is discussed mainly using a non-Abelian conformal N = 4 supersymmetric gauge theory and the theory of a closed superstring in the AdS 5 x S 5 metric as an example. It is shown that in the supergravity approximation, string duality yields the characteristics of a strong-coupling gauge theory. For a special shape of the contour, a Wilson loop expression is derived in the classical superstring approximation. The role of the hidden integrability in lower-loop calculations in gauge theory and in different approximations of string theory is discussed. It is demonstrated that in the large quantum-number limit, gauge theory operators can be described in terms of the dual string picture. Examples of metrics providing the dual description of gauge theories with broken conformal symmetry are presented, and formulations of the vacuum structure of such theories in terms of gravity are discussed. (reviews of topical problems)

Dualities in M-theory and Born-Infeld Theory

International Nuclear Information System (INIS)

Brace, Daniel M.

2001-01-01

We discuss two examples of duality. The first arises in the context of toroidal compactification of the discrete light cone quantization of M-theory. In the presence of nontrivial moduli coming from the M-theory three form, it has been conjectured that the system is described by supersymmetric Yang-Mills gauge theory on a noncommutative torus. We are able to provide evidence for this conjecture, by showing that the dualities of this M-theory compactification, which correspond to T-duality in Type IIA string theory, are also dualities of the noncommutative supersymmetric Yang-Mills description. One can also consider this as evidence for the accuracy of the Matrix Theory description of M-theory in this background. The second type of duality is the self-duality of theories with U(1) gauge fields. After discussing the general theory of duality invariance for theories with complex gauge fields, we are able to find a generalization of the well known U(1) Born-Infeld theory that contains any number of gauge fields and which is invariant under the maximal duality group. We then find a supersymmetric extension of our results, and also show that our results can be extended to find Born-Infeld type actions in any even dimensional spacetime

Fulltext PDF

Indian Academy of Sciences (India)

Catholic church, his godfather being the physicist - philosopher Ernst Mach. ... in 1918. He then joined Arnold Sommerfeld as a student in Munich, and ... and its orthodox or Copenhagen interpretation created by Bohr, Heisenberg and Pauli.

M(atrix) theory: matrix quantum mechanics as a fundamental theory

International Nuclear Information System (INIS)

Taylor, Washington

2001-01-01

This article reviews the matrix model of M theory. M theory is an 11-dimensional quantum theory of gravity that is believed to underlie all superstring theories. M theory is currently the most plausible candidate for a theory of fundamental physics which reconciles gravity and quantum field theory in a realistic fashion. Evidence for M theory is still only circumstantial -- no complete background-independent formulation of the theory exists as yet. Matrix theory was first developed as a regularized theory of a supersymmetric quantum membrane. More recently, it has appeared in a different guise as the discrete light-cone quantization of M theory in flat space. These two approaches to matrix theory are described in detail and compared. It is shown that matrix theory is a well-defined quantum theory that reduces to a supersymmetric theory of gravity at low energies. Although its fundamental degrees of freedom are essentially pointlike, higher-dimensional fluctuating objects (branes) arise through the non-Abelian structure of the matrix degrees of freedom. The problem of formulating matrix theory in a general space-time background is discussed, and the connections between matrix theory and other related models are reviewed

Gauge theory loop operators and Liouville theory

Energy Technology Data Exchange (ETDEWEB)

Drukker, Nadav [Humboldt Univ. Berlin (Germany). Inst. fuer Physik; Gomis, Jaume; Okuda, Takuda [Perimeter Inst. for Theoretical Physics, Waterloo, ON (Canada); Teschner, Joerg [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

2009-10-15

We propose a correspondence between loop operators in a family of four dimensional N=2 gauge theories on S{sup 4} - including Wilson, 't Hooft and dyonic operators - and Liouville theory loop operators on a Riemann surface. This extends the beautiful relation between the partition function of these N=2 gauge theories and Liouville correlators found by Alday, Gaiotto and Tachikawa. We show that the computation of these Liouville correlators with the insertion of a Liouville loop operator reproduces Pestun's formula capturing the expectation value of a Wilson loop operator in the corresponding gauge theory. We prove that our definition of Liouville loop operators is invariant under modular transformations, which given our correspondence, implies the conjectured action of S-duality on the gauge theory loop operators. Our computations in Liouville theory make an explicit prediction for the exact expectation value of 't Hooft and dyonic loop operators in these N=2 gauge theories. The Liouville loop operators are also found to admit a simple geometric interpretation within quantum Teichmueller theory as the quantum operators representing the length of geodesics. We study the algebra of Liouville loop operators and show that it gives evidence for our proposal as well as providing definite predictions for the operator product expansion of loop operators in gauge theory. (orig.)

Supersymmetric gauge theories from string theory

International Nuclear Information System (INIS)

Metzger, St.

2005-12-01

This thesis presents various ways to construct four-dimensional quantum field theories from string theory. In a first part we study the generation of a supersymmetric Yang-Mills theory, coupled to an adjoint chiral superfield, from type IIB string theory on non-compact Calabi-Yau manifolds, with D-branes wrapping certain sub-cycles. Properties of the gauge theory are then mapped to the geometric structure of the Calabi-Yau space. Even if the Calabi-Yau geometry is too complicated to evaluate the geometric integrals explicitly, one can then always use matrix model perturbation theory to calculate the effective superpotential. The second part of this work covers the generation of four-dimensional super-symmetric gauge theories, carrying several important characteristic features of the standard model, from compactifications of eleven-dimensional supergravity on G 2 -manifolds. If the latter contain conical singularities, chiral fermions are present in the four-dimensional gauge theory, which potentially lead to anomalies. We show that, locally at each singularity, these anomalies are cancelled by the non-invariance of the classical action through a mechanism called 'anomaly inflow'. Unfortunately, no explicit metric of a compact G 2 -manifold is known. Here we construct families of metrics on compact weak G 2 -manifolds, which contain two conical singularities. Weak G 2 -manifolds have properties that are similar to the ones of proper G 2 -manifolds, and hence the explicit examples might be useful to better understand the generic situation. Finally, we reconsider the relation between eleven-dimensional supergravity and the E 8 x E 8 -heterotic string. This is done by carefully studying the anomalies that appear if the supergravity theory is formulated on a ten-manifold times the interval. Again we find that the anomalies cancel locally at the boundaries of the interval through anomaly inflow, provided one suitably modifies the classical action. (author)

Group theory for chemists fundamental theory and applications

CERN Document Server

Molloy, K C

2010-01-01

The basics of group theory and its applications to themes such as the analysis of vibrational spectra and molecular orbital theory are essential knowledge for the undergraduate student of inorganic chemistry. The second edition of Group Theory for Chemists uses diagrams and problem-solving to help students test and improve their understanding, including a new section on the application of group theory to electronic spectroscopy.Part one covers the essentials of symmetry and group theory, including symmetry, point groups and representations. Part two deals with the application of group theory t

String theory as a quantum theory of gravity

International Nuclear Information System (INIS)

Horowitz, G.T.

1990-01-01

First, the connection between string theory and gravity is discussed - at first sight the theory of strings seem to have nothing to do with gravity but an intimate connection is shown. Then the quantum perturbation expansion is discussed. Thirdly, string theory is considered as a classical theory of gravity and finally recent speculation about a phase of string theory which is independent of a spacetime metric is discussed. (author)

Number theory via Representation theory

Indian Academy of Sciences (India)

2014-11-09

Number theory via Representation theory. Eknath Ghate. November 9, 2014. Eightieth Annual Meeting, Chennai. Indian Academy of Sciences1. 1. This is a non-technical 20 minute talk intended for a general Academy audience.

K-theory and representation theory

International Nuclear Information System (INIS)

Kuku, A.O.

2003-01-01

This contribution includes K-theory of orders, group-rings and modules over EI categories, equivariant higher algebraic K-theory for finite, profinite and compact Lie group actions together with their relative generalisations and applications

IEF 2008 Moves WHO's eco-bio-social framework forward | IDRC ...

International Development Research Centre (IDRC) Digital Library (Canada)

2011-05-10

May 10, 2011 ... ... infectious diseases and to define community-based integrated management interventions,” said Dr Johannes Sommerfeld. ... IEF 2008 was “a very lively event, which showed the dynamic nature of the ... Related articles ...

How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

Science.gov (United States)

Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

2016-06-01

Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

Large N field theories, string theory and gravity

Energy Technology Data Exchange (ETDEWEB)

Maldacena, J [Lyman Laboratory of Physics, Harvard University, Cambridge (United States)

2002-05-15

We describe the holographic correspondence between field theories and string/M theory, focusing on the relation between compactifications of string/ M theory on Anti-de Sitter spaces and conformal field theories. We review the background for this correspondence and discuss its motivations and the evidence for its correctness. We describe the main results that have been derived from the correspondence in the regime that the field theory is approximated by classical or semiclassical gravity. We focus on the case of the N = 4 supersymmetric gauge theory in four dimensions. These lecture notes are based on the Review written by O. Aharony, S. Gubser, J. Maldacena, H. Ooguri and Y. Oz. (author)

Morse theory interpretation of topological quantum field theories

International Nuclear Information System (INIS)

Labastida, J.M.F.

1989-01-01

Topological quantum field theories are interpreted as a generalized form of Morse theory. This interpretation is applied to formulate the simplest topological quantum field theory: Topological quantum mechanics. The only non-trivial topological invariant corresponding to this theory is computed and identified with the Euler characteristic. Using field theoretical methods this topological invariant is calculated in different ways and in the process a proof of the Gauss-Bonnet-Chern-Avez formula as well as some results of degenerate Morse theory are obtained. (orig.)

String theory

International Nuclear Information System (INIS)

Chan Hongmo.

1987-10-01

The paper traces the development of the String Theory, and was presented at Professor Sir Rudolf Peierls' 80sup(th) Birthday Symposium. The String theory is discussed with respect to the interaction of strings, the inclusion of both gauge theory and gravitation, inconsistencies in the theory, and the role of space-time. The physical principles underlying string theory are also outlined. (U.K.)

Gravity, general relativity theory and alternative theories

International Nuclear Information System (INIS)

Zel'dovich, Ya.B.; Grishchuk, L.P.; Moskovskij Gosudarstvennyj Univ.

1986-01-01

The main steps in plotting the current gravitation theory and some prospects of its subsequent development are reviewed. The attention is concentrated on a comparison of the relativistic gravitational field with other physical fields. Two equivalent formulations of the general relativity (GR) - geometrical and field-theoretical - are considered in detail. It is shown that some theories of gravity constructed as the field theories at a flat background space-time are in fact just different formulations of GR and not alternative theories

Theory X and Theory Y in the Organizational Structure.

Science.gov (United States)

Barry, Thomas J.

This document defines contrasting assumptions about the labor force--theory X and theory Y--and shows how they apply to the pyramid organizational structure, examines the assumptions of the two theories, and finally, based on a survey and individual interviews, proposes a merger of theories X and Y to produce theory Z. Organizational structures…

Supergravity theories

International Nuclear Information System (INIS)

Uehara, S.

1985-01-01

Of all supergravity theories, the maximal, i.e., N = 8 in 4-dimension or N = 1 in 11-dimension, theory should perform the unification since it owns the highest degree of symmetry. As to the N = 1 in d = 11 theory, it has been investigated how to compactify to the d = 4 theories. From the phenomenological point of view, local SUSY GUTs, i.e., N = 1 SUSY GUTs with soft breaking terms, have been studied from various angles. The structures of extended supergravity theories are less understood than those of N = 1 supergravity theories, and matter couplings in N = 2 extended supergravity theories are under investigation. The harmonic superspace was recently proposed which may be useful to investigate the quantum effects of extended supersymmetry and supergravity theories. As to the so-called Kaluza-Klein supergravity, there is another possibility. (Mori, K.)

On the interplay between string theory and field theory

International Nuclear Information System (INIS)

Brunner, I.

1998-01-01

In this thesis, we have discussed various aspects of branes in string theory and M-theory. In chapter 2 we were able to construct six-dimensional chiral interacting eld theories from Hanany-Witten like brane setups. The field theory requirement that the anomalies cancel was reproduced by RR-charge conservation in the brane setup. The data of the Hanany-Witten setup, which consists of brane positions, was mapped to instanton data. The orbifold construction can be extended to D and E type singularities. In chapter 3 we discussed a matrix conjecture, which claims that M-theory in the light cone gauge is described by the quantum mechanics of D0 branes. Toroidal compactifications of M-theory have a description in terms of super Yang-Mills theory an the dual torus. For more than three compactified dimensions, more degrees of freedom have to be added. In some sense, the philosophy in this chapter is orthogonal to the previous chapter: Here, we want to get M-theory results from eld theory considerations, whereas in the previous chapter we obtained eld theory results by embedding the theories in string theory. Our main focus was on the compactification on T 6 , which leads to complications. Here, the Matrix model is again given by an eleven dimensional theory, not by a lower dimensional field theory. Other problems and possible resolutions of Matrix theory are discussed at the end of chapter 3. In the last chapter we considered M- and F-theory compactifications on Calabi-Yau fourfolds. After explaining some basics of fourfolds, we showed that the web of fourfolds is connected by singular transitions. The two manifolds which are connected by the transition are different resolutions of the same singular manifold. The resolution of the singularities can lead to a certain type of divisors, which lead to non-perturbative superpotentials, when branes wrap them. The vacua connected by the transitions can be physically very different. (orig.)

On the interplay between string theory and field theory

Energy Technology Data Exchange (ETDEWEB)

Brunner, I.

1998-07-08

In this thesis, we have discussed various aspects of branes in string theory and M-theory. In chapter 2 we were able to construct six-dimensional chiral interacting eld theories from Hanany-Witten like brane setups. The field theory requirement that the anomalies cancel was reproduced by RR-charge conservation in the brane setup. The data of the Hanany-Witten setup, which consists of brane positions, was mapped to instanton data. The orbifold construction can be extended to D and E type singularities. In chapter 3 we discussed a matrix conjecture, which claims that M-theory in the light cone gauge is described by the quantum mechanics of D0 branes. Toroidal compactifications of M-theory have a description in terms of super Yang-Mills theory an the dual torus. For more than three compactified dimensions, more degrees of freedom have to be added. In some sense, the philosophy in this chapter is orthogonal to the previous chapter: Here, we want to get M-theory results from eld theory considerations, whereas in the previous chapter we obtained eld theory results by embedding the theories in string theory. Our main focus was on the compactification on T{sup 6}, which leads to complications. Here, the Matrix model is again given by an eleven dimensional theory, not by a lower dimensional field theory. Other problems and possible resolutions of Matrix theory are discussed at the end of chapter 3. In the last chapter we considered M- and F-theory compactifications on Calabi-Yau fourfolds. After explaining some basics of fourfolds, we showed that the web of fourfolds is connected by singular transitions. The two manifolds which are connected by the transition are different resolutions of the same singular manifold. The resolution of the singularities can lead to a certain type of divisors, which lead to non-perturbative superpotentials, when branes wrap them. The vacua connected by the transitions can be physically very different. (orig.)

Contemporary Danish book art

DEFF Research Database (Denmark)

Larsen, Poul Steen

the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

When is a theory a theory? A case example.

Science.gov (United States)

Alkin, Marvin C

2017-08-01

This discussion comments on the approximately 20years history of writings on the prescriptive theory called Empowerment Evaluation. To do so, involves examining how "Empowerment Evaluation Theory" has been defined at various points of time (particularly 1996 and now in 2015). Defining a theory is different from judging the success of a theory. This latter topic has been addressed elsewhere by Michael Scriven, Michael Patton, and Brad Cousins. I am initially guided by the work of Robin Miller (2010) who has written on the issue of how to judge the success of a theory. In doing so, she provided potential standards for judging the adequacy of theories. My task is not judging the adequacy or success of the Empowerment Evaluation prescriptive theory in practice, but determining how well the theory is delineated. That is, to what extent do the writings qualify as a prescriptive theory. Copyright © 2016 Elsevier Ltd. All rights reserved.

Superstring theory

International Nuclear Information System (INIS)

Schwarz, J.H.

1985-01-01

Dual string theories, initially developed as phenomenological models of hadrons, now appear more promising as candidates for a unified theory of fundamental interactions. Type I superstring theory (SST I), is a ten-dimensional theory of interacting open and closed strings, with one supersymmetry, that is free from ghosts and tachyons. It requires that an SO(eta) or Sp(2eta) gauge group be used. A light-cone-gauge string action with space-time supersymmetry automatically incorporates the superstring restrictions and leads to the discovery of type II superstring theory (SST II). SST II is an interacting theory of closed strings only, with two D=10 supersymmetries, that is also free from ghosts and tachyons. By taking six of the spatial dimensions to form a compact space, it becomes possible to reconcile the models with our four-dimensional perception of spacetime and to define low-energy limits in which SST I reduces to N=4, D=4 super Yang-Mills theory and SST II reduces to N=8, D=4 supergravity theory. The superstring theories can be described by a light-cone-gauge action principle based on fields that are functionals of string coordinates. With this formalism any physical quantity should be calculable. There is some evidence that, unlike any conventional field theory, the superstring theories provide perturbatively renormalizable (SST I) or finite (SST II) unifications of gravity with other interactions

Stability of spatially developing boundary layers

Science.gov (United States)

Govindarajan, Rama

1993-07-01

A new formulation of the stability of boundary-layer flows in pressure gradients is presented, taking into account the spatial development of the flow. The formulation assumes that disturbance wavelength and eigenfunction vary downstream no more rapidly than the boundary-layer thickness, and includes all terms of O(1) and O(R(exp -1)) in the boundary-layer Reynolds number R. Although containing the Orr-Sommerfeld operator, the present approach does not yield the Orr-Sommerfeld equation in any rational limit. In Blasius flow, the present stability equation is consistent with that of Bertolotti et al. (1992) to terms of O(R(exp -1)). For the Falkner-Skan similarity solutions neutral boundaries are computed without the necessity of having to march in space. Results show that the effects of spatial growth are striking in flows subjected to adverse pressure gradients.

Abelian gauge symmetries in F-theory and dual theories

Science.gov (United States)

Song, Peng

In this dissertation, we focus on important physical and mathematical aspects, especially abelian gauge symmetries, of F-theory compactifications and its dual formulations within type IIB and heterotic string theory. F-theory is a non-perturbative formulation of type IIB string theory which enjoys important dualities with other string theories such as M-theory and E8 x E8 heterotic string theory. One of the main strengths of F-theory is its geometrization of many physical problems in the dual string theories. In particular, its study requires a lot of mathematical tools such as advanced techniques in algebraic geometry. Thus, it has also received a lot of interests among mathematicians, and is a vivid area of research within both the physics and the mathematics community. Although F-theory has been a long-standing theory, abelian gauge symmetry in Ftheory has been rarely studied, until recently. Within the mathematics community, in 2009, Grassi and Perduca first discovered the possibility of constructing elliptically fibered varieties with non-trivial toric Mordell-Weil group. In the physics community, in 2012, Morrison and Park first made a major advancement by constructing general F-theory compactifications with U(1) abelian gauge symmetry. They found that in such cases, the elliptically-fibered Calabi-Yau manifold that F-theory needs to be compactified on has its fiber being a generic elliptic curve in the blow-up of the weighted projective space P(1;1;2) at one point. Subsequent developments have been made by Cvetic, Klevers and Piragua extended the works of Morrison and Park and constructed general F-theory compactifications with U(1) x U(1) abelian gauge symmetry. They found that in the U(1) x U(1) abelian gauge symmetry case, the elliptically-fibered Calabi-Yau manifold that F-theory needs to be compactified on has its fiber being a generic elliptic curve in the del Pezzo surface dP2. In chapter 2 of this dissertation, I bring this a step further by

F-theory and 2d (0,2) theories

Energy Technology Data Exchange (ETDEWEB)

Schäfer-Nameki, Sakura [Department of Mathematics, King’s College London, The Strand, London WC2R 2LS (United Kingdom); Weigand, Timo [Institut für Theoretische Physik, Ruprecht-Karls-Universität,Philosophenweg 19, 69120 Heidelberg (Germany)

2016-05-11

F-theory compactified on singular, elliptically fibered Calabi-Yau five-folds gives rise to two-dimensional gauge theories preserving N=(0,2) supersymmetry. In this paper we initiate the study of such compactifications and determine the dictionary between the geometric data of the elliptic fibration and the 2d gauge theory such as the matter content in terms of (0,2) superfields and their supersymmetric couplings. We study this setup both from a gauge-theoretic point of view, in terms of the partially twisted 7-brane theory, and provide a global geometric description based on the structure of the elliptic fibration and its singularities. Global consistency conditions are determined and checked against the dual M-theory compactification to one dimension. This includes a discussion of gauge anomalies, the structure of the Green-Schwarz terms and the Chern-Simons couplings in the dual M-theory supersymmetric quantum mechanics. Furthermore, by interpreting the resulting 2d (0,2) theories as heterotic worldsheet theories, we propose a correspondence between the geometric data of elliptically fibered Calabi-Yau five-folds and the target space of a heterotic gauged linear sigma-model (GLSM). In particular the correspondence between the Landau-Ginsburg and sigma-model phase of a 2d (0,2) GLSM is realized via different T-branes or gluing data in F-theory.

Diffraction at a Straight Edge

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 5. Diffraction at a Straight Edge: A Gem from Sommerfeld's Work in Classical Physics. Rajaram Nityananda. General Article Volume 20 Issue 5 May 2015 pp 389-400 ...

Fulltext PDF

Indian Academy of Sciences (India)

IAS Admin

10.1119/1.1989585) is Sommerfeld's acceptance of the Oersted Medal of the ... In connection with this, N. H. Frank of Massachusetts Institute of Technology ... Selmayr, the builder of ingenious models of crystal structures, which are also known ...

Strings - Links between conformal field theory, gauge theory and gravity

International Nuclear Information System (INIS)

Troost, J.

2009-05-01

String theory is a candidate framework for unifying the gauge theories of interacting elementary particles with a quantum theory of gravity. The last years we have made considerable progress in understanding non-perturbative aspects of string theory, and in bringing string theory closer to experiment, via the search for the Standard Model within string theory, but also via phenomenological models inspired by the physics of strings. Despite these advances, many deep problems remain, amongst which a non-perturbative definition of string theory, a better understanding of holography, and the cosmological constant problem. My research has concentrated on various theoretical aspects of quantum theories of gravity, including holography, black holes physics and cosmology. In this Habilitation thesis I have laid bare many more links between conformal field theory, gauge theory and gravity. Most contributions were motivated by string theory, like the analysis of supersymmetry preserving states in compactified gauge theories and their relation to affine algebras, time-dependent aspects of the holographic map between quantum gravity in anti-de-Sitter space and conformal field theories in the bulk, the direct quantization of strings on black hole backgrounds, the embedding of the no-boundary proposal for a wave-function of the universe in string theory, a non-rational Verlinde formula and the construction of non-geometric solutions to supergravity

78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

Science.gov (United States)

2013-01-31

.... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

Investigations in gauge theories, topological solitons and string theories

International Nuclear Information System (INIS)

1993-01-01

This is the Final Report on a supported research project on theoretical particle physics entitled ''Investigations in Gauge Theories, Topological Solitons and String Theories.'' The major theme of particle theory pursued has been within the rubric of the standard model, particularly on the interplay between symmetries and dynamics. Thus, the research has been carried out primarily in the context of gauge with or without chiral fermions and in effective chiral lagrangian field theories. The topics studied include the physical implications of abelian and non-abelian anomalies on the spectrum and possible dynamical symmetry breaking in a wide range of theories. A wide range of techniques of group theory, differential geometry and function theory have been applied to probe topological and conformal properties of quantum field theories in two and higher dimensions, the breaking of global chiral symmetries by vector-like gauge theories such as QCD,the phenomenology of a possibly strongly interacting Higgs sector within the minimal standard model, and the relevance of solitonic ideas to non-perturbative phenomena at SSC energies

String field theory

International Nuclear Information System (INIS)

Kaku, M.

1987-01-01

In this article, the authors summarize the rapid progress in constructing string field theory actions, such as the development of the covariant BRST theory. They also present the newer geometric formulation of string field theory, from which the BRST theory and the older light cone theory can be derived from first principles. This geometric formulation allows us to derive the complete field theory of strings from two geometric principles, in the same way that general relativity and Yang-Mills theory can be derived from two principles based on global and local symmetry. The geometric formalism therefore reduces string field theory to a problem of finding an invariant under a new local gauge group they call the universal string group (USG). Thus, string field theory is the gauge theory of the universal string group in much the same way that Yang-Mills theory is the gauge theory of SU(N). The geometric formulation places superstring theory on the same rigorous group theoretical level as general relativity and gauge theory

Yang-Mills theory - a string theory in disguise

International Nuclear Information System (INIS)

Foerster, D.

1979-01-01

An examination of the Schwinger-Dyson equations of U(N) lattice Yang-Mills theory shows that this theory is exactly equivalent to a theory of strings that interact with one another only through their topology. (Auth.)

Singularity theory and N = 2 superconformal field theories

International Nuclear Information System (INIS)

Warner, N.P.

1989-01-01

The N = 2 superconformal field theories that appear at the fixed points of the renormalization group flows of Landau-Ginsburg models are discussed. Some of the techniques of singularity theory are employed to deduce properties of these superconformal theories. These ideas are then used to deduce the relationship between Calabi-Yau compactifications and tensored discrete series models. The chiral rings of general N = 2 superconformal theories are also described. 14 refs

Game theory

DEFF Research Database (Denmark)

Hendricks, Vincent F.

Game Theory is a collection of short interviews based on 5 questions presented to some of the most influential and prominent scholars in game theory. We hear their views on game theory, its aim, scope, use, the future direction of game theory and how their work fits in these respects....

Identity theory and personality theory: mutual relevance.

Science.gov (United States)

Stryker, Sheldon

2007-12-01

Some personality psychologists have found a structural symbolic interactionist frame and identity theory relevant to their work. This frame and theory, developed in sociology, are first reviewed. Emphasized in the review are a multiple identity conception of self, identities as internalized expectations derived from roles embedded in organized networks of social interaction, and a view of social structures as facilitators in bringing people into networks or constraints in keeping them out, subsequently, attention turns to a discussion of the mutual relevance of structural symbolic interactionism/identity theory and personality theory, looking to extensions of the current literature on these topics.

Ring Theory

CERN Document Server

Jara, Pascual; Torrecillas, Blas

1988-01-01

The papers in this proceedings volume are selected research papers in different areas of ring theory, including graded rings, differential operator rings, K-theory of noetherian rings, torsion theory, regular rings, cohomology of algebras, local cohomology of noncommutative rings. The book will be important for mathematicians active in research in ring theory.

Journal bearing impedance descriptions for rotordynamic applications

NARCIS (Netherlands)

Childs, D.W.; Moes, H.; Leeuwen, van H.J.

1977-01-01

Bearing impedance vectors are introduced for plain journal bearings which define the bearing reaction force components as a function of the bearing motion. Impedance descriptions are developed directly for the approximate Ocvirk (short) and Sommerfeld (long) bearing solutions. The impedance vector

Cohomological gauge theory, quiver matrix models and Donaldson-Thomas theoryCohomological gauge theory, quiver matrix models and Donaldson-Thomas theory

NARCIS (Netherlands)

Cirafici, M.; Sinkovics, A.; Szabo, R.J.

2009-01-01

We study the relation between Donaldson–Thomas theory of Calabi–Yau threefolds and a six-dimensional topological Yang–Mills theory. Our main example is the topological U(N) gauge theory on flat space in its Coulomb branch. To evaluate its partition function we use equivariant localization techniques

String field theory-inspired algebraic structures in gauge theories

International Nuclear Information System (INIS)

Zeitlin, Anton M.

2009-01-01

We consider gauge theories in a string field theory-inspired formalism. The constructed algebraic operations lead, in particular, to homotopy algebras of the related Batalin-Vilkovisky theories. We discuss an invariant description of the gauge fixing procedure and special algebraic features of gauge theories coupled to matter fields.

GROUNDED THEORY METHODOLOGY and GROUNDED THEORY RESEARCH in TURKEY

OpenAIRE

ARIK, Ferhat; ARIK, Işıl Avşar

2016-01-01

This research discusses the historical development of the Grounded Theory Methodology, which is one of the qualitative research method, its transformation over time and how it is used as a methodology in Turkey. The Grounded Theory which was founded by Strauss and Glaser, is a qualitative methodology based on inductive logic to discover theories in contrast with the deductive understanding which is based on testing an existing theory in sociology. It is possible to examine the Grounded Theory...

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Psychological behaviorism and behaviorizing psychology

Science.gov (United States)

Staats, Arthur W.

1994-01-01

Paradigmatic or psychological behaviorism (PB), in a four-decade history of development, has been shaped by its goal, the establishment of a behaviorism that can also serve as the approach in psychology (Watson's original goal). In the process, PB has become a new generation of behaviorism with abundant heuristic avenues for development in theory, philosophy, methodology, and research. Psychology has resources, purview and problem areas, and nascent developments of many kinds, gathered in chaotic diversity, needing unification (and other things) that cognitivism cannot provide. Behaviorism can, within PB's multilevel framework for connecting and advancing both psychology and behaviorism. PMID:22478175

On novel string theories from 4d gauge theories

Directory of Open Access Journals (Sweden)

Kiritsis Elias

2014-04-01

Full Text Available We investigate strings theories as defined from four dimensional gauge theories. It is argued that novel (superstring theories exist up to 26 dimensions. Some of them may support weakly curved geometries. A proposal is outlined to link their local conformal invariance to the dynamics of the bulk string theory.

Atomic theories

CERN Document Server

Loring, FH

2014-01-01

Summarising the most novel facts and theories which were coming into prominence at the time, particularly those which had not yet been incorporated into standard textbooks, this important work was first published in 1921. The subjects treated cover a wide range of research that was being conducted into the atom, and include Quantum Theory, the Bohr Theory, the Sommerfield extension of Bohr's work, the Octet Theory and Isotopes, as well as Ionisation Potentials and Solar Phenomena. Because much of the material of Atomic Theories lies on the boundary between experimentally verified fact and spec

Theory and context / Theory in context

DEFF Research Database (Denmark)

Glaveanu, Vlad Petre

2014-01-01

trans-disciplinary manner. Consideration needs to be given as well to connected scholarship focusing on imagination, innova-tion, and improvisation. Last but not least, an expanded the-ory of context cannot ignore the institutional context of doing research on creativity. Creativity scholars are facing......It is debatable whether the psychology of creativity is a field in crisis or not. There are clear signs of increased fragmenta-tion and a scarcity of integrative efforts, but is this necessari-ly bad? Do we need more comprehensive theories of creativ-ity and a return to old epistemological...... questions? This de-pends on how one understands theory. Against a view of theoretical work as aiming towards generality, universality, uniformity, completeness, and singularity, I advocate for a dynamic perspective in which theory is plural, multifaceted, and contextual. Far from ‘waiting for the Messiah...

The rotor theories by Professor Joukowsky: Vortex theories

DEFF Research Database (Denmark)

Okulov, Valery L.; Sørensen, Jens Nørkær; Wood, David H.

2015-01-01

This is the second of two articles with the main, and largely self-explanatory, title "Rotor theories by Professor Joukowsky". This article considers rotors with finite number of blades and is subtitled "Vortex theories". The first article with subtitle "Momentum theories", assessed the starring...

Consumer culture theory (re)visits actor-network theory

DEFF Research Database (Denmark)

Bajde, Domen

2013-01-01

The vocabulary and tactics developed by actor-network theory (ANT) can shed light on several ontological and epistemological challenges faced by consumer culture theory. Rather than providing ready-made theories or methods, our translation of ANT puts forward a series of questions and propositions...

D walls and junctions in supersymmetric gluodynamics in the large N limit suggest the existence of heavy hadrons

International Nuclear Information System (INIS)

Gabadadze, Gregory; Shifman, Mikhail

2000-01-01

A number of arguments exists that the ''minimal'' Bogomol'nyi-Prasad-Sommerfeld (BPS) wall width in large-N supersymmetric gluodynamics vanishes as 1/N. There is a certain tension between this assertion and the fact that the mesons coupled to λλ have masses O(N 0 ). To reconcile these facts we argue that there should exist additional solitonlike states with masses scaling as N. The BPS walls must be ''made'' predominantly of these heavy states which are coupled to λλ stronger than the conventional mesons. The tension of the BPS wall junction scales as N 2 , which serves as an additional argument in favor of the 1/N scaling of the wall width. The heavy states can be thought of as solitons of the corresponding closed string theory. They are related to certain fivebranes in the M-theory construction. We study the issue of the wall width in toy models which capture some features of supersymmetric gluodynamics. We speculate that the special hadrons with mass scaling as N should also exist in the large-N limit of nonsupersymmetric gluodynamics. (c) 2000 The American Physical Society

'Theory of Mind' I: a theory of knowledge?

Science.gov (United States)

Plastow, Michael

2012-06-01

'Theory of mind' is a cognitive notion introduced by Simon Baron-Cohen and colleagues to explain certain deficits in autistic disorders. It has, however, been extended beyond this, and applied more broadly. It proposes a means of knowing the mind of others, and suggests that this means fails in autism. The epistemological basis of 'theory of mind' will be examined critically, not just in terms of its endeavour as a theory of knowledge, but also in regard to the principles that underlie it. The proponents of 'theory of mind' eschew the rich field of psychological and phenomenological research, privileging only the biological sciences into which they endeavour to place their theorizations. In doing this, they fail to recognize the epistemological problems involved. This leads to the theory remaining hamstrung by the very Cartesian ontological problems that it seeks to avoid. For some, 'theory of mind' is but an artefact of the cognitive approach that it employs. It is argued that these difficulties are compounded by the failure of 'theory of mind' to take account of the place of language in the interpersonal encounters it attempts to describe.

Building International Business Theory: A Grounded Theory Approach

OpenAIRE

Gligor, David; Esmark, Carol; Golgeci, Ismail

2016-01-01

The field of international business (IB) is in need of more theory development (Morck & Yeung, 2007). As such, the main focus of our manuscript was to provide guidance on how to build IB specific theory using grounded theory (GT). Moreover, we contribute to future theory development by identifying areas within IB where GT can be applied and the type of research issues that can be addressed using this methodology. Finally, we make a noteworthy contribution by discussing some of GT’s caveats an...

Local homotopy theory

CERN Document Server

Jardine, John F

2015-01-01

This monograph on the homotopy theory of topologized diagrams of spaces and spectra gives an expert account of a subject at the foundation of motivic homotopy theory and the theory of topological modular forms in stable homotopy theory. Beginning with an introduction to the homotopy theory of simplicial sets and topos theory, the book covers core topics such as the unstable homotopy theory of simplicial presheaves and sheaves, localized theories, cocycles, descent theory, non-abelian cohomology, stacks, and local stable homotopy theory. A detailed treatment of the formalism of the subject is interwoven with explanations of the motivation, development, and nuances of ideas and results. The coherence of the abstract theory is elucidated through the use of widely applicable tools, such as Barr's theorem on Boolean localization, model structures on the category of simplicial presheaves on a site, and cocycle categories. A wealth of concrete examples convey the vitality and importance of the subject in topology, n...

Unitary field theories

International Nuclear Information System (INIS)

Bergmann, P.G.

1980-01-01

A problem of construction of the unitary field theory is discussed. The preconditions of the theory are briefly described. The main attention is paid to the geometrical interpretation of physical fields. The meaning of the conceptions of diversity and exfoliation is elucidated. Two unitary field theories are described: the Weyl conformic geometry and Calitzy five-dimensioned theory. It is proposed to consider supersymmetrical theories as a new approach to the problem of a unitary field theory. It is noted that the supergravitational theories are really unitary theories, since the fields figuring there do not assume invariant expansion

Dynamical systems V bifurcation theory and catastrophe theory

CERN Document Server

1994-01-01

Bifurcation theory and catastrophe theory are two of the best known areas within the field of dynamical systems. Both are studies of smooth systems, focusing on properties that seem to be manifestly non-smooth. Bifurcation theory is concerned with the sudden changes that occur in a system when one or more parameters are varied. Examples of such are familiar to students of differential equations, from phase portraits. Moreover, understanding the bifurcations of the differential equations that describe real physical systems provides important information about the behavior of the systems. Catastrophe theory became quite famous during the 1970's, mostly because of the sensation caused by the usually less than rigorous applications of its principal ideas to "hot topics", such as the characterization of personalities and the difference between a "genius" and a "maniac". Catastrophe theory is accurately described as singularity theory and its (genuine) applications. The authors of this book, the first printing of w...

A succession of theories: purging redundancy from disturbance theory.

Science.gov (United States)

Pulsford, Stephanie A; Lindenmayer, David B; Driscoll, Don A

2016-02-01

The topics of succession and post-disturbance ecosystem recovery have a long and convoluted history. There is extensive redundancy within this body of theory, which has resulted in confusion, and the links among theories have not been adequately drawn. This review aims to distil the unique ideas from the array of theory related to ecosystem change in response to disturbance. This will help to reduce redundancy, and improve communication and understanding between researchers. We first outline the broad range of concepts that have developed over the past century to describe community change in response to disturbance. The body of work spans overlapping succession concepts presented by Clements in 1916, Egler in 1954, and Connell and Slatyer in 1977. Other theories describing community change include state and transition models, biological legacy theory, and the application of functional traits to predict responses to disturbance. Second, we identify areas of overlap of these theories, in addition to highlighting the conceptual and taxonomic limitations of each. In aligning each of these theories with one another, the limited scope and relative inflexibility of some theories becomes apparent, and redundancy becomes explicit. We identify a set of unique concepts to describe the range of mechanisms driving ecosystem responses to disturbance. We present a schematic model of our proposed synthesis which brings together the range of unique mechanisms that were identified in our review. The model describes five main mechanisms of transition away from a post-disturbance community: (i) pulse events with rapid state shifts; (ii) stochastic community drift; (iii) facilitation; (iv) competition; and (v) the influence of the initial composition of a post-disturbance community. In addition, stabilising processes such as biological legacies, inhibition or continuing disturbance may prevent a transition between community types. Integrating these six mechanisms with the functional

Effective actions for F-theory compactifications and tensor theories

International Nuclear Information System (INIS)

Bonetti, Federico

2014-01-01

In this thesis we study the low-energy effective dynamics emerging from a class of F-theory compactifications in four and six dimensions. We also investigate six-dimensional supersymmetric quantum field theories with self-dual tensors, motivated by the problem of describing the long-wavelength regime of a stack of M5-branes in M-theory. These setups share interesting common features. They both constitute examples of intrinsically non-perturbative physics. On the one hand, in the context of F-theory the non-perturbative character is encoded in the geometric formulation of this class of string vacua, which allows the complexified string coupling to vary in space. On the other hand, the dynamics of a stack of multiple M5-branes flows in the infrared to a novel kind of superconformal field theories in six dimensions - commonly referred to as (2,0) theories - that are expected to possess no perturbative weakly coupled regime and have resisted a complete understanding so far. In particular, no Lagrangian description is known for these models. The strategy we employ to address these two problems is also analogous. A recurring Leitmotif of our work is a transdimensional treatment of the system under examination: in order to extract information about dynamics in d dimensions we consider a (d-1)-dimensional setup. As far as F-theory compactifications are concerned, this is a consequence of the duality between M-theory and F-theory, which constitutes our main tool in the derivation of the effective action of F-theory compactifications. We apply it to six-dimensional F-theory vacua, obtained by taking the internal space to be an elliptically fibered Calabi-Yau threefold, but we also employ it to explore a novel kind of F-theory constructions in four dimensions based on manifolds with Spin(7) holonomy. With reference to six-dimensional (2,0) theories, the transdimensional character of our approach relies in the idea of studying these theories in five dimensions. Indeed, we

75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

Science.gov (United States)

2010-09-07

... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

Life Origination Hydrate Theory (LOH-Theory) and Mitosis and Replication Hydrate Theory (MRH-Theory): three-dimensional PC validation

Science.gov (United States)

Kadyshevich, E. A.; Dzyabchenko, A. V.; Ostrovskii, V. E.

2014-04-01

Size compatibility of the CH4-hydrate structure II and multi-component DNA fragments is confirmed by three-dimensional simulation; it is validation of the Life Origination Hydrate Theory (LOH-Theory).

Gauge theories

International Nuclear Information System (INIS)

Lee, B.W.

1976-01-01

Some introductory remarks to Yang-Mills fields are given and the problem of the Coulomb gauge is considered. The perturbation expansion for quantized gauge theories is discussed and a survey of renormalization schemes is made. The role of Ward-Takahashi identities in gauge theories is discussed. The author then discusses the renormalization of pure gauge theories and theories with spontaneously broken symmetry. (B.R.H.)

General Theory versus ENA Theory: Comparing Their Predictive Accuracy and Scope.

Science.gov (United States)

Ellis, Lee; Hoskin, Anthony; Hartley, Richard; Walsh, Anthony; Widmayer, Alan; Ratnasingam, Malini

2015-12-01

General theory attributes criminal behavior primarily to low self-control, whereas evolutionary neuroandrogenic (ENA) theory envisions criminality as being a crude form of status-striving promoted by high brain exposure to androgens. General theory predicts that self-control will be negatively correlated with risk-taking, while ENA theory implies that these two variables should actually be positively correlated. According to ENA theory, traits such as pain tolerance and muscularity will be positively associated with risk-taking and criminality while general theory makes no predictions concerning these relationships. Data from Malaysia and the United States are used to test 10 hypotheses derived from one or both of these theories. As predicted by both theories, risk-taking was positively correlated with criminality in both countries. However, contrary to general theory and consistent with ENA theory, the correlation between self-control and risk-taking was positive in both countries. General theory's prediction of an inverse correlation between low self-control and criminality was largely supported by the U.S. data but only weakly supported by the Malaysian data. ENA theory's predictions of positive correlations between pain tolerance, muscularity, and offending were largely confirmed. For the 10 hypotheses tested, ENA theory surpassed general theory in predictive scope and accuracy. © The Author(s) 2014.

Quantum Yang-Mills theory of Riemann surfaces and conformal field theory

International Nuclear Information System (INIS)

Killingback, T.P.

1989-01-01

It is shown that Yang-Mills theory on a smooth surface, when suitably quantized, is a topological quantum field theory. This topological gauge theory is intimately related to two-dimensional conformal field theory. It is conjectured that all conformal field theories may be obtained from Yang-Mills theory on smooth surfaces. (orig.)

Grounded theory.

Science.gov (United States)

Harris, Tina

2015-04-29

Grounded theory is a popular research approach in health care and the social sciences. This article provides a description of grounded theory methodology and its key components, using examples from published studies to demonstrate practical application. It aims to demystify grounded theory for novice nurse researchers, by explaining what it is, when to use it, why they would want to use it and how to use it. It should enable nurse researchers to decide if grounded theory is an appropriate approach for their research, and to determine the quality of any grounded theory research they read.

Commentary on Malone: Who Founded Behaviorism?

Science.gov (United States)

Reese, Hayne W

2015-05-01

Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

Ionization of heavy targets by impact of relativistic projectiles

International Nuclear Information System (INIS)

Deco, G.R.; Fainstein, P.D.; Comision Nacional de Energia Atomica, San Carlos de Bariloche; Rivarola, R.D.

1988-01-01

Electron ejection from atomic targets by impact of bare heavy projectiles at relativistic collision energies is studied theoretically. First-order Born calculations are presented by using initial Darwin and final Sommerfeld-Maue wavefunctions. Comparisons with other calculations and experimental data are given. (orig.)

Semiclassical multicomponent wave function

NARCIS (Netherlands)

Mostovoy, M.V.

A consistent method for obtaining the semiclassical multicomponent wave function for any value of adiabatic parameter is discussed and illustrated by examining the motion of a neutral particle in a nonuniform magnetic field. The method generalizes the Bohr-Sommerfeld quantization rule to

Comparison of Attachment theory and Cognitive-Motivational Structure theory.

Science.gov (United States)

Malerstein, A J

2005-01-01

Attachment theory and Cognitive-Motivational Structure (CMS) are similar in most respects. They differ primarily in their proposal of when, during development, one's sense of the self and of the outside world are formed. I propose that the theories supplement each other after about age seven years--when Attachment theory's predictions of social function become unreliable, CMS theory comes into play.

Generalizability theory and item response theory

NARCIS (Netherlands)

Glas, Cornelis A.W.; Eggen, T.J.H.M.; Veldkamp, B.P.

2012-01-01

Item response theory is usually applied to items with a selected-response format, such as multiple choice items, whereas generalizability theory is usually applied to constructed-response tasks assessed by raters. However, in many situations, raters may use rating scales consisting of items with a

Nonrelativistic superstring theories

International Nuclear Information System (INIS)

Kim, Bom Soo

2007-01-01

We construct a supersymmetric version of the critical nonrelativistic bosonic string theory [B. S. Kim, Phys. Rev. D 76, 106007 (2007).] with its manifest global symmetry. We introduce the anticommuting bc conformal field theory (CFT) which is the super partner of the βγ CFT. The conformal weights of the b and c fields are both 1/2. The action of the fermionic sector can be transformed into that of the relativistic superstring theory. We explicitly quantize the theory with manifest SO(8) symmetry and find that the spectrum is similar to that of type IIB superstring theory. There is one notable difference: the fermions are nonchiral. We further consider noncritical generalizations of the supersymmetric theory using the superspace formulation. There is an infinite range of possible string theories similar to the supercritical string theories. We comment on the connection between the critical nonrelativistic string theory and the lightlike linear dilaton theory

The motivational peculiarities of bribe-takers

Directory of Open Access Journals (Sweden)

Krivins A.

2018-01-01

Full Text Available Criminology (as the scientific study of criminal behaviour on the individual and social level and psychology (as the science, which seeks to understand individuals and groups pay special attention to motivation – a theoretical construction, used to explain behaviour. In this article the motivation of recipients of bribery is widely investigated. In addition to such well-established motives as greediness, selfishness, prevalence of personal interest, the author analyzes also other criminal behaviour determinants. The works, which are used in this research are of the following authors: John Broadus Watson, Edward Lee Thorndike (Behavioural; Sigmund Freud, Erich Fromm (Psychoanalysis; Carl Rogers, Abraham Maslow (Existential-humanistic theories; William Isaac Thomas (Thomas theorem; Florian Witold Znaniecki (sociological theory; Erik Homburger Erikson (theory on psychosocial development of human beings; Jean William Fritz Piaget (theory of cognitive development; Herbert Lefcourt, Ronald Smith (Locus of Control etc. As the result of this research the author has concluded that bribe-takers’ behaviour is determined by such psychological constructs as the desire for power, fear, envy, mental deflections, mania, feeling of exclusion, the need for extreme, oppressed creativity.

Recursion Theory Week

CERN Document Server

Müller, Gert; Sacks, Gerald

1990-01-01

These proceedings contain research and survey papers from many subfields of recursion theory, with emphasis on degree theory, in particular the development of frameworks for current techniques in this field. Other topics covered include computational complexity theory, generalized recursion theory, proof theoretic questions in recursion theory, and recursive mathematics.

A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

NARCIS (Netherlands)

Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

1995-01-01

In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

Science.gov (United States)

Fukawa-Connelly, Timothy Patrick; Newton, Charlene

2014-01-01

Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

the use of research in protected area management in Madagascar

African Journals Online (AJOL)

they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

Probability theory

CERN Document Server

Dorogovtsev, A Ya; Skorokhod, A V; Silvestrov, D S; Skorokhod, A V

1997-01-01

This book of problems is intended for students in pure and applied mathematics. There are problems in traditional areas of probability theory and problems in the theory of stochastic processes, which has wide applications in the theory of automatic control, queuing and reliability theories, and in many other modern science and engineering fields. Answers to most of the problems are given, and the book provides hints and solutions for more complicated problems.

How to Map Theory: Reliable Methods Are Fruitless Without Rigorous Theory.

Science.gov (United States)

Gray, Kurt

2017-09-01

Good science requires both reliable methods and rigorous theory. Theory allows us to build a unified structure of knowledge, to connect the dots of individual studies and reveal the bigger picture. Some have criticized the proliferation of pet "Theories," but generic "theory" is essential to healthy science, because questions of theory are ultimately those of validity. Although reliable methods and rigorous theory are synergistic, Action Identification suggests psychological tension between them: The more we focus on methodological details, the less we notice the broader connections. Therefore, psychology needs to supplement training in methods (how to design studies and analyze data) with training in theory (how to connect studies and synthesize ideas). This article provides a technique for visually outlining theory: theory mapping. Theory mapping contains five elements, which are illustrated with moral judgment and with cars. Also included are 15 additional theory maps provided by experts in emotion, culture, priming, power, stress, ideology, morality, marketing, decision-making, and more (see all at theorymaps.org ). Theory mapping provides both precision and synthesis, which helps to resolve arguments, prevent redundancies, assess the theoretical contribution of papers, and evaluate the likelihood of surprising effects.

Little string theory from double-scaling limits of field theories

International Nuclear Information System (INIS)

Ling, Henry; Shieh, H.-H.; Anders, Greg van

2007-01-01

We show that little string theory on S 5 can be obtained as double-scaling limits of the maximally supersymmetric Yang-Mills theories on R x S 2 and R x S 3 /Z k . By matching the gauge theory parameters with those in the dual supergravity solutions found by Lin and Maldacena, we determine the limits in the gauge theories that correspond to decoupling of NS5-brane degrees of freedom. We find that for the theory on R x S 2 , the 't Hooft coupling must be scaled like ln 3 N, and on R x S 3 /Z k , like ln 2 N. Accordingly, taking these limits in these field theories gives Lagrangian definitions of little string theory on S 5

Perturbation theory and coupling constant analyticity in two-dimensional field theories

International Nuclear Information System (INIS)

Simon, B.

1973-01-01

Conjectural material and results over a year old are presented in the discussion of perturbation theory and coupling constant analyticity in two-dimensional field theories. General properties of perturbation series are discussed rather than questions of field theory. The question is interesting for two reasons: First, one would like to understand why perturbation theory is such a good guide (to show that perturbation theory determines the theory in some way). Secondly, one hopes to prove that some or all of the theories are nontrivial. (U.S.)

New Pathways between Group Theory and Model Theory

CERN Document Server

Fuchs, László; Goldsmith, Brendan; Strüngmann, Lutz

2017-01-01

This volume focuses on group theory and model theory with a particular emphasis on the interplay of the two areas. The survey papers provide an overview of the developments across group, module, and model theory while the research papers present the most recent study in those same areas. With introductory sections that make the topics easily accessible to students, the papers in this volume will appeal to beginning graduate students and experienced researchers alike. As a whole, this book offers a cross-section view of the areas in group, module, and model theory, covering topics such as DP-minimal groups, Abelian groups, countable 1-transitive trees, and module approximations. The papers in this book are the proceedings of the conference “New Pathways between Group Theory and Model Theory,” which took place February 1-4, 2016, in Mülheim an der Ruhr, Germany, in honor of the editors’ colleague Rüdiger Göbel. This publication is dedicated to Professor Göbel, who passed away in 2014. He was one of th...

Quantum decision theory as quantum theory of measurement

International Nuclear Information System (INIS)

Yukalov, V.I.; Sornette, D.

2008-01-01

We present a general theory of quantum information processing devices, that can be applied to human decision makers, to atomic multimode registers, or to molecular high-spin registers. Our quantum decision theory is a generalization of the quantum theory of measurement, endowed with an action ring, a prospect lattice and a probability operator measure. The algebra of probability operators plays the role of the algebra of local observables. Because of the composite nature of prospects and of the entangling properties of the probability operators, quantum interference terms appear, which make actions noncommutative and the prospect probabilities nonadditive. The theory provides the basis for explaining a variety of paradoxes typical of the application of classical utility theory to real human decision making. The principal advantage of our approach is that it is formulated as a self-consistent mathematical theory, which allows us to explain not just one effect but actually all known paradoxes in human decision making. Being general, the approach can serve as a tool for characterizing quantum information processing by means of atomic, molecular, and condensed-matter systems

Changing theories of change: strategic shifting in implicit theory endorsement.

Science.gov (United States)

Leith, Scott A; Ward, Cindy L P; Giacomin, Miranda; Landau, Enoch S; Ehrlinger, Joyce; Wilson, Anne E

2014-10-01

People differ in their implicit theories about the malleability of characteristics such as intelligence and personality. These relatively chronic theories can be experimentally altered, and can be affected by parent or teacher feedback. Little is known about whether people might selectively shift their implicit beliefs in response to salient situational goals. We predicted that, when motivated to reach a desired conclusion, people might subtly shift their implicit theories of change and stability to garner supporting evidence for their desired position. Any motivated context in which a particular lay theory would help people to reach a preferred directional conclusion could elicit shifts in theory endorsement. We examine a variety of motivated situational contexts across 7 studies, finding that people's theories of change shifted in line with goals to protect self and liked others and to cast aspersions on disliked others. Studies 1-3 demonstrate how people regulate their implicit theories to manage self-view by more strongly endorsing an incremental theory after threatening performance feedback or memories of failure. Studies 4-6 revealed that people regulate the implicit theories they hold about favored and reviled political candidates, endorsing an incremental theory to forgive preferred candidates for past gaffes but leaning toward an entity theory to ensure past failings "stick" to opponents. Finally, in Study 7, people who were most threatened by a previously convicted child sex offender (i.e., parents reading about the offender moving to their neighborhood) gravitated most to the entity view that others do not change. Although chronic implicit theories are undoubtedly meaningful, this research reveals a previously unexplored source of fluidity by highlighting the active role people play in managing their implicit theories in response to goals. 2014 APA, all rights reserved

Generalizability Theory and Classical Test Theory

Science.gov (United States)

Brennan, Robert L.

2011-01-01

Broadly conceived, reliability involves quantifying the consistencies and inconsistencies in observed scores. Generalizability theory, or G theory, is particularly well suited to addressing such matters in that it enables an investigator to quantify and distinguish the sources of inconsistencies in observed scores that arise, or could arise, over…

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Resurgence and the Nekrasov-Shatashvili limit: connecting weak and strong coupling in the Mathieu and Lamé systems

Energy Technology Data Exchange (ETDEWEB)

Başar, Gökçe [Maryland Center for Fundamental Physics, University of Maryland,College Park, MD, 20742 (United States); Dunne, Gerald V. [Department of Physics, University of Connecticut,Storrs CT 06269 (United States)

2015-02-25

The Nekrasov-Shatashvili limit for the low-energy behavior of N=2 and N=2{sup ∗} supersymmetric SU(2) gauge theories is encoded in the spectrum of the Mathieu and Lamé equations, respectively. This correspondence is usually expressed via an all-orders Bohr-Sommerfeld relation, but this neglects non-perturbative effects, the nature of which is very different in the electric, magnetic and dyonic regions. In the gauge theory dyonic region the spectral expansions are divergent, and indeed are not Borel-summable, so they are more properly described by resurgent trans-series in which perturbative and non-perturbative effects are deeply entwined. In the gauge theory electric region the spectral expansions are convergent, but nevertheless there are non-perturbative effects due to poles in the expansion coefficients, and which we associate with worldline instantons. This provides a concrete analog of a phenomenon found recently by Drukker, Mariño and Putrov in the large N expansion of the ABJM matrix model, in which non-perturbative effects are related to complex space-time instantons. In this paper we study how these very different regimes arise from an exact WKB analysis, and join smoothly through the magnetic region. This approach also leads to a simple proof of a resurgence relation found recently by Dunne and Ünsal, showing that for these spectral systems all non-perturbative effects are subtly encoded in perturbation theory, and identifies this with the Picard-Fuchs equation for the quantized elliptic curve.

Grounded theory: building a middle-range theory in nursing

Directory of Open Access Journals (Sweden)

Maria João Fernandes

2015-03-01

Full Text Available The development of nursing as a discipline results from a boom of investigations underway for nearly a century, and of the construction of theories that have arisen during the 1950’s, with greater relevance since the 1960’s. Giving continuation to the production of knowledge in nursing and seeking to contribute to the increase in the number of explanatory theories of the functional content of nurses, there is interest in answering the question: how can a middle-range theory in nursing be built that explains the nurse-elderly interaction in a successful aging process? As well, we address the goal of describing the process of building a middle-range theory in nursing. Middle-range theory refers to a qualitative paradigm study of inductive thinking, developed in the context of primary health care. The information was collected through participant observation and interviews. Method of analysis grounded theory by Corbin and Strauss(1 was followed, utilizing the triangulation of data and theoretical sampling. Grounded theory has become a method of analysis which facilitates the understanding and explanation of the phenomenon under study. By making clear the nature and process of the nurse-elderly interaction in the selected context and within the context of successful aging, a middle-range theory proposal emerged.

String theory duals of Lifshitz–Chern–Simons gauge theories

International Nuclear Information System (INIS)

Balasubramanian, Koushik; McGreevy, John

2012-01-01

We propose candidate gravity duals for a class of non-Abelian z = 2 Lifshitz Chern–Simons (LCS) gauge theories studied by Mulligan, Kachru and Nayak. These are nonrelativistic gauge theories in 2+1 dimensions in which parity and time-reversal symmetries are explicitly broken by the presence of a Chern–Simons term. We show that these field theories can be realized as deformations of DLCQ N=4 super Yang–Mills theory. Using the holographic dictionary, we identify the bulk fields of type IIB supergravity that are dual to these deformations. The geometries describing the groundstates of the non-Abelian LCS gauge theories realized here exhibit a mass gap. (paper)

Introduction to conformal field theory. With applications to string theory

International Nuclear Information System (INIS)

Blumenhagen, Ralph; Plauschinn, Erik

2009-01-01

Based on class-tested notes, this text offers an introduction to Conformal Field Theory with a special emphasis on computational techniques of relevance for String Theory. It introduces Conformal Field Theory at a basic level, Kac-Moody algebras, one-loop partition functions, Superconformal Field Theories, Gepner Models and Boundary Conformal Field Theory. Eventually, the concept of orientifold constructions is explained in detail for the example of the bosonic string. In providing many detailed CFT calculations, this book is ideal for students and scientists intending to become acquainted with CFT techniques relevant for string theory but also for students and non-specialists from related fields. (orig.)

Genetics by the Numbers

Science.gov (United States)

... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

Quantum States of Neutron in Earth's Gravitational Field

Indian Academy of Sciences (India)

Keywords. Neutron; gravitational field; Bohr-Sommerfeld-Wilson quantization; projectile motion; elastic collision; Olympiad. Author Affiliations. Vijay A Singh1 Praveen Pathak1 K Krishna Chaitanya2. Homi Bhabha Centre For Science Education (TIFR), V N Purav Marg, Mankhurd Mumbai 400088, India. Physics Department ...

G-theory: The generator of M-theory and supersymmetry

Science.gov (United States)

Sepehri, Alireza; Pincak, Richard

2018-04-01

In string theory with ten dimensions, all Dp-branes are constructed from D0-branes whose action has two-dimensional brackets of Lie 2-algebra. Also, in M-theory, with 11 dimensions, all Mp-branes are built from M0-branes whose action contains three-dimensional brackets of Lie 3-algebra. In these theories, the reason for difference between bosons and fermions is unclear and especially in M-theory there is not any stable object like stable M3-branes on which our universe would be formed on it and for this reason it cannot help us to explain cosmological events. For this reason, we construct G-theory with M dimensions whose branes are formed from G0-branes with N-dimensional brackets. In this theory, we assume that at the beginning there is nothing. Then, two energies, which differ in their signs only, emerge and produce 2M degrees of freedom. Each two degrees of freedom create a new dimension and then M dimensions emerge. M-N of these degrees of freedom are removed by symmetrically compacting half of M-N dimensions to produce Lie-N-algebra. In fact, each dimension produces a degree of freedom. Consequently, by compacting M-N dimensions from M dimensions, N dimensions and N degrees of freedom is emerged. These N degrees of freedoms produce Lie-N-algebra. During this compactification, some dimensions take extra i and are different from other dimensions, which are known as time coordinates. By this compactification, two types of branes, Gp and anti-Gp-branes, are produced and rank of tensor fields which live on them changes from zero to dimension of brane. The number of time coordinates, which are produced by negative energy in anti-Gp-branes, is more sensible to number of times in Gp-branes. These branes are compactified anti-symmetrically and then fermionic superpartners of bosonic fields emerge and supersymmetry is born. Some of gauge fields play the role of graviton and gravitino and produce the supergravity. The question may arise that what is the physical reason

From F/M-theory to K-theory and back

International Nuclear Information System (INIS)

Garcia-Etxebarria, Inaki; Uranga, Angel M.

2006-01-01

We consider discrete K-theory tadpole cancellation conditions in type IIB orientifolds with magnetised 7-branes. Cancellation of K-theory charge constrains the choices of world-volume magnetic fluxes on the latter. We describe the F-/M-theory lift of these configurations, where 7-branes are encoded in the geometry of an elliptic fibration, and their magnetic quanta correspond to supergravity 4-form field strength fluxes. In a K3 compactification example, we show that standard quantization of 4-form fluxes as integer cohomology classes in K3 automatically implies the K-theory charge cancellation constraints on the 7-brane worldvolume magnetic fluxes in string theory (as well as new previously unnoticed discrete constraints, which we also interpret). Finally, we show that flux quantization in F-/M-theory implies that 7-brane world-volume flux quantization conditions are modified in the presence of 3-form fluxes

From F/M-theory to K-theory and back

CERN Document Server

Garcia-Etxebarria, I; Garcia-Etxebarria, Inaki; Uranga, Angel M.

2006-01-01

We consider discrete K-theory tadpole cancellation conditions in type IIB orientifolds with magnetised 7-branes. Cancellation of K-theory charge constrains the choices of world-volume magnetic fluxes on the latter. We describe the F-/M-theory lift of these configurations, where 7-branes are encoded in the geometry of an elliptic fibration, and their magnetic quanta correspond to supergravity 4-form field strength fluxes. In a K3 compactification example, we show that standard quantization of 4-form fluxes as integer cohomology classes in K3 automatically implies the K-theory charge cancellation constraints on the 7-brane worldvolume magnetic fluxes in string theory (as well as new previously unnoticed discrete constraints, which we also interpret). Finally, we show that flux quantization in F-/M-theory implies that 7-brane world-volume flux quantization conditions are modified in the presence of 3-form fluxes.

Galois Theory

CERN Document Server

Cox, David A

2012-01-01

Praise for the First Edition ". . .will certainly fascinate anyone interested in abstract algebra: a remarkable book!"—Monatshefte fur Mathematik Galois theory is one of the most established topics in mathematics, with historical roots that led to the development of many central concepts in modern algebra, including groups and fields. Covering classic applications of the theory, such as solvability by radicals, geometric constructions, and finite fields, Galois Theory, Second Edition delves into novel topics like Abel’s theory of Abelian equations, casus irreducibili, and the Galo

Field theory

CERN Multimedia

1999-11-08

In these lectures I will build up the concept of field theory using the language of Feynman diagrams. As a starting point, field theory in zero spacetime dimensions is used as a vehicle to develop all the necessary techniques: path integral, Feynman diagrams, Schwinger-Dyson equations, asymptotic series, effective action, renormalization etc. The theory is then extended to more dimensions, with emphasis on the combinatorial aspects of the diagrams rather than their particular mathematical structure. The concept of unitarity is used to, finally, arrive at the various Feynman rules in an actual, four-dimensional theory. The concept of gauge-invariance is developed, and the structure of a non-abelian gauge theory is discussed, again on the level of Feynman diagrams and Feynman rules.

Concept theory

DEFF Research Database (Denmark)

Hjørland, Birger

2009-01-01

  Concept theory is an extremely broad, interdisciplinary and complex field of research related to many deep fields with very long historical traditions without much consensus. However, information science and knowledge organization cannot avoid relating to theories of concepts. Knowledge...... organizing systems (e.g. classification systems, thesauri and ontologies) should be understood as systems basically organizing concepts and their semantic relations. The same is the case with information retrieval systems. Different theories of concepts have different implications for how to construe......, evaluate and use such systems. Based on "a post-Kuhnian view" of paradigms this paper put forward arguments that the best understanding and classification of theories of concepts is to view and classify them in accordance with epistemological theories (empiricism, rationalism, historicism and pragmatism...

Geophysical Field Theory

International Nuclear Information System (INIS)

Eloranta, E.

2003-11-01

The geophysical field theory includes the basic principles of electromagnetism, continuum mechanics, and potential theory upon which the computational modelling of geophysical phenomena is based on. Vector analysis is the main mathematical tool in the field analyses. Electrostatics, stationary electric current, magnetostatics, and electrodynamics form a central part of electromagnetism in geophysical field theory. Potential theory concerns especially gravity, but also electrostatics and magnetostatics. Solid state mechanics and fluid mechanics are central parts in continuum mechanics. Also the theories of elastic waves and rock mechanics belong to geophysical solid state mechanics. The theories of geohydrology and mass transport form one central field theory in geophysical fluid mechanics. Also heat transfer is included in continuum mechanics. (orig.)

Generalized string theory mapping relations between gravity and gauge theory

International Nuclear Information System (INIS)

Bjerrum-Bohr, N.E.J.

2003-01-01

A previous study of the Kawai, Lewellen and Tye (KLT) relations between gravity and gauge theories, imposed by the relationship of closed and open strings, are here extended in the light of general relativity and Yang-Mills theory as effective field theories. We discuss the possibility of generalizing the traditional KLT mapping in this effective setting. A generalized mapping between the effective Lagrangians of gravity and Yang-Mills theory is presented, and the corresponding operator relations between gauge and gravity theories at the tree level are further explored. From this generalized mapping remarkable diagrammatic relations are found, linking diagrams in gravity and Yang-Mills theory, as well as diagrams in pure effective Yang-Mills theory. Also the possibility of a gravitational coupling to an antisymmetric field in the gravity scattering amplitude is considered, and shown to allow for mixed open-closed string solutions, i.e., closed heterotic strings

Game theory and power theory : a critical comparison

OpenAIRE

Balzer, Wolfgang

1992-01-01

Social actions can be formulated in the frame of game theory or in a frame using, and foccussing on, the notion of power. The two frames are described and clarified. The comparison of theories from these two branches are evaluated from the point of theory of science.

Game theory.

Science.gov (United States)

Dufwenberg, Martin

2011-03-01

Game theory is a toolkit for examining situations where decision makers influence each other. I discuss the nature of game-theoretic analysis, the history of game theory, why game theory is useful for understanding human psychology, and why game theory has played a key role in the recent explosion of interest in the field of behavioral economics. WIREs Cogni Sci 2011 2 167-173 DOI: 10.1002/wcs.119 For further resources related to this article, please visit the WIREs website. Copyright © 2010 John Wiley & Sons, Ltd.

Does Size Matter?

Science.gov (United States)

Watson, David

2014-01-01

In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

Educational Technologists: Leading Change for a New Paradigm of Education

Science.gov (United States)

Aslan, Sinem; Reigeluth, Charles M.

2013-01-01

The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

Systemic Thinking in Career Development Theory: Contributions of the Systems Theory Framework

Science.gov (United States)

McMahon, Mary; Patton, Wendy

2018-01-01

This article considers systemic thinking in relation to the Systems Theory Framework (STF) and to career theory. An overview of systems theory and its applications is followed by a discussion of career theory to provide a context for the subsequent description of STF. The contributions of STF to career theory and to theory integration are…

Sources of political violence, political and psychological analysis

Directory of Open Access Journals (Sweden)

O. B. Balatska

2015-05-01

We also consider the following approaches to determining the nature and sources of aggression and violence such as instinktyvizm (K. Lorenz and behaviorism (J. B. Watson and B. F. Skinner et al.. Special attention is paid to theories of frustration aggression (J. Dollard, N. E. Miller, L. Berkowitz et al., according to which the causes of aggression and violence are hidden in a particular mental state – frustration. The particular importance of the theory of T. R. Gurr, in which the source of aggression and political violence are defined through the concept of relative deprivation, is underlined. Another approach is described in the article ­ the concept of aggression as a learned reaction (A. Bandura, G. Levin, B. Fleischmann et al.. Supporters of this approach believe that aggressive behavior is formed in the process of social training.

Critical Theory: Implications for School Leadership Theory and Practice.

Science.gov (United States)

Peca, Kathy

The school leader's behaviors are inspired by theories, and theories are intrinsic to practice. This paper provides an overview of an emerging perspective in educational administration, critical theory. The paper first highlights the philosophies of Immanuel Kant, Fichte, Hegel, Marx, and the Frankfurt School. It then discusses critical theory…

Conspiracy Theory

DEFF Research Database (Denmark)

Bjerg, Ole; Presskorn-Thygesen, Thomas

2017-01-01

The paper is a contribution to current debates about conspiracy theories within philosophy and cultural studies. Wittgenstein’s understanding of language is invoked to analyse the epistemological effects of designating particular questions and explanations as a ‘conspiracy theory......’. It is demonstrated how such a designation relegates these questions and explanations beyond the realm of meaningful discourse. In addition, Agamben’s concept of sovereignty is applied to explore the political effects of using the concept of conspiracy theory. The exceptional epistemological status assigned...... to alleged conspiracy theories within our prevalent paradigms of knowledge and truth is compared to the exceptional legal status assigned to individuals accused of terrorism under the War on Terror. The paper concludes by discussing the relation between conspiracy theory and ‘the paranoid style...

Putting a Realistic Theory of Mind into Agency Theory

DEFF Research Database (Denmark)

Foss, Nicolai Juul; Stea, Diego

2014-01-01

Agency theory is one of the most important foundational theories in management research, but it rests on contestable cognitive assumptions. Specifically, the principal is assumed to hold a perfect (correct) theory regarding some of the content of the agent's mind, while he is entirely ignorant...... concerning other such content. More realistically, individuals have some limited access to the minds of others. We explore the implications for classical agency theory of realistic assumptions regarding the human potential for interpersonal sensemaking. We discuss implications for the design and management...

Quantum potential theory

CERN Document Server

Schürmann, Michael

2008-01-01

This volume contains the revised and completed notes of lectures given at the school "Quantum Potential Theory: Structure and Applications to Physics," held at the Alfried-Krupp-Wissenschaftskolleg in Greifswald from February 26 to March 10, 2007. Quantum potential theory studies noncommutative (or quantum) analogs of classical potential theory. These lectures provide an introduction to this theory, concentrating on probabilistic potential theory and it quantum analogs, i.e. quantum Markov processes and semigroups, quantum random walks, Dirichlet forms on C* and von Neumann algebras, and boundary theory. Applications to quantum physics, in particular the filtering problem in quantum optics, are also presented.

Historicizing affordance theory

DEFF Research Database (Denmark)

Pedersen, Sofie; Bang, Jytte Susanne

2017-01-01

The aim of this article is to discuss how mutually enriching points from both affordance theory and cultural-historical activity theory can promote theoretical ideas which may prove useful as analytical tools for the study of human life and human development. There are two issues that need...... to be overcome in order to explore the potentials of James Gibson’s affordance theory: it does not sufficiently theorize (a) development and (b) society. We claim that Gibson’s affordance theory still needs to be brought beyond “the axiom of immediacy.” Ambivalences in Gibson’s affordance theory...... societal character of affordance theory....