WorldWideScience

Sample records for sole food source

  1. EPA Sole Source Aquifers

    Data.gov (United States)

    U.S. Environmental Protection Agency — Information on sole source aquifers (SSAs) is widely used in assessments under the National Environmental Policy Act and at the state and local level. A national...

  2. EPA Region 1 Sole Source Aquifers

    Data.gov (United States)

    U.S. Environmental Protection Agency — This coverage contains boundaries of EPA-approved sole source aquifers. Sole source aquifers are defined as an aquifer designated as the sole or principal source of...

  3. EPA Region 1 Sole Source Aquifers

    Science.gov (United States)

    This coverage contains boundaries of EPA-approved sole source aquifers. Sole source aquifers are defined as an aquifer designated as the sole or principal source of drinking water for a given aquifer service area; that is, an aquifer which is needed to supply 50% or more of the drinking water for the area and for which there are no reasonable alternative sources should the aquifer become contaminated.The aquifers were defined by a EPA hydrogeologist. Aquifer boundaries were then drafted by EPA onto 1:24000 USGS quadrangles. For the coastal sole source aquifers the shoreline as it appeared on the quadrangle was used as a boundary. Delineated boundaries were then digitized into ARC/INFO.

  4. Ammonium as sole N source improves grain quality in wheat.

    Science.gov (United States)

    Fuertes-Mendizábal, Teresa; González-Torralba, Jon; Arregui, Luis M; González-Murua, Carmen; González-Moro, M Begoña; Estavillo, José M

    2013-07-01

    The skilful handling of N fertilizer, including N source type and its timing, is necessary to obtain maximum profitability in wheat crops in terms of production and quality. Studies on grain yield and quality with ammonium as sole N source have not yet been conducted. The aim of this study was to evaluate the effect of N source management (nitrate vs. ammonium), and splitting it into two or three amendments during the wheat life cycle, on grain yield and quality under irrigated conditions. This experiment demonstrates that Cezanne wheat plants growing with ammonium as exclusive N source are able to achieve the same yield as plants growing with nitrate and that individual wheat plants grown in irrigated pots can efficiently use late N applied in GS37. Ammonium nutrition increased both types of grain reserve proteins (gliadins and glutenins) and also increased the ratio gli/glu with respect to nitrate nutrition. The splitting of the N rate enhanced the ammonium effect on grain protein composition. The application of ammonium N source, especially when split into three amendments, has an analogous effect on grain protein content and composition to applications at a higher N rate, leading to higher N use efficiency. © 2012 Society of Chemical Industry.

  5. Sole-Source Lighting for Controlled-Environment Agriculture

    Science.gov (United States)

    Mitchell.Cary; Stutte, Gary W.

    2015-01-01

    Since plants on Earth evolved under broad-spectrum solar radiation, anytime they are grown exclusively under electric lighting that does not contain all wavelengths in similar proportion to those in sunlight, plant appearance and size could be uniquely different. Nevertheless, plants have been grown for decades under fluorescent (FL) (1) + incandescent (IN) (2) lamps as a sole source of lighting (SSL), and researchers have become comfortable that, in certain proportions of FL + IN for a given species, plants can appear "normal" relative to their growth outdoors. The problem with using such traditional SSLs for commercial production typically is short lamp lifespans and not obtaining enough photosynthetically active radiation (PAR, 400-700 nm) when desired. These limitations led to supplementation of FL + IN lamp outputs with longer-lived, high-intensity discharge (HID) lamps in growth chambers (3). As researchers became comfortable that mixes of orange-biased high-pressure sodium (HPS) and blue-biased metal halide (MH) HIDs together also could give normal plant growth at higher intensities, growth chambers and phytotrons subsequently were equipped mainly with HID lamps, with their intense thermal output filtered out by ventilated light caps or thermal-controlled water barriers. For the most part, IN and HID lamps have found a home in commercial protected horticulture, usually for night-break photoperiod lighting (IN) or for seasonal supplemental lighting (mostly HPS) in greenhouses. However, lack of economically viable options for SSL have held back aspects of year-round indoor agriculture from taking off commercially.

  6. 75 FR 53269 - Federal Acquisition Regulation; Tribal Consultation; Justification and Approval of Sole-Source 8...

    Science.gov (United States)

    2010-08-31

    ... and approval of sole-source contracts over $20 million under the 8(a) small business development... valuable component of its deliberations in preparing to implement this law, which includes contracting with... Regulation; Tribal Consultation; Justification and Approval of Sole-Source 8(a) Contracts AGENCIES...

  7. 77 FR 23369 - Federal Acquisition Regulation; Justification and Approval of Sole-Source 8(a) Contracts

    Science.gov (United States)

    2012-04-18

    ... Business Administration (SBA) may not accept a sole- source 8(a) contract in excess of $20 million for... is no conflict with the law. Execution of the J&A prior to the SBA's initiation of contract... small number of businesses that have been awarded 8(a) contracts over the $20 million threshold may be...

  8. Enhanced biological phosphorus removal in a sequencing batch reactor using propionate as the sole carbon source.

    Science.gov (United States)

    Pijuan, M; Saunders, A M; Guisasola, A; Baeza, J A; Casas, C; Blackall, L L

    2004-01-05

    An enhanced biological phosphorus removal (EBPR) system was developed in a sequencing batch reactor (SBR) using propionate as the sole carbon source. The microbial community was followed using fluorescence in situ hybridization (FISH) techniques and Candidatus 'Accumulibacter phosphatis' were quantified from the start up of the reactor until steady state. A series of SBR cycle studies was performed when 55% of the SBR biomass was Accumulibacter, a confirmed polyphosphate accumulating organism (PAO) and when Candidatus 'Competibacter phosphatis', a confirmed glycogen-accumulating organism (GAO), was essentially undetectable. These experiments evaluated two different carbon sources (propionate and acetate), and in every case, two different P-release rates were detected. The highest rate took place while there was volatile fatty acid (VFA) in the mixed liquor, and after the VFA was depleted a second P-release rate was observed. This second rate was very similar to the one detected in experiments performed without added VFA.A kinetic and stoichiometric model developed as a modification of Activated Sludge Model 2 (ASM2) including glycogen economy, was fitted to the experimental profiles. The validation and calibration of this model was carried out with the cycle study experiments performed using both VFAs. The effect of pH from 6.5 to 8.0 on anaerobic P-release and VFA-uptake and aerobic P-uptake was also studied using propionate. The optimal overall working pH was around 7.5. This is the first study of the microbial community involved in EBPR developed with propionate as a sole carbon source along with detailed process performance investigations of the propionate-utilizing PAOs. Copyright 2003 Wiley Periodicals, Inc.

  9. Sodium and Food Sources

    Science.gov (United States)

    ... is processed food? The Dietary Guidelines for Americans define the term "processed food" includes "any raw agricultural ... of foods , ranging from the number 1 source—breads and rolls—to eggs and omelets, which are ...

  10. Final PHP bench-scale report for the DOE-ID/SAIC sole source contract

    International Nuclear Information System (INIS)

    1997-04-01

    The Plasma Hearth Process (PHP) Technology Development Project was established to develop, test, and evaluate a new concept for treating mixed waste. The new concept uses direct current (dc) transferred-arc plasma torch technology to process mixed waste into a glass-like end-product. Under the cognizance of the US Department of Energy (DOE) Office of Technology Development (OTD) Mixed Waste Focus Area (MWFA), the technology is being explored for its potential to treat mixed waste. Because it is a mature technology, well-understood and commercially available, it is expected to develop rapidly in this new application. This report summarizes the radioactive bench-scale system activities funded under PHP Sole Source Contract DE-AC07-94ID13266 through the end of the contract

  11. Isolation and characterization of a bacterium which utilizes polyester polyurethane as a sole carbon and nitrogen source.

    Science.gov (United States)

    Nakajima-Kambe, T; Onuma, F; Kimpara, N; Nakahara, T

    1995-06-01

    Various soil samples were screened for the presence of microorganisms which have the ability to degrade polyurethane compounds. Two strains with good polyurethane degrading activity were isolated. The more active strain was tentatively identified as Comamonas acidovorans. This strain could utilize polyester-type polyurethanes but not the polyether-type polyurethanes as sole carbon and nitrogen sources. Adipic acid and diethylene glycol were probably the main degradation products when polyurethane was supplied as a sole carbon and nitrogen source. When ammonium nitrate was used as nitrogen source, only diethylene glycol was detected after growth on polyurethane.

  12. Assessment of self-organizing maps to analyze sole-carbon source utilization profiles.

    Science.gov (United States)

    Leflaive, Joséphine; Céréghino, Régis; Danger, Michaël; Lacroix, Gérard; Ten-Hage, Loïc

    2005-07-01

    The use of community-level physiological profiles obtained with Biolog microplates is widely employed to consider the functional diversity of bacterial communities. Biolog produces a great amount of data which analysis has been the subject of many studies. In most cases, after some transformations, these data were investigated with classical multivariate analyses. Here we provided an alternative to this method, that is the use of an artificial intelligence technique, the Self-Organizing Maps (SOM, unsupervised neural network). We used data from a microcosm study of algae-associated bacterial communities placed in various nutritive conditions. Analyses were carried out on the net absorbances at two incubation times for each substrates and on the chemical guild categorization of the total bacterial activity. Compared to Principal Components Analysis and cluster analysis, SOM appeared as a valuable tool for community classification, and to establish clear relationships between clusters of bacterial communities and sole-carbon sources utilization. Specifically, SOM offered a clear bidimensional projection of a relatively large volume of data and were easier to interpret than plots commonly obtained with multivariate analyses. They would be recommended to pattern the temporal evolution of communities' functional diversity.

  13. Continuous operation of an ultra-low-power microcontroller using glucose as the sole energy source.

    Science.gov (United States)

    Lee, Inyoung; Sode, Takashi; Loew, Noya; Tsugawa, Wakako; Lowe, Christopher Robin; Sode, Koji

    2017-07-15

    An ultimate goal for those engaged in research to develop implantable medical devices is to develop mechatronic implantable artificial organs such as artificial pancreas. Such devices would comprise at least a sensor module, an actuator module, and a controller module. For the development of optimal mechatronic implantable artificial organs, these modules should be self-powered and autonomously operated. In this study, we aimed to develop a microcontroller using the BioCapacitor principle. A direct electron transfer type glucose dehydrogenase was immobilized onto mesoporous carbon, and then deposited on the surface of a miniaturized Au electrode (7mm 2 ) to prepare a miniaturized enzyme anode. The enzyme fuel cell was connected with a 100 μF capacitor and a power boost converter as a charge pump. The voltage of the enzyme fuel cell was increased in a stepwise manner by the charge pump from 330mV to 3.1V, and the generated electricity was charged into a 100μF capacitor. The charge pump circuit was connected to an ultra-low-power microcontroller. Thus prepared BioCapacitor based circuit was able to operate an ultra-low-power microcontroller continuously, by running a program for 17h that turned on an LED every 60s. Our success in operating a microcontroller using glucose as the sole energy source indicated the probability of realizing implantable self-powered autonomously operated artificial organs, such as artificial pancreas. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon

    Science.gov (United States)

    Patowary, Kaustuvmani; Patowary, Rupshikha; Kalita, Mohan C.; Deka, Suresh

    2017-01-01

    Production and spillage of petroleum hydrocarbons which is the most versatile energy resource causes disastrous environmental pollution. Elevated oil degrading performance from microorganisms is demanded for successful microbial remediation of those toxic pollutants. The employment of biosurfactant-producing and hydrocarbon-utilizing microbes enhances the effectiveness of bioremediation as biosurfactant plays a key role by making hydrocarbons bio-available for degradation. The present study aimed the isolation of a potent biosurfactant producing indigenous bacteria which can be employed for crude oil remediation, along with the characterization of the biosurfactant produced during crude oil biodegradation. A potent bacterial strain Pseudomonas aeruginosa PG1 (identified by 16s rDNA sequencing) was isolated from hydrocarbon contaminated soil that could efficiently produce biosurfactant by utilizing crude oil components as the carbon source, thereby leading to the enhanced degradation of the petroleum hydrocarbons. Strain PG1 could degrade 81.8% of total petroleum hydrocarbons (TPH) after 5 weeks of culture when grown in mineral salt media (MSM) supplemented with 2% (v/v) crude oil as the sole carbon source. GCMS analysis of the treated crude oil samples revealed that P. aeruginosa PG1 could potentially degrade various hydrocarbon contents including various PAHs present in the crude oil. Biosurfactant produced by strain PG1 in the course of crude oil degradation, promotes the reduction of surface tension (ST) of the culture medium from 51.8 to 29.6 mN m−1, with the critical micelle concentration (CMC) of 56 mg L−1. FTIR, LC-MS, and SEM-EDS studies revealed that the biosurfactant is a rhamnolipid comprising of both mono and di rhamnolipid congeners. The biosurfactant did not exhibit any cytotoxic effect to mouse L292 fibroblastic cell line, however, strong antibiotic activity against some pathogenic bacteria and fungus was observed. PMID:28275373

  15. Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon.

    Science.gov (United States)

    Patowary, Kaustuvmani; Patowary, Rupshikha; Kalita, Mohan C; Deka, Suresh

    2017-01-01

    Production and spillage of petroleum hydrocarbons which is the most versatile energy resource causes disastrous environmental pollution. Elevated oil degrading performance from microorganisms is demanded for successful microbial remediation of those toxic pollutants. The employment of biosurfactant-producing and hydrocarbon-utilizing microbes enhances the effectiveness of bioremediation as biosurfactant plays a key role by making hydrocarbons bio-available for degradation. The present study aimed the isolation of a potent biosurfactant producing indigenous bacteria which can be employed for crude oil remediation, along with the characterization of the biosurfactant produced during crude oil biodegradation. A potent bacterial strain Pseudomonas aeruginosa PG1 (identified by 16s rDNA sequencing) was isolated from hydrocarbon contaminated soil that could efficiently produce biosurfactant by utilizing crude oil components as the carbon source, thereby leading to the enhanced degradation of the petroleum hydrocarbons. Strain PG1 could degrade 81.8% of total petroleum hydrocarbons (TPH) after 5 weeks of culture when grown in mineral salt media (MSM) supplemented with 2% (v/v) crude oil as the sole carbon source. GCMS analysis of the treated crude oil samples revealed that P. aeruginosa PG1 could potentially degrade various hydrocarbon contents including various PAHs present in the crude oil. Biosurfactant produced by strain PG1 in the course of crude oil degradation, promotes the reduction of surface tension (ST) of the culture medium from 51.8 to 29.6 mN m -1 , with the critical micelle concentration (CMC) of 56 mg L -1 . FTIR, LC-MS, and SEM-EDS studies revealed that the biosurfactant is a rhamnolipid comprising of both mono and di rhamnolipid congeners. The biosurfactant did not exhibit any cytotoxic effect to mouse L292 fibroblastic cell line, however, strong antibiotic activity against some pathogenic bacteria and fungus was observed.

  16. Glyphosate Shapes a Dinoflagellate-Associated Bacterial Community While Supporting Algal Growth as Sole Phosphorus Source

    Directory of Open Access Journals (Sweden)

    Cong Wang

    2017-12-01

    Full Text Available Glyphosate is a widely used herbicide that can potentially be a phosphorus (P source for phytoplankton and microbes when discharged into the coastal ocean. In contrast to bacteria, few eukaryotic phytoplankton species appear capable of directly utilizing glyphosate. In this study, we observed, after a long delay (>60 days, Prorocentrum donghaiense, a dinoflagellate known to cause major harmful algal blooms in the East China Sea, could grow in a medium with glyphosate as the sole P source; suggesting that P. donghaiense growth was through bacterial mediation. To understand how the bacteria community might respond to glyphosate, we analyzed the 16S rRNA genes of the microbial community present in P. donghaiense cultures when grown under lower (36 μM and higher (360 μM glyphosate concentrations. Based on both Sanger and Illumina high throughput sequencing, we obtained more than 55,323 good-quality sequences, which were classified into six phyla. As the concentration of glyphosate rose, our results showed a significant increase in the phyla Proteobacteria and Firmicutes and a decrease in the phylum Bacteroidetes. Further qPCR (Quantitative PCR analysis showed higher abundances of two specific phylotypes in the higher-glyphosate P. donghaiense cultures when compared to the lower-glyphosate and no-glyphosate cultures. Correspondingly, qPCR displayed the same trend for the abundance of a gammaproteobacterial type of phnJ, a gene encoding Alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase, which is responsible for phosphonate degradation. In addition, Tax4Fun analysis based on our 16S rRNA gene sequences results in higher predicted abundances of phosphonate metabolizing genes in glyphosate-treated cultures. This study demonstrates that glyphosate could selectively promote the growth of particular groups of bacteria within an algal culture and in glyphosate enriched coastal waters, this interaction may potentially further facilitate the growth of

  17. 5 CFR 890.1048 - Waiver of debarment for a provider that is the sole source of health care services in a community.

    Science.gov (United States)

    2010-01-01

    ... is the sole source of health care services in a community. 890.1048 Section 890.1048 Administrative... HEALTH BENEFITS PROGRAM Administrative Sanctions Imposed Against Health Care Providers Exceptions to the Effect of Debarments § 890.1048 Waiver of debarment for a provider that is the sole source of health care...

  18. N-(2-PIRYDYLAMINO METHYLENEBISPHOSPHONIC ACID AS A SOLE SOURCE OF A FUNGI FUSARIUM STRAINS GROWING

    Directory of Open Access Journals (Sweden)

    Teresa Krzyśko-Łupicka

    2016-09-01

    The results of growth kinetics of the studied Fusarium fungi in the presence of N-(2-pirydyloamino methyle-nobisphosphonic acid, were expressed by dry weight [g·dm-3]. Only Fusarium oxysporum XVI has been capa-ble to grow in acidic medium (pH 4.0 using N-(2-pirydylamino methylene-bisphosphonic acid as an alterna-tive source of phosphorus. In these conditions the N-(2-pirydylamino methylenebisphosphonic acid degrada-tion was carried out to utilize phosphorus compounds as a source of nutrient components for this strain. The presence of N-(2-pirydylamino methylenebisphosphonic acid receded a growth rate of mycelium but did not have an effect on spores of tested fungi.

  19. Biodegradation and utilization of 4-n-nonylphenol by Aspergillus versicolor as a sole carbon and energy source

    International Nuclear Information System (INIS)

    Krupiński, Mariusz; Janicki, Tomasz; Pałecz, Bartłomiej; Długoński, Jerzy

    2014-01-01

    Highlights: • A. versicolor is able to degrade 4-n-NP as the sole source of carbon and energy. • 4-n-NP removal by A. versicolor was accompanied by the formation of metabolites. • Radioactive experiments show complete 4-n-NP mineralization by A. versicolor. • 4-n-NP initiates heat production in the A. versicolor spores. - Abstract: 4-n-Nonylphenol (4-n-NP) is an environmental pollutant with endocrine-disrupting activities that is formed during the degradation of nonylphenol polyethoxylates, which are widely used as surfactants. Utilization of 4-n-NP by the filamentous fungus Aspergillus versicolor as the sole carbon and energy source was investigated. By means of gas chromatography–mass spectrometry, we showed that in the absence of any carbon source other than 4-n-NP in the medium, A. versicolor completely removed the xenobiotic (100 mg L −1 ) after 3 d of cultivation. Moreover, mass spectrometric analysis of intracellular extracts led to the identification of eight intermediates. The mineralization of the xenobiotic in cultures supplemented with 4-n-NP [ring- 14 C(U)] as a growth substrate was also assessed. After 3 d of incubation, approximately 50% of the initially applied radioactivity was recovered in the form of 14 CO 2 , proving that this xenobiotic was completely metabolized and utilized by A. versicolor as a carbon source. Based on microscopic analysis, A. versicolor is capable of germinating spores under such conditions. To confirm these observations, a microcalorimetric method was used. The results show that even the highest amount of 4-n-NP initiates heat production in the fungal samples, proving that metabolic processes were affected by the use of 4-n-NP as an energetic substrate

  20. Biodegradation and utilization of 4-n-nonylphenol by Aspergillus versicolor as a sole carbon and energy source

    Energy Technology Data Exchange (ETDEWEB)

    Krupiński, Mariusz; Janicki, Tomasz [Department of Industrial Microbiology and Biotechnology, University of Lodz, Banacha 12/16, 90-237 Łódź (Poland); Pałecz, Bartłomiej [Department of Physical Chemistry, University of Lodz, Pomorska 165, 90-236 Łódź (Poland); Długoński, Jerzy, E-mail: jdlugo@biol.uni.lodz.pl [Department of Industrial Microbiology and Biotechnology, University of Lodz, Banacha 12/16, 90-237 Łódź (Poland)

    2014-09-15

    Highlights: • A. versicolor is able to degrade 4-n-NP as the sole source of carbon and energy. • 4-n-NP removal by A. versicolor was accompanied by the formation of metabolites. • Radioactive experiments show complete 4-n-NP mineralization by A. versicolor. • 4-n-NP initiates heat production in the A. versicolor spores. - Abstract: 4-n-Nonylphenol (4-n-NP) is an environmental pollutant with endocrine-disrupting activities that is formed during the degradation of nonylphenol polyethoxylates, which are widely used as surfactants. Utilization of 4-n-NP by the filamentous fungus Aspergillus versicolor as the sole carbon and energy source was investigated. By means of gas chromatography–mass spectrometry, we showed that in the absence of any carbon source other than 4-n-NP in the medium, A. versicolor completely removed the xenobiotic (100 mg L{sup −1}) after 3 d of cultivation. Moreover, mass spectrometric analysis of intracellular extracts led to the identification of eight intermediates. The mineralization of the xenobiotic in cultures supplemented with 4-n-NP [ring-{sup 14}C(U)] as a growth substrate was also assessed. After 3 d of incubation, approximately 50% of the initially applied radioactivity was recovered in the form of {sup 14}CO{sub 2}, proving that this xenobiotic was completely metabolized and utilized by A. versicolor as a carbon source. Based on microscopic analysis, A. versicolor is capable of germinating spores under such conditions. To confirm these observations, a microcalorimetric method was used. The results show that even the highest amount of 4-n-NP initiates heat production in the fungal samples, proving that metabolic processes were affected by the use of 4-n-NP as an energetic substrate.

  1. Levoglucosan kinase involved in citric acid fermentation by Aspergillus niger CBX-209 using levoglucosan as sole carbon and energy source

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, X.L.; Zhang, H.X.; Tang, J.J. [Chinese Academy of Sciences, Beijing (China). Research Center for Eco-Environmental Sciences

    2001-07-01

    Conditions were optimized for the production of citric acid by a mutant A. niger CBX-209 using levoglucosan derived from pyrolysis of wastepaper as a sole carbon and energy source in a simple medium. The optimum concentration of levoglucosan and wheat bran in the medium was 8% and 3%, respectively, at an optimum initial pH between 5.5 and 6.0 at 35{sup o}C. During fermentation, direct formation of glucose 6-phosphate from levogluocosan in the presence of ATP and Mg{sup 2+} as observed by HPLC in the reaction with both cell extracts and partially purified enzyme, suggested that the enzyme acting on levoglucosan isa kinase. Time-course changes in the levels of this special levoglucosan kinase in A. niger CBX-209 grown on levoglucosan and glucose revealed that levoglucosan kinase was an inductive enzyme. (Author)

  2. Household income differences in food sources and food items purchased.

    Science.gov (United States)

    French, Simone A; Wall, Melanie; Mitchell, Nathan R

    2010-10-26

    The present study examined income-related household food purchases among a sample of 90 households from the community. Annotated food purchase receipts were collected for a four-week period by the primary household shopper. Receipt food source and foods items were classified into specific categories, and food quantities in ounces were recorded by research staff. For home sources, a limited number of food/beverage categories were recorded. For eating out sources, all food/beverage items were recorded. Median monthly per person dollars spent and per person ounces purchased were computed. Food sources and food categories were examined by household income tertile. A community-based sample of 90 households. Higher income households spent significantly more dollars per person per month from both home and eating out sources compared with lower income households ($163 versus $100, p income households, higher income households spent significantly more home source dollars on both fruits/vegetables (21.5 versus 10.2, p income households (45% versus 26%, p sources, lower income households spent a significantly greater percent of dollars per person at carry out places (54% versus 37%, p income differences were observed for dollars spent at discount grocery stores, small grocery stores or convenience stores. Higher income households spent more money on both healthy and less healthy foods from a wide range of sources. Lower income households spent a larger proportion of their eating out dollars at carry out places, and a larger proportion of their home beverage purchases were sugar sweetened beverages.

  3. Exploring Fingerprints of the Extreme Thermoacidophile Metallosphaera sedula Grown on Synthetic Martian Regolith Materials as the Sole Energy Sources

    Directory of Open Access Journals (Sweden)

    Denise Kölbl

    2017-10-01

    Full Text Available The biology of metal transforming microorganisms is of a fundamental and applied importance for our understanding of past and present biogeochemical processes on Earth and in the Universe. The extreme thermoacidophile Metallosphaera sedula is a metal mobilizing archaeon, which thrives in hot acid environments (optimal growth at 74°C and pH 2.0 and utilizes energy from the oxidation of reduced metal inorganic sources. These characteristics of M. sedula make it an ideal organism to further our knowledge of the biogeochemical processes of possible life on extraterrestrial planetary bodies. Exploring the viability and metal extraction capacity of M. sedula living on and interacting with synthetic extraterrestrial minerals, we show that M. sedula utilizes metals trapped in the Martian regolith simulants (JSC Mars 1A; P-MRS; S-MRS; MRS07/52 as the sole energy sources. The obtained set of microbiological and mineralogical data suggests that M. sedula actively colonizes synthetic Martian regolith materials and releases free soluble metals. The surface of bioprocessed Martian regolith simulants is analyzed for specific mineralogical fingerprints left upon M. sedula growth. The obtained results provide insights of biomining of extraterrestrial material as well as of the detection of biosignatures implementing in life search missions.

  4. Heterotrophic cultivation of Chlorella pyrenoidosa using sucrose as the sole carbon source by co-culture with Rhodotorula glutinis.

    Science.gov (United States)

    Wang, Shikai; Wu, Yong; Wang, Xu

    2016-11-01

    Heterotrophic cultivation of microalgae is a feasible alternative strategy to avoid the light limitation of photoautotrophic culture, but the heterotrophic utilization of disaccharides is difficult for microalgae. Aimed at this problem, a co-culture system was developed by mix culture of C. pyrenoidosa and R. glutinis using sucrose as the sole carbon source. In this system, C. pyrenoidosa could utilize glucose and fructose which were hydrolyzed from sucrose by R. glutinis. The highest specific growth rate and final cell number proportion of algae was 1.02day(-1) and 45%, respectively, when cultured at the initial algal cell number proportion of 95.24% and the final algal cell density was 111.48×10(6)cells/mL. In addition, the lipid content was also promoted due to the synergistic effects in mix culture. This study provides a novel approach using sucrose-riched wastes for the heterotrophic culture of microalgae and may effectively decrease the cost of carbon source. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Exploring Fingerprints of the Extreme Thermoacidophile Metallosphaera sedula Grown on Synthetic Martian Regolith Materials as the Sole Energy Sources.

    Science.gov (United States)

    Kölbl, Denise; Pignitter, Marc; Somoza, Veronika; Schimak, Mario P; Strbak, Oliver; Blazevic, Amir; Milojevic, Tetyana

    2017-01-01

    The biology of metal transforming microorganisms is of a fundamental and applied importance for our understanding of past and present biogeochemical processes on Earth and in the Universe. The extreme thermoacidophile Metallosphaera sedula is a metal mobilizing archaeon, which thrives in hot acid environments (optimal growth at 74°C and pH 2.0) and utilizes energy from the oxidation of reduced metal inorganic sources. These characteristics of M. sedula make it an ideal organism to further our knowledge of the biogeochemical processes of possible life on extraterrestrial planetary bodies. Exploring the viability and metal extraction capacity of M. sedula living on and interacting with synthetic extraterrestrial minerals, we show that M. sedula utilizes metals trapped in the Martian regolith simulants (JSC Mars 1A; P-MRS; S-MRS; MRS07/52) as the sole energy sources. The obtained set of microbiological and mineralogical data suggests that M. sedula actively colonizes synthetic Martian regolith materials and releases free soluble metals. The surface of bioprocessed Martian regolith simulants is analyzed for specific mineralogical fingerprints left upon M. sedula growth. The obtained results provide insights of biomining of extraterrestrial material as well as of the detection of biosignatures implementing in life search missions.

  6. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source

    International Nuclear Information System (INIS)

    Vital-Jacome, Miguel; Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor; Thalasso, Frederic

    2016-01-01

    Highlights: • Microrespirometry was used to characterize aerobic granules. • Kinetic parameters for 4-chorophenol degradation were determined. • Intrinsic and apparent kinetic parameters were quantified and contrasted. • Aerobic granules presented lower μ_m_a_x and higher K_S than disaggregated granules. • Microrespirometry can be useful in model development and calibration. - Abstract: In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9 kg COD m"−"3 d"−"1, and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems.

  7. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source

    Energy Technology Data Exchange (ETDEWEB)

    Vital-Jacome, Miguel [Department of Biotechnology and Bioengineering, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav-IPN), Av. IPN 2508, 07360 México DF, México (Mexico); Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor [Laboratory for Research on Advanced Process for Water Treatment, Unidad Académica Juriquilla, Instituto de Ingeniería, Universidad Nacional Autónoma de México, Blvd. Juriquilla 3001, Querétaro 76320, México (Mexico); Thalasso, Frederic, E-mail: thalasso@cinvestav.mx [Department of Biotechnology and Bioengineering, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (Cinvestav-IPN), Av. IPN 2508, 07360 México DF, México (Mexico)

    2016-08-05

    Highlights: • Microrespirometry was used to characterize aerobic granules. • Kinetic parameters for 4-chorophenol degradation were determined. • Intrinsic and apparent kinetic parameters were quantified and contrasted. • Aerobic granules presented lower μ{sub max} and higher K{sub S} than disaggregated granules. • Microrespirometry can be useful in model development and calibration. - Abstract: In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9 kg COD m{sup −3} d{sup −1}, and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems.

  8. Isotope and machine sources for food irradiation

    International Nuclear Information System (INIS)

    Balcazar G, M.

    1992-05-01

    Artificial radioactive sources as Co-60 and Cs- 137 are produced by bombarding Co-59 with neutrons in a nuclear reactor and by chemical separation of spent nuclear fuel respectively. Both radioactive sources emit very high frequency electromagnetic radiation called y-rays. This highly penetrating radiation is employed for preservation of food. Each y-ray emitted from a radioactive source transports energy from the source to the irradiated food. Penetration of y-rays and their intensity depend on y-energy. Inside this study the advantages and disadvantages of both sources are compared. (Author)

  9. Isotope and machine sources for food irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Balcazar G, M

    1992-05-15

    Artificial radioactive sources as Co-60 and Cs- 137 are produced by bombarding Co-59 with neutrons in a nuclear reactor and by chemical separation of spent nuclear fuel respectively. Both radioactive sources emit very high frequency electromagnetic radiation called y-rays. This highly penetrating radiation is employed for preservation of food. Each y-ray emitted from a radioactive source transports energy from the source to the irradiated food. Penetration of y-rays and their intensity depend on y-energy. Inside this study the advantages and disadvantages of both sources are compared. (Author)

  10. Growth of Candida famata and Trichosporon cutaneum on uric acid as the sole source of carbon and energy, a hitherto unknown property of yeasts

    NARCIS (Netherlands)

    Middelhoven, W.J.; Brink, Jolanda A. van den; Veenhuis, M.

    1983-01-01

    Yeast strains capable of utilizing uric acid as the sole source of carbon and energy were isolated from soil by the enrichment culture method. The strains were identified as Candida famata (Harrison) Meyer et Yarrow and Trichosporon cutaneum (De Beurm., Gougerot et Vaucher) Ota. On the subcellular

  11. Fungi as a Source of Food.

    Science.gov (United States)

    Dupont, Joëlle; Dequin, Sylvie; Giraud, Tatiana; Le Tacon, François; Marsit, Souhir; Ropars, Jeanne; Richard, Franck; Selosse, Marc-André

    2017-06-01

    In this article, we review some of the best-studied fungi used as food sources, in particular, the cheese fungi, the truffles, and the fungi used for drink fermentation such as beer, wine, and sake. We discuss their history of consumption by humans and the genomic mechanisms of adaptation during artificial selection.

  12. Production of FucoPol by Enterobacter A47 using waste tomato paste by-product as sole carbon source.

    Science.gov (United States)

    Antunes, Sílvia; Freitas, Filomena; Sevrin, Chantal; Grandfils, Christian; Reis, Maria A M

    2017-03-01

    Out-of-specification tomato paste, a by-product from the tomato processing industry, was used as the sole substrate for cultivation of the bacterium Enterobacter A47 and production of FucoPol, a value-added fucose-rich extracellular polysaccharide. Among the different tested fed-batch strategies, pH-stat, DO-stat and continuous substrate feeding, the highest production (8.77gL -1 ) and overall volumetric productivity (2.92gL -1 d -1 ) were obtained with continuous substrate feeding at a constant flow rate of 11gh -1 . The polymer produced had the typical FucoPol composition (37mol% fucose, 27mol% galactose, 23mol% glucose and 12mol% glucuronic acid, with an acyl groups content of 13wt%). The average molecular weight was 4.4×10 6 Da and the polydispersity index was 1.2. This study demonstrated that out-of-specification tomato paste is a suitable low-cost substrate for the production of FucoPol, thus providing a route for the valorization of this by-product into a high-value microbial product. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. New protein sources and food legislation

    DEFF Research Database (Denmark)

    Belluco, Simone; Halloran, Afton Marina Szasz; Ricci, Antonia

    2017-01-01

    Growing global food demand has generated a greater interest in the consumption of new and diversified protein sources. Novel foodstuffs represent a challenge for food law as they need proper safety assessments before obtaining market permission. The case of edible insects and European law is a good...... representation of this issue because a selection of food grade insect species may be available on the European market in the coming years. However, European legislation does not explicitly address edible insects. Consequently, this has left a grey area, allowing different interpretations of the legislation among....... Particular attention will be paid to the evolution of legislation and to the experiences of both EU and non-EU countries. In recent years, a number of different stakeholders have supported the legalization of edible insect consumption in Europe, but market permission is just the first step towards a new...

  14. Natural Colorants: Food Colorants from Natural Sources.

    Science.gov (United States)

    Sigurdson, Gregory T; Tang, Peipei; Giusti, M Mónica

    2017-02-28

    The color of food is often associated with the flavor, safety, and nutritional value of the product. Synthetic food colorants have been used because of their high stability and low cost. However, consumer perception and demand have driven the replacement of synthetic colorants with naturally derived alternatives. Natural pigment applications can be limited by lower stability, weaker tinctorial strength, interactions with food ingredients, and inability to match desired hues. Therefore, no single naturally derived colorant can serve as a universal alternative for a specified synthetic colorant in all applications. This review summarizes major environmental and biological sources for natural colorants as well as nature-identical counterparts. Chemical characteristics of prevalent pigments, including anthocyanins, carotenoids, betalains, and chlorophylls, are described. The possible applications and hues (warm, cool, and achromatic) of currently used natural pigments, such as anthocyanins as red and blue colorants, and possible future alternatives, such as purple violacein and red pyranoanthocyanins, are also discussed.

  15. On the autarchic use of solely PIXE data in particulate matter source apportionment studies by receptor modeling

    Energy Technology Data Exchange (ETDEWEB)

    Lucarelli, F. [Department of Physics and Astronomy, University of Florence, Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); National Institute of Nuclear Physics (INFN)-Florence, Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Nava, S., E-mail: nava@fi.infn.it [National Institute of Nuclear Physics (INFN)-Florence, Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Calzolai, G. [Department of Physics and Astronomy, University of Florence, Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Chiari, M. [National Institute of Nuclear Physics (INFN)-Florence, Via G. Sansone 1, 50019 Sesto Fiorentino (Italy); Giannoni, M.; Traversi, R.; Udisti, R. [Department of Chemistry, University of Florence, Via della Lastruccia 3, 50019 Sesto Fiorentino (Italy)

    2015-11-15

    Particle Induced X-ray Emission (PIXE) analysis of aerosol samples allows simultaneous detection of several elements, including important tracers of many particulate matter sources. This capability, together with the possibility of analyzing a high number of samples in very short times, makes PIXE a very effective tool for source apportionment studies by receptor modeling. However, important aerosol components, like nitrates, OC and EC, cannot be assessed by PIXE: this limitation may strongly compromise the results of a source apportionment study if based on PIXE data alone. In this work, an experimental dataset characterised by an extended chemical speciation (elements, EC–OC, ions) is used to test the effect of reducing input species in the application of one of the most widely used receptor model, namely Positive Matrix Factorization (PMF). The main effect of using only PIXE data is that the secondary nitrate source is not identified and the contribution of biomass burning is overestimated, probably due to the similar seasonal pattern of these two sources.

  16. Grasshoppers as a food source? A review

    Directory of Open Access Journals (Sweden)

    Paul, A.

    2016-01-01

    Full Text Available Description of the subject. Current trends suggest an increasing future demand for conventional meats, which indicates a strong need to shift this dependency to other alternative protein sources such as insects. Literature. From a nutritional point of view, of all the insects consumed globally, grasshoppers are particularly important as a human food. Data from the literature regarding the nutrient composition, amino acid profile, fatty acid profile, mineral composition and vitamin content of grasshoppers as reviewed in this paper, suggest that a number of grasshopper species are a good source of nutrients. It also highlights some of the health related aspects that might arise from the consumption of grasshoppers, mostly linked to agricultural practices and the allergic response of sensitive individuals. The paper also summarizes some religious, social and economic factors that are associated with grasshopper consumption. Conclusions. The success of introducing grasshoppers as a novel food in western countries depends on changes in consumer attitudes. It would be interesting to develop food products derived from grasshoppers in a form acceptable to consumers. Furthermore, it is important to explore the food potential of some grasshopper species native to western countries and to develop their rearing methodologies to enhance availability.

  17. Scale-up of an alkaline protease from Bacillus pumilus MTCC 7514 utilizing fish meal as a sole source of nutrients.

    Science.gov (United States)

    Gupta, Rishikesh Kumar; Prasad, Dinesh; Sathesh, Jaykumar; Naidu, Ramachandra Boopathy; Kamini, Numbi Ramudu; Palanivel, Saravanan; Gowthaman, Marichetti Kuppuswami

    2012-09-01

    Fish meal grades SL1 and SL2 from Sardine (Sardinella longiceps) and NJ from Pink Perch (Nemipterus japonicas) were evaluated as a sole source of carbon and nitrogen in the medium for alkaline protease production by Bacillus pumilus MTCC 7514. The analysis of the fish meal suggests that the carbon and nitrogen contents in fish meal are sufficient to justify its choice as replacement for other nutrients. Protease production increased significantly (4,914 U/ml) in medium containing only fish meal, compared with the basal medium (2,646 U/ml). However, the elimination of inorganic salts from media reduced the protease productivity. In addition, all the three grades of fish meal yielded almost the same amounts of protease when employed as the sole source of carbon and nitrogen. Nevertheless, the best results were observed in fish meal SL1 medium. Furthermore, protease production was enhanced to 6,966 U/ml and 7,047 U/ml on scaling up from flask (4,914 U/ml) to 3.7 and 20 L fermenters, respectively, using fish meal (10 g/l). Similarly, the corresponding improvement in productivities over flask (102.38 U/ml/h) was 193.5 and 195.75 U/ml/h in 3.7 and 20 L fermenters, respectively. The crude protease was found to have dehairing ability in leather processing, which is bound to have great environmental benefits.

  18. An industrial radiation source for food processing

    International Nuclear Information System (INIS)

    Sadat, R.

    1986-01-01

    The scientific linacs realized by CGR MeV in France have been installed in several research centers, the medical accelerators of CGR MeV have been installed in radiotherapy centers all over the world, and the industrial linacs have been used for radiography in heavy industries. Based on the experience for 30 years, CGR MeV has realized a new industrial radiation source for food processing. CARIC is going to install a new machine of CGR MeV, CASSITRON, as the demand for radiation increased. This machine has been devised specially for industrial irradiation purpose. Its main features are security, simplicity and reliability, and it is easy to incorporate it into a production line. The use of CASSITRON for food industry, the ionizing effect on mechanically separated poultry meat, the capital and processing cost and others are explained. Only 10 % of medical disposable supplies is treated by ionizing energy in France. The irradiation for food decontamination, and that for industrial treatment are demanded. Therefore, CARIC is going to increase the capacity by installing a CASSITRON for sterilization. The capital and processing cost are shown. The start of operation is expected in March, 1986. At present, a CASSITRON is being installed in the SPI food processing factory, and starts operation in a few weeks. (Kako, I.)

  19. Chemical and microbiological monitoring of a sole-source aquifer intended for artificial recharge, Nassau County, New York

    Science.gov (United States)

    Katz, Brian G.; Mallard, Gail E.

    1980-01-01

    In late 1980, approximately 4 million gallons per day of highly treated wastewater will be used to recharge the groundwater reservoir in central Nassau County through a system of 10 recharge basins and 5 shallow injection wells. To evaluate the impact of large-scale recharge with reclaimed water on groundwater quality, the U.S. Geological Survey has collected hydrologic and water-quality data from a 1-square-mile area around the recharge site to provide a basis for future comparison. Extensive chemical and microbiological analyses are being made on samples from 48 wells screened in the upper glacial (water-table) aquifer and the upper part of the underlying Magothy (public-supply) aquifer. Preliminary results indicate that water from the upper glacial aquifer contains significant concentrations of nitrate and low-molecular-weight chlorinated hydrocarbons and detectable concentrations of organochlorine insecticides and polychlorinated biphenyls. At present, no fecal contamination is evident in either aquifer in the area studied. In the few samples containing fecal indicator bacteria, the numbers were low. Nonpoint sources provide significant loads of organic and inorganic compounds; major sources include cesspool and septic-tank effluent, cesspool and septic-tank cleaners and other over-the-counter domestic organic solvents, fertilizers, insecticides for termite and other pest control, and stormwater runoff to recharge basins. The water-table aquifer is composed mainly of stratified, well-sorted sand and gravel and, as a result, is highly permeable. In the 1-square-mile area studied, some contaminants seem to have traveled 200 feet downward to the bottom of the water-table aquifer and into the upper part of the public-supply aquifer. (USGS)

  20. Latin American food sources of carotenoids.

    Science.gov (United States)

    Rodriguez-Amaya, D B

    1999-09-01

    Latin America has a wide variety of carotenogenic foods, notable for the diversity and high levels of carotenoids. A part of this natural wealth has been analyzed. Carrot, red palm oil and some cultivars of squash and pumpkin are sources of both beta-carotene and alpha-carotene. beta-carotene is the principal carotenoid of the palm fruits burití, tucumã and bocaiuva, other fruits such as loquat, marolo and West Indian cherry, and sweet potato. Buriti also has high amounts of alpha-carotene and gamma-carotene. beta-Cryptoxanthin is the major carotenoid in caja, nectarine, orange-fleshed papaya, orange, peach, tangerine and the tree tomato. Lycopene predominates in tomato, red-fleshed papaya, guava, pitanga and watermelon. Pitanga also has substantial amounts of beta-cryptoxanthin, gamma-carotene and rubixanthin. Zeaxanthin, principal carotenoid of corn, is also predominant only in piquí. delta-Carotene is the main carotenoid of the peach palm and zeta-carotene of passion fruit. Lutein and beta-carotene, in high concentrations, are encountered in the numerous leafy vegetables of the region, as well as in other green vegetables and in some varieties of squash and pumpkin. Violaxanthin is the principal carotenoid of mango and mamey and is also found in appreciable amounts in green vegetables. Quantitative, in some cases also qualitative, differences exist among cultivars of the same food. Generally, carotenoids are in greater concentrations in the peel than in the pulp, increase considerably during ripening and are in higher levels in foods produced in hot places. Other Latin America indigenous carotenogenic foods must be investigated before they are supplanted by introduced crops, which are often poorer sources of carotenoids.

  1. Supercontinuum light sources for food analysis

    DEFF Research Database (Denmark)

    Møller, Uffe Visbech; Petersen, Christian Rosenberg; Kubat, Irnis

    2014-01-01

    . One track of Light & Food will target the mid-infrared spectral region. To date, the limitations of mid-infraredlight sources, such as thermal emitters, low-power laser diodes, quantum cascade lasers and synchrotron radiation, have precluded mid-IR applications where the spatial coherence, broad...... bandwidth,high brightness and portability of a supercontinuum laser are all required. DTU Fotonik has now demonstrated the first optical fiber based broadband supercontinuum light souce, which covers 1.4-13.3μm and thereby most of the molecular fingerprint region....

  2. Allergenicity assessment strategy for novel food proteins and protein sources

    NARCIS (Netherlands)

    Verhoeckx, Kitty; Broekman, Henrike; Knulst, André; Houben, Geert

    To solve the future food insecurity problem, alternative and sustainable protein sources (e.g. insects, rapeseed, fava bean and algae) are now being explored for the production of food and feed. To approve these novel protein sources for future food a comprehensive risk assessment is needed

  3. Key enzymes enabling the growth of Arthrobacter sp. strain JBH1 with nitroglycerin as the sole source of carbon and nitrogen.

    Science.gov (United States)

    Husserl, Johana; Hughes, Joseph B; Spain, Jim C

    2012-05-01

    Flavoprotein reductases that catalyze the transformation of nitroglycerin (NG) to dinitro- or mononitroglycerols enable bacteria containing such enzymes to use NG as the nitrogen source. The inability to use the resulting mononitroglycerols limits most strains to incomplete denitration of NG. Recently, Arthrobacter strain JBH1 was isolated for the ability to grow on NG as the sole source of carbon and nitrogen, but the enzymes and mechanisms involved were not established. Here, the enzymes that enable the Arthrobacter strain to incorporate NG into a productive pathway were identified. Enzyme assays indicated that the transformation of nitroglycerin to mononitroglycerol is NADPH dependent and that the subsequent transformation of mononitroglycerol is ATP dependent. Cloning and heterologous expression revealed that a flavoprotein catalyzes selective denitration of NG to 1-mononitroglycerol (1-MNG) and that 1-MNG is transformed to 1-nitro-3-phosphoglycerol by a glycerol kinase homolog. Phosphorylation of the nitroester intermediate enables the subsequent denitration of 1-MNG in a productive pathway that supports the growth of the isolate and mineralization of NG.

  4. Production of Extra-Cellular Proteases from Marine Bacillus Sp. Cultured in Media Containing Ammonium Sulfate as the Sole Nitrogen Source

    Directory of Open Access Journals (Sweden)

    Seri Intan, M.

    2005-01-01

    Full Text Available Useful bacterial strains can be used to increase mineralize activity of an aquatic system. These bacteria can specifically degrade targeted compound by producing extra-cellular enzymes. Three species of Bacillus i.e. B. subtilis, B. pumilus and B. licheniformis acquired from shrimp ponds were tested for their ability to utilize ammonia and produce extracellular enzymes. These bacteria were grown in artificial seawater (30 ppt salinity and pH 7.6 supplemented with decreasing yeast extract concentration but increasing ammonium sulfate concentration. All three bacteria grew in artificial seawater containing only 0.01% yeast extract and 1% ammonium sulfate. However, only B. pumilus and B. licheniformis were able to grow in the medium containing only 1% ammonium sulfate as a sole energy source. Bacterialgrowth reduced when alkaline proteases activities was maximum from culture filtrates of all three bacterial cultures during 24 hour culturing in artificial seawater containing 0.01% yeast extract and 1% ammonium sulfate at 30 C when assayed at pH 9. Bacterial growth increased when acid proteases activities was maximum from culture filtrates of all three bacterial cultures during 48 hour culturing in artificial seawater containing 0.01% yeast extract and 1% ammoniumsulfate at 30 C when assayed at pH 5.

  5. Radionuclide and electric accelerator sources for food irradiation

    International Nuclear Information System (INIS)

    Lagunas-Solar, M.C.; Matthews, S.M.

    1985-01-01

    Radiation processing of food requires radiation sources with high intensity, penetrability, reliability, and the flexibility to be adapted to current food processing techniques. Current proposed regulations limit the radiation sources which can be utilized to radionuclides or electrically-driven accelerators. Therefore, the power, throughput, and use efficiency of these sources are important factors affecting the design, installation, operation, and economics of large-scale food-processing facilities. An analysis of the advantages and disadvantages of these sources is presented here, with special attention to the current status of both technologies, and with emphasis on the needs of the food-processing industry. (author)

  6. Dietary Intake Contributions of Food and Beverages by Source and Food Security Status in US Adults.

    Science.gov (United States)

    Spees, Colleen K; Clark, Jill E; Hooker, Neal H; Watowicz, Rosanna P; Taylor, Christopher A

    2017-09-01

    To compare the consumption patterns and diet quality of foods and beverages obtained from various sources by food security status. Cross-sectional analysis of 2011-2012 National Health and Nutrition Examination Survey data. A total of 4,789 adults (aged >19 years) with dietary intake and food security data. The contribution of foods and beverages to energy, nutrients, and diet quality by locations where food was obtained was compared across food security status. Descriptive analysis and logistic regression. Almost all US adults consumed food and beverages obtained from grocery stores, regardless of food security status (about 95%), which accounted for one half to two thirds of total macronutrient intakes. The diet quality of foods from grocery stores was better in highly food-secure adults. Convenience stores are used most by very low food-secure adults; those foods had the poorest diet quality profile. Dietary patterns of marginally food-secure adults more closely resembled sources and intakes of low and very low food-secure adults. Food-insecure adults use food sources differently, resulting in diet quality differences of foods and beverages obtained. Place-based interventions in the food environment may have differential effects by food security status. Copyright © 2017 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  7. A novel pink-pigmented facultative methylotroph, Methylobacterium thiocyanatum sp. nov., capable of growth on thiocyanate or cyanate as sole nitrogen sources.

    Science.gov (United States)

    Wood, A P; Kelly, D P; McDonald, I R; Jordan, S L; Morgan, T D; Khan, S; Murrell, J C; Borodina, E

    1998-02-01

    The isolation and properties of a novel species of pink-pigmented methylotroph, Methylobacterium thiocyanatum, are described. This organism satisfied all the morphological, biochemical, and growth-substrate criteria to be placed in the genus Methylobacterium. Sequencing of the gene encoding its 16S rRNA confirmed its position in this genus, with its closest phylogenetic relatives being M. rhodesianum, M. zatmanii and M. extorquens, from which it differed in its ability to grow on several diagnostic substrates. Methanol-grown organisms contained high activities of hydroxypyruvate reductase -3 micromol NADH oxidized min-1 (mg crude extract protein)-1], showing that the serine pathway was used for methylotrophic growth. M. thiocyanatum was able to use thiocyanate or cyanate as the sole source of nitrogen for growth, and thiocyanate as the sole source of sulfur in the absence of other sulfur compounds. It tolerated high concentrations (at least 50 mM) of thiocyanate or cyanate when these were supplied as nitrogen sources. Growing cultures degraded thiocyanate to produce thiosulfate as a major sulfur end product, apparently with the intermediate formation of volatile sulfur compounds (probably hydrogen sulfide and carbonyl sulfide). Enzymatic hydrolysis of thiocyanate by cell-free extracts was not demonstrated. Cyanate was metabolized by means of a cyanase enzyme that was expressed at approximately sevenfold greater activity during growth on thiocyanate [Vmax 634 +/- 24 nmol NH3 formed min-1 (mg protein)-1] than on cyanate [89 +/- 9 nmol NH3 min-1 (mg protein)-1]. Kinetic study of the cyanase in cell-free extracts showed the enzyme (1) to exhibit high affinity for cyanate (Km 0.07 mM), (2) to require bicarbonate for activity, (3) to be subject to substrate inhibition by cyanate and competitive inhibition by thiocyanate (Ki 0.65 mM), (4) to be unaffected by 1 mM ammonium chloride, (5) to be strongly inhibited by selenocyanate, and (6) to be slightly inhibited by 5 m

  8. Future radiation sources and identification of irradiated foods

    International Nuclear Information System (INIS)

    Brynjolfsson, A.

    1989-01-01

    Two major questions regarding irradiation that are raised today are: (1) Which sources should be used for irradiating food? and (2) How can irradiated foods be identified? This article considers both questions. After briefly mentioning a few of the historical stepping stones in the development of radiation sources, present and future radiation sources are discussed. Next the changes in foods caused by irradiation are considered. These changes are extremely small-so minor in fact that it is difficult to detect if the food has been irradiated. Still, these are several detection methods available, and this article describes them

  9. Community Assessment of Natural Food Sources of Vitamin A ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Community Assessment of Natural Food Sources of Vitamin A: Guidelines for an Ethnographic Protocol. Book cover Community Assessment of Natural Food Sources of Vitamin A: Guidelines for an Ethnographic. Auteur(s) : L. Blum, P.J. Pelto, G.H. Pelto, and H.V. Kuhnlein. Maison(s) d'édition : INFDC, IDRC. 1 janvier 1997.

  10. Community Assessment of Natural Food Sources of Vitamin A ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    1 janv. 1997 ... Community Assessment of Natural Food Sources of Vitamin A : Guidelines for an Ethnographic Protocol. Couverture du livre Community Assessment of Natural Food Sources of Vitamin A : Guidelines for an. Auteur(s):. L. Blum, P.J. Pelto, G.H. Pelto et H.V. Kuhnlein. Maison(s) d'édition: INFDC, CRDI.

  11. Food Sources of Important Nutrients (for Vegetarians)

    Science.gov (United States)

    ... include dairy products, calcium can be obtained from plant-based foods, but the amount of calcium that ... or fat-free milk, yogurt and cheese Fortified plant-based milks such as soy or almond Fortified ...

  12. SoleSound

    DEFF Research Database (Denmark)

    Zanotto, Damiano; Turchet, Luca; Boggs, Emily Marie

    2014-01-01

    This paper introduces the design of SoleSound, a wearable system designed to deliver ecological, audio-tactile, underfoot feedback. The device, which primarily targets clinical applications, uses an audio-tactile footstep synthesis engine informed by the readings of pressure and inertial sensors...... embedded in the footwear to integrate enhanced feedback modalities into the authors' previously developed instrumented footwear. The synthesis models currently implemented in the SoleSound simulate different ground surface interactions. Unlike similar devices, the system presented here is fully portable...

  13. CONSUMER BIOTECHNOLOGY FOOD AND NUTRITION INFORMATION SOURCES: THE TRUST FACTOR

    OpenAIRE

    Ekanem, Enefiok P.; Muhammad, Safdar; Tegegne, Fisseha; Singh, Surendra P.

    2004-01-01

    Although much has been written on consumer attitudes toward genetically modified foods, not much is known about how or where consumers get the information for the decisions they make about genetically modified foods. This paper reports on the media used by consumers in acquiring information about biotech food and nutrition issues, and examines how much trust consumers put in selected information sources. The paper also discusses how socio-economic variables affect level of trust in selected s...

  14. Community Assessment of Natural Food Sources of Vitamin A ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    1997-01-01

    Jan 1, 1997 ... This manual presents a practical step-by-step guide for assessing various aspects of natural food sources of vitamin A within a community and is essential for any research program involved in alleviating vitamin A deficiency.

  15. Allergenicity assessment strategy for novel food proteins and protein sources.

    Science.gov (United States)

    Verhoeckx, Kitty; Broekman, Henrike; Knulst, André; Houben, Geert

    2016-08-01

    To solve the future food insecurity problem, alternative and sustainable protein sources (e.g. insects, rapeseed, fava bean and algae) are now being explored for the production of food and feed. To approve these novel protein sources for future food a comprehensive risk assessment is needed according to the European food legislation. Allergenicity risk assessment might pose some major difficulties, since detailed guidance on how to assess the allergenic potential of novel foods is not available. At present, the approach relies mostly on the guidance of allergenicity assessment for genetically modified (GM) plant foods. The most recent one was proposed by EFSA (2010 and 2011); "weight-of-evidence approach". However this guidance is difficult to interpret, not completely applicable or validated for novel foods and therefore needs some adjustments. In this paper we propose a conceptual strategy which is based on the "weight-of-evidence approach" for food derived from GM plants and other strategies that were previously published in the literature. This strategy will give more guidance on how to assess the allergenicity of novel food proteins and protein sources. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Spatial and Semantic Validation of Secondary Food Source Data

    DEFF Research Database (Denmark)

    Lyseen, Anders Knørr; Hansen, Henning Sten

    2014-01-01

    Governmental and commercial lists of food retailers are often used to measure food environments and foodscapes for health and nutritional research. Information about the validity of such secondary food source data is relevant to understanding the potential and limitations of its application....... This study assesses the validity of two government lists of food retailer locations and types by comparing them to direct field observations, including an assessment of whether pre-classification of the directories can reduce the need for field observation. Lists of food retailers were obtained from......-classification was measured through the calculation of PPV, sensitivity and negative prediction value (NPV). The application of either CVR or Smiley as a measure of the food environment would result in a misrepresentation. The pre-classification based on the food retailer names was found to be a valid method for identifying...

  17. Vitamin B12-Containing Plant Food Sources for Vegetarians

    Science.gov (United States)

    Watanabe, Fumio; Yabuta, Yukinori; Bito, Tomohiro; Teng, Fei

    2014-01-01

    The usual dietary sources of Vitamin B12 are animal-derived foods, although a few plant-based foods contain substantial amounts of Vitamin B12. To prevent Vitamin B12 deficiency in high-risk populations such as vegetarians, it is necessary to identify plant-derived foods that contain high levels of Vitamin B12. A survey of naturally occurring plant-derived food sources with high Vitamin B12 contents suggested that dried purple laver (nori) is the most suitable Vitamin B12 source presently available for vegetarians. Furthermore, dried purple laver also contains high levels of other nutrients that are lacking in vegetarian diets, such as iron and n-3 polyunsaturated fatty acids. Dried purple laver is a natural plant product and it is suitable for most people in various vegetarian groups. PMID:24803097

  18. Vitamin B12-Containing Plant Food Sources for Vegetarians

    Directory of Open Access Journals (Sweden)

    Fumio Watanabe

    2014-05-01

    Full Text Available The usual dietary sources of Vitamin B12 are animal-derived foods, although a few plant-based foods contain substantial amounts of Vitamin B12. To prevent Vitamin B12 deficiency in high-risk populations such as vegetarians, it is necessary to identify plant-derived foods that contain high levels of Vitamin B12. A survey of naturally occurring plant-derived food sources with high Vitamin B12 contents suggested that dried purple laver (nori is the most suitable Vitamin B12 source presently available for vegetarians. Furthermore, dried purple laver also contains high levels of other nutrients that are lacking in vegetarian diets, such as iron and n-3 polyunsaturated fatty acids. Dried purple laver is a natural plant product and it is suitable for most people in various vegetarian groups.

  19. [Research progress on food sources and food web structure of wetlands based on stable isotopes].

    Science.gov (United States)

    Chen, Zhan Yan; Wu, Hai Tao; Wang, Yun Biao; Lyu, Xian Guo

    2017-07-18

    The trophic dynamics of wetland organisms is the basis of assessing wetland structure and function. Stable isotopes of carbon and nitrogen have been widely applied to identify trophic relationships in food source, food composition and food web transport in wetland ecosystem studies. This paper provided an overall review about the current methodology of isotope mixing model and trophic level in wetland ecosystems, and discussed the standards of trophic fractionation and baseline. Moreover, we characterized the typical food sources and isotopic compositions of wetland ecosystems, summarized the food sources in different trophic levels of herbivores, omnivores and carnivores based on stable isotopic analyses. We also discussed the limitations of stable isotopes in tra-cing food sources and in constructing food webs. Based on the current results, development trends and upcoming requirements, future studies should focus on sample treatment, conservation and trophic enrichment measurement in the wetland food web, as well as on combing a variety of methodologies including traditional stomach stuffing, molecular markers, and multiple isotopes.

  20. Microbial source tracking: a tool for identifying sources of microbial contamination in the food chain.

    Science.gov (United States)

    Fu, Ling-Lin; Li, Jian-Rong

    2014-01-01

    The ability to trace fecal indicators and food-borne pathogens to the point of origin has major ramifications for food industry, food regulatory agencies, and public health. Such information would enable food producers and processors to better understand sources of contamination and thereby take corrective actions to prevent transmission. Microbial source tracking (MST), which currently is largely focused on determining sources of fecal contamination in waterways, is also providing the scientific community tools for tracking both fecal bacteria and food-borne pathogens contamination in the food chain. Approaches to MST are commonly classified as library-dependent methods (LDMs) or library-independent methods (LIMs). These tools will have widespread applications, including the use for regulatory compliance, pollution remediation, and risk assessment. These tools will reduce the incidence of illness associated with food and water. Our aim in this review is to highlight the use of molecular MST methods in application to understanding the source and transmission of food-borne pathogens. Moreover, the future directions of MST research are also discussed.

  1. The influence of ethical values and food choice motivations on intentions to purchase sustainably sourced foods.

    Science.gov (United States)

    Dowd, Kylie; Burke, Karena J

    2013-10-01

    This study examined a three-step adaptation of the Theory of Planned Behaviour (TPB) applied to the intention of consumers to purchase sustainably sourced food. The sample consisted of 137 participants, of which 109 were female, who were recruited through a farmers market and an organic produce outlet in an Australian capital city. Participants completed an online questionnaire containing the TPB scales of attitude, subjective norms, perceived behavioural control and intention; measures of positive moral attitude and ethical self identity; and food choice motives. Hierarchical multiple regression was used to examine the predictive utility of the TPB in isolation (step 1) and the TPB expanded to include the constructs of moral attitude and ethical self-identity (step 2). The results indicated the expansion of the TPB to include these constructs added significantly to the predictive model measuring intention to purchase sustainably sourced food. The third step in the adaptation utilised this expanded TPB model and added a measure of retail channel (where consumers reported buying fresh produce) and 9 food choice motives, in order to assess the predictive utility of the inclusion of choice motivations in this context. Of the 8 food choice motives examined, only health and ethical values significantly predicted intention to purchase sustainably sourced food. However, with the addition of food choice motives, ethical self-identity was no longer a significant predictor of intention to purchase sustainably sourced food. Overall the adapted TPB model explained 76% of the variance in intention to purchase sustainably sourced food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Umami taste components and their sources in Asian foods.

    Science.gov (United States)

    Hajeb, P; Jinap, S

    2015-01-01

    Umami, the fifth basic taste, is the inimitable taste of Asian foods. Several traditional and locally prepared foods and condiments of Asia are rich in umami. In this part of world, umami is found in fermented animal-based products such as fermented and dried seafood, and plant-based products from beans and grains, dry and fresh mushrooms, and tea. In Southeast Asia, the most preferred seasonings containing umami are fish and seafood sauces, and also soybean sauces. In the East Asian region, soybean sauces are the main source of umami substance in the routine cooking. In Japan, the material used to obtain umami in dashi, the stock added to almost every Japanese soups and boiled dishes, is konbu or dried bonito. This review introduces foods and seasonings containing naturally high amount of umami substances of both animal and plant sources from different countries in Asia.

  3. Feeding of wheat bran and sugar beet pulp as sole supplements in high-forage diets emphasizes the potential of dairy cattle for human food supply.

    Science.gov (United States)

    Ertl, P; Zebeli, Q; Zollitsch, W; Knaus, W

    2016-02-01

    Besides the widely discussed negative environmental effects of dairy production, such as greenhouse gas emissions, the feeding of large amounts of potentially human-edible feedstuffs to dairy cows is another important sustainability concern. The aim of this study was therefore to investigate the effects of a complete substitution of common cereal grains and pulses with a mixture of wheat bran and sugar beet pulp in a high-forage diet on cow performance, production efficiency, feed intake, and ruminating behavior, as well as on net food production potential. Thirteen multiparous and 7 primiparous mid-lactation Holstein dairy cows were randomly assigned to 1 of 2 treatments in a change-over design with 7-wk periods. Cows were fed a high-forage diet (grass silage and hay accounted for 75% of the dry matter intake), supplemented with either a cereal grain-based concentrate mixture (CON), or a mixture of wheat bran and dried sugar beet pulp (WBBP). Human-edible inputs were calculated for 2 different scenarios based on minimum and maximum potential recovery rates of human-edible energy and protein from the respective feedstuffs. Dietary starch and neutral detergent fiber contents were 3.0 and 44.1% for WBBP, compared with 10.8 and 38.2% in CON, respectively. Dietary treatment did not affect milk production, milk composition, feed intake, or total chewing activity. However, chewing index expressed in minutes per kilogram of neutral detergent fiber ingested was 12% lower in WBBP compared with CON. In comparison to CON, the human-edible feed conversion efficiencies for energy and protein, defined as human-edible output per human-edible input, were 6.8 and 5.3 times higher, respectively, in WBBP under the maximum scenario. For the maximum scenario, the daily net food production (human-edible output minus human-edible input) increased from 5.4 MJ and 250 g of crude protein per cow in CON to 61.5 MJ and 630 g of crude protein in the WBBP diet. In conclusion, our data suggest

  4. Consumption of added sugars among US children and adults by food purchase location and food source.

    Science.gov (United States)

    Drewnowski, Adam; Rehm, Colin D

    2014-09-01

    The proposed changes to the Nutrition Facts Label by the US Food and Drug Administration will include information on added sugars for the first time. The objective was to evaluate the sources of added sugars in the diets of a representative sample of US children and adults by food purchase location and food source (eg, food group). This cross-sectional study among 31,035 children, adolescents, and adults aged ≥6 y from the 2003-2004, 2005-2006, 2007-2008, and 2009-2010 NHANES used data from a 24-h dietary recall to evaluate consumption of added sugars. Food locations of origin were identified as stores (supermarket or grocery store), quick-service restaurants/pizza (QSRs), full-service restaurants (FSRs), schools, and others (eg, vending machines or gifts). Added sugars consumption by food purchase location was evaluated by age, family income-to-poverty ratio, and race-ethnicity. Food group sources of added sugars were identified by using the National Cancer Institute food categories. Added sugars accounted for ∼14.1% of total dietary energy. Between 65% and 76% of added sugars came from stores, 6% and 12% from QSRs, and 4% and 6% from FSRs, depending on age. Older adults (aged ≥51 y) obtained a significantly greater proportion of added sugars from stores than did younger adults. Lower-income adults obtained a significantly greater proportion of added sugars from stores than did higher-income adults. Intake of added sugars did not vary by family income among children/adolescents. Soda and energy and sports drinks were the largest food group sources of added sugars (34.4%), followed by grain desserts (12.7%), fruit drinks (8.0%), candy (6.7%), and dairy desserts (5.6%). Most added sugars came from foods obtained from stores. The proposed changes to the Nutrition Facts Label should capture the bulk of added sugars in the US food supply, which suggests that the recommended changes have the potential to reduce added sugars consumption. © 2014 American Society

  5. The use of acetonitrile as the sole nitrogen and carbon source by Geotrichum sp. JR1 Uso de acetonitrila como única fonte de carbono e nitrogênio por Geotrichum sp. JR1

    Directory of Open Access Journals (Sweden)

    Rachel Passos Rezende

    2004-06-01

    Full Text Available A yeast strain identified as Geotrichum sp. JR1 was able to use acetonitrile as the sole carbon and nitrogen source. The strain grew in 0.5 to 2M acetonitrile. Ammonia generation as enzymatic product during the strain growth indicates the presence of an acetonitrile degrading enzyme. Acetic acid and acetamide were detected during assays with the resting cells cultivated in acetonitrile, indicating the presence of nitrile and amide degrading enzymes. This paper is the first to describe the use of acetonitrile as the sole carbon and nitrogen source by a yeast.Uma linhagem de levedura identificada como Geotrichum sp. JR1 foi capaz de utilizar acetonitrila, em concentrações de 0,5 a 2M, como única fonte de carbono e de nitrogênio. A geração de amônia durante o crescimento do microrganismo indica a presença de sistema enzimático capaz de degradar acetonitrila. Durante os ensaios enzimáticos, com células cultivadas em acetonitrila, foram detectados ácido acético e acetamida como produtos indicando a presença de sistema enzimático capaz de degradar acetonitrila e acetamida. Este trabalho é o primeiro a descrever a utilização de acetonitrila como única fonte de carbono e de nitrogênio por uma levedura.

  6. Tropical crops as a basic source of food

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, J.E.G.

    1979-01-01

    A study is made of the potential that exists for food production in the Latin American tropics, and ways in which this could improve and diversify nutritional patterns in other ecological regions. Crops which could become more important include roots and tubers, varieties of beans, fruits, nuts and vegetables. Tropical crops such as sugar cane and cassava could also be used as renewable sources of energy, to replace conventional non-renewable fuels.

  7. Selenium speciation from food source to metabolites: a critical review

    Energy Technology Data Exchange (ETDEWEB)

    Dumont, Emmie; Vanhaecke, Frank; Cornelis, Rita [Ghent University, Department of Analytical Chemistry, Ghent (Belgium)

    2006-08-15

    Especially in the last decade, a vast number of papers on Se and its role in health issues have been published. This review gives a brief, critical overview of the main analytical findings reported in these papers. Of particular interest is the Se content in different food sources worldwide and the extent to which their consumption is reflected in the Se content of human tissues and body fluids. Several food sources, both natural (Brazil nuts, garlic, Brassica juncea) and Se-enriched (yeast-based supplements), are discussed as to origin, characteristics, Se metabolism and impact of their consumption on the human body. The continuous development of new and improvement of existing analytical techniques has provided different powerful tools to unravel the Se species and their function. An up-to-date literature study on Se speciation analysis is given, illustrating how analytical chemistry in its different facets aids in the identification of Se compounds and provides insight into the complete metabolic pathway of Se throughout the human body. This review includes a detailed image of the current state-of-the-art of Se speciation analysis in these food sources and in human tissues and body fluids. (orig.)

  8. The need for animal source foods by Kenyan children.

    Science.gov (United States)

    Bwibo, Nimrod O; Neumann, Charlotte G

    2003-11-01

    Food intake and dietary patterns in Kenyan households have been studied since the 1920s. Reports on breastfeeding, nutrient intake, micronutrient deficiencies and the impacts of malaria and intestinal parasites on nutritional status are reviewed. Diets are mainly cereal-based, with tubers and a variety of vegetables and fruits when available. White maize, sorghum and millet are high in phytate and fiber, which inhibit the absorption of micronutrients such as zinc and iron. Communities growing cash crops have little land for food crops. Although households may own cattle, goats and poultry, commonly these are not consumed. Adults in nomadic communities consume more meat than nonpastoralists. Lakeside and oceanside communities do not consume adequate amounts of fish. Poor households have a limited capacity to grow and purchase food, therefore they have more nutrient deficiencies. Early weaning to cereal porridge deprives the infant of protein and other nutrients from human milk. Other milk is consumed only in small amounts in sweetened tea. Older children eat adult diets, which are extremely bulky and hard to digest. Anemia is mainly due to iron deficiency, malaria and intestinal parasites. In general, Kenyan children have inadequate intakes of energy, fat and micronutrients such as calcium, zinc, iron, riboflavin and vitamins A and B-12. The multiple micronutrient deficiencies may contribute to early onset of stunting and poor child development, whereas lack of calcium together with vitamin D deficiency are responsible for the resurgence of rickets. There is an urgent need to increase the intake of animal source foods by Kenyan children.

  9. The neighborhood food environment: sources of historical data on retail food stores

    Directory of Open Access Journals (Sweden)

    Gonzalez Alma A

    2006-07-01

    Full Text Available Abstract With the rapidly increasing prevalence of obesity in the United States, and the minimal success of education-based interventions, there is growing interest in understanding the role of the neighborhood food environment in determining dietary behavior. This study, as part of a larger study, identifies historical data on retail food stores, evaluates strengths and limitations of the data for research, and assesses the comparability of historical retail food store data from a government and a commercial source. Five government and commercial listings of retail food stores were identified. The California State Board of Equalization (SBOE database was selected and then compared to telephone business directory listings. The Spearman's correlation coefficient was used to assess the congruency of food store counts per census tract between the SBOE and telephone business directory databases. The setting was four cities in Northern California, 1979–1990. The SBOE and telephone business directory databases listed 127 and 351 retail food stores, respectively. The SBOE listed 36 stores not listed by the telephone business directories, while the telephone business directories listed 260 stores not listed by the SBOE. Spearman's correlation coefficients between estimates of stores per census tract made from the SBOE listings and those made from the telephone business directory listings were approximately 0.5 (p

  10. Green tea as a source of food antioxidants

    DEFF Research Database (Denmark)

    Yin, Jie

    of green tea catechins and green tea extract were investigated in terms of scavenging efficiency of the food-derived free radicals. The relevant experimental methods were based on electrochemical detection of oxygen consumption, electron spin resonance (ESR) spectroscopy, Rancimat test and liposome...... induced by free radicals. Moreover, the combinations of green tea catechins and green tea extract with α-tocopherol were found to exert synergistic antioxidant effects in the heterogeneous systems such as o/w emulsions. Secondly, the ability of green tea catechins to reduce the protein radicals generated...... and proteins. Lipid oxidation as well as the Maillard reactions can affect the quality of foods. An efficient way to retard or inhibit both types of reactions can be achieved by utilizing natural antioxidants, which are normally presumed to be safe when the source is plant material, “Generally Recognized...

  11. Spent yeast as natural source of functional food additives

    Science.gov (United States)

    Rakowska, Rita; Sadowska, Anna; Dybkowska, Ewa; Świderski, Franciszek

    Spent yeasts are by-products arising from beer and wine production which over many years have been chiefly used as feed additives for livestock. They contain many valuable and bioactive substances which has thereby generated much interest in their exploitation. Up till now, the main products obtained from beer-brewing yeasts are β-glucans and yeast extracts. Other like foodstuffs include dried brewer’s yeast, where this is dried and the bitterness removed to be fit for human consumption as well as mannan-oligosaccharides hitherto used in the feed industry. β-glucans constitute the building blocks of yeast cell walls and can thus be used in human nutrition as dietary supplements or serving as food additives in functional foods. β-glucans products obtained via post-fermentation of beer also exhibit a high and multi-faceted biological activity where they improve the blood’s lipid profile, enhance immunological status and have both prebiotic and anti-oxidant properties. Yeast extracts are currently being used more and more to enhance flavour in foodstuffs, particularly for meat and its products. Depending on how autolysis is carried out, it is possible to design extracts of various meat flavours characteristic of specific meats. Many different flavour profiles can be created which may be additionally increased in combination with vegetable extracts. Within the food market, yeast extracts can appear in various guises such as liquids, pastes or powders. They all contain significant amounts of glutamic acid, 5’-GMP and 5’-IMP nucleotides together with various amino acids and peptides that act synergistically for enhancing the flavour of foodstuff products. Recent studies have demonstrated additional benefits of yeast extracts as valuable sources of amino acids and peptides which can be used in functional foods and dietary supplements. These products possess GRAS status (Generally Recognised As Safe) which thereby also adds further as to why they should be used

  12. Printed paper and board food contact materials as a potential source of food contamination.

    Science.gov (United States)

    Van Bossuyt, Melissa; Van Hoeck, Els; Vanhaecke, Tamara; Rogiers, Vera; Mertens, Birgit

    2016-11-01

    Food contact materials (FCM) are estimated to be the largest source of food contamination. Apart from plastics, the most commonly used FCM are made of printed paper and board. Unlike their plastic counterparts, these are not covered by a specific European regulation. Several contamination issues have raised concerns towards potential adverse health effects caused by exposure to substances migrating from printed paper and board FCM. In the current study, an inventory combining the substances which may be used in printed paper and board FCM, was created. More than 6000 unique compounds were identified, the majority (77%) considered non-evaluated in terms of potential toxicity. Based on a preliminary study of their physicochemical properties, it is estimated that most of the non-evaluated single substances have the potential to migrate into the food and become bioavailable after oral intake. Almost all are included in the FACET tool, indicating that their use in primary food packaging has been confirmed by industry. Importantly, 19 substances are also present in one of the lists with substances of concern compiled by the European Chemicals Agency (ECHA). To ensure consumer safety, the actual use of these substances in printed paper and board FCM should be investigated urgently. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. The impact of animal source food products on human nutrition and ...

    African Journals Online (AJOL)

    FBDG

    Associates of the Institute of Food, Nutrition and Well-being, University of ... nutrition), the role of animal source foods as part of a healthy diet requires continuous investment ... Keywords: Animal source foods, livestock products, nutrition, health ..... sensation of fullness that persists after eating until hunger returns (Benelam, ...

  14. Source segregation of food waste in office areas: Factors affecting waste generation rates and quality

    DEFF Research Database (Denmark)

    Edjabou, Vincent Maklawe Essonanawe; Boldrin, Alessio; Scheutz, Charlotte

    2015-01-01

    Existing legislation mandates that the amount of waste being recycled should be increased. Among others, in its Resource Strategy Plan, the Danish Government decided that at least 60% of food waste generated by the service sector, including in office areas, should be source-sorted and collected...... separately by 2018. To assess the achievability of these targets, source-sorted food waste and residual waste from office areas was collected and weighed on a daily basis during 133 working days. Waste composition analyses were conducted every week to investigate the efficiency of the source-sorting campaign...... and the purity of the source-sorted food waste. The moisture content of source-sorted food waste and residual waste fractions, and potential methane production from source-sorted food waste, was also investigated.Food waste generation equated to 23. ±. 5. kg/employee/year, of which 20. ±. 5. kg...

  15. Food sources for the mangrove tree crab aratus pisonii: a carbon isotopic study

    International Nuclear Information System (INIS)

    Lacerda, L.D.; Silva, C.A.R.; Rezende, C.E.; Martinelli, L.A.

    1991-01-01

    Muscle tissues from the mangrove tree crab Aratus pisonii was analysed for carbon isotopic composition, in order to trace its major food sources. Potential food sources: mangrove leaves epi phytic green algae, mangrove sediments and open water and mangrove suspended matter; were also analysed. The results show that A. pisonii is basically omnivorous, with major food sources from marine origin. However, mangrove carbon can contribute with 16% to 42% in the crab's diet. (author)

  16. Is the Inclusion of Animal Source Foods in Fortified Blended Foods Justified?

    Directory of Open Access Journals (Sweden)

    Kristen E. Noriega

    2014-09-01

    Full Text Available Fortified blended foods (FBF are used for the prevention and treatment of moderate acute malnutrition (MAM in nutritionally vulnerable individuals, particularly children. A recent review of FBF recommended the addition of animal source food (ASF in the form of whey protein concentrate (WPC, especially to corn-soy blends. The justification for this recommendation includes the potential of ASF to increase length, weight, muscle mass accretion and recovery from wasting, as well as to improve protein quality and provide essential growth factors. Evidence was collected from the following four different types of studies: (1 epidemiological; (2 ASF versus no intervention or a low-calorie control; (3 ASF versus an isocaloric non-ASF; and (4 ASF versus an isocaloric, isonitrogenous non-ASF. Epidemiological studies consistently associated improved growth outcomes with ASF consumption; however, little evidence from isocaloric and isocaloric, isonitrogenous interventions was found to support the inclusion of meat or milk in FBF. Evidence suggests that whey may benefit muscle mass accretion, but not linear growth. Overall, little evidence supports the costly addition of WPC to FBFs. Further, randomized isocaloric, isonitrogenous ASF interventions with nutritionally vulnerable children are needed.

  17. A new approach to the modification of cell membrane glycosphingolipids: Ganglioside composition of JTC-12 P3 cells altered by feeding with galactose as a sole carbohydrate source in protein- and lipid-free synthetic medium

    International Nuclear Information System (INIS)

    Kawaguchi, Tatsuya; Takaoka, Toshiko; Yoshida, Eiko; Iwamori, Masao; Nagai, Yoshitaka; Takatsuki, Kiyoshi

    1988-01-01

    A significant difference in the glycosphingolipid composition of JTC-12 P3 cells established from monkey kidney tissue was observed when cells cultured in a protein- and lipid-free synthetic medium containing glucose (DM-160) as a sole carbohydrate source were transferred and cultured in the same medium containing galactose and pyruvic acid (DM-170) in place of glucose. In particular, the amounts of gangliosides GM3, GM2, and GD3 in the cells cultured in DM-170 were 5.3-, 17.8-, and more than 8-fold those in the cells cultured in DM-160, respectively, indicating that anabolism of gangliosides is greatly enhanced in cells cultured in the presence of galactose and pyruvic acid, as compared with cells cultured in the presence of glucose. In fact, after cultivation of cells in the medium with N-acetyl-D-[ 14 C]mannosamine for 96 h, the radioactivity incorporated into the gangliosides of the cells in DM-170 was 10-fold that of the cells in DM-160. Among the gangliosides of the cells in DM-170, highly sialylated molecules such as GD3, GD1a, GD1b, and GT1b were preferentially labeled, indicating that the sialytransferases responsible for the synthesis of gangliosides are significantly more activated in cells cultured in DM-170 than in DM-160. These observations reveal that the glycosphingolipid composition of the plasma membrane can be modified epigenetically under well-defined conditions and provide important clues for clarifying the roles of glycosphingolipids associated with particular cell functions

  18. Fiber Based Mid Infrared Supercontinuum Source for Spectroscopic Analysis in Food Production

    DEFF Research Database (Denmark)

    Ramsay, Jacob; Dupont, Sune Vestergaard Lund; Keiding, Søren Rud

    Optimization of sustainable food production is a worldwide challenge that is undergoing continuous development as new technologies emerge. Applying solutions for food analysis with novel bright and broad mid-infrared (MIR) light sources has the potential to meet the increasing demands for food...

  19. The Role of External Sources of Information in Children's Evaluative Food Categories

    Science.gov (United States)

    Nguyen, Simone P.

    2012-01-01

    Evaluative food categories are value-laden assessments, which reflect the healthfulness and palatability of foods (e.g. healthy/unhealthy, yummy/yucky). In a series of three studies, this research examines how 3- to 4-year-old children (N?=?147) form evaluative food categories based on input from external sources of information. The results…

  20. Drosophila learn efficient paths to a food source.

    Science.gov (United States)

    Navawongse, Rapeechai; Choudhury, Deepak; Raczkowska, Marlena; Stewart, James Charles; Lim, Terrence; Rahman, Mashiur; Toh, Alicia Guek Geok; Wang, Zhiping; Claridge-Chang, Adam

    2016-05-01

    Elucidating the genetic, and neuronal bases for learned behavior is a central problem in neuroscience. A leading system for neurogenetic discovery is the vinegar fly Drosophila melanogaster; fly memory research has identified genes and circuits that mediate aversive and appetitive learning. However, methods to study adaptive food-seeking behavior in this animal have lagged decades behind rodent feeding analysis, largely due to the challenges presented by their small scale. There is currently no method to dynamically control flies' access to food. In rodents, protocols that use dynamic food delivery are a central element of experimental paradigms that date back to the influential work of Skinner. This method is still commonly used in the analysis of learning, memory, addiction, feeding, and many other subjects in experimental psychology. The difficulty of microscale food delivery means this is not a technique used in fly behavior. In the present manuscript we describe a microfluidic chip integrated with machine vision and automation to dynamically control defined liquid food presentations and sensory stimuli. Strikingly, repeated presentations of food at a fixed location produced improvements in path efficiency during food approach. This shows that improved path choice is a learned behavior. Active control of food availability using this microfluidic system is a valuable addition to the methods currently available for the analysis of learned feeding behavior in flies. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Molecular identification and food source inference of constructive ...

    African Journals Online (AJOL)

    Ophiocordyceps sinensis is a precious and effectual Traditional Chinese Medicine, native to Tibetan Plateau. Its development originated from parasitization of Hirsutella sinensis to Hepialus larvae, which was deemed to be of great importance including feeding food habit. Hereby in the present, study on food resource ...

  2. Sodium intakes of US children and adults from foods and beverages by location of origin and by specific food source.

    Science.gov (United States)

    Drewnowski, Adam; Rehm, Colin D

    2013-05-28

    Sodium intakes, from foods and beverages, of 22,852 persons in the National Health and Nutrition Examination Surveys (NHANES 2003-2008) were examined by specific food source and by food location of origin. Analyses were based on a single 24-h recall. Separate analyses were conducted for children (6-11 years of age), adolescents (12-19), and adults (20-50 and ≥51 years). Grouping of like foods (e.g., food sources) used a scheme proposed by the National Cancer Institute, which divides foods/beverages into 96 food subgroups (e.g., pizza, yeast breads or cold cuts). Food locations of origin were stores (e.g., grocery, convenience and specialty stores), quick-service restaurant/pizza (QSR), full-service restaurant (FSR), school, or other. Food locations of sodium were also evaluated by race/ethnicity amongst adults. Stores provided between 58.1% and 65.2% of dietary sodium, whereas QSR and FSR together provided between 18.9% and 31.8% depending on age. The proportion of sodium from QSR varied from 10.1% to 19.9%, whereas that from FSR varied from 3.4% to 13.3%. School meals provided 10.4% of sodium for 6-11 year olds and 6.0% for 12-19 year olds. Pizza from QSR, the top away from home food item, provided 5.4% of sodium in adolescents. QSR pizza, chicken, burgers and Mexican dishes combined provided 7.8% of total sodium in adult diets. Most sodium came from foods purchased in stores. Food manufacturers, restaurants, and grocery stores all have a role to play in reducing the amount of sodium in the American diet.

  3. Algae as nutritional and functional food sources: revisiting our understanding.

    Science.gov (United States)

    Wells, Mark L; Potin, Philippe; Craigie, James S; Raven, John A; Merchant, Sabeeha S; Helliwell, Katherine E; Smith, Alison G; Camire, Mary Ellen; Brawley, Susan H

    2017-01-01

    Global demand for macroalgal and microalgal foods is growing, and algae are increasingly being consumed for functional benefits beyond the traditional considerations of nutrition and health. There is substantial evidence for the health benefits of algal-derived food products, but there remain considerable challenges in quantifying these benefits, as well as possible adverse effects. First, there is a limited understanding of nutritional composition across algal species, geographical regions, and seasons, all of which can substantially affect their dietary value. The second issue is quantifying which fractions of algal foods are bioavailable to humans, and which factors influence how food constituents are released, ranging from food preparation through genetic differentiation in the gut microbiome. Third is understanding how algal nutritional and functional constituents interact in human metabolism. Superimposed considerations are the effects of harvesting, storage, and food processing techniques that can dramatically influence the potential nutritive value of algal-derived foods. We highlight this rapidly advancing area of algal science with a particular focus on the key research required to assess better the health benefits of an alga or algal product. There are rich opportunities for phycologists in this emerging field, requiring exciting new experimental and collaborative approaches.

  4. Essential Oils: Sources of Antimicrobials and Food Preservatives

    Science.gov (United States)

    Pandey, Abhay K.; Kumar, Pradeep; Singh, Pooja; Tripathi, Nijendra N.; Bajpai, Vivek K.

    2017-01-01

    Aromatic and medicinal plants produce essential oils in the form of secondary metabolites. These essential oils can be used in diverse applications in food, perfume, and cosmetic industries. The use of essential oils as antimicrobials and food preservative agents is of concern because of several reported side effects of synthetic oils. Essential oils have the potential to be used as a food preservative for cereals, grains, pulses, fruits, and vegetables. In this review, we briefly describe the results in relevant literature and summarize the uses of essential oils with special emphasis on their antibacterial, bactericidal, antifungal, fungicidal, and food preservative properties. Essential oils have pronounced antimicrobial and food preservative properties because they consist of a variety of active constituents (e.g., terpenes, terpenoids, carotenoids, coumarins, curcumins) that have great significance in the food industry. Thus, the various properties of essential oils offer the possibility of using natural, safe, eco-friendly, cost-effective, renewable, and easily biodegradable antimicrobials for food commodity preservation in the near future. PMID:28138324

  5. Applications of lead isotope rations for identification and apportionment on pollution sources in food

    International Nuclear Information System (INIS)

    Zhao Duoyong; Wei Yimin; Guo Boli; Wei Shuai

    2011-01-01

    Lead is one of the toxic heavy metals which can accumulate to an adverse effect level in human bodies through ingestion, inhalation or other pathways. Because of the persistent lead contamination in farmland environment, large risk exists in the primary stage of 'from farm to table' chain. Environmental media such as soils, atmospheric aerosols were the possible lead sources of agro-food. To pinpoint the pollution sources exactly, cut off the contamination pathways in time, and reduce the risk of hazard, pollution sources tracing was very important. Lead isotope ratio combined with certain models is an effective method to discriminate correctly pollution sources and calculate the individual source contributions. In this review, to provide theoretical and technical reference for controlling lead pollution in environment and food, lead pollution sources in food, tracing principle and methods of lead isotope ratios, and its applications on vegetable, tea, wine, cereal and other food products were concerned. (authors)

  6. Algae as nutritional and functional food sources: revisiting our understanding

    OpenAIRE

    Wells, Mark L.; Potin, Philippe; Craigie, James S.; Raven, John A.; Merchant, Sabeeha S.; Helliwell, Katherine E.; Smith, Alison G.; Camire, Mary Ellen; Brawley, Susan H.

    2016-01-01

    Global demand for macroalgal and microalgal foods is growing, and algae are increasingly being consumed for functional benefits beyond the traditional considerations of nutrition and health. There is substantial evidence for the health benefits of algal-derived food products, but there remain considerable challenges in quantifying these benefits, as well as possible adverse effects. First, there is a limited understanding of nutritional composition across algal species, geographical regions, ...

  7. Effects of animal source food and micronutrient fortification in complementary food products on body composition, iron status, and linear growth

    DEFF Research Database (Denmark)

    Skau, Jutta Kloppenborg Heick; Touch, Bunthang; Chhoun, Chamnan

    2015-01-01

    Background: Poor nutritional quality of complementary foods often limits growth. Animal source foods, such as milk or meat, are often unaffordable. Local affordable alternatives are needed. Objective: We evaluate the efficacy of 2 newly developed, rice-based complementary food products: WinFood (WF......) with small fish and edible spiders and WinFood-Lite (WF-L) fortified with small fish, against 2 existing fortified corn-soy blend products, CSB+ (purely plant based) and CSB++ (8% dried skimmed milk). Design: In total, 419 infants aged 6 mo were enrolled in this randomized, single-blinded study for 9 mo...... increase in knee-heel length in WF-L compared with CSB+ was not significant. Conclusions: No difference was found between the locally produced products (WF and WF-L) and the CSBs. Micronutrient fortification may be necessary, and small fish may be an affordable alternative to milk to improve complementary...

  8. FOOD SOURCES AND CARBON BUDGET OF CHINESE PRAWN PENAEUS CHINENSIS

    Institute of Scientific and Technical Information of China (English)

    董双林; 张硕; 王芳

    2002-01-01

    This study deals with contribution of artificial food pellet and natural food to Chinese prawn (Penaeus orientalis) growth in a semiintensive culture pond. The prawn carbon consumption, budget, and the effects of some factors on the budget were investigated. The results showed that 26.2% of P. orientalis growth carbon came from formulated feed at the initial culture stage (when the prawns were 0.06±0.01 g in wet weight), and was 62.5% when the prawns were 9.56±1.04 g. The remaining part of the growth carbon was derived from organic fertilizer and natural food. The highest growth rate occurred at 20×10-3 salinity. Suitable salinity for culturing Chinese prawn was (20-28)×10-3.

  9. The neighborhood food environment: sources of historical data on retail food stores

    OpenAIRE

    Gonzalez Alma A; Wang May C; Ritchie Lorrene D; Winkleby Marilyn A

    2006-01-01

    Abstract With the rapidly increasing prevalence of obesity in the United States, and the minimal success of education-based interventions, there is growing interest in understanding the role of the neighborhood food environment in determining dietary behavior. This study, as part of a larger study, identifies historical data on retail food stores, evaluates strengths and limitations of the data for research, and assesses the comparability of historical retail food store data from a government...

  10. Recontamination as a source of pathogens in processed foods

    NARCIS (Netherlands)

    Reij, M.W.; Asselt-den Aantrekker, van E.D.

    2004-01-01

    Food products that have been submitted to an adequate heat-treatment during processing are free of vegetative pathogens and, depending on the treatments, of sporeformers and are generally regarded as safe. Processed products such as pate, ice cream, infant formulae and others have nevertheless been

  11. Sea salts as a potential source of food spoilage fungi.

    Science.gov (United States)

    Biango-Daniels, Megan N; Hodge, Kathie T

    2018-02-01

    Production of sea salt begins with evaporation of sea water in shallow pools called salterns, and ends with the harvest and packing of salts. This process provides many opportunities for fungal contamination. This study aimed to determine whether finished salts contain viable fungi that have the potential to cause spoilage when sea salt is used as a food ingredient by isolating fungi on a medium that simulated salted food with a lowered water activity (0.95 a w ). The viable filamentous fungi from seven commercial salts were quantified and identified by DNA sequencing, and the fungal communities in different salts were compared. Every sea salt tested contained viable fungi, in concentrations ranging from 0.07 to 1.71 colony-forming units per gram of salt. In total, 85 fungi were isolated representing seven genera. One or more species of the most abundant genera, Aspergillus, Cladosporium, and Penicillium was found in every salt. Many species found in this study have been previously isolated from low water activity environments, including salterns and foods. We conclude that sea salts contain many fungi that have potential to cause food spoilage as well as some that may be mycotoxigenic. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. 76 FR 80873 - Food Source Attribution; Public Meeting

    Science.gov (United States)

    2011-12-27

    ... outline or summary of an oral presentation, contact: Juanita Yates, FDA, Center for Food Safety and Applied Nutrition, telephone: (240) 402-1731, email: [email protected] . To request special... the meeting, contact Dr. David Goldman, Assistant Administrator, Office of Public Health Science, USDA...

  13. Indigenous African foods plants: vehicles of disease or sources of ...

    African Journals Online (AJOL)

    This study determines the mycological quality of traditional leafy vegetables, commonly referred to as morogo, and investigates the folate content of such crops, as well as the antimutagenic and anticarcinogenic potential of indigenous rooibos tea and other traditional food and medicinal plants. Results showed that a ...

  14. Coprophilous Streptomycetes and Fungi - Food Sources for Enchytraeid Worms (Enchytraeidae)

    Czech Academy of Sciences Publication Activity Database

    Krištůfek, Václav; Nováková, Alena; Pižl, Václav

    2001-01-01

    Roč. 46, č. 6 (2001), s. 555-558 ISSN 0015-5632 R&D Projects: GA AV ČR IAA6066001 Institutional research plan: CEZ:AV0Z6066911 Keywords : food selection * vermicomposting * Eisenia and rei Subject RIV: EH - Ecology, Behaviour Impact factor: 0.776, year: 2001

  15. Sources of Funds for Nigerian Companies: Experience of the food ...

    African Journals Online (AJOL)

    This paper analyzes some of the experiences of operators in the Food and Beverage Industry in Nigeria. It examines the evolution of capital structure and discusses the implications for corporate performance of the observed mode of financing. LBS Management Review Vol.5(1) 2000: 33-47 ...

  16. A REVIEW ON ACRYLAMIDE IN FOODS: SOURCES AND ...

    African Journals Online (AJOL)

    JONATHAN

    The acrolein pathway and enzymatic decarboxylation of asparagine, as well as ... suggested that both molecular mobility and sugar reactivity would determine the ... It decomposes non-thermally to form ammonia, and thermal decomposition produces ..... Evaluation of Acrylamide in Food from China by a LC/MS/MS Method.

  17. Functional food awareness and perceptions in relation to information sources in older adults.

    Science.gov (United States)

    Vella, Meagan N; Stratton, Laura M; Sheeshka, Judy; Duncan, Alison M

    2014-05-17

    The functional food industry has experienced innovative and economic expansion, yet research into consumer perceptions of functional foods and their associated health claims is limited. Among consumers, older adults could benefit from functional foods due to age-related issues pertaining to food and health. The purpose of this research was to identify the need for information related to functional foods among older adults (≥60 years old) and to assess awareness and perceptions of health claims on functional food packages. Community-dwelling older adults (n = 200) completed a researcher administered questionnaire designed to collect information about functional foods including current consumption, motivating factors for consumption, perceived need for information, sources of information for functional foods and awareness of health claims. Prevalence of functional food consumption among participants was 93.0%. Increased awareness and knowledge was the most commonly reported factor that would promote functional food consumption (85.5%) and 63.5% of participants wanted more information about functional foods with preferred sources being newspapers/magazines/books (68.5%) and food labels (66.1%). Participants were predominately (93.5%) aware of health claims on functional foods and those with more education were more likely to report being aware of health claims (p = 0.045). Although functional food consumption among older adults in this sample is high, there is a need for further information regarding functional foods. These results inform stakeholders regarding the potential for information to influence functional food acceptance among older adult consumers.

  18. Functional food awareness and perceptions in relation to information sources in older adults

    Science.gov (United States)

    2014-01-01

    Background The functional food industry has experienced innovative and economic expansion, yet research into consumer perceptions of functional foods and their associated health claims is limited. Among consumers, older adults could benefit from functional foods due to age-related issues pertaining to food and health. The purpose of this research was to identify the need for information related to functional foods among older adults (≥60 years old) and to assess awareness and perceptions of health claims on functional food packages. Methods Community-dwelling older adults (n = 200) completed a researcher administered questionnaire designed to collect information about functional foods including current consumption, motivating factors for consumption, perceived need for information, sources of information for functional foods and awareness of health claims. Results Prevalence of functional food consumption among participants was 93.0%. Increased awareness and knowledge was the most commonly reported factor that would promote functional food consumption (85.5%) and 63.5% of participants wanted more information about functional foods with preferred sources being newspapers/magazines/books (68.5%) and food labels (66.1%). Participants were predominately (93.5%) aware of health claims on functional foods and those with more education were more likely to report being aware of health claims (p = 0.045). Conclusions Although functional food consumption among older adults in this sample is high, there is a need for further information regarding functional foods. These results inform stakeholders regarding the potential for information to influence functional food acceptance among older adult consumers. PMID:24886306

  19. Enteroaggregative Escherichia coli is the predominant diarrheagenic E. coli pathotype among irrigation water and food sources in South Africa.

    Science.gov (United States)

    Aijuka, Matthew; Santiago, Araceli E; Girón, Jorge A; Nataro, James P; Buys, Elna M

    2018-08-02

    Diarrheagenic E. coli (DEC) has been implicated in foodborne outbreaks worldwide and have been associated with childhood stunting in the absence of diarrhoea. Infection is extraordinarily common, but the routes of transmission have not been determined. Therefore, determining the most prevalent pathotypes in food and environmental sources may help provide better guidance to various stakeholders in ensuring food safety and public health and advancing understanding of the epidemiology of enteric disease. We characterized 205 E. coli strains previously isolated from producer distributor bulk milk (PDBM)(118), irrigation water (48), irrigated lettuce (29) and street vendor coleslaw (10) in South Africa. Enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC) and diffusely adherent E. coli (DAEC) were sought. We used PCR and partial gene sequencing for all 205 strains while 46 out of 205 that showed poor resolution were subsequently characterized using cell adherence (HeLa cells). PCR and partial gene sequencing of aatA and/or aaiC genes confirmed EAEC (2%, 5 out of 205) as the only pathotype. Phylogenetic analysis of sequenced EAEC strains with E. coli strains in GenBank showing ≥80% nucleotide sequence similarity based on possession of aaiC and aatA generated distinct clusters of strains separated predominantly based on their source of isolation (food source or human stool) suggesting a potential role of virulence genes in source tracking. EAEC 24%, 11 out of 46 strains (PDBM = 15%, irrigation water = 7%, irrigated lettuce = 2%) was similarly the predominant pathotype followed by strains showing invasiveness to HeLa cells, 4%, 2 out of 46 (PDBM = 2%, irrigated lettuce = 2%), among stains characterized using cell adherence. Therefore, EAEC may be the leading cause of DEC associated food and water-borne enteric infection in South Africa. Additionally, solely using molecular based methods targeting virulence

  20. Consumption of added sugars among US children and adults by food purchase location and food source123

    Science.gov (United States)

    Drewnowski, Adam; Rehm, Colin D

    2014-01-01

    Background: The proposed changes to the Nutrition Facts Label by the US Food and Drug Administration will include information on added sugars for the first time. Objective: The objective was to evaluate the sources of added sugars in the diets of a representative sample of US children and adults by food purchase location and food source (eg, food group). Design: This cross-sectional study among 31,035 children, adolescents, and adults aged ≥6 y from the 2003–2004, 2005–2006, 2007–2008, and 2009–2010 NHANES used data from a 24-h dietary recall to evaluate consumption of added sugars. Food locations of origin were identified as stores (supermarket or grocery store), quick-service restaurants/pizza (QSRs), full-service restaurants (FSRs), schools, and others (eg, vending machines or gifts). Added sugars consumption by food purchase location was evaluated by age, family income-to-poverty ratio, and race-ethnicity. Food group sources of added sugars were identified by using the National Cancer Institute food categories. Results: Added sugars accounted for ∼14.1% of total dietary energy. Between 65% and 76% of added sugars came from stores, 6% and 12% from QSRs, and 4% and 6% from FSRs, depending on age. Older adults (aged ≥51 y) obtained a significantly greater proportion of added sugars from stores than did younger adults. Lower-income adults obtained a significantly greater proportion of added sugars from stores than did higher-income adults. Intake of added sugars did not vary by family income among children/adolescents. Soda and energy and sports drinks were the largest food group sources of added sugars (34.4%), followed by grain desserts (12.7%), fruit drinks (8.0%), candy (6.7%), and dairy desserts (5.6%). Conclusions: Most added sugars came from foods obtained from stores. The proposed changes to the Nutrition Facts Label should capture the bulk of added sugars in the US food supply, which suggests that the recommended changes have the potential to

  1. Drosophila learn efficient paths to a food source

    OpenAIRE

    Stewart, James; Lim, Terrence; Claridge-Chang, Adam; Wang, Zhiping; Toh, Alicia; Rahman, Mashiur; Navawongse, Rapeechai; Raczkowska, Marlena; Choudhury, Deepak

    2016-01-01

    Elucidating the genetic, and neuronal bases for learned behavior is a central problem in neuroscience. A leading system for neurogenetic discovery is the vinegar fly Drosophila melanogaster; fly memory research has identified genes and circuits that mediate aversive and appetitive learning. However, methods to study adaptive food-seeking behavior in this animal have lagged decades behind rodent feeding analysis, largely due to the challenges presented by their small scale. There is currently ...

  2. Non-terrestrial food source for Fiordland brachiopods

    International Nuclear Information System (INIS)

    Lyon, G.L.; Richardson, Joyce

    1983-05-01

    Carbon-13 analyses were determined for brachiopods and particulate organic matter from Fiordland waters. Brachiopod delta 13 $ 0 C are about -18 per mille which is significantly enriched in 13 C relative to the particulate matter (about -23 per mille) and different from local terrestrial matter (about -28 per mille). There is no carbon-13 evidence for non-marine food in the diet of brachiopods

  3. The impact of animal source food products on human nutrition and ...

    African Journals Online (AJOL)

    The impact of animal source food products on human nutrition and health. ... the widest array of complex scientific, economic, environmental and political issues. ... investment in research and extrapolation of information towards appropriate ...

  4. Performance of Helicoverpa armigera (Hübner (Lepidoptera: Noctuidae larvae in different food sources

    Directory of Open Access Journals (Sweden)

    Crislaine Sartori Suzana

    2015-12-01

    Full Text Available Recently observed in Brazil, Helicoverpa armigera became a relevant pest due to its rapid spread and the economic importance of crops in which it has established, such as soybean and maize. Understanding its establishment process in different regions and production systems, as well as the population dynamics of a polyphagous pest, as the basis for its management, depends on the knowledge of the effect of plant species as food sources on the pest biology. A laboratory experiment was conducted, supplying the caterpillars with reproductive organs of soybean, maize, canola, black oat, oat, turnip and ryegrass. It was concluded that the different food sources affect the larval development of H. armigera. Maize and wheat ears and canola siliques are the best food sources for the development of H. armigera. Ryegrass ears, on the other hand, are the worst ones. Black oat and oat panicles and turnip siliques are less suitable than soybean pods as food sources for the caterpillars.

  5. Potential sources for the radiation treatment of food

    International Nuclear Information System (INIS)

    Sande, W.E.; Libby, R.A.

    1976-01-01

    The present, near-term, and potential (through year 2000) supply of radiation sources for large-scale radiosterilization applications is discussed. Principal sources considered are 60 Co produced in nuclear power reactors, 137 Cs presently available from ERDA encapsulation operations, and a mixture of 134 Cs- 137 Cs potentially available from the reprocessing of spent nuclear fuel. Some consideration is also given to electron accelerators

  6. Attributing human foodborne illness to food sources and water in Latin America and the Caribbean using data from outbreak investigations

    DEFF Research Database (Denmark)

    Pires, Sara Monteiro; Vieira, Antonio; Perez, Enrique

    2012-01-01

    &C). Foods implicated in outbreaks were classified by their ingredients as simple foods (i.e. belonging to one single food category), or complex foods (i.e. belonging to multiple food categories). For each agent, the data from simple-food outbreaks were summarized, and the proportion of outbreaks caused...... by each category was used to define the probability that an outbreak was caused by a source. For the calculation of the number of outbreaks attributed to each source, simple-food outbreaks were attributed to the single food category in question, and complex-food outbreaks were partitioned to each category......Foodborne pathogens are responsible for an increasing burden of disease worldwide. Knowledge on the contribution of different food sources and water for disease is essential to prioritize food safety interventions and implement appropriate control measures. Source attribution using outbreak data...

  7. Imprecision in waggle dances of the honeybee (Apis mellifera) for nearby food sources : error or adaptation?

    OpenAIRE

    Weidenmüller, Anja; Seeley, Thomas

    1999-01-01

    A curious feature of the honeybee's waggle dance is the imprecision in the direction indication for nearby food sources. One hypothesis for the function of this imprecision is that it serves to spread recruits over a certain area and thus is an adaptation to the typical spatial configuration of the bees' food sources, i.e., flowers in sizable patches. We report an experiment that tests this tuned-error hypothesis. We measured the precision of direction indication in waggle dances advertising ...

  8. Community Assessment of Natural Food Sources of Vitamin A ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ce manuel constitue un guide pratique qui aide à évaluer, étape par étape, divers aspects des sources alimentaires naturelles de vitamine A dans une collectivité. C'est un document essentiel pour tout programme de recherche qui cherche à lutter contre la carence en vitamine A.

  9. Characteristics of Prepared Food Sources in Low-Income Neighborhoods of Baltimore City

    OpenAIRE

    LEE, SEUNG HEE; ROWAN, MEGAN T.; POWELL, LISA M.; NEWMAN, SARA; KLASSEN, ANN CARROLL; FRICK, KEVIN D.; ANDERSON, JENNIFER; GITTELSOHN, JOEL

    2010-01-01

    The food environment is associated with obesity risk and diet-related chronic diseases. Despite extensive research conducted on retail food stores, little is known about prepared food sources (PFSs). We conducted an observational assessment of all PFSs (N = 92) in low-income neighborhoods in Baltimore. The most common PFSs were carry-outs, which had the lowest availability of healthy food choices. Only a small proportion of these carry-outs offered healthy sides, whole wheat bread, or entrée ...

  10. Nanoparticle Technology for Biorefining of Non-Food Source Feedstocks

    Energy Technology Data Exchange (ETDEWEB)

    Pruski, Marek; Trewyn, Brian G.; Lee, Young-Jin; Lin, Victor S.-Y.

    2013-01-22

    The goal of this proposed work is to develop and optimize the synthesis of mesoporous nanoparticle materials that are able to selectively sequester fatty acids from hexane extracts from algae, and to catalyze their transformation, as well as waste oils, into biodiesel. The project involves studies of the interactions between the functionalized MSN surface and the sequestering molecules. We investigate the mechanisms of selective extraction of fatty acids and conversion of triglycerides and fatty acids into biodiesel by the produced nanoparticles. This knowledge is used to further improve the properties of the mesoporous nanoparticle materials for both tasks. Furthermore, we investigate the strategies for scaling the synthesis of the catalytic nanomaterials up from the current pilot plant scale to industrial level, such that the biodiesel obtained with this technology can successfully compete with food crop-based biodiesel and petroleum diesel.

  11. Food sources of carbohydrates in a European cohort of adults

    DEFF Research Database (Denmark)

    Wirfält, E.; McTaggart, A.; Pala, V.

    2002-01-01

    . RESULTS: The 10 food groups contributing most carbohydrate were bread; fruit; milk and milk products; sweet buns, cakes and pies; potato; sugar and jam; pasta and rice; vegetables and legumes; crispbread; and fruit and vegetable juices. Consumption of fruits as well as vegetables and legumes was higher...... in southern compared with northern centres, while soft drinks consumption was higher in the north. Italian centres had high pasta and rice consumption, but breakfast cereal, potato, and sweet buns, cakes and pies were higher in northern centres. In Sweden, lower bread consumption was balanced with a higher...... consumption of crispbread, and with sweet buns, cakes and pies. Overall, men consumed higher amounts of vegetables and legumes, bread, soft drinks, potatoes, pasta and rice, breakfast cereal and sugar and jam than women, but fruit consumption appeared more frequent in women. CONCLUSION: The study supports...

  12. Nanoparticle Technology for Biorefinery of Non-Food Source Feedstocks

    Energy Technology Data Exchange (ETDEWEB)

    Pruski, Marek [Ames Lab., Ames, IA (United States); Trewyn, Brian [Ames Lab., Ames, IA (United States); Lee, Young-Jin [Ames Lab., Ames, IA (United States); Lin, Victor S.-Y. [Ames Lab., Ames, IA (United States)

    2013-01-22

    The goal of this proposed work is to develop and optimize the synthesis of mesoporous nanoparticle materials that are able to selectively sequester fatty acids from hexane extracts from algae, and to catalyze their transformation, as well as waste oils, into biodiesel. The project involves studies of the interactions between the functionalized MSN surface and the sequestering molecules. We investigate the mechanisms of selective extraction of fatty acids and conversion of triglycerides and fatty acids into biodiesel by the produced nanoparticles. This knowledge is used to further improve the properties of the mesoporous nanoparticle materials for both tasks. Furthermore, we investigate the strategies for scaling the synthesis of the catalytic nanomaterials up from the current pilot plant scale to industrial level, such that the biodiesel obtained with this technology can successfully compete with food crop-based biodiesel and petroleum diesel.

  13. Microalgae, a Potential Natural Functional Food Source – a Review

    Directory of Open Access Journals (Sweden)

    Villarruel-López Angélica

    2017-12-01

    Full Text Available Microalgae are a group of microorganisms used in aquaculture. The number of studies regarding their use as a functional food has recently increased due to their nutritional and bioactive compounds such as polysaccharides, fatty acids, bioactive peptides, and pigments. Specific microalgal glucans (polysaccharides can activate the immune system or exert antioxidant and hypocholesterolemic effects. The importance of algal lipids is based on their polyunsaturated fatty acids, their anti-inflammatory effects, their modulation of lipid pathways, and their neuroprotective action. Microalgae peptides can bind or inhibit specific receptors in cardiovascular diseases and cancer, while carotenoids can act as potent antioxidants. The beneficial biological activity will depend on the specific microalga and its chemical constituents. Therefore, knowledge of the composition of microalgae would aid in identifying, selecting, and studying their functional effects.

  14. Using Social Media to Identify Sources of Healthy Food in Urban Neighborhoods.

    Science.gov (United States)

    Gomez-Lopez, Iris N; Clarke, Philippa; Hill, Alex B; Romero, Daniel M; Goodspeed, Robert; Berrocal, Veronica J; Vinod Vydiswaran, V G; Veinot, Tiffany C

    2017-06-01

    An established body of research has used secondary data sources (such as proprietary business databases) to demonstrate the importance of the neighborhood food environment for multiple health outcomes. However, documenting food availability using secondary sources in low-income urban neighborhoods can be particularly challenging since small businesses play a crucial role in food availability. These small businesses are typically underrepresented in national databases, which rely on secondary sources to develop data for marketing purposes. Using social media and other crowdsourced data to account for these smaller businesses holds promise, but the quality of these data remains unknown. This paper compares the quality of full-line grocery store information from Yelp, a crowdsourced content service, to a "ground truth" data set (Detroit Food Map) and a commercially-available dataset (Reference USA) for the greater Detroit area. Results suggest that Yelp is more accurate than Reference USA in identifying healthy food stores in urban areas. Researchers investigating the relationship between the nutrition environment and health may consider Yelp as a reliable and valid source for identifying sources of healthy food in urban environments.

  15. Companion Animals as a Source of Viruses for Human Beings and Food Production Animals.

    Science.gov (United States)

    Reperant, L A; Brown, I H; Haenen, O L; de Jong, M D; Osterhaus, A D M E; Papa, A; Rimstad, E; Valarcher, J-F; Kuiken, T

    2016-07-01

    Companion animals comprise a wide variety of species, including dogs, cats, horses, ferrets, guinea pigs, reptiles, birds and ornamental fish, as well as food production animal species, such as domestic pigs, kept as companion animals. Despite their prominent place in human society, little is known about the role of companion animals as sources of viruses for people and food production animals. Therefore, we reviewed the literature for accounts of infections of companion animals by zoonotic viruses and viruses of food production animals, and prioritized these viruses in terms of human health and economic importance. In total, 138 virus species reportedly capable of infecting companion animals were of concern for human and food production animal health: 59 of these viruses were infectious for human beings, 135 were infectious for food production mammals and birds, and 22 were infectious for food production fishes. Viruses of highest concern for human health included hantaviruses, Tahyna virus, rabies virus, West Nile virus, tick-borne encephalitis virus, Crimean-Congo haemorrhagic fever virus, Aichi virus, European bat lyssavirus, hepatitis E virus, cowpox virus, G5 rotavirus, influenza A virus and lymphocytic choriomeningitis virus. Viruses of highest concern for food production mammals and birds included bluetongue virus, African swine fever virus, foot-and-mouth disease virus, lumpy skin disease virus, Rift Valley fever virus, porcine circovirus, classical swine fever virus, equine herpesvirus 9, peste des petits ruminants virus and equine infectious anaemia virus. Viruses of highest concern for food production fishes included cyprinid herpesvirus 3 (koi herpesvirus), viral haemorrhagic septicaemia virus and infectious pancreatic necrosis virus. Of particular concern as sources of zoonotic or food production animal viruses were domestic carnivores, rodents and food production animals kept as companion animals. The current list of viruses provides an objective

  16. Food Sources of Energy and Nutrients among Adults in the US: NHANES 2003–2006

    Directory of Open Access Journals (Sweden)

    Theresa A. Nicklas

    2012-12-01

    Full Text Available Identification of current food sources of energy and nutrients among US adults is needed to help with public health efforts to implement feasible and appropriate dietary recommendations. To determine the food sources of energy and 26 nutrients consumed by US adults the 2003–2006 National Health and Nutrition Examination Survey (NHANES 24-h recall (Day 1 dietary intake data from a nationally representative sample of adults 19+ years of age (y (n = 9490 were analyzed. An updated USDA Dietary Source Nutrient Database was developed for NHANES 2003–2006 using current food composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from food sources were sample-weighted. Percentages of total dietary intake contributed from food sources were ranked. The highest ranked sources of energy and nutrients among adults more than 19 years old were: energy — yeast bread/rolls (7.2% and cake/cookies/quick bread/pastry/pie (7.2%; protein—poultry (14.4% and beef (14.0%; total fat — other fats and oils (9.8%; saturated fatty acids — cheese (16.5% and beef (9.1%; carbohydrate — soft drinks/soda (11.4% and yeast breads/rolls (10.9%; dietary fiber — yeast breads/rolls (10.9% and fruit (10.2%; calcium — milk (22.5% and cheese (21.6%; vitamin D — milk (45.1% and fish/shellfish (14.4%; and potassium — milk (9.6% and coffee/tea/other non-alcoholic beverages (8.4%. Knowledge of primary food sources of energy and nutrients can help health professionals design effective strategies to reduce excess energy consumed by US adults and increase the nutrient adequacy of their diets.

  17. Food Sources of Energy and Nutrients among Adults in the US: NHANES 2003–2006

    Science.gov (United States)

    O’Neil, Carol E.; Keast, Debra R.; Fulgoni, Victor L.; Nicklas, Theresa A.

    2012-01-01

    Identification of current food sources of energy and nutrients among US adults is needed to help with public health efforts to implement feasible and appropriate dietary recommendations. To determine the food sources of energy and 26 nutrients consumed by US adults the 2003–2006 National Health and Nutrition Examination Survey (NHANES) 24-h recall (Day 1) dietary intake data from a nationally representative sample of adults 19+ years of age (y) (n = 9490) were analyzed. An updated USDA Dietary Source Nutrient Database was developed for NHANES 2003–2006 using current food composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from food sources were sample-weighted. Percentages of total dietary intake contributed from food sources were ranked. The highest ranked sources of energy and nutrients among adults more than 19 years old were: energy—yeast bread/rolls (7.2%) and cake/cookies/quick bread/pastry/pie (7.2%); protein—poultry (14.4%) and beef (14.0%); total fat—other fats and oils (9.8%); saturated fatty acids—cheese (16.5%) and beef (9.1%); carbohydrate—soft drinks/soda (11.4%) and yeast breads/rolls (10.9%); dietary fiber—yeast breads/rolls (10.9%) and fruit (10.2%); calcium—milk (22.5%) and cheese (21.6%); vitamin D—milk (45.1%) and fish/shellfish (14.4%); and potassium—milk (9.6%) and coffee/tea/other non-alcoholic beverages (8.4%). Knowledge of primary food sources of energy and nutrients can help health professionals design effective strategies to reduce excess energy consumed by US adults and increase the nutrient adequacy of their diets. PMID:23363999

  18. Food sources of energy and nutrients among adults in the US: NHANES 2003–2006.

    Science.gov (United States)

    O'Neil, Carol E; Keast, Debra R; Fulgoni, Victor L; Nicklas, Theresa A

    2012-12-19

    Identification of current food sources of energy and nutrients among US adults is needed to help with public health efforts to implement feasible and appropriate dietary recommendations. To determine the food sources of energy and 26 nutrients consumed by US adults the 2003-2006 National Health and Nutrition Examination Survey (NHANES) 24-h recall (Day 1) dietary intake data from a nationally representative sample of adults 19+ years of age (y) (n = 9490) were analyzed. An updated USDA Dietary Source Nutrient Database was developed for NHANES 2003-2006 using current food composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from food sources were sample-weighted. Percentages of total dietary intake contributed from food sources were ranked. The highest ranked sources of energy and nutrients among adults more than 19 years old were: energy - yeast bread/rolls (7.2%) and cake/cookies/quick bread/pastry/pie (7.2%); protein-poultry (14.4%) and beef (14.0%); total fat - other fats and oils (9.8%); saturated fatty acids - cheese (16.5%) and beef (9.1%); carbohydrate - soft drinks/soda (11.4%) and yeast breads/rolls (10.9%); dietary fiber - yeast breads/rolls (10.9%) and fruit (10.2%); calcium - milk (22.5%) and cheese (21.6%); vitamin D - milk (45.1%) and fish/shellfish (14.4%); and potassium - milk (9.6%) and coffee/tea/other non-alcoholic beverages (8.4%). Knowledge of primary food sources of energy and nutrients can help health professionals design effective strategies to reduce excess energy consumed by US adults and increase the nutrient adequacy of their diets.

  19. "Closing the Loop": Overcoming barriers to locally sourcing food in Fort Collins, Colorado

    Science.gov (United States)

    DeMets, C. M.

    2012-12-01

    Environmental sustainability has become a focal point for many communities in recent years, and restaurants are seeking creative ways to become more sustainable. As many chefs realize, sourcing food locally is an important step towards sustainability and towards building a healthy, resilient community. Review of literature on sustainability in restaurants and the local food movement revealed that chefs face many barriers to sourcing their food locally, but that there are also many solutions for overcoming these barriers that chefs are in the early stages of exploring. Therefore, the purpose of this research is to identify barriers to local sourcing and investigate how some restaurants are working to overcome those barriers in the city of Fort Collins, Colorado. To do this, interviews were conducted with four subjects who guide purchasing decisions for restaurants in Fort Collins. Two of these restaurants have created successful solutions and are able to source most of their food locally. The other two are interested in and working towards sourcing locally but have not yet been able to overcome barriers, and therefore only source a few local items. Findings show that there are four barriers and nine solutions commonly identified by each of the subjects. The research found differences between those who source most of their food locally and those who have not made as much progress in local sourcing. Based on these results, two solution flowcharts were created, one for primary barriers and one for secondary barriers, for restaurants to assess where they are in the local food chain and how they can more successfully source food locally. As there are few explicit connections between this research question and climate change, it is important to consider the implicit connections that motivate and justify this research. The question of whether or not greenhouse gas emissions are lower for locally sourced food is a topic of much debate, and while there are major developments

  20. Online Chemical Characterization of Food-Cooking Organic Aerosols: Implications for Source Apportionment.

    Science.gov (United States)

    Reyes-Villegas, Ernesto; Bannan, Thomas; Le Breton, Michael; Mehra, Archit; Priestley, Michael; Percival, Carl; Coe, Hugh; Allan, James D

    2018-04-11

    Food-cooking organic aerosols (COA) are one of the primary sources of submicron particulate matter in urban environments. However, there are still many questions surrounding source apportionment related to instrumentation as well as semivolatile partitioning because COA evolve rapidly in the ambient air, making source apportionment more complex. Online measurements of emissions from cooking different types of food were performed in a laboratory to characterize particles and gases. Aerosol mass spectrometer (AMS) measurements showed that the relative ionization efficiency for OA was higher (1.56-3.06) relative to a typical value of 1.4, concluding that AMS is over-estimating COA and suggesting that previous studies likely over-estimated COA concentrations. Food-cooking mass spectra were generated using AMS, and gas and particle food markers were identified with filter inlets for gases and aerosols-chemical ionization mass spectrometer (CIMS) measurements to be used in future food cooking-source apportionment studies. However, there is a considerable variability in both gas and particle markers, and dilution plays an important role in the particle mass budget, showing the importance of using these markers with caution during receptor modeling. These findings can be used to better understand the chemical composition of COA, and they provides useful information to be used in future source-apportionment studies.

  1. Terminalia catappa Linn seeds as a new food source

    Directory of Open Access Journals (Sweden)

    Monthana Weerawatanakorn

    2015-10-01

    Full Text Available To evaluate their potential use as a new dietary source, the seeds of Terminalia catappa Linn were analyzed for their nutritional and antinutritional properties, and to determine the effect of roasting. The TC seeds contained high levels of protein, oil and essential minerals. The 2 most limiting amino acids were Tryptophan and Lysine. Oleic acid (C18:1 and linoleic acid (C18:2 are the main fatty acids which were determined at 32.4 and 30.3%, respectively. The ratio of saturated: monounsaturated: polyunsaturated fatty acid was close to what is recommended in the dietary guidelines of the American Heart Association. Contents of phenolic compounds and phytates (IP4 + IP5 + IP6 in raw seeds were 64.9 g of GAE/g and 2,110 mg/100g, which are comparable to the values in edible nuts. Trypsin inhibitor activity was 2.3 trypsin inhibitor units/mg. After roasting at 180°C for 4 min, both phenolic compounds and trypsin activity were reduced, while IP6 phytate degraded into IP4 and IP5 forms

  2. Anaerobic co-digestion of source segregated brown water (feces-without-urine) and food waste: For Singapore context

    International Nuclear Information System (INIS)

    Rajagopal, Rajinikanth; Lim, Jun Wei; Mao, Yu; Chen, Chia-Lung; Wang, Jing-Yuan

    2013-01-01

    The objective of this study was to evaluate the feasibility of anaerobic co-digestion of brown water (BW) [feces-without-urine] and food waste (FW) in decentralized, source-separation-based sanitation concept. An effort has been made to separate the yellow water (urine) and brown water from the source (using no-mix toilet) primarily to facilitate further treatment, resource recovery and utilization. Batch assay analytical results indicated that anaerobic co-digestion [BW + FW] showed higher methane yield (0.54–0.59 L CH 4 /gVS added ) than BW or FW as a sole substrate. Anaerobic co-digestion was performed in the semi-continuously fed laboratory scale reactors viz. two-phase continuous stirred-tank reactor (CSTR) and single-stage sequencing-batch operational mode reactor (SeqBR). Initial 120 d of operation shows that SeqBR performed better in terms of organic matter removal and maximum methane production. At steady-state, CODs, CODt, VS removals of 92.0 ± 3.0, 76.7 ± 5.1 and 75.7 ± 6.6% were achieved for SeqBR at 16 d HRT, respectively. This corresponds to an OLR of 2–3 gCOD/L d and methane yield of about 0.41 L CH 4 /gVS added . Good buffering capacity did not lead to accumulation of VFA, showing better process stability of SeqBR at higher loading rates. The positive findings show the great potential of applying anaerobic co-digestion of BW + FW for energy production and waste management. In addition, daily flush water consumption is reduced up to 80%. Decentralized, source-separation-based sanitation concept is expected to provide a practical solution for those countries experiencing rapid urbanization and water shortage issues, for instance Singapore. - Highlights: ► Source separation of organic waste/wastewater streams on household level was done. ► Brown water (BW) was collected from a specially designed no-mix toilet. ► BW and food waste codigestion proved as a potential substrate for biogas production. ► A distinct improvement in methane yield

  3. Anaerobic co-digestion of source segregated brown water (feces-without-urine) and food waste: For Singapore context

    Energy Technology Data Exchange (ETDEWEB)

    Rajagopal, Rajinikanth, E-mail: rrajinime@yahoo.co.in [Residues and Resource Reclamation Centre, Nanyang Environment and Water Research Institute, Nanyang Technological University, 06-08 CleanTech One, 1 Cleantech Loop, 637141 Singapore (Singapore); Lim, Jun Wei [Residues and Resource Reclamation Centre, Nanyang Environment and Water Research Institute, Nanyang Technological University, 06-08 CleanTech One, 1 Cleantech Loop, 637141 Singapore (Singapore); Mao, Yu [Residues and Resource Reclamation Centre, Nanyang Environment and Water Research Institute, Nanyang Technological University, 06-08 CleanTech One, 1 Cleantech Loop, 637141 Singapore (Singapore); School of Energy and Environmental Sciences, Yunnan Normal University, 121 Street, Kunming 650092 China (China); Chen, Chia-Lung [Residues and Resource Reclamation Centre, Nanyang Environment and Water Research Institute, Nanyang Technological University, 06-08 CleanTech One, 1 Cleantech Loop, 637141 Singapore (Singapore); Wang, Jing-Yuan [Residues and Resource Reclamation Centre, Nanyang Environment and Water Research Institute, Nanyang Technological University, 06-08 CleanTech One, 1 Cleantech Loop, 637141 Singapore (Singapore); School of Civil and Environmental Engineering, Nanyang Technological University, 50 Nanyang Avenue, 639798 Singapore (Singapore)

    2013-01-15

    The objective of this study was to evaluate the feasibility of anaerobic co-digestion of brown water (BW) [feces-without-urine] and food waste (FW) in decentralized, source-separation-based sanitation concept. An effort has been made to separate the yellow water (urine) and brown water from the source (using no-mix toilet) primarily to facilitate further treatment, resource recovery and utilization. Batch assay analytical results indicated that anaerobic co-digestion [BW + FW] showed higher methane yield (0.54–0.59 L CH{sub 4}/gVS{sub added}) than BW or FW as a sole substrate. Anaerobic co-digestion was performed in the semi-continuously fed laboratory scale reactors viz. two-phase continuous stirred-tank reactor (CSTR) and single-stage sequencing-batch operational mode reactor (SeqBR). Initial 120 d of operation shows that SeqBR performed better in terms of organic matter removal and maximum methane production. At steady-state, CODs, CODt, VS removals of 92.0 ± 3.0, 76.7 ± 5.1 and 75.7 ± 6.6% were achieved for SeqBR at 16 d HRT, respectively. This corresponds to an OLR of 2–3 gCOD/L d and methane yield of about 0.41 L CH{sub 4}/gVS{sub added}. Good buffering capacity did not lead to accumulation of VFA, showing better process stability of SeqBR at higher loading rates. The positive findings show the great potential of applying anaerobic co-digestion of BW + FW for energy production and waste management. In addition, daily flush water consumption is reduced up to 80%. Decentralized, source-separation-based sanitation concept is expected to provide a practical solution for those countries experiencing rapid urbanization and water shortage issues, for instance Singapore. - Highlights: ► Source separation of organic waste/wastewater streams on household level was done. ► Brown water (BW) was collected from a specially designed no-mix toilet. ► BW and food waste codigestion proved as a potential substrate for biogas production. ► A distinct improvement

  4. Food allergens in mattress dust in Norwegian homes - a potentially important source of allergen exposure.

    Science.gov (United States)

    Bertelsen, R J; Faeste, C K; Granum, B; Egaas, E; London, S J; Carlsen, K-H; Lødrup Carlsen, K C; Løvik, M

    2014-01-01

    Sensitization to food allergens and food allergic reactions are mostly caused by ingesting the allergen, but can also occur from exposure via the respiratory tract or the skin. Little is known about exposure to food allergens in the home environment. The objective of this study was firstly to describe the frequency of detection of allergens from fish, egg, milk, and peanut in mattress dust collected from homes of 13-year-old adolescents and secondly to identify home characteristics associated with the presence of food allergen contamination in dust. Food allergens were measured by dot blot analysis in mattress dust from 143 homes in Oslo, Norway. We analysed associations between home characteristics (collected by parental questionnaires and study technicians) and food allergens by multivariate regression models. Fish allergen was detected in 46%, peanut in 41%, milk in 39%, and egg allergen in 22% of the mattress dust samples; only three samples contained none of these allergens. All four food allergens were more frequently detected in mattresses in small dwellings (Food allergens occurred frequently in beds in Norwegian homes, with dwelling size and proximity of kitchen and bedroom as the most important determinants. Due to the amount of time children spent in the bedroom, mattress dust may be an important source of exposure to food allergens. © 2013 John Wiley & Sons Ltd.

  5. SOLE: enhanced FIA data analysis capabilities

    Science.gov (United States)

    Michael Spinney; Paul Van Deusen

    2009-01-01

    The Southern On Line Estimator (SOLE), is an Internet-based annual forest inventory and analysis (FIA) data analysis tool developed cooperatively by the National Council for Air and Stream Improvement and the Forest Service, U.S. Department of Agriculture's Forest Inventory and Analysis program at the Southern Research Station. Recent development of SOLE has...

  6. Characteristics of prepared food sources in low-income neighborhoods of Baltimore City.

    Science.gov (United States)

    Lee, Seung Hee; Rowan, Megan T; Powell, Lisa M; Newman, Sara; Klassen, Ann Carroll; Frick, Kevin D; Anderson, Jennifer; Gittelsohn, Joel

    2010-01-01

    The food environment is associated with obesity risk and diet-related chronic diseases. Despite extensive research conducted on retail food stores, little is known about prepared food sources(PFSs). We conducted an observational assessment of all PFSs(N = 92) in low-income neighborhoods in Baltimore. The most common PFSs were carry-outs, which had the lowest availability of healthy food choices. Only a small proportion of these carry-outs offered healthy sides, whole wheat bread, or entrée salads (21.4%, 7.1%, and 33.9%, respectively). These findings suggest that carry-out-specific interventions are necessary to increase healthy food availability in low-income urban neighborhoods.

  7. A Bayesian approach to quantify the contribution of animal-food sources to human salmonellosis

    DEFF Research Database (Denmark)

    Hald, Tine; Vose, D.; Wegener, Henrik Caspar

    2004-01-01

    Based on the data from the integrated Danish Salmonella surveillance in 1999, we developed a mathematical model for quantifying the contribution of each of the major animal-food sources to human salmonellosis. The model was set up to calculate the number of domestic and sporadic cases caused...... salmonellosis was also included. The joint posterior distribution was estimated by fitting the model to the reported number of domestic and sporadic cases per Salmonella type in a Bayesian framework using Markov Chain Monte Carlo simulation. The number of domestic and sporadic cases was obtained by subtracting.......8-10.4%) of the cases, respectively. Taken together, imported foods were estimated to account for 11.8% (95% CI: 5.0-19.0%) of the cases. Other food sources considered had only a minor impact, whereas 25% of the cases could not be associated with any source. This approach of quantifying the contribution of the various...

  8. Nutrient patterns and their food sources in an International Study Setting: report from the EPIC study.

    Science.gov (United States)

    Moskal, Aurelie; Pisa, Pedro T; Ferrari, Pietro; Byrnes, Graham; Freisling, Heinz; Boutron-Ruault, Marie-Christine; Cadeau, Claire; Nailler, Laura; Wendt, Andrea; Kühn, Tilman; Boeing, Heiner; Buijsse, Brian; Tjønneland, Anne; Halkjær, Jytte; Dahm, Christina C; Chiuve, Stephanie E; Quirós, Jose R; Buckland, Genevieve; Molina-Montes, Esther; Amiano, Pilar; Huerta Castaño, José M; Gurrea, Aurelio Barricarte; Khaw, Kay-Tee; Lentjes, Marleen A; Key, Timothy J; Romaguera, Dora; Vergnaud, Anne-Claire; Trichopoulou, Antonia; Bamia, Christina; Orfanos, Philippos; Palli, Domenico; Pala, Valeria; Tumino, Rosario; Sacerdote, Carlotta; de Magistris, Maria Santucci; Bueno-de-Mesquita, H Bas; Ocké, Marga C; Beulens, Joline W J; Ericson, Ulrika; Drake, Isabel; Nilsson, Lena M; Winkvist, Anna; Weiderpass, Elisabete; Hjartåker, Anette; Riboli, Elio; Slimani, Nadia

    2014-01-01

    Compared to food patterns, nutrient patterns have been rarely used particularly at international level. We studied, in the context of a multi-center study with heterogeneous data, the methodological challenges regarding pattern analyses. We identified nutrient patterns from food frequency questionnaires (FFQ) in the European Prospective Investigation into Cancer and Nutrition (EPIC) Study and used 24-hour dietary recall (24-HDR) data to validate and describe the nutrient patterns and their related food sources. Associations between lifestyle factors and the nutrient patterns were also examined. Principal component analysis (PCA) was applied on 23 nutrients derived from country-specific FFQ combining data from all EPIC centers (N = 477,312). Harmonized 24-HDRs available for a representative sample of the EPIC populations (N = 34,436) provided accurate mean group estimates of nutrients and foods by quintiles of pattern scores, presented graphically. An overall PCA combining all data captured a good proportion of the variance explained in each EPIC center. Four nutrient patterns were identified explaining 67% of the total variance: Principle component (PC) 1 was characterized by a high contribution of nutrients from plant food sources and a low contribution of nutrients from animal food sources; PC2 by a high contribution of micro-nutrients and proteins; PC3 was characterized by polyunsaturated fatty acids and vitamin D; PC4 was characterized by calcium, proteins, riboflavin, and phosphorus. The nutrients with high loadings on a particular pattern as derived from country-specific FFQ also showed high deviations in their mean EPIC intakes by quintiles of pattern scores when estimated from 24-HDR. Center and energy intake explained most of the variability in pattern scores. The use of 24-HDR enabled internal validation and facilitated the interpretation of the nutrient patterns derived from FFQs in term of food sources. These outcomes open research opportunities and

  9. Nutrient patterns and their food sources in an International Study Setting: report from the EPIC study.

    Directory of Open Access Journals (Sweden)

    Aurelie Moskal

    Full Text Available Compared to food patterns, nutrient patterns have been rarely used particularly at international level. We studied, in the context of a multi-center study with heterogeneous data, the methodological challenges regarding pattern analyses.We identified nutrient patterns from food frequency questionnaires (FFQ in the European Prospective Investigation into Cancer and Nutrition (EPIC Study and used 24-hour dietary recall (24-HDR data to validate and describe the nutrient patterns and their related food sources. Associations between lifestyle factors and the nutrient patterns were also examined. Principal component analysis (PCA was applied on 23 nutrients derived from country-specific FFQ combining data from all EPIC centers (N = 477,312. Harmonized 24-HDRs available for a representative sample of the EPIC populations (N = 34,436 provided accurate mean group estimates of nutrients and foods by quintiles of pattern scores, presented graphically. An overall PCA combining all data captured a good proportion of the variance explained in each EPIC center. Four nutrient patterns were identified explaining 67% of the total variance: Principle component (PC 1 was characterized by a high contribution of nutrients from plant food sources and a low contribution of nutrients from animal food sources; PC2 by a high contribution of micro-nutrients and proteins; PC3 was characterized by polyunsaturated fatty acids and vitamin D; PC4 was characterized by calcium, proteins, riboflavin, and phosphorus. The nutrients with high loadings on a particular pattern as derived from country-specific FFQ also showed high deviations in their mean EPIC intakes by quintiles of pattern scores when estimated from 24-HDR. Center and energy intake explained most of the variability in pattern scores.The use of 24-HDR enabled internal validation and facilitated the interpretation of the nutrient patterns derived from FFQs in term of food sources. These outcomes open research

  10. The Remote Food Photography Method Accurately Estimates Dry Powdered Foods-The Source of Calories for Many Infants.

    Science.gov (United States)

    Duhé, Abby F; Gilmore, L Anne; Burton, Jeffrey H; Martin, Corby K; Redman, Leanne M

    2016-07-01

    Infant formula is a major source of nutrition for infants, with more than half of all infants in the United States consuming infant formula exclusively or in combination with breast milk. The energy in infant powdered formula is derived from the powder and not the water, making it necessary to develop methods that can accurately estimate the amount of powder used before reconstitution. Our aim was to assess the use of the Remote Food Photography Method to accurately estimate the weight of infant powdered formula before reconstitution among the standard serving sizes. For each serving size (1 scoop, 2 scoops, 3 scoops, and 4 scoops), a set of seven test bottles and photographs were prepared as follow: recommended gram weight of powdered formula of the respective serving size by the manufacturer; three bottles and photographs containing 15%, 10%, and 5% less powdered formula than recommended; and three bottles and photographs containing 5%, 10%, and 15% more powdered formula than recommended (n=28). Ratio estimates of the test photographs as compared to standard photographs were obtained using standard Remote Food Photography Method analysis procedures. The ratio estimates and the US Department of Agriculture data tables were used to generate food and nutrient information to provide the Remote Food Photography Method estimates. Equivalence testing using the two one-sided t tests approach was used to determine equivalence between the actual gram weights and the Remote Food Photography Method estimated weights for all samples, within each serving size, and within underprepared and overprepared bottles. For all bottles, the gram weights estimated by the Remote Food Photography Method were within 5% equivalence bounds with a slight underestimation of 0.05 g (90% CI -0.49 to 0.40; P<0.001) and mean percent error ranging between 0.32% and 1.58% among the four serving sizes. The maximum observed mean error was an overestimation of 1.58% of powdered formula by the Remote

  11. Allisonella histaminiformans gen. nov., sp. nov. A novel bacterium that produces histamine, utilizes histidine as its sole energy source, and could play a role in bovine and equine laminitis.

    Science.gov (United States)

    Garner, Matthew R; Flint, Joseph F; Russell, James B

    2002-12-01

    When cattle and horses are fed large amounts of grain, histamine can accumulate in the gastrointestinal tract, and this accumulation can cause an acute inflammation of the hooves (laminitis). When ruminal fluid from dairy cattle fed grain supplements was serially diluted in anaerobic MRS medium containing histidine (50 mM), histamine was detected at dilutions as high as 10(-7). The histidine enrichments were then transferred successively in an anaerobic, carbonate-based medium (50 mM histidine) without glucose. The histamine producing bacteria could not be isolated from the rumens of cattle fed hay; however, histamine producing bacteria could be isolated the feces of cattle fed grain and the cecum of a horse. All of the histamine producing isolates had the same ovoid morphology. The cells stained Gram-negative and were resistant to the ionophore, monensin (25 microM). The doubling time was 110 min, and the yield was 1.5 mg cell protein per mmol histidine. The G+C content was 46.8%. Lysine was the only other amino acid used, but lysine did not allow growth if histidine was absent. Because carbohydrate and organic acid utilization was not detected, it appeared that the isolates used histidine decarboxylation as their sole mechanism of energy derivation. 16s rRNA gene sequencing indicated that the isolates were most closely related to low G+C Gram-positive bacteria (firmicutes), but similarities were < or = 94%. Because the most closely related bacteria (Dialister pneumonsintes, Megasphaera elsdenii and Selenomonas ruminantium) did not produce histamine from histidine, we propose that these histamine producing bacteria be assigned to a new genus, Allisonella, as Allisonella histaminiformans gen. nov., sp. nov. The type strain is MR2 (ATCC BAA610, DSM 15230).

  12. The Importance of Animal Source Foods for Nutrient Sufficiency in the Developing World: The Zambia Scenario.

    Science.gov (United States)

    Zhang, Zhiying; Goldsmith, Peter D; Winter-Nelson, Alex

    2016-05-05

    There have been successful interventions fortifying staple foods to mobilize micronutrients as well as agricultural efforts to raise yields of staple foods to increase food availability. Zambia serves as an interesting case study because since 1961 there has been a notable decline in the availability of animal source foods (ASFs) and pulses and a significant increase in the supply of cassava and vegetable oils. The shift in food availability was partly attributed to the agricultural success in high-yielding and drought-resistant varieties that made cassava and oil crops more affordable and readily available. In this research, we explore another policy strategy that involves ASF as a mechanism to help remedy micronutrient inadequacies in a population. A scenario modeling analysis compares the changes in the nutrient profile of the Zambian diet through adding either staple plant source foods (PSFs) or ASFs. The scenarios under study involve the addition of (1) 18 fl oz of whole cow's milk; (2) 60 g of beef, 30 g of chicken, and 5 g of beef liver; (3) milk plus meat; or (4) 83 g of maize flour, 123 g of cassava, and other staple PSF, that is, isocaloric to the "milk + meat" group. The findings alert program planners and policy makers to the value of increasing the availability, accessibility, and utilization of ASF to simultaneously address multiple nutrient deficiencies, as well as the nutrition challenges that remain when expanding the availability of plant-based staples. © The Author(s) 2016.

  13. Energy and Macronutrient Intakes and Food Sources in Preschool Children: Thai NHES IV.

    Science.gov (United States)

    Satheannoppakao, Warapone; Kasemsup, Rachada; Nontarak, Jiraluck; Kessomboon, Pattapong; Putwatana, Panwadee; Taneepanichskul, Surasak; Sangthong, Rassamee; Chariyalertsak, Suwat; Aekplakorn, Wichai

    2015-10-01

    Examine intakes of energy and macronutrients, and identify their food sources, in Thai preschool children. Data from the Thai National Health Examination Survey (NHES) IV were used. Mothers/caregivers were interviewed regarding their children's 24-hour-dietary intake. Dietary data were analyzed for energy and macronutrients, and their food sources were investigated. Due to skewed data, Mann-Whitney U test was used to compare energy and macronutrient intake between sexes and age groups. Among 256 preschool children, more than 90% had protein intakes higher than the recommended level. Only 12.7 to 29.0% met the recommended intake for energy. Amounts of carbohydrate and fat consumed varied from below to above the Dietary Reference Intake (DRI) recommendation. Intakes of carbohydrate in boys and fat in girls were statistically different between age groups (p energy came from dairy products, grains and starchy products. The major carbohydrate contributors were grains and starchy products. Dairy products were the main source of protein. Important food sources of fat were dairy products for one- to three-year-old children and fat and oils for four- to five-year-old children. Thai preschool children have inappropriate intakes of energy and macronutrients. Dairy products and grains and/or starchy products were the main sources of energy, carbohydrate, and protein. Dietary fat sources varied by age group.

  14. Should we reject animal source foods to save the planet? A review ...

    African Journals Online (AJOL)

    Within the next 40 years, the global livestock industry will have to considerably increase production in order to supply the population with animal-source foods, yet the industry must concurrently improve the three metrics of sustainability – economic viability, environmental stewardship and social responsibility. Environmental ...

  15. Assessment of intake inadequacy and food sources of zinc of people in China

    NARCIS (Netherlands)

    Ma Guansheng,; Li Yanping,; Kok, F.J.; Xiaoguang, Y.

    2007-01-01

    Objectives: To assess the intake inadequacy and food sources of zinc of people in China. Design and subjects: Diets of 68 962 subjects aged 2-101 years (urban 21103, rural 47859) in the 2002 China National Nutrition and Health Survey were analysed. Dietary intake was assessed using 24-hour recall

  16. Sporulation of Bacillus spp. within biofilms: a potential source of contamination in food processing environments.

    Science.gov (United States)

    Faille, C; Bénézech, T; Midelet-Bourdin, G; Lequette, Y; Clarisse, M; Ronse, G; Ronse, A; Slomianny, C

    2014-06-01

    Bacillus strains are often isolated from biofilms in the food industries. Previous works have demonstrated that sporulation could occur in biofilms, suggesting that biofilms would be a significant source of food contamination with spores. In this study, we investigated the properties of mono-species and mixed Bacillus biofilms and the ability of Bacillus strains to sporulate inside biofilms. Bacillus strains were able to form mono-species biofilms on stainless steel coupons, with up to 90% spores after a 48 h-incubation. These spores were highly resistant to cleaning but were easily transferred to agar, mimicking the cross-contamination of food, thereby suggesting that biofilms would be of particular concern due to a potential for Bacillus spore food contamination. This hypothesis was strengthened by the fact that Bacillus strains were able to form mixed biofilms with resident strains and that sporulation still occurred easily in these complex structures. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Sole risk and non-consent

    International Nuclear Information System (INIS)

    Winsor, Tom

    1994-01-01

    This article discusses the subjects of sole risk and non-consent in joint operation agreements as used by oil and gas joint ventures in the United Kingdom. The difference between these two concepts is examined in detail. (UK)

  18. Recent advances in microencapsulation of natural sources of antimicrobial compounds used in food - A review.

    Science.gov (United States)

    Castro-Rosas, Javier; Ferreira-Grosso, Carlos Raimundo; Gómez-Aldapa, Carlos Alberto; Rangel-Vargas, Esmeralda; Rodríguez-Marín, María Luisa; Guzmán-Ortiz, Fabiola Araceli; Falfan-Cortes, Reyna Nallely

    2017-12-01

    Food safety and microbiological quality are major priorities in the food industry. In recent years, there has been an increasing interest in the use of natural antimicrobials in food products. An ongoing challenge with natural antimicrobials is their degradation during food storage and/or processing, which reduces their antimicrobial activity. This creates the necessity for treatments that maintain their stability and/or activity when applied to food. Microencapsulation of natural antimicrobial compounds is a promising alternative once this technique consists of producing microparticles, which protect the encapsulated active substances. In other words, the material to be protected is embedded inside another material or system known as wall material. There are few reports in the literature about microencapsulation of antimicrobial compounds. These published articles report evidence of increased antimicrobial stability and activity when the antimicrobials are microencapsulated when compared to unprotected ones during storage. This review focuses mainly on natural sources of antimicrobial compounds and the methodological approach for encapsulating these natural compounds. Current data on the microencapsulation of antimicrobial compounds and their incorporation into food suggests that 1) encapsulation increases compound stability during storage and 2) encapsulation of antimicrobial compounds reduces their interaction with food components, preventing their inactivation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Lentil and Kale: Complementary Nutrient-Rich Whole Food Sources to Combat Micronutrient and Calorie Malnutrition

    Directory of Open Access Journals (Sweden)

    Megan Migliozzi

    2015-11-01

    Full Text Available Lentil (Lens culinaris Medik. is a nutritious food and a staple for millions of people. Not only are lentils a good source of energy, they also contain a range of micronutrients and prebiotic carbohydrates. Kale (Brassica oleracea v. acephala has been considered as a health food, but its full range of benefits and composition has not been extensively studied. Recent studies suggest that foods are enrich in prebiotic carbohydrates and dietary fiber that can potentially reduce risks of non-communicable diseases, including obesity, cancer, heart disease, and diabetes. Lentil and kale added to a cereal-based diet would enhance intakes of essential minerals and vitamins to combat micronutrient malnutrition. This review provides an overview of lentil and kale as a complementary nutrient-rich whole food source to combat global malnutrition and calorie issues. In addition, prebiotic carbohydrate profiles and the genetic potential of these crops for further micronutrient enrichment are briefly discussed with respect to developing sustainable and nutritious food systems.

  20. Lentil and Kale: Complementary Nutrient-Rich Whole Food Sources to Combat Micronutrient and Calorie Malnutrition.

    Science.gov (United States)

    Migliozzi, Megan; Thavarajah, Dil; Thavarajah, Pushparajah; Smith, Powell

    2015-11-11

    Lentil (Lens culinaris Medik.) is a nutritious food and a staple for millions of people. Not only are lentils a good source of energy, they also contain a range of micronutrients and prebiotic carbohydrates. Kale (Brassica oleracea v. acephala) has been considered as a health food, but its full range of benefits and composition has not been extensively studied. Recent studies suggest that foods are enrich in prebiotic carbohydrates and dietary fiber that can potentially reduce risks of non-communicable diseases, including obesity, cancer, heart disease, and diabetes. Lentil and kale added to a cereal-based diet would enhance intakes of essential minerals and vitamins to combat micronutrient malnutrition. This review provides an overview of lentil and kale as a complementary nutrient-rich whole food source to combat global malnutrition and calorie issues. In addition, prebiotic carbohydrate profiles and the genetic potential of these crops for further micronutrient enrichment are briefly discussed with respect to developing sustainable and nutritious food systems.

  1. Learning in an exotic social wasp while relocating a food source.

    Science.gov (United States)

    Lozada, Mariana; D'Adamo, Paola

    2014-01-01

    In this paper we review several studies on Vespulagermanica behavioral plasticity while relocating a food source in natural environments. This exotic social wasp, which has become established in many parts of the world, displays diverse cognitive abilities when foraging. Given its successful invasiveness worldwide, our initial hypothesis was that this species has great behavioral plasticity, which enables it to face environmental uncertainty. In our work we have analyzed foraging behavior associated with undepleted resources. Throughout several experiments, rapid learning was observed in this species; after few learning experiences they associate diverse contextual cues with a food source. However, by exploring wasp behavior when food suddenly disappeared, either because it had been removed or displaced, we found that they continued searching over a no longer rewarding site for a considerable period of time, suggesting that past experience can hinder new learning. Particularly surprising is the fact that when food was displaced nearby, wasps persisted in searching over the empty dish, ignoring the presence of food close by. We propose that this species could be a suitable model for studying cognitive plasticity in relation to environmental uncertainty. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Food sources of nitrates and nitrites: the physiologic context for potential health benefits.

    Science.gov (United States)

    Hord, Norman G; Tang, Yaoping; Bryan, Nathan S

    2009-07-01

    The presence of nitrates and nitrites in food is associated with an increased risk of gastrointestinal cancer and, in infants, methemoglobinemia. Despite the physiologic roles for nitrate and nitrite in vascular and immune function, consideration of food sources of nitrates and nitrites as healthful dietary components has received little attention. Approximately 80% of dietary nitrates are derived from vegetable consumption; sources of nitrites include vegetables, fruit, and processed meats. Nitrites are produced endogenously through the oxidation of nitric oxide and through a reduction of nitrate by commensal bacteria in the mouth and gastrointestinal tract. As such, the dietary provision of nitrates and nitrites from vegetables and fruit may contribute to the blood pressure-lowering effects of the Dietary Approaches to Stop Hypertension (DASH) diet. We quantified nitrate and nitrite concentrations by HPLC in a convenience sample of foods. Incorporating these values into 2 hypothetical dietary patterns that emphasize high-nitrate or low-nitrate vegetable and fruit choices based on the DASH diet, we found that nitrate concentrations in these 2 patterns vary from 174 to 1222 mg. The hypothetical high-nitrate DASH diet pattern exceeds the World Health Organization's Acceptable Daily Intake for nitrate by 550% for a 60-kg adult. These data call into question the rationale for recommendations to limit nitrate and nitrite consumption from plant foods; a comprehensive reevaluation of the health effects of food sources of nitrates and nitrites is appropriate. The strength of the evidence linking the consumption of nitrate- and nitrite-containing plant foods to beneficial health effects supports the consideration of these compounds as nutrients.

  3. Clostridium difficile from food and surface samples in a Belgian nursing home: an unlikely source of contamination.

    Science.gov (United States)

    Rodriguez, C; Korsak, N; Taminiau, B; Avesani, V; Van Broeck, J; Brach, P; Delmée, M; Daube, G

    2015-04-01

    This study investigates the contamination of foods and surfaces with Clostridium difficile in a single nursing home. C. difficile PCR-ribotype 078 was found in one food sample and in none of the tested surfaces. These results indicate that food and surfaces are an unlikely source of C. difficile infection in this setting. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Successful large-scale hatchery culture of sandfish (Holothuria scabra using micro-algae concentrates as a larval food source

    Directory of Open Access Journals (Sweden)

    Thane A. Militz

    2018-02-01

    Full Text Available This paper reports methodology for large-scale hatchery culture of sandfish, Holothuria scabra, in the absence of live, cultured micro-algae. We demonstrate how commercially-available micro-algae concentrates can be incorporated into hatchery protocols as the sole larval food source to completely replace live, cultured micro-algae. Micro-algae concentrates supported comparable hatchery production of sandfish to that of live, cultured micro-algae traditionally used in large-scale hatchery culture. The hatchery protocol presented allowed a single technician to achieve production of more than 18,800 juvenile sandfish at 40 days post-fertilisation in a low-resource hatchery in Papua New Guinea. Growth of auricularia larvae fed micro-algae concentrates was represented by the equation length (μm = 307.8 × ln(day + 209.2 (R2 = 0.93 while survival over the entire 40 day hatchery cycle was described by the equation survival = 2 × day−1.06 (R2 = 0.74. These results show that micro-algae concentrates have great potential for simplifying hatchery culture of sea cucumbers by reducing infrastructural and technical resources required for live micro-algae culture. The hatchery methodology described in this study is likely to have applicability to low-resource hatcheries throughout the Indo-Pacific and could support regional expansion of sandfish hatchery production.

  5. New resources for smart food retail mapping a GIS and the open source perspective

    Directory of Open Access Journals (Sweden)

    Eric Vaz

    2016-12-01

    Full Text Available In this paper it is demonstrated that open-source GIS software may contribute to allow nonprofit organizations and local food retailers to strategically locate food shops. This impacts realtors and other businesses as well. Areas are covered and clients served avoiding food deserts and increasing security in the health sector (Barnes et al., 2016. The methodology demonstrates how mapping may be processed, allowing people to get a good understanding of the food distribution. Also, decision making at corporate level improves due to better connecting to local production and organic retailers and to better reach out to local consumption. A major consequence of this exercise is likewise to educate users on the negative impacts of food deserts on health and improve awareness supporting the design and integration of sustainable and healthy lifestyles (Vaz and Zhao, 2016. This novel proposal that combines spatial and locational data visualization (McIver, 2003, as well as sharing of information of healthy food retailers within the urban nexus (Morgan and Sonnino, 2010 engage communities actively to participate in the integration of new consumer behaviours and make them clearly expressed.

  6. How parental dietary behavior and food parenting practices affect children's dietary behavior. Interacting sources of influence?

    Science.gov (United States)

    Larsen, Junilla K; Hermans, Roel C J; Sleddens, Ester F C; Engels, Rutger C M E; Fisher, Jennifer O; Kremers, Stef P J

    2015-06-01

    Until now, the literatures on the effects of food parenting practices and parents' own dietary behavior on children's dietary behavior have largely been independent from one another. Integrating findings across these areas could provide insight on simultaneous and interacting influences on children's food intake. In this narrative review, we provide a conceptual model that bridges the gap between both literatures and consists of three main hypotheses. First, parental dietary behavior and food parenting practices are important interactive sources of influence on children's dietary behavior and Body Mass Index (BMI). Second, parental influences are importantly mediated by changes in the child's home food environment. Third, parenting context (i.e., parenting styles and differential parental treatment) moderates effects of food parenting practices, whereas child characteristics (i.e., temperament and appetitive traits) mainly moderate effects of the home food environment. Future studies testing (parts of) this conceptual model are needed to inform effective parent-child overweight preventive interventions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Antimicrobial resistance of Aeromonas hydrophila isolated from different food sources: A mini-review

    Directory of Open Access Journals (Sweden)

    Deyan Stratev

    2016-09-01

    Full Text Available Summary: Aeromonas hydrophila is a Gram-negative, oxidase-positive, facultative, anaerobic, opportunistic aquatic pathogen. A. hydrophila produces virulence factors, such as hemolysins, aerolysins, adhesins, enterotoxins, phospholipase and lipase. In addition to isolation from aquatic sources, A. hydrophila has been isolated from meat and meat products, milk and dairy products, and vegetables. However, various studies showed that this opportunistic pathogen is resistant to commercial antibiotics. This is attributed to factors such as the indiscriminate use of antibiotics in aquaculture, plasmids or horizontal gene transfer. In this report, we highlight the occurrence, prevalence and antimicrobial resistance of A. hydrophila isolated from different food samples. The presence of antimicrobial-resistant A. hydrophila in food poses threats to public and aquatic animal health. Keywords: A. hydrophila, Antimicrobial resistance, Microbial food safety

  8. Encapsulation of vegetable oils as source of omega-3 fatty acids for enriched functional foods.

    Science.gov (United States)

    Ruiz Ruiz, Jorge Carlos; Ortiz Vazquez, Elizabeth De La Luz; Segura Campos, Maira Rubi

    2017-05-03

    Polyunsaturated omega-3 fatty acids (PUFAs), a functional component present in vegetable oils, are generally recognized as being beneficial to health. Omega-3 PUFAs are rich in double bonds and unsaturated in nature; this attribute makes them highly susceptible to lipid oxidation and unfit for incorporation into long shelf life foods. The microencapsulation of oils in a polymeric matrix (mainly polysaccharides) offers the possibility of controlled release of the lipophilic functional ingredient and can be useful for the supplementation of foods with PUFAs. The present paper provides a literature review of different vegetable sources of omega-3 fatty acids, the functional effects of omega-3 fatty acids, different microencapsulation methods that can possibly be used for the encapsulation of oils, the properties of vegetable oil microcapsules, the effect of encapsulation on oxidation stability and fatty acid composition of vegetable oils, and the incorporation of long-chain omega-3 polyunsaturated fatty acids in foods.

  9. A nutribusiness strategy for processing and marketing animal-source foods for children.

    Science.gov (United States)

    Mills, Edward W; Seetharaman, Koushik; Maretzki, Audrey N

    2007-04-01

    Nutritional benefits of animal source foods in the diets of children in developing countries indicate a need to increase the availability of such foods to young children. A nutribusiness strategy based on a dried meat and starch product could be used to increase children's access to such foods. The "Chiparoo" was developed at The Pennsylvania State University with this objective in mind. Plant-based and meat ingredients of the Chiparoo are chosen based on regional availability and cultural acceptability. Chiparoo processing procedures, including solar drying, are designed to ensure product safety and to provide product properties that allow them to be eaten as a snack or crumbled into a weaning porridge. Continued work is needed to develop formulation and processing variations that accommodate the needs of cultures around the world.

  10. Phenolic-enriched foods: sources and processing for enhanced health benefits.

    Science.gov (United States)

    McDougall, Gordon J

    2017-05-01

    Polyphenols are ubiquitous secondary products present in many plant foods. Their intake has been associated with health benefits ranging from reduced incidence of CVD, diabetes and cancers to improved neurodegenerative outcomes. Major dietary sources include beverages such as coffee, teas and foods such as chocolate. Fruits are also major sources and berries in particular are a palatable source of a diverse range of polyphenol components. There are a number of ways that polyphenol uptake could be increased and healthier polyphenol-rich foods could be produced with specific compositions to target-specific health effects. Firstly, we could exploit the genetic diversity of plants (with a focus on berries) to select varieties that have enhanced levels of specific polyphenols implicated in disease mitigation (e.g. anthocyanins, tannins or flavonols). Working with variation induced by environmental and agronomic factors, modern molecular breeding techniques could exploit natural variation and beneficially alter polyphenol content and composition, although this could be relatively long term. Alternatively, we could employ a synthetic biology approach and design new plants that overexpress certain genes or re-deploy more metabolic effort into specific polyphenols. However, such 'polyphenol-plus' fruit could prove unpalatable as polyphenols contribute to sensorial properties (e.g. astringency of tannins). However, if the aim was to produce a polyphenol as a pharmaceutical then 'lifting' biosynthetic pathways from plants and expressing them in microbial vectors may be a feasible option. Secondly, we could design processing methods to enhance the polyphenolic composition or content of foods. Fermentation of teas, cocoa beans and grapes, or roasting of cocoa and coffee beans has long been used and can massively influence polyphenol composition and potential bioactivity. Simple methods such as milling, heat treatment, pasteurisation or juicing (v. pureeing) can have notable

  11. Levels and sources of fat in the U.S. food supply.

    Science.gov (United States)

    Raper, N R; Marston, R M

    1986-01-01

    The amount of fat in the U.S. food supply increased one-third between 1909-13 and 1984, from 124 grams to 166 grams per capita per day. Also, the proportion of food energy provided by fat increased from 32 to 43 percent. The gain in fat in the food supply was due to an increase in fat from vegetable sources. The share of fat from vegetable sources increased from 17 to 42 percent between 1909-13 and 1984. Although animal fats provided the largest share of fat, their proportionate contribution declined from 83 to 58 percent between 1909-13 and 1984. Three food groups--fats and oils; meat, poultry, and fish; and dairy products--provided about 90 percent of the fat in the food supply throughout the past 75 years. However, the shares of fat provided by these groups changed. The share from the fats and oils group increased from 37 to 44 percent between 1909-13 and 1984, while the share from the meat, poultry, and fish group declined from 37 to 34 percent, and the share from the dairy products group declined from 15 to 12 percent. Fat from the fats and oils group increased 59 percent between 1909-13 and 1984. Most of the gain in fat from this group was due to increased use of edible oils. Margarine replaced much of the butter and shortening replaced much of the lard as sources of fat. Fat from the meat, poultry, and fish group increased 24 percent between 1909-13 and 1984. Pork accounted for the largest proportion of fat from this group and beef ranked second. The share of fat from poultry, although much smaller than either pork or beef, almost tripled. Fat from dairy products was about the same in 1984 as in 1909-13. Cheese was the leading source of fat from dairy products by 1984. Until recent years, whole milk was the leading source, although its share declined substantially after the late 1950's. Despite their low fat content, the share of fat from skim and lowfat milks increased as use increased, particularly in the past 25 years. The proportion of fat provided by

  12. Piper nigrum, Piper betle and Gnetum gnemon- Natural Food Sources with Anti-Quorum Sensing Properties

    Science.gov (United States)

    Tan, Li Ying; Yin, Wai-Fong; Chan, Kok-Gan

    2013-01-01

    Various parts of Piper nigrum, Piper betle and Gnetum gnemon are used as food sources by Malaysians. The purpose of this study is to examine the anti-quorum sensing (anti-QS) properties of P. nigrum, P. betle and G. gnemon extracts. The hexane, chloroform and methanol extracts of these plants were assessed in bioassays involving Pseudomonas aeruginosa PA01, Escherichia coli [pSB401], E. coli [pSB1075] and Chromobacterium violaceum CV026. It was found that the extracts of these three plants have anti-QS ability. Interestingly, the hexane, chloroform and methanol extracts from P. betle showed the most potent anti-QS activity as judged by the bioassays. Since there is a variety of plants that serve as food sources in Malaysia that have yet to be tested for anti-QS activity, future work should focus on identification of these plants and isolation of the anti-QS compounds. PMID:23519352

  13. Campylobacter species in animal, food, and environmental sources, and relevant testing programs in Canada.

    Science.gov (United States)

    Huang, Hongsheng; Brooks, Brian W; Lowman, Ruff; Carrillo, Catherine D

    2015-10-01

    Campylobacter species, particularly thermophilic campylobacters, have emerged as a leading cause of human foodborne gastroenteritis worldwide, with Campylobacter jejuni, Campylobacter coli, and Campylobacter lari responsible for the majority of human infections. Although most cases of campylobacteriosis are self-limiting, campylobacteriosis represents a significant public health burden. Human illness caused by infection with campylobacters has been reported across Canada since the early 1970s. Many studies have shown that dietary sources, including food, particularly raw poultry and other meat products, raw milk, and contaminated water, have contributed to outbreaks of campylobacteriosis in Canada. Campylobacter spp. have also been detected in a wide range of animal and environmental sources, including water, in Canada. The purpose of this article is to review (i) the prevalence of Campylobacter spp. in animals, food, and the environment, and (ii) the relevant testing programs in Canada with a focus on the potential links between campylobacters and human health in Canada.

  14. Biosynthesis of higher alcohol flavour compounds by the yeast Saccharomyces cerevisiae: impact of oxygen availability and responses to glucose pulse in minimal growth medium with leucine as sole nitrogen source.

    Science.gov (United States)

    Espinosa Vidal, Esteban; de Morais, Marcos Antonio; François, Jean Marie; de Billerbeck, Gustavo M

    2015-01-01

    Higher alcohol formation by yeast is of great interest in the field of fermented beverages. Among them, medium-chain alcohols impact greatly the final flavour profile of alcoholic beverages, even at low concentrations. It is widely accepted that amino acid metabolism in yeasts directly influences higher alcohol formation, especially the catabolism of aromatic and branched-chain amino acids. However, it is not clear how the availability of oxygen and glucose metabolism influence the final higher alcohol levels in fermented beverages. Here, using an industrial Brazilian cachaça strain of Saccharomyces cerevisiae, we investigated the effect of oxygen limitation and glucose pulse on the accumulation of higher alcohol compounds in batch cultures, with glucose (20 g/l) and leucine (9.8 g/l) as the carbon and nitrogen sources, respectively. Fermentative metabolites and CO2 /O2 balance were analysed in order to correlate the results with physiological data. Our results show that the accumulation of isoamyl alcohol by yeast is independent of oxygen availability in the medium, depending mainly on leucine, α-keto-acids and/or NADH pools. High-availability leucine experiments showed a novel and unexpected accumulation of isobutanol, active amyl alcohol and 2-phenylethanol, which could be attributed to de novo biosynthesis of valine, isoleucine and phenylalanine and subsequent outflow of these pathways. In carbon-exhausted conditions, our results also describe, for the first time, the metabolization of isoamyl alcohol, isobutanol, active amyl alcohol but not of 2-phenylethanol, by yeast strains in stationary phase, suggesting a role for these higher alcohols as carbon source for cell maintenance and/or redox homeostasis during this physiological phase. Copyright © 2014 John Wiley & Sons, Ltd.

  15. Availability of added sugars in Brazil: distribution, food sources and time trends.

    Science.gov (United States)

    Levy, Renata Bertazzi; Claro, Rafael Moreira; Bandoni, Daniel Henrique; Mondini, Lenise; Monteiro, Carlos Augusto

    2012-03-01

    To describe the regional and socio-economic distribution of consumption of added sugar in Brazil in 2002/03, particularly products, sources of sugar and trends in the past 15 years. The study used data from Household Budget Surveys since the 1980s about the type and quantity of food and beverages bought by Brazilian families. Different indicators were analyzed: % of sugar calories over the total diet energy and caloric % of table sugar fractions and sugar added to processed food/ sugar calories of diet. In 2002/03, of the total energy available for consumption, 16.7% came from added sugar in all regional and socio-economic strata. The table sugar/ sugar added to processed food ratio was inversely proportional to increase in income. Although this proportion fell in the past 15 years, sugar added to processed food doubled, especially in terms of consumption of soft drinks and cookies. Brazilians consume more sugar than the recommended levels determined by the WHO and the sources of consumption of sugar have changed significantly.

  16. Bioactive Carbohydrates and Peptides in Foods: An Overview of Sources, Downstream Processing Steps and Associated Bioactivities.

    Science.gov (United States)

    Hayes, Maria; Tiwari, Brijesh K

    2015-09-17

    Bioactive peptides and carbohydrates are sourced from a myriad of plant, animal and insects and have huge potential for use as food ingredients and pharmaceuticals. However, downstream processing bottlenecks hinder the potential use of these natural bioactive compounds and add cost to production processes. This review discusses the health benefits and bioactivities associated with peptides and carbohydrates of natural origin and downstream processing methodologies and novel processes which may be used to overcome these.

  17. Influence of Source Credibility on Consumer Acceptance of Genetically Modified Foods in China

    Directory of Open Access Journals (Sweden)

    Mingyang Zhang

    2016-09-01

    Full Text Available This paper examines the reasoning mechanism behind the consumer acceptance of genetically modified foods (GMFs in China, and investigates influence of source credibility on consumer acceptance of GMFs. Based on the original Persuasion Model—which was developed by Carl Hovland, an American psychologist and pioneer in the study of communication and its effect on attitudes and beliefs—we conducted a survey using multistage sampling from 1167 urban residents, which were proportionally selected from six cities in three economic regions (south, central, and north in the Jiangsu province through face to face interviews. Mixed-process regression that could correct endogeneity and ordered probit model were used to test the impact of source credibility on consumers’ acceptance of GMFs. Our major finding was that consumer acceptance of GMFs is affected by such factors as information source credibility, general attitudes, gender, and education levels. The reliability of biotechnology research institutes, government offices devoted to management of GM organisms (GMOs, and GMO technological experts have expedited urban consumer acceptance of GM soybean oil. However, public acceptance can also decrease as faith in the environmental organization. We also found that ignorance of the endogeneity of above mentioned source significantly undervalued its effect on consumers’ acceptance. Moreover, the remaining three sources (non-GMO experts, food companies, and anonymous information found on the Internet had almost no effect on consumer acceptance. Surprisingly, the more educated people in our survey were more skeptical towards GMFs. Our results contribute to the behavioral literature on consumer attitudes toward GMFs by developing a reasoning mechanism determining consumer acceptance of GMFs. Particularly, this paper quantitatively studied the influence of different source credibility on consumer acceptance of GMFs by using mixed-process regression to

  18. Relationship between Dietary Fat Intake, Its Major Food Sources and Assisted Reproduction Parameters.

    Science.gov (United States)

    Kazemi, Ashraf; Ramezanzadeh, Fatemeh; Nasr-Esfahani, Mohammad Hosein

    2014-10-01

    High dietary fat consumption may alter oocyte development and embryonic development. This prospective study was conducted to determine the relation between dietary fat consumption level, its food sources and the assisted reproduction parameters. A prospective study was conducted on 240 infertile women. In assisted reproduction treatment cycle, fat consumption and major food sources over the previous three months were identified. The number of retrieved oocytes, metaphase ΙΙ stage oocytes numbers, fertilization rate, embryo quality and clinical pregnancy rate were also determined. The data were analyzed using multiple regression, binary logistic regression, chi-square and t-test. The p-value of less than 0.05 was considered significant. Total fat intake adjusted for age, body mass index, physical activity and etiology of infertility was positively associated with the number of retrieved oocytes and inversely associated with the high embryo quality rate. An inverse association was observed between sausage and turkey ham intake and the number of retrieved oocytes. Also, oil intake level had an inverse association with good cleavage rate. The results revealed that higher levels of fat consumption tend to increase the number of retrieved oocytes and were adversely related to embryonic development. Among food sources of fat, vegetable oil, sausage and turkey ham intake may adversely affect assisted reproduction parameters.

  19. Laser Scribed Graphene Biosensor for Detection of Biogenic Amines in Food Samples Using Locally Sourced Materials

    Directory of Open Access Journals (Sweden)

    Diana C. Vanegas

    2018-04-01

    Full Text Available In foods, high levels of biogenic amines (BA are the result of microbial metabolism that could be affected by temperatures and storage conditions. Thus, the level of BA is commonly used as an indicator of food safety and quality. This manuscript outlines the development of laser scribed graphene electrodes, with locally sourced materials, for reagent-free food safety biosensing. To fabricate the biosensors, the graphene surface was functionalized with copper microparticles and diamine oxidase, purchased from a local supermarket; and then compared to biosensors fabricated with analytical grade materials. The amperometric biosensor exhibits good electrochemical performance, with an average histamine sensitivity of 23.3 µA/mM, a lower detection limit of 11.6 µM, and a response time of 7.3 s, showing similar performance to biosensors constructed from analytical grade materials. We demonstrated the application of the biosensor by testing total BA concentration in fish paste samples subjected to fermentation with lactic acid bacteria. Biogenic amines concentrations prior to lactic acid fermentation were below the detection limit of the biosensor, while concentration after fermentation was 19.24 ± 8.21 mg histamine/kg, confirming that the sensor was selective in a complex food matrix. The low-cost, rapid, and accurate device is a promising tool for biogenic amine estimation in food samples, particularly in situations where standard laboratory techniques are unavailable, or are cost prohibitive. This biosensor can be used for screening food samples, potentially limiting food waste, while reducing chances of foodborne outbreaks.

  20. Estimation of dietary flavonoid intake and major food sources of Korean adults.

    Science.gov (United States)

    Jun, Shinyoung; Shin, Sangah; Joung, Hyojee

    2016-02-14

    Epidemiological studies have suggested that flavonoids exhibit preventive effects on degenerative diseases. However, lack of sufficient data on flavonoid intake has limited evaluating the proposed effects in populations. Therefore, we aimed to estimate the total and individual flavonoid intakes among Korean adults and determine the major dietary sources of these flavonoids. We constructed a flavonoid database of common Korean foods, based on the food list reported in the 24-h recall of the Korea National Health and Nutrition Examination Survey (KNHANES) 2007-2012, using data from the Korea Functional Food Composition Table, US Department of Agriculture flavonoid database, Phenol-Explorer database and other analytical studies. This database, which covers 49 % of food items and 76 % of food intake, was linked with the 24-h recall data of 33 581 subjects aged ≥19 years in the KNHANES 2007-2012. The mean daily intake of total flavonoids in Korean adults was 318·0 mg/d, from proanthocyanidins (22·3%), flavonols (20·3%), isoflavones (18·1%), flavan-3-ols (16·2%), anthocyanidins (11·6%), flavanones (11·3%) and flavones (0·3%). The major contributing food groups to the flavonoid intake were fruits (54·4%), vegetables (20·5%), legumes and legume products (16·2%) and beverages and alcohols (3·1%), and the major contributing food items were apples (21·9%), mandarins (12·5%), tofu (11·5%), onions (9·6%) and grapes (9·0%). In the regression analysis, the consumption of legumes and legume products, vegetables and fruits predicted total flavonoid intake the most. The findings of this study could facilitate further investigation on the health benefits of flavonoids and provide the basic information for establishing recommended flavonoid intakes for Koreans.

  1. Diurnal periodicity in the activity of the common sole, solea vulgaris quensel

    NARCIS (Netherlands)

    Kruuk, H.

    1963-01-01

    1. 1. The diurnal rhythm in the trawl catch of Solea vulgaris Quensel gave rise to this investigation into the diurnal activity rhythm of the fish. 2. 2. Periodicity in the food intake of the Sole in its natural habitat was studied by analyses of the contents of the intestines. Food intake

  2. Anthropogenic and natural sources of acidity and metals and their influence on the structure of stream food webs

    International Nuclear Information System (INIS)

    Hogsden, Kristy L.; Harding, Jon S.

    2012-01-01

    We compared food web structure in 20 streams with either anthropogenic or natural sources of acidity and metals or circumneutral water chemistry in New Zealand. Community and diet analysis indicated that mining streams receiving anthropogenic inputs of acidic and metal-rich drainage had much simpler food webs (fewer species, shorter food chains, less links) than those in naturally acidic, naturally high metal, and circumneutral streams. Food webs of naturally high metal streams were structurally similar to those in mining streams, lacking fish predators and having few species. Whereas, webs in naturally acidic streams differed very little from those in circumneutral streams due to strong similarities in community composition and diets of secondary and top consumers. The combined negative effects of acidity and metals on stream food webs are clear. However, elevated metal concentrations, regardless of source, appear to play a more important role than acidity in driving food web structure. - Highlights: ► Food webs in acid mine drainage impacted streams are small and extremely simplified. ► Conductivity explained differences in food web properties between streams. ► Number of links and web size accounted for much dissimilarity between food webs. ► Food web structure was comparable in naturally acidic and circumneutral streams. - Food web structure differs in streams with anthropogenic and natural sources of acidity and metals.

  3. Earthworms and priming of soil organic matter - The impact of food sources, food preferences and fauna - microbiota interactions

    Science.gov (United States)

    Potthoff, Martin; Wichern, Florian; Dyckmans, Jens; Joergensen, Rainer Georg

    2016-04-01

    Earthworms deeply interact with the processes of soil organic matter turnover in soil. Stabilization of carbon by soil aggregation and in the humus fraction of SOM are well known processes related to earthworm activity and burrowing. However, recent research on priming effects showed inconsistent effects for the impact of earthworm activity. Endogeic earthworms can induce apparent as well as true positive priming effects. The main finding is almost always that earthworm increase the CO2 production from soil. The sources of this carbon release can vary and seem to depend on a complex interaction of quantity and quality of available carbon sources including added substrates like straw or other compounds, food preferences and feeding behavior of earthworms, and soil properties. Referring to recent studies on earthworm effects on soil carbon storage and release (mainly Eck et al. 2015 Priming effects of Aporrectodea caliginosa on young rhizodeposits and old soil organic matter following wheat straw addition, European Journal of Soil Biology 70:38-45; Zareitalabad et al. 2010 Decomposition of 15N-labelled maize leaves in soil affected by endogeic geophagous Aporrectodea caliginosa, Soil Biology and Biochemistry 42(2):276-282; and Potthoff et al. 2001 Short-term effects of earthworm activity and straw amendment on the microbial C and N turnover in a remoistened arable soil after summer drought, Soil Biology and Biochemistry 33(4):583-591) we summaries the knowledge on earthworms and priming and come up with a conceptual approach and further research needs.

  4. Tracing carbon sources through aquatic and terrestrial food webs using amino acid stable isotope fingerprinting.

    Directory of Open Access Journals (Sweden)

    Thomas Larsen

    Full Text Available Tracing the origin of nutrients is a fundamental goal of food web research but methodological issues associated with current research techniques such as using stable isotope ratios of bulk tissue can lead to confounding results. We investigated whether naturally occurring δ(13C patterns among amino acids (δ(13CAA could distinguish between multiple aquatic and terrestrial primary production sources. We found that δ(13CAA patterns in contrast to bulk δ(13C values distinguished between carbon derived from algae, seagrass, terrestrial plants, bacteria and fungi. Furthermore, we showed for two aquatic producers that their δ(13CAA patterns were largely unaffected by different environmental conditions despite substantial shifts in bulk δ(13C values. The potential of assessing the major carbon sources at the base of the food web was demonstrated for freshwater, pelagic, and estuarine consumers; consumer δ(13C patterns of essential amino acids largely matched those of the dominant primary producers in each system. Since amino acids make up about half of organismal carbon, source diagnostic isotope fingerprints can be used as a new complementary approach to overcome some of the limitations of variable source bulk isotope values commonly encountered in estuarine areas and other complex environments with mixed aquatic and terrestrial inputs.

  5. Tracing carbon sources through aquatic and terrestrial food webs using amino acid stable isotope fingerprinting.

    Science.gov (United States)

    Larsen, Thomas; Ventura, Marc; Andersen, Nils; O'Brien, Diane M; Piatkowski, Uwe; McCarthy, Matthew D

    2013-01-01

    Tracing the origin of nutrients is a fundamental goal of food web research but methodological issues associated with current research techniques such as using stable isotope ratios of bulk tissue can lead to confounding results. We investigated whether naturally occurring δ(13)C patterns among amino acids (δ(13)CAA) could distinguish between multiple aquatic and terrestrial primary production sources. We found that δ(13)CAA patterns in contrast to bulk δ(13)C values distinguished between carbon derived from algae, seagrass, terrestrial plants, bacteria and fungi. Furthermore, we showed for two aquatic producers that their δ(13)CAA patterns were largely unaffected by different environmental conditions despite substantial shifts in bulk δ(13)C values. The potential of assessing the major carbon sources at the base of the food web was demonstrated for freshwater, pelagic, and estuarine consumers; consumer δ(13)C patterns of essential amino acids largely matched those of the dominant primary producers in each system. Since amino acids make up about half of organismal carbon, source diagnostic isotope fingerprints can be used as a new complementary approach to overcome some of the limitations of variable source bulk isotope values commonly encountered in estuarine areas and other complex environments with mixed aquatic and terrestrial inputs.

  6. Potential Sources for Lipid Soluble Food Colorants from Selected Malaysian Traditional Vegetables

    International Nuclear Information System (INIS)

    Rashidi Othman; Fatimah Azzahra Mohd Zaifuddin; Norazian Mohd Hassan

    2015-01-01

    Colour is one important characteristic to food products as it dictates consumers first perception on the foods flavour and quality. In the current food industry, most of the colorants used were derived from synthetic sources. However, due to negative health impacts of the synthetic colorants, the urgency to find natural colorants and impose it to food products is of great importance. In this study, a group of plant pigments which are potentially introduced as natural food colorants were quantified from 24 species of local traditional vegetables (ulam), characterized as neoxanthin, violaxanthin, lutein, zeaxanthin, β-cryptoxanthine, α-carotene and β-carotene by using HPLC. It was shown that Sauropus androgynous contained the highest amount of neoxanthin, violaxanthin and β-cryptoxanthine at 142.40±3.57, 28.06±0.65 and 0.07±0.00 mg/ g dry weight (DW), respectively. In contrast, highest content of lutein and α-carotene were observed in Centella asiatica at 16.53±0.97 and 2.14±0.12 mg/ g DW, accordingly. Meanwhile, Piper sarmentosum contained the highest zeaxanthin level (123.45±12.3 mg/ g DW) and Oenanthe javanica has the largest amount of β-carotene (3.09±0.06 mg/ g DW). The extracted yellow-to-red lipid soluble pigments can be further developed into commercial food colorant to replace the synthetic colorants in the market thus improving social awareness towards natural products as well as strengthening the national economy. (author)

  7. Use of transglutaminases in foods and potential utilization of plants as a transglutaminase source – Review

    Directory of Open Access Journals (Sweden)

    Fernando Bittencourt Luciano

    2012-09-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2012v25n4p1   Transglutaminases (TGases are enzymes able to catalyze acyl-transfer reactions introducing covalent cross-links between proteins, peptides and primary amines. Animal TGases were the first studied and are divided in nine different groups of isoenzymes. They have a wide range of functions in the metabolism of most animal cells, and share the characteristic of being Ca2+-dependent. Microbial and plant TGases were also identified, and there is a vast heterogeneity among their amino acid sequences. Interestingly, it seems that all transglutaminases share a specific amino acid triad of Cys-His-Asp in their catalytic site, which can be found in all tertiary structures of the enzymes yet studied so far. Microbial TGases are the most widely used for food modification due to lower costs and high yields involved with their extraction and purification when compared to mammal sources. TGases are ubiquitously found in a variety of plants, and their utilization for food transformation has been proposed. However, there is only a single attempt using vegetal TGase in food systems, where apple pomace was used to improve the quality of pork meat. The transference of mammalian TGase genes to plants has also been considered and they were found to be successfully expressed in rice and tobacco leaves. These results lead to a new approach, where TGases could be literally farmed for food utilization.

  8. Estimated Daily Intake and Seasonal Food Sources of Quercetin in Japan

    Directory of Open Access Journals (Sweden)

    Haruno Nishimuro

    2015-04-01

    Full Text Available Quercetin is a promising food component, which can prevent lifestyle related diseases. To understand the dietary intake of quercetin in the subjects of a population-based cohort study and in the Japanese population, we first determined the quercetin content in foods available in the market during June and July in or near a town in Hokkaido, Japan. Red leaf lettuce, asparagus, and onions contained high amounts of quercetin derivatives. We then estimated the daily quercetin intake by 570 residents aged 20–92 years old in the town using a food frequency questionnaire (FFQ. The average and median quercetin intakes were 16.2 and 15.5 mg day−1, respectively. The quercetin intakes by men were lower than those by women; the quercetin intakes showed a low correlation with age in both men and women. The estimated quercetin intake was similar during summer and winter. Quercetin was mainly ingested from onions and green tea, both in summer and in winter. Vegetables, such as asparagus, green pepper, tomatoes, and red leaf lettuce, were good sources of quercetin in summer. Our results will help to elucidate the association between quercetin intake and risks of lifestyle-related diseases by further prospective cohort study and establish healthy dietary requirements with the consumption of more physiologically useful components from foods.

  9. Use of transglutaminases in foods and potential utilization of plants as a transglutaminase source – Review

    Directory of Open Access Journals (Sweden)

    Fernando B. Luciano

    2012-11-01

    Full Text Available Transglutaminases (TGases are enzymes able to catalyze acyl-transfer reactions introducing covalent cross-links between proteins, peptides and primary amines. Animal TGases were the first studied and are divided in nine different groups of isoenzymes. They have a wide range of functions in the metabolism of most animal cells, and share the characteristic of being Ca2+-dependent. Microbial and plant TGases were also identified, and here is a vast heterogeneity among their amino acid sequences. Interestingly, it seems that all transglutaminases share a specific amino acid triad of Cys-His-Asp in their catalytic site, which can be found in all tertiary structures of the enzymes yet studied so far. Microbial TGases are the most widely used for food modification due to lower costs and high yields involved with their extraction and purification when compared to mammal sources. TGases are ubiquitously found in a variety of plants, and their utilization for food transformation has been proposed. However, there is only a single attempt using vegetal TGase in food systems, where apple pomace was used to improve the quality of pork meat. The transference of mammalian TGase genes to plants has also been considered and they were found to be successfully expressed in rice and tobacco leaves. These results lead to a new approach, where TGases could be literally farmed for food utilization.

  10. Production of γ-aminobutyric acid by microorganisms from different food sources.

    Science.gov (United States)

    Hudec, Jozef; Kobida, Ľubomír; Čanigová, Margita; Lacko-Bartošová, Magdaléna; Ložek, Otto; Chlebo, Peter; Mrázová, Jana; Ducsay, Ladislav; Bystrická, Judita

    2015-04-01

    γ-Aminobutyric acid (GABA) is a potentially bioactive component of foods and pharmaceuticals. The aim of this study was screen lactic acid bacteria belonging to the Czech Collection of Microorganisms, and microorganisms (yeast and bacteria) from 10 different food sources for GABA production by fermentation in broth or plant and animal products. Under an aerobic atmosphere, very low selectivity of GABA production (from 0.8% to 1.3%) was obtained using yeast and filamentous fungi, while higher selectivity (from 6.5% to 21.0%) was obtained with bacteria. The use of anaerobic conditions, combined with the addition of coenzyme (pyridoxal-5-phosphate) and salts (CaCl2 , NaCl), led to the detection of a low concentration of GABA precursor. Simultaneously, using an optimal temperature of 33 °C, a pH of 6.5 and bacteria from banana (Pseudomonadaceae and Enterobacteriaceae families), surprisingly, a high selectivity of GABA was obtained. A positive impact of fenugreek sprouts on the proteolytic process and GABA production from plant material as a source of GABA precursor was identified. Lactic acid bacteria for the production of new plant and animal GABA-rich products from different natural sources containing GABA precursor can be used. © 2014 Society of Chemical Industry.

  11. Habitual Intakes, Food Sources and Excretions of Phosphorus and Calcium in Three German Study Collectives

    Directory of Open Access Journals (Sweden)

    Ulrike Trautvetter

    2018-02-01

    Full Text Available Phosphorus intake in Europe is far above recommendations. We present baseline data from three human intervention studies between 2006 and 2014 regarding intake and excretion of phosphorus and calcium. All subjects documented their nutritional habits in weighed dietary records. Fasting blood samples were drawn, and feces and urine were quantitatively collected. Dietary phosphorus intake was estimated based on weighed dietary records and urine phosphorus excretions. Food sources were identified by allocation to defined food product groups. Average phosphorus consumption was 1338 mg/day and did not change from 2006 to 2014, while calcium intake decreased during this period (1150 to 895 mg/day. The main sources for phosphorus intake were bread/cereal products, milk/milk products and meat/meat products/sausage products and the main sources of calcium intake included milk/milk products/cheese, bread/cereal products and beverages. There was no difference between estimated phosphorus intake from the weighed dietary records and urine phosphorus excretion. In conclusion, we demonstrated constant phosphorus intakes far above the recommendations and decreasing calcium intakes below the recommendations in three German collectives from 2006 to 2014. Furthermore, we could show in case of usual intakes that an estimated phosphorus intake from urine phosphorus excretion is similar to the calculated intake from weighed dietary records.

  12. Aquaculture: a rapidly growing and significant source of sustainable food? Status, transitions and potential.

    Science.gov (United States)

    Little, D C; Newton, R W; Beveridge, M C M

    2016-08-01

    The status and potential of aquaculture is considered as part of a broader food landscape of wild aquatic and terrestrial food sources. The rationale and resource base required for the development of aquaculture are considered in the context of broader societal development, cultural preferences and human needs. Attention is drawn to the uneven development and current importance of aquaculture globally as well as its considerable heterogeneity of form and function compared with established terrestrial livestock production. The recent drivers of growth in demand and production are examined and the persistent linkages between exploitation of wild stocks, full life cycle culture and the various intermediate forms explored. An emergent trend for sourcing aquaculture feeds from alternatives to marine ingredients is described and the implications for the sector with rapidly growing feed needs discussed. The rise of non-conventional and innovative feed ingredients, often shared with terrestrial livestock, are considered, including aquaculture itself becoming a major source of marine ingredients. The implications for the continued expected growth of aquaculture are set in the context of sustainable intensification, with the challenges that conventional intensification and emergent integration within, and between, value chains explored. The review concludes with a consideration of the implications for dependent livelihoods and projections for various futures based on limited resources but growing demand.

  13. Potential Impacts of Food Production on Freshwater Availability Considering Water Sources

    Directory of Open Access Journals (Sweden)

    Shinjiro Yano

    2016-04-01

    Full Text Available We quantify the potential impacts of global food production on freshwater availability (water scarcity footprint; WSF by applying the water unavailability factor (fwua as a characterization factor and a global water resource model based on life cycle impact assessment (LCIA. Each water source, including rainfall, surface water, and groundwater, has a distinct fwua that is estimated based on the renewability rate of each geographical water cycle. The aggregated consumptive water use level for food production (water footprint inventory; WI was found to be 4344 km3/year, and the calculated global total WSF was 18,031 km3 H2Oeq/year, when considering the difference in water sources. According to the fwua concept, which is based on the land area required to obtain a unit volume of water from each source, the calculated annual impact can also be represented as 98.5 × 106 km2. This value implies that current agricultural activities requires a land area that is over six times larger than global total cropland. We also present the net import of the WI and WSF, highlighting the importance of quantitative assessments for utilizing global water resources to achieve sustainable water use globally.

  14. Anthropogenic and natural sources of acidity and metals and their influence on the structure of stream food webs.

    Science.gov (United States)

    Hogsden, Kristy L; Harding, Jon S

    2012-03-01

    We compared food web structure in 20 streams with either anthropogenic or natural sources of acidity and metals or circumneutral water chemistry in New Zealand. Community and diet analysis indicated that mining streams receiving anthropogenic inputs of acidic and metal-rich drainage had much simpler food webs (fewer species, shorter food chains, less links) than those in naturally acidic, naturally high metal, and circumneutral streams. Food webs of naturally high metal streams were structurally similar to those in mining streams, lacking fish predators and having few species. Whereas, webs in naturally acidic streams differed very little from those in circumneutral streams due to strong similarities in community composition and diets of secondary and top consumers. The combined negative effects of acidity and metals on stream food webs are clear. However, elevated metal concentrations, regardless of source, appear to play a more important role than acidity in driving food web structure. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Preferred natural food of breeding Kakapo is a high value source of calcium and vitamin D.

    Science.gov (United States)

    von Hurst, P R; Moorhouse, R J; Raubenheimer, D

    2016-11-01

    The Kakapo, a large NZ native parrot, is under severe threat of extinction. Kakapo breed only in years when the local podocarps, including rimu (Dacrydium cupressinum), are fruiting heavily, and the fruit are the preferred food both in the diet of breeding females and for provisioning chicks. Attempts to provide a supplementary food during years of poor fruit supply have failed to encourage breeding. Nutrient analysis of rimu berries reveals high calcium content (8.4mg/g dry matter) which would be essential for both egg shell production and the growing skeleton of the chick. Vitamin D is also critical for these processes and for the maintenance of calcium homeostasis, but the source of vitamin D for these nocturnal, ground-dwelling vegetarians is unknown. To examine the vitamin D status of adult Kakapo, and to investigate the possibility that rimu berries provide vitamin D as well as calcium, thus differentiating them from the supplementary foods provided to date. Previously collected and frozen serum from 10 adult birds (6 females, 4 males) was assayed for 25(OH)D 3 and D 2 . Two batches of previously frozen rimu berries were analysed for vitamin D 3 and D 2 . Vitamin D status of the 10 adult birds was very low; mean 4.9nmol/l, range 1-14nmol/l 25(OH)D 3 . No 25(OH)D 2 was detected in any of the birds. High levels of D 2 and moderate levels of D 3 were found in the rimu berries. Traditionally it has been considered that the D 3 isoform of this endogenously produced secosteroid is produced only in animals. However, D 3 has been reported in the leaves of plants of the Solanacae family (tomato, potato, capsicum). The avian vitamin D receptor (VDR) is thought to have a much greater affinity for the D 3 form. Therefore if rimu fruit are able to provide breeding Kakapo with D 3 , and are a plentiful source of calcium, they could be the perfect food package for breeding and nesting birds. Of wider importance, this finding challenges conventional understanding that D3

  16. Dietary intake and food sources of fatty acids in Australian adolescents.

    Science.gov (United States)

    O'Sullivan, Therese A; Ambrosini, Gina; Beilin, Lawrie J; Mori, Trevor A; Oddy, Wendy H

    2011-02-01

    Dietary fat consumed during childhood and adolescence may be related to the development of cardiovascular and other chronic diseases in adulthood; however, there is a lack of information on specific fatty acid intakes and food sources in these populations. Our study aimed to assess fatty acid intakes in Australian adolescents, compare intakes with national guidelines, and identify major food sources of fatty acids. Dietary intake was assessed using measured 3-d records in 822 adolescents aged 13-15 y participating in The Western Australian Pregnancy Cohort (Raine) Study, Australia. Mean daily total fat intakes were 90 ± 25 g for boys and 73 ± 20 g for girls, with saturated fat contributing 14% of total energy intake. Mean contribution to daily energy intake for linoleic, alpha-linolenic, eicosapentaenoic, docosapentaenoic, and docosahexaenoic acids were 3.0%, 0.40%, 0.02%, 0.01%, and 0.04%, respectively, for boys, and 3.3%, 0.42%, 0.02%, 0.01%, and 0.05% for girls. To meet guidelines for chronic disease prevention, consumption of long-chain omega-3 fatty acids in this population may need to increase up to three-fold and the proportion of saturated fat decrease by one-third. Girls were more likely to achieve the guidelines. Major food sources were dairy products for total fat, saturated fat and alpha-linolenic acid, margarines for linoleic acid, and fish for long-chain omega-3 fatty acids. Results suggest that for this population, a higher dietary intake of long-chain omega-3 fatty acids, particularly for boys, and lower proportion of saturated fat is required to meet recommendations for prevention of chronic disease. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Debunking Technical Competency as the Sole Source of Innovation

    Science.gov (United States)

    2015-01-01

    nations are losing control of businesses as they become more transnational through overseas direct investment. If Walmart were a country, it would...be China’s eighth largest trading partner.40 The Walmart example emphasizes the difficulty the United States would have in imposing restrictions

  18. Food sources of energy and nutrients in Finnish girls and boys 6-8 years of age - the PANIC study.

    Science.gov (United States)

    Eloranta, Aino-Maija; Venäläinen, Taisa; Soininen, Sonja; Jalkanen, Henna; Kiiskinen, Sanna; Schwab, Ursula; Lakka, Timo A; Lindi, Virpi

    2016-01-01

    Data on food sources of nutrients are needed to improve strategies to enhance nutrient intake among girls and boys in Western countries. To identify major food sources of energy, energy nutrients, dietary fibre, and micronutrients, and to study gender differences in these food sources among children. We assessed food consumption and nutrient intake using 4-day food records in a population sample of Finnish girls ( n =213) and boys ( n =217) aged 6-8 years from the Physical Activity and Nutrition in Children Study. We calculated the percentual contribution of 55 food groups for energy and nutrient intake using the population proportion method. Low-fibre grain products, skimmed milk, and high-fibre bread provided almost 23% of total energy intake. Skimmed milk was the top source of protein (18% of total intake), vitamin D (32%), potassium (20%), calcium (39%), magnesium (17%), and zinc (16%). Vegetable oils (15%) and high-fat vegetable oil-based spreads (14%) were the top sources of polyunsaturated fat. High-fibre bread was the top source of fibre (27%) and iron (12%). Non-root vegetables were the top source of folate (14%) and vitamin C (22%). Sugar-sweetened beverages provided 21% of sucrose intake. Pork was a more important source of protein and sausage was a more important source of total fat and monounsaturated fat in boys than in girls. Vegetable oils provided a higher proportion of unsaturated fat and vitamin E among boys, whereas high-fat vegetable oil-based spreads provided a higher proportion of these nutrients among girls. Commonly recommended foods, such as skimmed milk, high-fibre grain products, vegetables, vegetable oil, and vegetable oil-based spreads, were important sources of several nutrients, whereas sugar-sweetened beverages provided the majority of sucrose intake among children. This knowledge can be used in improving health among children by dietary interventions, nutrition education, and health policy decision making.

  19. Piper nigrum, Piper betle and Gnetum gnemon- Natural Food Sources with Anti-Quorum Sensing Properties

    OpenAIRE

    Tan, Li Ying; Yin, Wai-Fong; Chan, Kok-Gan

    2013-01-01

    Various parts of Piper nigrum, Piper betle and Gnetum gnemon are used as food sources by Malaysians. The purpose of this study is to examine the anti-quorum sensing (anti-QS) properties of P. nigrum, P. betle and G. gnemon extracts. The hexane, chloroform and methanol extracts of these plants were assessed in bioassays involving Pseudomonas aeruginosa PA01, Escherichia coli [pSB401], E. coli [pSB1075] and Chromobacterium violaceum CV026. It was found that the extracts of these three plants ha...

  20. Consumer Preferences for Animal Source Foods in Uganda: Quality, Retail Forms and Retail Outlets

    Directory of Open Access Journals (Sweden)

    Nadhem Mtimet

    2013-10-01

    Full Text Available This paper presents the results of a rapid consumer survey undertaken in Uganda. The survey aimed at identifying preferred quality and safety attributes, retail forms and retail outlets for major livestock products and by type of consumers. Results of the survey, combined with nationally representative household datasets, allows description of both the quantitative and qualitative dimensions of the developing market for animal-source foods, which is anticipated to provide major business opportunities for small-scale livestock producers in the short and medium terms.

  1. Food as a Source and Target of Metaphors: Inclusion and Exclusion of Foodstuffs and Persons through Metaphors

    NARCIS (Netherlands)

    Korthals, M.J.J.A.A.

    2008-01-01

    Food is an engine and source of metaphorical meanings that permeates our life. Apples can incorporate references of sin or toxin or simple land life, and tomatoes, blood and love. Fast food symbolically represents for many items of the American Dream. Olives are seen as signs of peace. However,

  2. Simultaneous Determination of Thermal Conductivity and Thermal Diffusivity of Food and Agricultural Materials Using a Transient Plane-Source Method

    Science.gov (United States)

    Thermal conductivity and thermal diffusivity are two important physical properties essential for designing any food engineering processes. Recently a new transient plane-source method was developed to measure a variety of materials, but its application in foods has not been documented. Therefore, ...

  3. Exploration and exploitation of food sources by social insect colonies: a revision of the scout-recruit concept

    NARCIS (Netherlands)

    Biesmeijer, J.C.; Vries, Han de

    2000-01-01

    Social insect colonies need to explore and exploit multiple food sources simultaneously and efficiently. At the individual level, this colony-level behaviour has been thought to be taken care of by two types of individual: scouts that independently search for food, and recruits that are

  4. The 21st century nuclear park: A source of energy, water, food, and jobs

    International Nuclear Information System (INIS)

    Madia, W.J.

    2004-01-01

    The concept of a nuclear-powered agro-industrial complex, or 'nuplex', first advanced 40 years ago, provides an increasingly attractive means of addressing critical challenges in developing nations. The nuplex concept, updated for the 21st century, can serve as the basis for a nuclear park that provides a safe, environmentally friendly, and reliable source of energy at a cost comparable to other means of generation. This 21st century nuclear park can meet burgeoning demands for new sources of power and water, support the development of highly efficient agriculture to supply food to a growing world population, and offer employment at levels ranging from unskilled to highly skilled, thus creating opportunities for economic development and improving the quality of life in regions where it is deployed. (author)

  5. Tannins: current knowledge of food sources, intake, bioavailability and biological effects.

    Science.gov (United States)

    Serrano, José; Puupponen-Pimiä, Riitta; Dauer, Andreas; Aura, Anna-Marja; Saura-Calixto, Fulgencio

    2009-09-01

    Tannins are a unique group of phenolic metabolites with molecular weights between 500 and 30 000 Da, which are widely distributed in almost all plant foods and beverages. Proanthocyanidins and hydrolysable tannins are the two major groups of these bioactive compounds, but complex tannins containing structural elements of both groups and specific tannins in marine brown algae have also been described. Most literature data on food tannins refer only to oligomeric compounds that are extracted with aqueous-organic solvents, but a significant number of non-extractable tannins are usually not mentioned in the literature. The biological effects of tannins usually depend on their grade of polymerisation and solubility. Highly polymerised tannins exhibit low bioaccessibility in the small intestine and low fermentability by colonic microflora. This review summarises a new approach to analysis of extractable and non-extractable tannins, major food sources, and effects of storage and processing on tannin content and bioavailability. Biological properties such as antioxidant, antimicrobial and antiviral effects are also described. In addition, the role of tannins in diabetes mellitus has been discussed.

  6. Survival and preference of cotton boll weevil adults for alternative food sources

    Directory of Open Access Journals (Sweden)

    M. Pimenta

    Full Text Available Abstract Plants that have potential as alternative food source (floral nectar, pollen and plant tissues to the boll weevil during the intercropping season were evaluated considering the prevalent conditions of Cerrado in the Central Brazil. Initially, we tested the nutritional adequacy for the survival of the insect of flower resource (pollen and nectar provided by eight plant species (fennel, mexican sunflower, castor bean, okra, hibiscus, sorghum, pigeonpea and sunn hemp. Subsequently, we tested if the resources provided by the selected plants continued to be exploited by the boll weevil in the presence of cotton plant, its main food source average longevity of boll weevil adults was significantly longer when they were fed on hibiscus’ flowers (166.6 ± 74.4 and okra flowers (34.7 ± 28.9 than when they fed on flowers of other six species. Subsequently, the preference of the boll weevil in the use of resources was compared between okra or hibiscus and cotton plants, in dual choice experiments. Boll weevils preferred plants of the three species in the reproductive stages than those in vegetative stages. Although the cotton plant in the reproductive stage was the most preferred plant of all, boll weevils preferred flowering okra and hibiscus than cotton at the vegetative stage.

  7. Food Proteins and Bioactive Peptides: New and Novel Sources, Characterisation Strategies and Applications

    Directory of Open Access Journals (Sweden)

    Maria Hayes

    2018-03-01

    Full Text Available By 2050, the world population is estimated to reach 9.6 billion, and this growth continues to require more food, particularly proteins. Moreover, the Westernisation of society has led to consumer demand for protein products that taste good and are convenient to consume, but additionally have nutritional and health maintenance and well-being benefits. Proteins provide energy, but additionally have a wide range of functions from enzymatic activities in the body to bioactivities including those associated with heart health, diabetes-type 2-prevention and mental health maintenance; stress relief as well as a plethora of other health beneficial attributes. Furthermore, proteins play an important role in food manufacture and often provide the binding, water- or oil-holding, emulsifying, foaming or other functional attributes required to ensure optimum sensory and taste benefits for the consumer. The purpose of this issue is to highlight current and new protein sources and their associated functional, nutritional and health benefits as well as best practices for quantifying proteins and bioactive peptides in both a laboratory and industry setting. The bioaccessibility, bioavailability and bioactivities of proteins from dairy, cereal and novel sources including seaweeds and insect protein and how they are measured and the relevance of protein quality measurement methods including the Protein Digestibility Amino Acid Score (PDCAAS and Digestible Indispensable Amino Acid Score (DIAAS are highlighted. In addition, predicted future protein consumption trends and new markets for protein and peptide products are discussed.

  8. Estimated Dietary Polyphenol Intake and Major Food and Beverage Sources among Elderly Japanese

    Directory of Open Access Journals (Sweden)

    Chie Taguchi

    2015-12-01

    Full Text Available Estimating polyphenol intake contributes to the understanding of polyphenols’ health benefits. However, information about human polyphenol intake is scarce, especially in the elderly. This study aimed to estimate the dietary intake and major sources of polyphenols and to determine whether there is any relationship between polyphenol intake and micronutrient intake in healthy elderly Japanese. First, 610 subjects (569 men, 41 women; aged 67.3 ± 6.1 years completed food frequency questionnaires. We then calculated their total polyphenol intake using our polyphenol content database. Their average total polyphenol intake was 1492 ± 665 mg/day, the greatest part of which was provided by beverages (79.1%. The daily polyphenol intake differed largely among individuals (183–4854 mg/day, also attributable mostly to beverage consumption. Coffee (43.2% and green tea (26.6% were the major sources of total polyphenol; the top 20 food items accounted for >90%. The polyphenol intake did not strongly correlate with the intake of any micronutrient, suggesting that polyphenols may exert health benefits independently of nutritional intake. The polyphenol intake in this elderly population was slightly higher than previous data in Japanese adults, and beverages such as coffee and green tea contributed highly to the intake.

  9. Interrogating pollution sources in a mangrove food web using multiple stable isotopes.

    Science.gov (United States)

    Souza, Iara da C; Arrivabene, Hiulana P; Craig, Carol-Ann; Midwood, Andrew J; Thornton, Barry; Matsumoto, Silvia T; Elliott, Michael; Wunderlin, Daniel A; Monferrán, Magdalena V; Fernandes, Marisa N

    2018-06-01

    Anthropogenic activities including metal contamination create well-known problems in coastal mangrove ecosystems but understanding and linking specific pollution sources to distinct trophic levels within these environments is challenging. This study evaluated anthropogenic impacts on two contrasting mangrove food webs, by using stable isotopes (δ 13 C, δ 15 N, 87 Sr/ 86 Sr, 206 Pb/ 207 Pb and 208 Pb/ 207 Pb) measured in sediments, mangrove trees (Rhizophora mangle, Laguncularia racemosa, Avicennia schaueriana), plankton, shrimps (Macrobranchium sp.), crabs (Aratus sp.), oysters (Crassostrea rhizophorae) and fish (Centropomus parallelus) from both areas. Strontium and Pb isotopes were also analysed in water and atmospheric particulate matter (PM). δ 15 N indicated that crab, shrimp and oyster are at intermediate levels within the local food web and fish, in this case C. parallelus, was confirmed at the highest trophic level. δ 15 N also indicates different anthropogenic pressures between both estuaries; Vitória Bay, close to intensive human activities, showed higher δ 15 N across the food web, apparently influenced by sewage. The ratio 87 Sr/ 86 Sr showed the primary influence of marine water throughout the entire food web. Pb isotope ratios suggest that PM is primarily influenced by metallurgical activities, with some secondary influence on mangrove plants and crabs sampled in the area adjacent to the smelting works. To our knowledge, this is the first demonstration of the effect of anthropogenic pollution (probable sewage pollution) on the isotopic fingerprint of estuarine-mangrove systems located close to a city compared to less impacted estuarine mangroves. The influence of industrial metallurgical activity detected using Pb isotopic analysis of PM and mangrove plants close to such an impacted area is also notable and illustrates the value of isotopic analysis in tracing the impact and species affected by atmospheric pollution. Copyright © 2018 Elsevier B

  10. Biology and nutrition of Spodoptera frugiperda (Lepidoptera: Noctuidae fed on different food sources

    Directory of Open Access Journals (Sweden)

    Débora Mello da Silva

    Full Text Available ABSTRACT: We studied Spodoptera frugiperda development using different food sources in the laboratory and field. Newly hatched larvae were fed soybean, cotton, maize, wheat, and oat leaves. An artificial diet was used as the control. Duration of pre-pupal, pupal, and larva-adult period, pupal weight, sex ratio, survival, larva feeding preferences, oviposition preferences, and nutritional quality of different hosts were evaluated. Insects fed on wheat showed the shortest larva-adult period. The insects fed on cotton and soybean had longer larval development cycles and pupae of lower weight. Feeding preference was evident for third instar larvae and did not differ between wheat, oat, maize, and soybean, which were the preferred hosts. Moths oviposited to a greater extent on the upper canopy of wheat than that of other plants in both the no-choice and free-choice tests. Treatments influenced insect growth, food consumption, and digestion when nutritional variables were analyzed. Thus, grasses were better hosts for S. frugiperda development. Cotton was the least preferred food, followed by soybean. The present study can improve our understanding of S. frugiperda in these different crops and help in developing management strategies. Even though S. frugiperda is considered to be polyphagous, this pest is closely associated with grasses (maize, wheat, oat and has lower potential as a soybean or cotton feeder. Howerver, S. frugiperda food intake regulation appears to be triggered by a complex of different mechanisms. Thus, S. frugiperda can also damage soybean and cotton and adapt to them in the absence of preferred hosts.

  11. Comparative economic factors on the use of radionuclide or electrical sources for food processing with ionizing radiation

    International Nuclear Information System (INIS)

    Lagunas-Solar, M.C.

    1985-01-01

    Food irradiation is a promising addition to conventional food processing techniques. However, as is the case with most new technologies, its economic suitability will be determined by comparison to current methods. Assuming that current food processing facilities are adaptable to the incorporation of a food irradiation capability, an analysis of cost for several different optional systems able to process up to 100 Mrad ton/day (1 MGy ton/day; or 1,000 ton/day at 100 krad) will be made. Both radionuclide and electrical accelerators will be compared as sources of ionizing radiation. The cost of irradiation will be shown to be competitive with most other treatments including fumigation, low-temperature storage, and controlled atmosphere. A proper figure-of-merit for comparing the different sources will be defined and used as a basis for an economic evaluation of food irradiation. (author)

  12. Dietary intakes and food sources of fatty acids in Guatemalan schoolchildren: A cross-sectional study

    LENUS (Irish Health Repository)

    Bermudez, Odilia I.

    2010-04-23

    Abstract Background Consumption of healthy diets that contribute with adequate amounts of fat and fatty acids is needed for children. Among Guatemalan children, there is little information about fat intakes. Therefore, the present study sought to assess intakes of dietary fats and examine food sources of those fats in Guatemalan children. Methods The study subjects consisted of a convenience sample of 449 third- and fourth-grade schoolchildren (8-10 y), attending public or private schools in Quetzaltenango City, Guatemala. Dietary data was obtained by means of a single pictorial 24-h record. Results The percentages of total energy (%E) from total fat, saturated fat (SFA) and monounsaturated fat (MUFA) reached 29%E for total fat and 10%E for each SFA and MUFA, without gender differences. %E from fats in high vs. low-socio economic status (SES) children were significantly higher for boys, but not for girls, for total fat (p = 0.002) and SFA (p < 0.001). Large proportions of the children had low levels of intakes of some fatty acids (FA), particularly for n-3 FA, with >97% of all groups consuming less than 1%E from this fats. Fried eggs, sweet rolls, whole milk and cheese were main sources of total fat and, SFA. Whole milk and sweet bread were important sources of n-3 FA for high- and low-SES boys and girls, respectively. Fried plantain was the main source of n-3 FA for girls in the high-SES group. Fried fish, seafood soup, and shrimp, consumed only by boys in low amounts, were sources of eicosapentaenoic (EPA) and docosahexaenoic (DHA) acids, which may explain the low intakes of these nutrients. Conclusions α-linolenic acid, EPA and DHA were the most limiting fatty acids in diets of Guatemalan schoolchildren, which could be partially explained by the low consumption of sources of these nutrients, particularly fish and seafood (for EPA and DHA). This population will benefit from a higher consumption of culturally acceptable foods that are rich in these limiting

  13. Inherent variation in multiple shoe-sole test impressions.

    Science.gov (United States)

    Shor, Yaron; Wiesner, Sarena; Tsach, Tsadok; Gurel, Ron; Yekutieli, Yoram

    2018-04-01

    Shoeprints left at crime scenes are seldom perfect. Many prints are distorted or contaminated by various materials. Noisy background often contributes to vagueness on the shoeprints as well. Test impressions made from the suspect's shoes in the laboratory are considered a genuine replication of the shoe-sole. This naïve attitude is far from being correct. Consecutive test impressions made in the laboratory under strict similar conditions revealed differences among the exemplars of the same sole. Some of them are minor, but some are major, and can mislead the less experienced practitioners during the comparison process. This article focuses on the inherent within source variability between controlled shoeprints made from the same shoe, as it appears on the RACs. To describe and analyze this variability, repeated test impressions were prepared, and datasets were created. Several RACs were marked on each test impression, using an expert assisting software tool (developed in the authors' lab). The variance in repeated test impressions is demonstrated and possible sources are discussed. This variance should be considered when trying to establish the degree of matching between individual characteristics. Copyright © 2017. Published by Elsevier B.V.

  14. Share your sweets: Chimpanzee (Pan troglodytes) and bonobo (Pan paniscus) willingness to share highly attractive, monopolizable food sources.

    Science.gov (United States)

    Byrnit, Jill T; Høgh-Olesen, Henrik; Makransky, Guido

    2015-08-01

    All over the world, humans (Homo sapiens) display resource-sharing behavior, and common patterns of sharing seem to exist across cultures. Humans are not the only primates to share, and observations from the wild have long documented food sharing behavior in our closest phylogenetic relatives, chimpanzees (Pan troglodytes) and bonobos (Pan paniscus). However, few controlled studies have been made in which groups of Pan are introduced to food items that may be shared or monopolized by a first food possessor, and very few studies have examined what happens to these sharing patterns if the food in question is a highly attractive, monopolizable food source. The one study to date to include food quality as the independent variable used different types of food as high- and low-value items, making differences in food divisibility and size potentially confounding factors. It was the aim of the present study to examine the sharing behavior of groups of captive chimpanzees and bonobos when introducing the same type of food (branches) manipulated to be of 2 different degrees of desirability (with or without syrup). Results showed that the large majority of food transfers in both species came about as sharing in which group members were allowed to cofeed or remove food from the stock of the food possessor, and the introduction of high-value food resulted in more sharing, not less. Food sharing behavior differed between species in that chimpanzees displayed significantly more begging behavior than bonobos. Bonobos, instead, engaged in sexual invitations, which the chimpanzees never did. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

  15. Effects of alkalinity sources on the stability of anaerobic digestion from food waste.

    Science.gov (United States)

    Chen, Shujun; Zhang, Jishi; Wang, Xikui

    2015-11-01

    This study investigated the effects of some alkalinity sources on the stability of anaerobic digestion (AD) from food waste (FW). Four alkalinity sources, namely lime mud from papermaking (LMP), waste eggshell (WES), CaCO3 and NaHCO3, were applied as buffer materials and their stability effects were evaluated in batch AD. The results showed that LMP and CaCO3 had more remarkable effects than NaHCO3 and WES on FW stabilization. The methane yields were 120.2, 197.0, 156.2, 251.0 and 194.8 ml g(-1) VS for the control and synergistic digestions of CaCO3, NaHCO3, LMP and WES added into FW, respectively. The corresponding final alkalinity reached 5906, 7307, 9504, 7820 and 6782 mg l(-1), while the final acidities were determined to be 501, 200, 50, 350 and 250 mg l(-1), respectively. This indicated that the synergism between alkalinity and inorganic micronutrients from different alkalinity sources played an important role in the process stability of AD from FW. © The Author(s) 2015.

  16. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  17. ANTIMICROBIAL DRUG RESISTANCE IN STRAINS OF Escherichia coli ISOLATED FROM FOOD SOURCES

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin Rasheed

    2014-07-01

    Full Text Available A variety of foods and environmental sources harbor bacteria that are resistant to one or more antimicrobial drugs used in medicine and agriculture. Antibiotic resistance in Escherichia coli is of particular concern because it is the most common Gram-negative pathogen in humans. Hence this study was conducted to determine the antibiotic sensitivity pattern of E. coli isolated from different types of food items collected randomly from twelve localities of Hyderabad, India. A total of 150 samples comprising; vegetable salad, raw egg-surface, raw chicken, unpasteurized milk, and raw meat were processed microbiologically to isolate E. coli and to study their antibiotic susceptibility pattern by the Kirby-Bauer method. The highest percentages of drug resistance in isolates of E. coli were detected from raw chicken (23.3% followed by vegetable salad (20%, raw meat (13.3%, raw egg-surface (10% and unpasteurized milk (6.7%. The overall incidence of drug resistant E. coli was 14.7%. A total of six (4% Extended Spectrum β-Lactamase (ESBL producers were detected, two each from vegetable salads and raw chicken, and one each from raw egg-surface and raw meat. Multidrug resistant strains of E. coli are a matter of concern as resistance genes are easily transferable to other strains. Pathogen cycling through food is very common and might pose a potential health risk to the consumer. Therefore, in order to avoid this, good hygienic practices are necessary in the abattoirs to prevent contamination of cattle and poultry products with intestinal content as well as forbidding the use of untreated sewage in irrigating vegetables.

  18. Shallow-water habitats as sources of fallback foods for hominins.

    Science.gov (United States)

    Wrangham, Richard; Cheney, Dorothy; Seyfarth, Robert; Sarmiento, Esteban

    2009-12-01

    Underground storage organs (USOs) have been proposed as critical fallback foods for early hominins in savanna, but there has been little discussion as to which habitats would have been important sources of USOs. USOs consumed by hominins could have included both underwater and underground storage organs, i.e., from both aquatic and terrestrial habitats. Shallow aquatic habitats tend to offer high plant growth rates, high USO densities, and relatively continuous USO availability throughout the year. Baboons in the Okavango delta use aquatic USOs as a fallback food, and aquatic or semiaquatic USOs support high-density human populations in various parts of the world. As expected given fossilization requisites, the African early- to mid-Pleistocene shows an association of Homo and Paranthropus fossils with shallow-water and flooded habitats where high densities of plant-bearing USOs are likely to have occurred. Given that early hominins in the tropics lived in relatively dry habitats, while others occupied temperate latitudes, ripe, fleshy fruits of the type preferred by African apes would not normally have been available year round. We therefore suggest that water-associated USOs were likely to have been key fallback foods, and that dry-season access to aquatic habitats would have been an important predictor of hominin home range quality. This study differs from traditional savanna chimpanzee models of hominin origins by proposing that access to aquatic habitats was a necessary condition for adaptation to savanna habitats. It also raises the possibility that harvesting efficiency in shallow water promoted adaptations for habitual bipedality in early hominins.

  19. Non-human C. difficile Reservoirs and Sources: Animals, Food, Environment.

    Science.gov (United States)

    Rodriguez Diaz, Cristina; Seyboldt, Christian; Rupnik, Maja

    2018-01-01

    Clostridium difficile is ubiquitous and is found in humans, animals and in variety of environments. The substantial overlap of ribotypes between all three main reservoirs suggests the extensive transmissions. Here we give the overview of European studies investigating farm, companion and wild animals, food and environments including water, soil, sediment, waste water treatment plants, biogas plants, air and households. Studies in Europe are more numerous especially in last couple of years, but are still fragmented in terms of countries, animal species or type of environment covered. Soil seem to be the habitat of divergent unusual lineages of C. difficile. But the most important aspect of animals and environment is their role in C. difficile transmissions and their potential as a source for human infection is discussed.

  20. The effect of proteins from animal source foods on heme iron bioavailability in humans.

    Science.gov (United States)

    Pizarro, Fernando; Olivares, Manuel; Valenzuela, Carolina; Brito, Alex; Weinborn, Valerie; Flores, Sebastián; Arredondo, Miguel

    2016-04-01

    Forty-five women (35-45 year) were randomly assigned to three iron (Fe) absorption sub-studies, which measured the effects of dietary animal proteins on the absorption of heme Fe. Study 1 was focused on heme, red blood cell concentrate (RBCC), hemoglobin (Hb), RBCC+beef meat; study 2 on heme, heme+fish, chicken, and beef; and study 3 on heme and heme+purified animal protein (casein, collagen, albumin). Study 1: the bioavailability of heme Fe from Hb was similar to heme only (∼13.0%). RBCC (25.0%) and RBCC+beef (21.3%) were found to be increased 2- and 1.6-fold, respectively, when compared with heme alone (pProteins from animal source foods and their digestion products did not enhance heme Fe absorption. Copyright © 2015. Published by Elsevier Ltd.

  1. Biological denitrification from mature landfill leachate using a food-waste-derived carbon source.

    Science.gov (United States)

    Yan, Feng; Jiang, Jianguo; Zhang, Haowei; Liu, Nuo; Zou, Quan

    2018-05-15

    The mature landfill leachate containing high ammonia concentration (>1000 mg/L) is a serious threat to environment; however, the low COD to TN ratio (C/N, waste and oil-added food waste, were first applied as external carbon sources for the biological nitrogen removal from mature landfill leachate in an aerobic/anoxic membrane bioreactor. "Acidogenic liquid b" served quite better than commercial sodium acetate, considering the higher denitrification efficiency and the slightly rapider denitrification rate. The effect of C/N and temperature were investigated under hydraulic retention time (HRT) of 7 d, which showed that C/N ≥ 7 (25 °C) was enough to meet the general discharge standards of NH 4 + -N, TN and COD in China. Even for some special areas of China, the more stringent discharge standards (NH 4 + -N ≤ 8 mg/L, TN ≤ 20 mg/L) could also be achieved under longer HRT of 14 d and C/N ≥ 6. Notably, the COD concentration in effluent could also be well reduced to 50-55 mg/L, without further physical-chemical treatment. This proposed strategy, involving the high-value utilization of food waste, is thus promising for efficient nitrogen removal from mature landfill leachate. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Food for the Future: A Study of Insects as a Protein Source

    Science.gov (United States)

    Riggs, S.

    2017-12-01

    This study is designed to gain a sustainable, organic food source containing the proper amino acids, minerals, and protein to sustain the needs of human life on Earth as the current economy and environment will not be able to equip the needs for the future. The hypotheses are if available protein is increased in an insect's diet then their nutritional value will increase to fulfill a human's daily protein requirements in one serving size or less for each species tested and if there is a higher content of protein in the insects, then food created with it will receive higher ratings. Protein supplements were added to an insect's natural diet to increase nutritional value. Protein value in the insects increased to fulfill a human's daily dietary protein requirement in a third of a serving size. Biuret and absorption spectrometry testing demonstrates this correlation. Insects increased protein in their body showing a positive correlation to the hypothesis. Week one, protein values doubled and tripled in some species, unexpectedly. After three weeks, protein still continued increasing. There was high success in increasing the protein value in the different species of insects chosen. Is there a taste difference benefit with a higher content of protein in the insects? Over 55% of participants rated the brownies with more protein higher than the control groups, and overall 88% preferred brownies with insects opposed to without, supporting the second hypothesis.

  3. Isotopic study of mercury sources and transfer between a freshwater lake and adjacent forest food web

    International Nuclear Information System (INIS)

    Kwon, Sae Yun; Blum, Joel D.; Nadelhoffer, Knute J.; Timothy Dvonch, J.; Tsui, Martin Tsz-Ki

    2015-01-01

    Studies of monomethylmercury (MMHg) sources and biogeochemical pathways have been extensive in aquatic ecosystems, but limited in forest ecosystems. Increasing evidence suggests that there is significant mercury (Hg) exchange between aquatic and forest ecosystems. We use Hg stable isotope ratios (δ 202 Hg and Δ 199 Hg) to investigate the relative importance of MMHg sources and assess Hg transfer pathways between Douglas Lake and adjacent forests located at the University of Michigan Biological Station, USA. We characterize Hg isotopic compositions of basal resources and use linear regression of % MMHg versus δ 202 Hg and Δ 199 Hg to estimate Hg isotope values for inorganic mercury (IHg) and MMHg in the aquatic and adjacent forest food webs. In the aquatic ecosystem, we found that lake sediment represents a mixture of IHg pools deposited via watershed runoff and precipitation. The δ 202 Hg and Δ 199 Hg values estimated for IHg are consistent with other studies that measured forest floor in temperate forests. The Δ 199 Hg value estimated for MMHg in the aquatic food web indicates that MMHg is subjected to ~ 20% photochemical degradation prior to bioaccumulation. In the forest ecosystem, we found a significant negative relationship between total Hg and δ 202 Hg and Δ 199 Hg of soil collected at multiple distances from the lakeshore and lake sediment. This suggests that IHg input from watershed runoff provides an important Hg transfer pathway between the forest and aquatic ecosystems. We measured Δ 199 Hg values for high trophic level insects and compared these insects at multiple distances perpendicular to the lake shoreline. The Δ 199 Hg values correspond to the % canopy cover suggesting that forest MMHg is subjected to varying extents of photochemical degradation and the extent may be controlled by sunlight. Our study demonstrates that the use of Hg isotopes adds important new insight into the relative importance of MMHg sources and complex Hg transfer

  4. Isotopic study of mercury sources and transfer between a freshwater lake and adjacent forest food web

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Sae Yun, E-mail: saeyunk@umich.edu [Department of Earth and Environmental Sciences, University of Michigan, 1100 N. University Ave, Ann Arbor, MI 48109 (United States); Blum, Joel D. [Department of Earth and Environmental Sciences, University of Michigan, 1100 N. University Ave, Ann Arbor, MI 48109 (United States); Department of Ecology and Evolutionary Biology, University of Michigan, 830 N. University Ave, Ann Arbor, MI 48109 (United States); Nadelhoffer, Knute J. [Department of Ecology and Evolutionary Biology, University of Michigan, 830 N. University Ave, Ann Arbor, MI 48109 (United States); Timothy Dvonch, J. [Department of Environmental Health Sciences, University of Michigan, 1415 Washington Heights, Ann Arbor, MI 48109 (United States); Tsui, Martin Tsz-Ki [Department of Biology, University of North Carolina at Greensboro, 321 McIver Street, Greensboro, NC 27402 (United States)

    2015-11-01

    Studies of monomethylmercury (MMHg) sources and biogeochemical pathways have been extensive in aquatic ecosystems, but limited in forest ecosystems. Increasing evidence suggests that there is significant mercury (Hg) exchange between aquatic and forest ecosystems. We use Hg stable isotope ratios (δ{sup 202}Hg and Δ{sup 199}Hg) to investigate the relative importance of MMHg sources and assess Hg transfer pathways between Douglas Lake and adjacent forests located at the University of Michigan Biological Station, USA. We characterize Hg isotopic compositions of basal resources and use linear regression of % MMHg versus δ{sup 202}Hg and Δ{sup 199}Hg to estimate Hg isotope values for inorganic mercury (IHg) and MMHg in the aquatic and adjacent forest food webs. In the aquatic ecosystem, we found that lake sediment represents a mixture of IHg pools deposited via watershed runoff and precipitation. The δ{sup 202}Hg and Δ{sup 199}Hg values estimated for IHg are consistent with other studies that measured forest floor in temperate forests. The Δ{sup 199}Hg value estimated for MMHg in the aquatic food web indicates that MMHg is subjected to ~ 20% photochemical degradation prior to bioaccumulation. In the forest ecosystem, we found a significant negative relationship between total Hg and δ{sup 202}Hg and Δ{sup 199}Hg of soil collected at multiple distances from the lakeshore and lake sediment. This suggests that IHg input from watershed runoff provides an important Hg transfer pathway between the forest and aquatic ecosystems. We measured Δ{sup 199}Hg values for high trophic level insects and compared these insects at multiple distances perpendicular to the lake shoreline. The Δ{sup 199}Hg values correspond to the % canopy cover suggesting that forest MMHg is subjected to varying extents of photochemical degradation and the extent may be controlled by sunlight. Our study demonstrates that the use of Hg isotopes adds important new insight into the relative

  5. Attribution of Human Listeria monocytogenes Infections in England and Wales to Ready-to-Eat Food Sources Placed on the Market: Adaptation of the Hald Salmonella Source Attribution Model

    DEFF Research Database (Denmark)

    Little, Christine L.; Pires, Sara Monteiro; Gillespie, Iain A.

    2010-01-01

    the potential of this approach to quantify the contribution of different food sources to the burden of human listeriosis in England and Wales from 2004 to 2007. The most important food sources for the overall population were multicomponent foods (sandwiches and prepacked mixed salad vegetables) (23.1%), finfish...

  6. Determination of food sources for benthic invertebrates in a salt marsh (Aiguillon Bay, France) by carbon and nitrogen stable isotopes: importance of locally produced sources

    NARCIS (Netherlands)

    Riera, P.; Stal, L.J.; Nieuwenhuize, J.; Richard, P.; Blanchard, G.F.; Gentil, F.

    1999-01-01

    delta(13)C and delta(15)N were measured in benthic invertebrates and food sources collected in the salt marsh of the Aiguillon Bay, France. The results showed that, although Spartina anglica was dominant, this marine phanerogame did not contribute significantly to the carbon and nitrogen

  7. Orange-fleshed sweet potato-based infant food is a better source of dietary vitamin A than a maize-legume blend as complementary food.

    Science.gov (United States)

    Amagloh, Francis Kweku; Coad, Jane

    2014-03-01

    White maize, which is widely used for complementary feeding and is seldom fortified at the household level, may be associated with the high prevalence of vitamin A deficiency among infants in low-income countries. The nutrient composition of complementary foods based on orange-fleshed sweet potato (OFSP) and cream-fleshed sweet potato (CFSP), maize-soybean-groundnut (Weanimix), and a proprietary wheat-based infant cereal (Nestlé Cerelac) were assessed using the Codex Standard (CODEX STAN 074-1981, Rev. 1-2006) specification as a reference. Additionally, the costs of OFSP complementary food, CFSP complementary food, and Weanimix production at the household level were estimated. Phytate and polyphenols, which limit the bioavailability of micronutrients, were assessed. Energy, macronutrients, and micronutrients listed as essential composition in the Codex Standard were determined and expressed as energy or nutrient density. All the formulations met the stipulated energy and nutrient densities as specified in the Codex Standard. The beta-carotene content of OFSP complementary food exceeded the vitamin A specification (60 to 180 microg retinol activity equivalents/100 kcal). All the formulations except Weanimix contained measurable amounts of ascorbic acid (> or = 32.0 mg/100 g). The level of phytate in Weanimix was highest, about twice that of OFSP complementary food. The sweet potato-based foods contained about twice as much total polyphenols as the cereal-based products. The estimated production cost of OFSP complementary food was slightly higher (1.5 times) than that of Weanimix. OFSP complementary food is a good source of beta-carotene and would therefore contribute to the vitamin A requirements of infants. Both OFSP complementary food and Weanimix may inhibit iron absorption because of their high levels of polyphenols and phytate, respectively, compared with those of Nestlé Cerelac.

  8. Dietary exposure of juvenile common sole (Solea solea L.) to polybrominated diphenyl ethers (PBDEs): Part 2. Formation, bioaccumulation and elimination of hydroxylated metabolites

    International Nuclear Information System (INIS)

    Munschy, C.; Heas-Moisan, K.; Tixier, C.; Pacepavicius, G.; Alaee, M.

    2010-01-01

    The uptake, elimination and transformation of six PBDE congeners (BDE-28, -47, -99, -100, -153, -209) were studied in juvenile common sole (Solea solea L.) exposed to spiked contaminated food over a three-month period, and then depurated over a five-month period. Methoxylated (MeO-) and hydroxylated (OH-) PBDEs were determined in fish plasma exposed to PBDEs and compared to those obtained in control fish. While all MeO- and some OH- congeners identified in fish plasma were found to originate from non-metabolic sources, several OH- congeners, i.e., OH-tetraBDEs and OH-pentaBDEs, were found to originate from fish metabolism. Among these, 4'-OH-BDE-49 was identified as a BDE-47 metabolite. Congener 4'-OH-BDE-101, identified here for the first time, may be the result of BDE-99 metabolic transformation. Our results unequivocally showed that PBDEs are metabolised in juvenile sole via the formation of OH- metabolites. However, this was not a major biotransformation route compared to biotransformation through debromination. - Juvenile sole exposed to artificially-contaminated food showed the ability to biotransform PBDEs into hydroxylated metabolites; these meta-bolites accumulated in fish.

  9. Development of an updated phytoestrogen database for use with the SWAN food frequency questionnaire: intakes and food sources in a community-based, multiethnic cohort study.

    Science.gov (United States)

    Huang, Mei-Hua; Norris, Jean; Han, Weijuan; Block, Torin; Gold, Ellen; Crawford, Sybil; Greendale, Gail A

    2012-01-01

    Phytoestrogens, heterocyclic phenols found in plants, may benefit several health outcomes. However, epidemiologic studies of the health effects of dietary phytoestrogens have yielded mixed results, in part due to challenges inherent in estimating dietary intakes. The goal of this study was to improve the estimates of dietary phytoestrogen consumption using a modified Block Food Frequency Questionnaire (FFQ), a 137-item FFQ created for the Study of Women's Health Across the Nation (SWAN) in 1994. To expand the database of sources from which phytonutrient intakes were computed, we conducted a comprehensive PubMed/Medline search covering January 1994 through September 2008. The expanded database included 4 isoflavones, coumestrol, and 4 lignans. The new database estimated isoflavone content of 105 food items (76.6%) vs. 14 (10.2%) in the 1994 version and computed coumestrol content of 52 food items (38.0%), compared to 1 (0.7%) in the original version. Newly added were lignans; values for 104 FFQ food items (75.9%) were calculated. In addition, we report here the phytonutrient intakes for each racial and language group in the SWAN sample and present major food sources from which the phytonutrients came. This enhanced ascertainment of phytoestrogens will permit improved studies of their health effects.

  10. Nile tilapia Oreochromis niloticus as a food source in advanced life support systems: Initial considerations

    Science.gov (United States)

    Gonzales, John M.; Brown, Paul B.

    2006-01-01

    Maintenance of crew health is of paramount importance for long duration space missions. Weight loss, bone and calcium loss, increased exposure to radiation and oxidative stress are critical concerns that need to be alleviated. Tilapia are currently under evaluation as a source of food and their contribution to reducing waste in advanced life support systems (ALSS). The nutritional composition of tilapia whole bodies, fillet, and carcass residues were quantitatively determined. Carbon and nitrogen free-extract percentages were similar among whole body (53.76% and 6.96%, respectively), fillets (47.06% and 6.75%, respectively), and carcass (56.36% and 7.04%, respectively) whereas percentages of N, S, and protein were highest in fillet (13.34, 1.34, and 83.37%, respectively) than whole body (9.27, 0.62, and 57.97%, respectively) and carcass (7.70, 0.39, and 48.15%, respectively). Whole body and fillet meet and/or exceeded current nutritional recommendations for protein, vitamin D, ascorbic acid, and selenium for international space station missions. Whole body appears to be a better source of lipids and n-3 fatty acids, calcium, and phosphorous than fillet. Consuming whole fish appears to optimize equivalent system mass compared to consumption of fillets. Additional research is needed to determine nutritional composition of tilapia whole body, fillet, and carcass when fed waste residues possibly encountered in an ALSS.

  11. How Growing Complexity of Consumer Choices and Drivers of Consumption Behaviour Affect Demand for Animal Source Foods.

    Science.gov (United States)

    Perry, B D; Grace, D C

    2015-12-01

    Many societies are spoiled for choice when they purchase meat and other livestock products, and around the globe food choice has grown dramatically in the last two decades. What is more, besides the cost and obvious health concerns influencing commodity section, an increasing proportion of choices is made to contribute to the achievement of certain ideals, such as natural resource management, climate change mitigation, animal welfare concerns and personal lifestyle. At the same time, human health considerations are becoming more important for consumption choices as richer societies, and increasingly the urban poor in low- and middle-income countries, face an unprecedented epidemic of over-consumption and associated diet-related non-communicable diseases. Animal source foods are considered significant contributors to this trend. This paper reviews this complicated arena, and explores the range of considerations that influence consumers' preferences for meat and other animal source foods. This paper also argues that deeper drivers of consumption behaviour of many foods may act in opposition to the articulated preferences for choices around animal source food consumption. We review how the returns to different causes are being valued, how emerging metrics are helping to manage and influence consumption behaviours, and draw conclusions regarding options which influence food choice.

  12. Screening assays of termite gut microbes that potentially as probiotic for human to digest cellulose as new food source

    Science.gov (United States)

    Abdullah, R.; Ananda, K. R. T.; Wijanarka

    2018-05-01

    According to UN, earth population will increase approximately 7.3 billion people up to 11.2 billion from 2015 until 2100. On the other side, food needs are not balance with the availability of food on earth. People of the world need solution for a new food source. By cellulose digesting ability, people analyzed can consume cellulose as the new food source to get glucose. The aims of research is obtaining termite gut cellulase bacteria selected which is potential as probiotic to split cellulose. Method used was as follows; isolation of termite gut microbes, microbial cellulase purification by screening method and probiotic test includes microbial pathogenicity test and human stomach acid and salt osmotic concentration resistance test. The result shows, 3 pure isolates of termite gut microbes can break down cellulose in the medium 1% CMC and 0.1% congo red (indicator of cellulose degradation activity) and life at pH 2- 2.5 and osmotic salt condition. Two isolates show the activity of gamma hemolysis (non-pathogenic in terms of pathogenicity on human blood). In conclusion, there are isolated termite gut microbes can be used as probiotic candidate for human to digest cellulose of the new food source for global food scarcity era.

  13. Food source quality and ant dominance hierarchy influence the outcomes of ant-plant interactions in an arid environment

    Science.gov (United States)

    Flores-Flores, Rocío Vianey; Aguirre, Armando; Anjos, Diego V.; Neves, Frederico S.; Campos, Ricardo I.; Dáttilo, Wesley

    2018-02-01

    In this study, we conducted a series of experiments in a population of Vachellia constricta (Fabaceae) in the arid Tehuacan-Cuicatláan valley, Mexico, in order to evaluate if the food source quality and ant dominance hierarchy influence the outcomes of ant-plant interactions. Using an experiment with artificial nectaries, we observed that ants foraging on food sources with higher concentration of sugar are quicker in finding and attacking potential herbivorous insects. More specifically, we found that the same ant species may increase their defence effectiveness according to the quality of food available. These findings indicate that ant effectiveness in plant protection is context-dependent and may vary according to specific individual characteristics of plants. In addition, we showed that competitively superior ant species tend to dominate plants in periods with high nectar activity, emphasizing the role of the dominance hierarchy structuring ant-plant interactions. However, when high sugar food sources were experimentally available ad libitum, the nocturnal and competitively superior ant species, Camponotus atriceps, did not dominate the artificial nectaries during the day possibly due to limitation of its thermal tolerance. Therefore, temporal niche partitioning may be allowing the coexistence of two dominant ant species (Camponotus rubritorax during the day and C. atriceps at night) on V. constricta. Our findings indicate that the quality of the food source, and temporal shifts in ant dominance are key factors which structure the biotic plant defences in an arid environment.

  14. 25 CFR 140.1 - Sole power to appoint.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Sole power to appoint. 140.1 Section 140.1 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FINANCIAL ACTIVITIES LICENSED INDIAN TRADERS § 140.1 Sole power to appoint. The Commissioner of Indian Affairs shall have the sole power and authority to...

  15. Selenium Accumulating Leafy Vegetables Are a Potential Source of Functional Foods

    Directory of Open Access Journals (Sweden)

    Petro E. Mabeyo

    2015-01-01

    Full Text Available Selenium deficiency in humans has been associated with various diseases, the risks of which can be reduced through dietary supplementation. Selenium accumulating plants may provide a beneficial nutrient for avoiding such illnesses. Thus, leafy vegetables such as Amaranthus hybridus, Amaranthus sp., Cucurbita maxima, Ipomoea batatas, Solanum villosum, Solanum scabrum, and Vigna unguiculata were explored for their capabilities to accumulate selenium when grown on selenium enriched soil and for use as a potential source of selenium enriched functional foods. Their selenium contents were determined by spectrophotometry using the complex of 3,3′-diaminobenzidine hydrochloride (DABH as a chromogen. The mean concentrations in the leaves were found to range from 7.90±0.40 to 1.95±0.12 μg/g dry weight (DW, with C. maxima accumulating the most selenium. In stems, the accumulated selenium content ranged from 1.12±0.10 μg/g in Amaranthus sp. to 5.35±0.78 μg/g DW in C. maxima and was hence significantly different (P<0.01. The cancer cell line MDA-MB-231 was used in cytotoxicity assays to determine the anticancer potential of these extracts. With exception of S. scabrum and S. villosum, no cytotoxicity was detected for the selenium enriched vegetable extracts up to 100 μg/mL concentration. Hence, following careful evaluation the studied vegetables may be considered as selenium enriched functional foods.

  16. Food Sources of Sodium Intake in an Adult Mexican Population: A Sub-Analysis of the SALMEX Study

    Science.gov (United States)

    Colin-Ramirez, Eloisa; Miranda-Alatriste, Paola Vanessa; Tovar-Villegas, Verónica Ivette; Arcand, JoAnne; Correa-Rotter, Ricardo

    2017-01-01

    Excessive dietary sodium intake increases blood pressure and cardiovascular risk. In Western diets, the majority of dietary sodium comes from packaged and prepared foods (≈75%); however, in Mexico there is no available data on the main food sources of dietary sodium. The main objective of this study was to identify and characterize the major food sources of dietary sodium in a sample of the Mexican Salt and Mexico (SALMEX) cohort. Adult male and female participants of the SALMEX study who provided a complete and valid three-day food record during the baseline visit were included. Overall, 950 participants (mean age 38.6 ± 10.7 years) were analyzed to determine the total sodium contributed by the main food sources of sodium identified. Mean daily sodium intake estimated by three-day food records and 24-h urinary sodium excretion was 2647.2 ± 976.9 mg/day and 3497.2 ± 1393.0, in the overall population, respectively. Processed meat was the main contributor to daily sodium intake, representing 8% of total sodium intake per capita as measured by three-day food records. When savory bread (8%) and sweet bakery goods (8%) were considered together as bread products, these were the major contributor to daily sodium intake, accounting for the 16% of total sodium intake, followed by processed meat (8%), natural cheeses (5%), and tacos (5%). These results highlight the need for public health policies focused on reducing the sodium content of processed food in Mexico. PMID:28749449

  17. Do food blogs serve as a source of nutritionally balanced recipes? An analysis of 6 popular food blogs.

    Science.gov (United States)

    Schneider, Elizabeth P; McGovern, Emily E; Lynch, Colleen L; Brown, Lisa S

    2013-01-01

    To determine whether sampled food blogs provide nutritionally balanced recipes. Two entree recipes per season, per year (2010-2011) were selected from 6 highly ranked food blogs (n = 96). Food Processor Nutrition and Fitness software was used to analyze sodium, saturated fat, and energy content. Analysis was separated by protein type (vegetarian, poultry, red meat, and seafood). Recipes met energy recommendations but were excessive in saturated fat and sodium. Vegetarian and seafood recipes were significantly lower in risk nutrients compared with red meat and poultry recipes. Red meat recipes were not significantly different from poultry recipes for risk nutrients studied; poultry recipes were higher in sodium and energy compared with red meat recipes. The public should be aware of the nutritional limitations of popular food blogs; dietitians could assist in modifying blog recipes for individuals and partner with bloggers to improve the nutritional profile of recipes. Copyright © 2013 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  18. 75 FR 31321 - Fisheries of the Exclusive Economic Zone Off Alaska; Rock Sole, Flathead Sole, and “Other...

    Science.gov (United States)

    2010-06-03

    .... 0910131363-0087-02] RIN 0648-XW74 Fisheries of the Exclusive Economic Zone Off Alaska; Rock Sole, Flathead... participating in the Amendment 80 limited access fishery in the Bering Sea and Aleutian Islands management area... the trawl rock sole, flathead sole, and ``other flatfish'' fishery category by vessels participating...

  19. The evaluation of metabolizable energy in traditional Korean food for protein sources

    Directory of Open Access Journals (Sweden)

    Eunmi Kim

    2015-12-01

    Conclusion: The various food ingredients involved in the cooking process of traditional Korean food lead to differences between the energy level attained from chemical analysis and from actual animal testing.

  20. Variation in low food access areas due to data source inaccuracies

    OpenAIRE

    Ma, Xiaoguang; Battersby, Sarah E.; Bell, Bethany A.; Hibbert, James D.; Barnes, Timothy L.; Liese, Angela D.

    2013-01-01

    Several spatial measures of community food access identifying so called “food deserts” have been developed based on geospatial information and commercially-available, secondary data listings of food retail outlets. It is not known how data inaccuracies influence the designation of Census tracts as areas of low access. This study replicated the U.S. Department of Agriculture Economic Research Service (USDA ERS) food desert measure and the Centers for Disease Control and Prevention (CDC) non-he...

  1. Sources and severity of self-reported food intolerance after ileal pouch-anal anastomosis

    NARCIS (Netherlands)

    Steenhagen, E.; Roos, de N.M.; Bouwman, C.A.; Laarhoven, van C.J.H.M.; Staveren, van W.A.

    2006-01-01

    Data on food intolerance after ileal pouch-anal anastomosis are scarce. The aim of this study was to identify foods causing intolerance and to determine the nature and severity of reported symptoms. Patients from the Dutch Crohn's and Ulcerative Colitis Association were mailed a survey on food

  2. Mercury in organisms from the Northwestern Mediterranean slope: Importance of food sources

    Energy Technology Data Exchange (ETDEWEB)

    Cresson, P., E-mail: pierre.cresson@ifremer.fr [Ifremer, Centre de Méditerranée, CS 20330, F-83 507 La Seyne-sur-Mer (France); Fabri, M.C., E-mail: marie.claire.fabri@ifremer.fr [Ifremer, Centre de Méditerranée, CS 20330, F-83 507 La Seyne-sur-Mer (France); Bouchoucha, M., E-mail: marc.bouchoucha@ifremer.fr [Ifremer, Centre de Méditerranée, CS 20330, F-83 507 La Seyne-sur-Mer (France); Brach Papa, C., E-mail: christophe.brach.papa@ifremer.fr [Ifremer, Centre Atlantique, BP 21105, F-44311 Nantes Cedex 03 (France); Chavanon, F., E-mail: fabienne.chavanon@ifremer.fr [Ifremer, Centre de Méditerranée, CS 20330, F-83 507 La Seyne-sur-Mer (France); Jadaud, A., E-mail: angelique.jadaud@ifremer.fr [Ifremer, Centre de Méditerranée, CS 30171, F-34203 Sète Cedex (France); Knoery, J., E-mail: joel.knoery@ifremer.fr [Ifremer, Centre Atlantique, BP 21105, F-44311 Nantes Cedex 03 (France); Miralles, F., E-mail: fmarco@ifremer.fr [Ifremer, Centre de Méditerranée, CS 20330, F-83 507 La Seyne-sur-Mer (France); Cossa, D., E-mail: daniel.cossa@ifremer.fr [Ifremer, Centre de Méditerranée, CS 20330, F-83 507 La Seyne-sur-Mer (France); IS Terre, Université Joseph Fourier, BP 53, F-38041 Grenoble (France)

    2014-11-01

    Mercury (Hg) is a global threat for marine ecosystems, especially within the Mediterranean Sea. The concern is higher for deep-sea organisms, as the Hg concentration in their tissues is commonly high. To assess the influence of food supply at two trophic levels, total Hg concentrations and carbon and nitrogen stable isotope ratios were determined in 7 species (4 teleosts, 2 sharks, and 1 crustacean) sampled on the upper part of the continental slope of the Gulf of Lions (Northwestern Mediterranean Sea), at depths between 284 and 816 m. Mean Hg concentrations ranged from 1.30 ± 0.61 to 7.13 ± 7.09 μg g{sup −1} dry mass, with maximum values observed for small-spotted catshark Scyliorhinus canicula. For all species except blue whiting Micromesistius poutassou, Hg concentrations were above the health safety limits for human consumption defined by the European Commission, with a variable proportion of the individuals exceeding limits (from 23% for the Norway lobster Nephrops norvegicus to 82% for the blackbelly rosefish Helicolenus dactylopterus). Measured concentrations increased with increasing trophic levels. Carbon isotopic ratios measured for these organisms demonstrated that settling phytoplanktonic organic matter is not only the main source fueling trophic webs but also the carrier of Hg to this habitat. Inter- and intraspecific variations of Hg concentrations revealed the importance of feeding patterns in Hg bioaccumulation. In addition, biological parameters, such as growth rate or bathymetric range explain the observed contamination trends. - Highlights: • Hg and stable isotope ratios were assessed in 7 species from Mediterranean slope. • Settling phytoplankton was the main OM and Hg source, as confirmed by δ{sup 13}C values. • All species except one exceeded Hg consumption limits. • Depth and diet were important factors explaining Hg content. • Results confirmed the concern about Hg in the deep Mediterranean.

  3. Mercury in organisms from the Northwestern Mediterranean slope: Importance of food sources

    International Nuclear Information System (INIS)

    Cresson, P.; Fabri, M.C.; Bouchoucha, M.; Brach Papa, C.; Chavanon, F.; Jadaud, A.; Knoery, J.; Miralles, F.; Cossa, D.

    2014-01-01

    Mercury (Hg) is a global threat for marine ecosystems, especially within the Mediterranean Sea. The concern is higher for deep-sea organisms, as the Hg concentration in their tissues is commonly high. To assess the influence of food supply at two trophic levels, total Hg concentrations and carbon and nitrogen stable isotope ratios were determined in 7 species (4 teleosts, 2 sharks, and 1 crustacean) sampled on the upper part of the continental slope of the Gulf of Lions (Northwestern Mediterranean Sea), at depths between 284 and 816 m. Mean Hg concentrations ranged from 1.30 ± 0.61 to 7.13 ± 7.09 μg g −1 dry mass, with maximum values observed for small-spotted catshark Scyliorhinus canicula. For all species except blue whiting Micromesistius poutassou, Hg concentrations were above the health safety limits for human consumption defined by the European Commission, with a variable proportion of the individuals exceeding limits (from 23% for the Norway lobster Nephrops norvegicus to 82% for the blackbelly rosefish Helicolenus dactylopterus). Measured concentrations increased with increasing trophic levels. Carbon isotopic ratios measured for these organisms demonstrated that settling phytoplanktonic organic matter is not only the main source fueling trophic webs but also the carrier of Hg to this habitat. Inter- and intraspecific variations of Hg concentrations revealed the importance of feeding patterns in Hg bioaccumulation. In addition, biological parameters, such as growth rate or bathymetric range explain the observed contamination trends. - Highlights: • Hg and stable isotope ratios were assessed in 7 species from Mediterranean slope. • Settling phytoplankton was the main OM and Hg source, as confirmed by δ 13 C values. • All species except one exceeded Hg consumption limits. • Depth and diet were important factors explaining Hg content. • Results confirmed the concern about Hg in the deep Mediterranean

  4. Analysis of pollen and nectar of Arbutus unedo as a food source for Bombus terrestris (Hymenoptera: Apidae).

    Science.gov (United States)

    Rasmont, Pierre; Regali, Ariane; Ings, Thomas C; Lognay, Georges; Baudart, Evelyne; Marlier, Michel; Delcarte, Emile; Viville, Pascal; Marot, Cécile; Falmagne, Pol; Verhaeghe, Jean-Claude; Chittka, Lars

    2005-06-01

    The mineral, total amino acid, and sterol compositions of pollen collected by Apis mellifera L. were compared with the pollen of a plant consumed by Bombus terrestris (L.): Arbutus unedo L. This plant provides the predominant food resource for the main autumn generation of B. terrestris in southern France. Honey bees also forage on this plant, although only for nectar. The mineral composition of 30 pollen samples collected by honey bees is close to the presently known requirements of A. mellifera, except for Cu and Mn, which are substantially lower. The total amino acid mean composition of a set of 54 pollen samples fits the basic requirements of honey bees except for valine, isoleucine, and methionine, which are present in lower concentrations in all the samples. For pollen of A. unedo, the amino acid balance is not very different from that of the survey. The main sterolic component in pollen of A. unedo, beta-sitosterol, is known to have antifeedant effects on A. mellifera. Honey bees cannot dealkylate C29 sterols like beta-sitosterol or delta5-avenasterol to obtain C27 cholesterol and ecdysteroids. Because these phytosterols as well as cholesterol are nearly absent from pollen of A. unedo, the metabolic capabilities of Apis seem unadapted to this plant. On the contrary, pollen of A. unedo is freely consumed by B. terrestris, which develops huge autumn populations solely on this food. These data indicate that the sterolic metabolisms of B. terrestris and A. mellifera differ, allowing separation in foraging activity.

  5. The deposition of anal excretions by Melipona favosa foragers (Apidae: Meliponinae): behavioural observations concerning the location of food sources

    NARCIS (Netherlands)

    Aguilar, I. (Ingrid); Sommeijer, M.J.

    2000-01-01

    Melipona favosa consistently deposited anal excretions while foraging. Anal depositions were released more frequently and by more bees on artificial food sources at a greater distance from the nest. Our hypothesis that these deposits serve as scent marks is supported by experimental evidence

  6. Functional Foods Enriched with Marine Microalga Nannochloropsis oculata as a Source of ω-3 Fatty Acids

    Directory of Open Access Journals (Sweden)

    Srinivasan Babuskin

    2014-01-01

    Full Text Available The demand for functional food incorporated with ω-3 fatty acids is increasing over the years due to their added health benefits, such as reducing the risk of cardiovascular diseases, type II diabetes, ocular diseases, arthritis, etc. This study mainly aims to develop functional cookies and pasta enriched with ω-3 fatty acids. Nannochloropsis oculata was used because of its relatively high growth rate, high lipid content, resistance to mixing and contamination together with high nutritional values. The effect of the incorporation of Nannochloropsis oculata biomass on colour, firmness, fatty acid profile and sensory characteristics of cookies and pasta were evaluated. The colour values were found to be stable for two months of storage and the firmness increased with the addition of microalgal biomass. Omega-3 polyunsaturated fatty acid (PUFA levels (eicosapentaenoic and docosahexaenoic acids of 98 mg per 100 g and 63 mg per 100 g were observed in cookies and pasta, respectively, enriched with 1 % of Nannochloropsis oculata biomass. Sensory evaluation showed that the addition of up to 2 and 3 % of microalgal biomass was positively evaluated and accepted for cookies and pasta, respectively. This study confirms that the cookies and pasta enriched with Nannochloropsis oculata biomass might be used as a potential source of ω-3 fatty acids.

  7. A comparison of food safety knowledge among restaurant managers, by source of training and experience, in Oklahoma County, Oklahoma.

    Science.gov (United States)

    Lynch, Robert A; Elledge, Brenda L; Griffith, Charles C; Boatright, Daniel T

    2003-09-01

    The annual incidence of illness related to food consumption continues to present a challenge to environmental health management. A significant fraction of cases have been attributed to consumption of food in restaurants, and as the number of meals eaten away from the home continues to rise, the potential for large-scale foodborne-disease outbreaks will continue to increase. Food handlers in retail establishments contribute to the incidence of foodborne disease; therefore, it is essential that workers and management staff have a thorough understanding of safe food practices. Since the training, certification, and experience of food service managers vary greatly, it is also likely that managers' knowledge base may differ. In the study reported here, restaurant managers were administered a survey designed to measure their understanding of basic food safety principles. The sources of training, certification, and experience were found to significantly affect the level of food safety knowledge; however, increased hours of training did not increase knowledge. In addition, the time lapsed since training did not significantly affect the level of knowledge.

  8. Determination of sulfur in food by high resolution continuum source flame molecular absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zambrzycka, Elżbieta; Godlewska-Żyłkiewicz, Beata, E-mail: bgodlew@uwb.edu.pl

    2014-11-01

    In the present work, a fast, simple and sensitive analytical method for determination of sulfur in food and beverages by high resolution continuum source flame molecular absorption spectrometry was developed. The determination was performed via molecular absorption of carbon monosulfide, CS. Different CS rotational lines (257.959 nm, 258.033 nm, 258.055 nm), number of pixels and types of standard solution of sulfur, namely: sulfuric acid, sodium sulfate, ammonium sulfate, sodium sulfite, sodium sulfide, DL-cysteine, and L-cystine, were studied in terms of sensitivity, repeatability of results as well as limit of detection and limit of quantification. The best results were obtained for measurements of absorption of the CS molecule at 258.055 nm at the wavelength range covering 3 pixels and DL-cysteine in 0.2 mol L{sup −1} HNO{sub 3} solution as a calibration standard. Under optimized conditions the limit of detection and the limit of quantification achieved for sulfur were 10.9 mg L{sup −1} and 36.4 mg L{sup −1}, respectively. The repeatability of the results expressed as relative standard deviation was typically < 5%. The accuracy of the method was tested by analysis of digested biological certified reference materials (soya bean flour, corn flour and herbs) and recovery experiment for beverage samples with added known amount of sulfur standard. The recovery of analyte from such samples was in the range of 93–105% with the repeatability in the range of 4.1–5.0%. The developed method was applied for the determination of sulfur in milk (194 ± 10 mg kg{sup −1}), egg white (2188 ± 29 mg kg{sup −1}), mineral water (31.0 ± 0.9 mg L{sup −1}), white wine (260 ± 4 mg L{sup −1}) and red wine (82 ± 2 mg L{sup −1}), as well as in sample rich in ions, such as bitter mineral water (6900 ± 100 mg L{sup −1}). - Highlights: • HR-CS FMAS technique was used for sulfur measurement via molecular absorption of carbon monosulfide, CS. • Organic DL

  9. Perceived relevance and information needs regarding food topics and preferred information sources among Dutch adults: results of a quantitative consumer study

    NARCIS (Netherlands)

    Dillen, van S.M.E.; Hiddink, G.J.; Koelen, M.A.; Graaf, de C.; Woerkum, van C.M.J.

    2004-01-01

    Objective: For more effective nutrition communication, it is crucial to identify sources from which consumers seek information. Our purpose was to assess perceived relevance and information needs regarding food topics, and preferred information sources by means of quantitative consumer research.

  10. Validation of food store environment secondary data source and the role of neighborhood deprivation in Appalachia, Kentucky

    Directory of Open Access Journals (Sweden)

    Gustafson Alison A

    2012-08-01

    Full Text Available Abstract Background Based on the need for better measurement of the retail food environment in rural settings and to examine how deprivation may be unique in rural settings, the aims of this study were: 1 to validate one commercially available data source with direct field observations of food retailers; and 2 to examine the association between modified neighborhood deprivation and the modified retail food environment score (mRFEI. Methods Secondary data were obtained from a commercial database, InfoUSA in 2011, on all retail food outlets for each census tract. In 2011, direct observation identifying all listed food retailers was conducted in 14 counties in Kentucky. Sensitivity and positive predictive values (PPV were compared. Neighborhood deprivation index was derived from American Community Survey data. Multinomial regression was used to examine associations between neighborhood deprivation and the mRFEI score (indicator of retailers selling healthy foods such as low-fat foods and fruits and vegetables relative to retailers selling more energy dense foods. Results The sensitivity of the commercial database was high for traditional food retailers (grocery stores, supermarkets, convenience stores, with a range of 0.96-1.00, but lower for non-traditional food retailers; dollar stores (0.20 and Farmer’s Markets (0.50. For traditional food outlets, the PPV for smaller non-chain grocery stores was 38%, and large chain supermarkets was 87%. Compared to those with no stores in their neighborhoods, those with a supercenter [OR 0.50 (95% CI 0.27. 0.97] or convenience store [OR 0.67 (95% CI 0.51, 0.89] in their neighborhood have lower odds of living in a low deprivation neighborhood relative to a high deprivation neighborhood. Conclusion The secondary commercial database used in this study was insufficient to characterize the rural retail food environment. Our findings suggest that neighborhoods with high neighborhood deprivation are associated with

  11. Assessing the Applicability of Currently Available Methods for Attributing Foodborne Disease to Sources, Including Food and Food Commodities

    DEFF Research Database (Denmark)

    Pires, Sara Monteiro

    2013-01-01

    on the public health question being addressed, on the data requirements, on advantages and limitations of the method, and on the data availability of the country or region in question. Previous articles have described available methods for source attribution, but have focused only on foodborne microbiological...

  12. The Sources of Chemical Contaminants in Food and Their Health Implications

    Science.gov (United States)

    Rather, Irfan A.; Koh, Wee Yin; Paek, Woon K.; Lim, Jeongheui

    2017-01-01

    Food contamination is a matter of serious concern, as the high concentration of chemicals present in the edibles poses serious health risks. Protecting the public from the degrees of the harmfulness of contaminated foods has become a daunting task. This article highlights the causes, types, and health implications of chemical contamination in food. The food contamination could be due to naturally occurring contaminants in the environment or artificially introduced by the human. The phases of food processing, packaging, transportation, and storage are also significant contributors to food contamination. The implications of these chemical contaminants on human health are grave, ranging from mild gastroenteritis to fatal cases of hepatic, renal, and neurological syndromes. Although, the government regulates such chemicals in the eatables by prescribing minimum limits that are safe for human consumption yet measures still need to be taken to curb food contamination entirely. Therefore, a variety of food needs to be inspected and measured for the presence of chemical contaminants. The preventative measures pertaining about the food contaminants problems are pointed out and discussed. PMID:29204118

  13. The Sources of Chemical Contaminants in Food and Their Health Implications

    Directory of Open Access Journals (Sweden)

    Irfan A. Rather

    2017-11-01

    Full Text Available Food contamination is a matter of serious concern, as the high concentration of chemicals present in the edibles poses serious health risks. Protecting the public from the degrees of the harmfulness of contaminated foods has become a daunting task. This article highlights the causes, types, and health implications of chemical contamination in food. The food contamination could be due to naturally occurring contaminants in the environment or artificially introduced by the human. The phases of food processing, packaging, transportation, and storage are also significant contributors to food contamination. The implications of these chemical contaminants on human health are grave, ranging from mild gastroenteritis to fatal cases of hepatic, renal, and neurological syndromes. Although, the government regulates such chemicals in the eatables by prescribing minimum limits that are safe for human consumption yet measures still need to be taken to curb food contamination entirely. Therefore, a variety of food needs to be inspected and measured for the presence of chemical contaminants. The preventative measures pertaining about the food contaminants problems are pointed out and discussed.

  14. Sole Mothers in Australia: Supporting Mothers to Seek Work

    OpenAIRE

    Marilyn McHugh; Jane Millar

    1996-01-01

    The rapid increase in the numbers of sole parents in Australia - and their high risk of poverty - has meant that these families have become a focus of increasing concern. This paper explores the issue of sole motherhood and employment, with a particular emphasis on examining the relationship between social security policies and current discourses on the role of women in Australian society, including the perspectives of sole mothers themselves. The paper is part of an edited collection (Duncan...

  15. Tax Policy and Sole Proprietorships: A Closer Look

    OpenAIRE

    Nelson, Susan C.

    2008-01-01

    The 21 million sole proprietorship returns filed in 2005 represent a wide variety of economic activity. This paper examines three major tax policy issues related to sole proprietorships—taxpayer compliance, taxpayer burden, and incentives for growth. It uses tax return data to take a closer look at sole proprietorships. It proposes a new taxonomy for describing these returns in an economically meaningful way, based on the principal factors of production that they use: their own labor, hired l...

  16. Determination of sulfur in food by high resolution continuum source flame molecular absorption spectrometry

    Science.gov (United States)

    Zambrzycka, Elżbieta; Godlewska-Żyłkiewicz, Beata

    2014-11-01

    In the present work, a fast, simple and sensitive analytical method for determination of sulfur in food and beverages by high resolution continuum source flame molecular absorption spectrometry was developed. The determination was performed via molecular absorption of carbon monosulfide, CS. Different CS rotational lines (257.959 nm, 258.033 nm, 258.055 nm), number of pixels and types of standard solution of sulfur, namely: sulfuric acid, sodium sulfate, ammonium sulfate, sodium sulfite, sodium sulfide, DL-cysteine, and L-cystine, were studied in terms of sensitivity, repeatability of results as well as limit of detection and limit of quantification. The best results were obtained for measurements of absorption of the CS molecule at 258.055 nm at the wavelength range covering 3 pixels and DL-cysteine in 0.2 mol L- 1 HNO3 solution as a calibration standard. Under optimized conditions the limit of detection and the limit of quantification achieved for sulfur were 10.9 mg L- 1 and 36.4 mg L- 1, respectively. The repeatability of the results expressed as relative standard deviation was typically beverage samples with added known amount of sulfur standard. The recovery of analyte from such samples was in the range of 93-105% with the repeatability in the range of 4.1-5.0%. The developed method was applied for the determination of sulfur in milk (194 ± 10 mg kg- 1), egg white (2188 ± 29 mg kg- 1), mineral water (31.0 ± 0.9 mg L- 1), white wine (260 ± 4 mg L- 1) and red wine (82 ± 2 mg L- 1), as well as in sample rich in ions, such as bitter mineral water (6900 ± 100 mg L- 1).

  17. Sources of Calicivirus contamination in foodborne outbreaks in Denmark, 2005-2011--the role of the asymptomatic food handler.

    Science.gov (United States)

    Franck, Kristina T; Lisby, Morten; Fonager, Jannik; Schultz, Anna C; Böttiger, Blenda; Villif, Annette; Absalonsen, Helle; Ethelberg, Steen

    2015-02-15

    Norovirus (NoV) is the predominant cause of foodborne disease outbreaks. Virus contamination may occur during all steps of food processing, from production to preparation and serving. The relative importance of these different routes of contamination is unknown. The purpose of this study was to estimate the proportions of outbreaks caused by asymptomatic and symptomatic food handlers (FHs). Reports of foodborne NoV and sapovirus outbreaks (n=191) that occurred over a 7-year period were extracted, reviewed, and categorized according to the available evidence for source of contamination. In 64 (34%) of the outbreaks, contamination from FHs took place during preparation or serving of food. In the majority of these outbreaks (n=41; 64%), the FHs were asymptomatic during food handling. Some had been in contact with ill household members before handling the food and remained asymptomatic; others developed symptoms shortly after or were post-symptomatic. In 51 (27%) of the outbreaks, contamination occurred during production of the food, and in 55 (29%) of the outbreaks, contamination had supposedly occurred after serving a guest at a self-serve buffet. Guidelines regarding exclusion of FHs where household members suffer from gastroenteritis could limit the number of outbreaks. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Carotenoids: Actual knowledge on food sources, intakes, stability and bioavailability and their protective role in humans

    DEFF Research Database (Denmark)

    Maiani, Giuseppe; Castón, María Jesús Periago; Catasta, Giovina

    2009-01-01

    Carotenoids are one of the major food micronutrients in human diets and the overall objective of this review is to re-examine the role of carotenoids in human nutrition. We have emphasized the attention on the following carotenoids present in food and human tissues: -carotene, -cryptoxanthin, -ca...

  19. Honeydew as a food source for natural enemies: Making the best of a bad meal?

    NARCIS (Netherlands)

    Wäckers, F.L.; Van Rijn, P.C.J.; Heimpel, G.E.

    2008-01-01

    The majority of predators and parasitoids require non-prey food as part of their diet. The availability of suitable non-prey food can impact predator–prey and parasitoid–host dynamics and may be critical to the efficacy of biological pest control. A growing body of work addresses the role of floral

  20. Safety of Novel Protein Sources (Insects, Microalgae, Seaweed, Duckweed, and Rapeseed) and Legislative Aspects for Their Application in Food and Feed Production

    NARCIS (Netherlands)

    Spiegel, van der M.; Noordam, M.Y.; Fels-Klerx, van der H.J.

    2013-01-01

    Novel protein sources (like insects, algae, duckweed, and rapeseed) are expected to enter the European feed and food market as replacers for animal-derived proteins. However, food safety aspects of these novel protein sources are not well-known. The aim of this article is to review the state of the

  1. Trophic discrimination of stable isotopes and potential food source partitioning by leaf-eating crabs in mangrove environments

    DEFF Research Database (Denmark)

    Kristensen, Erik; Lee, Shing Yip; Mangion, Perrine

    2017-01-01

    Diet composition of leaf-eating mangrove crabs is a puzzle among mangrove ecologists. Nutrient-poor leaf litter can in most cases not support animal growth. Food partitioning (mangrove leaves, animal tissue, and microphytobenthos [MPB]) of sesarmid and ucidid mangrove crabs from eight locations...... here for crabs foraging on leaf litter to identify discrimination values that provide a balanced diet with sufficient nutrients (i.e., N) when combined with other food sources. The data from all mangrove locations suggest that sesarmid and ucidid crabs ingest and assimilate mixtures of available food...... is probably caused by metabolic disparities between these two crab families. Deviations in 15N discrimination have in most cases only minor influence on the model-based 13C discrimination thresholds. The present findings lead us to suggest a modified Optimal Foraging Theory for leaf-eating mangrove crabs....

  2. Agro-industrial fruit co-products in Colombia, their sources and potential uses in processed food industries: a review

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Alarcón García

    2015-06-01

    Full Text Available Fruit agribusinesses generate large amounts of byproductswith diverse characteristics that are inherent to the fruitsfrom which they come, which are a source of great use potentialbecause their compositions include molecules that are currentlyof high interest (antioxidants and dietary fiber. It is clear that,without correct handling and disposal, theses fruits present aproblem due to the environmental pollution that large quantitiesof residues can generate. Although there are varied uses for agroindustrialco-products, this review focused on the potential usesthat co-products could have in different processed food matrices.In this sense, this paper led to the revelation that one of theprincipal objectives of the reviewed research was to conditionco-products for use in processed foods in an attempt to takeadvantage of the bio-active compounds they contain, principallythe natural antioxidant activity, which especially enjoys acceptanceby consumers of processed foods.

  3. Piper nigrum, Piper betle and Gnetum gnemon--natural food sources with anti-quorum sensing properties.

    Science.gov (United States)

    Tan, Li Ying; Yin, Wai-Fong; Chan, Kok-Gan

    2013-03-20

    Various parts of Piper nigrum, Piper betle and Gnetum gnemon are used as food sources by Malaysians. The purpose of this study is to examine the anti-quorum sensing (anti-QS) properties of P. nigrum, P. betle and G. gnemon extracts. The hexane, chloroform and methanol extracts of these plants were assessed in bioassays involving Pseudomonas aeruginosa PA01, Escherichia coli [pSB401], E. coli [pSB1075] and Chromobacterium violaceum CV026. It was found that the extracts of these three plants have anti-QS ability. Interestingly, the hexane, chloroform and methanol extracts from P. betle showed the most potent anti-QS activity as judged by the bioassays. Since there is a variety of plants that serve as food sources in Malaysia that have yet to be tested for anti-QS activity, future work should focus on identification of these plants and isolation of the anti-QS compounds.

  4. Red pepper (Capsicum annuum) carotenoids as a source of natural food colors: analysis and stability-a review.

    Science.gov (United States)

    Arimboor, Ranjith; Natarajan, Ramesh Babu; Menon, K Ramakrishna; Chandrasekhar, Lekshmi P; Moorkoth, Vidya

    2015-03-01

    Carotenoids are increasingly drawing the attention of researchers as a major natural food color due to their inherent nutritional characteristics and the implicated possible role in prevention and protection against degenerative diseases. In this report, we review the role of red pepper as a source for natural carotenoids. The composition of the carotenoids in red pepper and the application of different methodologies for their analysis were discussed in this report. The stability of red pepper carotenoids during post-harvest processing and storage is also reviewed. This review highlights the potential of red pepper carotenoids as a source of natural food colors and also discusses the need for a standardized approach for the analysis and reporting of composition of carotenoids in plant products and designing model systems for stability studies.

  5. Recruitment in Swarm-Founding Wasps: Polybia occidentalis Does not Actively Scent-Mark Carbohydrate Food Sources

    Directory of Open Access Journals (Sweden)

    Benjamin J. Taylor

    2011-01-01

    Full Text Available Scent marking food resources is expected to enhance foraging efficiency reducing search time. Many social bees exhibit this behavior, but scent-marking is absent in social wasps, except for Vespa mandarinia. We tested for scent marking in the swarm-founding wasp, Polybia occidentalis. This wasp has moderately large colonies and utilizes resources that are concentrated in time and space, making scent marking profitable. Also, this wasp uses chemical markings to lead nestmates to a new nest site during swarm emigration, making it possible that it could use the same behavior to recruit nestmates to a food source. Foragers from 11 colonies were given a choice between a previously visited feeder and an unvisited one, both containing a rich, unscented sucrose solution. There was no difference in the number of visits to the two treatments. However, some individuals chose the feeder on one side more often. We conclude that foragers of this species of wasp do not use odor marks left behind by nestmates to find food, but they do exhibit the tendency, when returning to a food source that has not been depleted, to choose a resource based on its relative position, presumably by using visual cues.

  6. The Stingless Bee Melipona solani Deposits a Signature Mixture and Methyl Oleate to Mark Valuable Food Sources.

    Science.gov (United States)

    Alavez-Rosas, David; Malo, Edi A; Guzmán, Miguel A; Sánchez-Guillén, Daniel; Villanueva-Gutiérrez, Rogel; Cruz-López, Leopoldo

    2017-10-01

    Stingless bees foraging for food improve recruitment by depositing chemical cues on valuable food sites or pheromone marks on vegetation. Using gas chromatography/mass spectrometry and bioassays, we showed that Melipona solani foragers leave a mixture composed mostly of long chain hydrocarbons from their abdominal cuticle plus methyl oleate from the labial gland as a scent mark on rich food sites. The composition of hydrocarbons was highly variable among individuals and varied in proportions, depending on the body part. A wide ratio of compounds present in different body parts of the bees elicited electroantennogram responses from foragers and these responses were dose dependent. Generally, in bioassays, these bees prefer to visit previously visited feeders and feeders marked with extracts from any body part of conspecifics. The mean number of visits to a feeder was enhanced when synthetic methyl oleate was added. We propose that this could be a case of multi-source odor marking, in which hydrocarbons, found in large abundance, act as a signature mixture with attraction enhanced through deposition of methyl oleate, which may indicate a rich food source.

  7. The recruiter's excitement--features of thoracic vibrations during the honey bee's waggle dance related to food source profitability.

    Science.gov (United States)

    Hrncir, Michael; Maia-Silva, Camila; Mc Cabe, Sofia I; Farina, Walter M

    2011-12-01

    The honey bee's waggle dance constitutes a remarkable example of an efficient code allowing social exploitation of available feeding sites. In addition to indicating the position (distance, direction) of a food patch, both the occurrence and frequency of the dances depend on the profitability of the exploited resource (sugar concentration, solution flow rate). During the waggle dance, successful foragers generate pulsed thoracic vibrations that putatively serve as a source of different kinds of information for hive bees, who cannot visually decode dances in the darkness of the hive. In the present study, we asked whether these vibrations are a reliable estimator of the excitement of the dancer when food profitability changes in terms of both sugar concentration and solution flow rate. The probability of producing thoracic vibrations as well as several features related to their intensity during the waggle phase (pulse duration, velocity amplitude, duty cycle) increased with both these profitability variables. The number of vibratory pulses, however, was independent of sugar concentration and reward rate exploited. Thus, pulse number could indeed be used by dance followers as reliable information about food source distance, as suggested in previous studies. The variability of the dancer's thoracic vibrations in relation to changes in food profitability suggests their role as an indicator of the recruiter's motivational state. Hence, the vibrations could make an important contribution to forager reactivation and, consequently, to the organisation of collective foraging processes in honey bees.

  8. Discards monitoring in the gillnet fishery for sole

    NARCIS (Netherlands)

    Uhlmann, S.S.

    2014-01-01

    Approximately 2-3% of the Dutch fishing quota for sole (Solea solea) is caught by a 60-vessel strong inshore fleet of gillnetters. From their home ports in IJmuiden, Scheveningen and Den Helder, these vessels fish typically with bottom-set gillnets for sole during 1 day trips between March and

  9. 31 CFR 515.546 - Accounts of Cuban sole proprietorships.

    Science.gov (United States)

    2010-07-01

    ... proprietorships. Specific licenses are issued unblocking sole proprietorships established under the laws of Cuba... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Accounts of Cuban sole proprietorships. 515.546 Section 515.546 Money and Finance: Treasury Regulations Relating to Money and Finance...

  10. Stingless bees (Melipona scutellaris) learn to associate footprint cues at food sources with a specific reward context.

    Science.gov (United States)

    Roselino, Ana Carolina; Rodrigues, André Vieira; Hrncir, Michael

    2016-10-01

    Foraging insects leave chemical footprints on flowers that subsequent foragers may use as indicators for recent flower visits and, thus, potential resource depletion. Accordingly, foragers should reject food sources presenting these chemical cues. Contrasting this assumption, experimental studies in stingless bees (Apidae, Meliponini), so far, demonstrated an attractive effect of footprints. These findings lead to doubts about the meaning of these chemical cues in natural foraging contexts. Here, we asked whether foragers of stingless bees (Melipona scutellaris) use footprints according to the previously experienced reward level of visited food sources. Bees were trained to artificial flower patches, at which the reward of a flower either decreased or, alternatively, increased after a visit by a forager. Individuals were allowed a total of nine foraging bouts to the patch, after which their preference for visited or unvisited flowers was tested. In the choice tests, bees trained under the decreasing reward context preferred unvisited flowers, whereas individuals trained under the increasing reward context preferred visited flowers. Foragers without experience chose randomly between visited and unvisited flowers. These results demonstrate that M. scutellaris learns to associate unspecific footprint cues at food sources with differential, specific reward contexts, and uses these chemical cues accordingly for their foraging decisions.

  11. Plants and mushrooms as sources of bio-based food coloring, preserving and bioactive agents

    OpenAIRE

    Ferreira, Isabel C.F.R.

    2018-01-01

    Food additives have been used for thousands of years to enhance food properties, safety and appearance. Nevertheless, several of the worldwide used artificial additives have been related to potential toxic and allergenic effects to the consumers, which has been justifying the growing interest in additives of natural origin that provide colouring, preserving, and bioactive properties to foodstuff without hazardous effects [1]. In this context, several plants and mushrooms have been...

  12. Effects of Animal-Source Foods and Micronutrient-Fortification Complementary Foods on Body Composition, Linear Growth, Iron Status – the WinFood Project in Cambodia

    International Nuclear Information System (INIS)

    Chhoun, Chamnan; Kloppenborg Heick Skau, Jutta; Dijkhuizen, Marjoleine; Friis, Henrik; Michaelsen, Kim F.; Roos, Nanna; Touch, Bunthang; Chea, Mary; Wieringa, Frank; Berger, Jacques

    2014-01-01

    Background and objective: The nutritional quality of CF in developing countries is often insufficient to sustain optimal growth. The Winfood project evaluated the efficacy of two new, processed rice-fish based CF with local ASF in Cambodia: non-fortified ‘WinFood’ (WF) with 14% by dry-weight ASF from small-sized fish (Esomus longimanus and Paralaubuca typus) and edible spiders (Haplopelma sp.); an adjusted ‘lite’ WinFood (WF-L) with 10% by dry-weight ASF from small-sized fish of mixed species, and fortified with minerals and vitamins. The products were precooked by extrusion. The WF-products were compared with two standard products from World Food Programme: Corn-Soy-Blend (CSB+) and CSB++ (8% by dry-weight skimmed-milk powder), in a single-blinded randomized trial. Methods: 419 Cambodian infants at age 6 months were randomized to daily rations of one of the four products for nine months period. BC (deuterium dilution) and iron status (serum ferritin and hemoglobin) were measured before and after intervention; and anthropometry (knee-heel-length, length, weight, MUAC, head circumference and skinfolds) monthly. Data were analyzed by intention-to-treat. Results: Among 358 children completing the study, no significant difference in BC between the groups where found, but knee-heel length increments differed (P = 0.046: WF-L: 3.6 cm, CSB++: 3.6 cm, WF: 3.5 cm, CSB+: 3.4 cm), suggesting that micronutrient-fortified products with 8-10% ASF (CSB++ and WF-L) promoted better linear growth than products without fortification or ASF. Knee-heel and total length increment was significantly higher in the highest food compliance quartile compared to the lowest, across food groups. There were no differences in ferritin and hemoglobin concentration. There was higher prevalence of anemic children in the WF group. Conclusion: Products with ASF (milk or small fish) and micronutrient premix resulted in slightly better linear growth. Small fish is a cheap ASF with high potential

  13. Attributing human salmonellosis and campylobacteriosis to food, animal and environmental sources

    DEFF Research Database (Denmark)

    Pires, Sara Monteiro

    to the responsible sources, compare methods and results, and make recommendations on which approach to choose to answer specific risk management questions. The work is based on six manuscripts. In the first manuscript, concepts and terminology on source attribution are presented, and the remaining manuscripts...... recommendations on how to choose one or more source attribution methods to address different risk management problems. For this purpose, a “source attribution tool-box” based on the experiences from this PhD was developed....... sources of the pathogen and estimate the relative contribution of each source to the burden of human disease. A variety of methods to attribute human illness to specific sources is available, including microbial subtyping, comparative exposure assessment, analysis of studies of sporadic infections...

  14. Source segregation and food waste prevention activities in high-density households in a deprived urban area

    International Nuclear Information System (INIS)

    Rispo, A.; Williams, I.D.; Shaw, P.J.

    2015-01-01

    Highlights: • Study of waste management in economically and socially deprived high-density housing. • Food waste segregation, prevention and recycling activities investigated. • Study involved a waste audit and household survey of 1034 households. • Populations in such areas are “hard-to-reach”. • Exceptional efforts and additional resources are required to improve performance. - Abstract: A waste audit and a household questionnaire survey were conducted in high-density housing estates in one of the most economically and socially deprived areas of England (Haringey, London). Such areas are under-represented in published research. The study examined source segregation, potential participation in a food waste segregation scheme, and food waste prevention activities in five estates (1034 households). The results showed that: contamination of recyclables containers was low; ca. 28% of the mixed residual waste’s weight was recyclable; food waste comprised a small proportion of the waste from these residents, probably because of their relatively disadvantaged economic circumstances; and the recycling profile reflected an intermittent pattern of behaviour. Although the majority of respondents reported that they would participate in a food waste separation scheme, the response rate was low and many responses of “don’t know” were recorded. Municipalities committed to foster improved diversion from landfill need to recognise that there is no “quick and easy fix”, regardless of local or national aspirations. Lasting and sustained behaviour change requires time and the quality of service provision and associated infrastructure play a fundamental role in facilitating residents to participate effectively in waste management activities that maximise capture of source-segregated materials. Populations in deprived areas that reside in high-rise, high-density dwellings are “hard-to-reach” in terms of participation in recycling schemes and exceptional

  15. Source segregation and food waste prevention activities in high-density households in a deprived urban area

    Energy Technology Data Exchange (ETDEWEB)

    Rispo, A.; Williams, I.D., E-mail: idw@soton.ac.uk; Shaw, P.J.

    2015-10-15

    Highlights: • Study of waste management in economically and socially deprived high-density housing. • Food waste segregation, prevention and recycling activities investigated. • Study involved a waste audit and household survey of 1034 households. • Populations in such areas are “hard-to-reach”. • Exceptional efforts and additional resources are required to improve performance. - Abstract: A waste audit and a household questionnaire survey were conducted in high-density housing estates in one of the most economically and socially deprived areas of England (Haringey, London). Such areas are under-represented in published research. The study examined source segregation, potential participation in a food waste segregation scheme, and food waste prevention activities in five estates (1034 households). The results showed that: contamination of recyclables containers was low; ca. 28% of the mixed residual waste’s weight was recyclable; food waste comprised a small proportion of the waste from these residents, probably because of their relatively disadvantaged economic circumstances; and the recycling profile reflected an intermittent pattern of behaviour. Although the majority of respondents reported that they would participate in a food waste separation scheme, the response rate was low and many responses of “don’t know” were recorded. Municipalities committed to foster improved diversion from landfill need to recognise that there is no “quick and easy fix”, regardless of local or national aspirations. Lasting and sustained behaviour change requires time and the quality of service provision and associated infrastructure play a fundamental role in facilitating residents to participate effectively in waste management activities that maximise capture of source-segregated materials. Populations in deprived areas that reside in high-rise, high-density dwellings are “hard-to-reach” in terms of participation in recycling schemes and exceptional

  16. Food animal transport: A potential source of community exposures to health hazards from industrial farming (CAFOs

    Directory of Open Access Journals (Sweden)

    Ana M. Rule

    Full Text Available Summary: Use of antimicrobial feed additives in food animal production is associated with selection for drug resistance in bacterial pathogens, which can then be released into the environment through occupational exposures, high volume ventilation of animal houses, and land application of animal wastes. We tested the hypothesis that current methods of transporting food animals from farms to slaughterhouses may result in pathogen releases and potential exposures of persons in vehicles traveling on the same road. Air and surface samples were taken from cars driving behind poultry trucks for 17 miles. Air conditioners and fans were turned off and windows fully opened. Background and blank samples were used for quality control. Samples were analyzed for susceptible and drug-resistant strains. Results indicate an increase in the number of total aerobic bacteria including both susceptible and drug-resistant enterococci isolated from air and surface samples, and suggest that food animal transport in open crates introduces a novel route of exposure to harmful microorganisms and may disseminate these pathogens into the general environment. These findings support the need for further exposure characterization, and attention to improving methods of food animal transport, especially in highly trafficked regions of high density farming such as the Delmarva Peninsula. Keywords: Antimicrobial resistance, CAFO, Bioaerosol, Food animal transport, Air sampling, Surface sampling

  17. Conventional foods, followed by dietary supplements and fortified foods, are the key sources of vitamin D, vitamin B6, and selenium intake in Dutch participants of the NU-AGE study.

    Science.gov (United States)

    Berendsen, Agnes A M; van Lieshout, Lilou E L M; van den Heuvel, Ellen G H M; Matthys, Christophe; Péter, Szabolcs; de Groot, Lisette C P G M

    2016-10-01

    With aging, energy needs decrease, necessitating a more nutrient-dense diet to meet nutritional needs. To bridge this gap, the use of nutrient-dense foods, fortified foods, and dietary supplements can be important. This observational study aims to describe current micronutrient intakes of Dutch elderly and to identify the contribution of nutrient-dense foods, fortified foods, and dietary supplements to the intake of micronutrients that are often inadequately consumed in Dutch elderly. Data of 245 Dutch volunteers from the NU-AGE study aged 65 to 80 years were used. Dietary intake was assessed by means of 7-day food records, and dietary supplement use was recorded with an additional questionnaire. Information on fortified foods was obtained from the Dutch Food Composition Table 2011. Nutrient density of foods was evaluated using the Nutrient Rich Food 9.3 score. The percentages of participants not meeting their average requirement were high for vitamin D (99%), selenium (41%), and vitamin B6 (54%) based on conventional foods and also when taking into account fortified foods (98%, 41%, and 27%, respectively) and vitamin and mineral supplements (87%, 36%, and 20%, respectively). Conventional foods were the main source of vitamin D, vitamin B6, and selenium intake (42%, 45%, and 82%, respectively), followed by vitamin and mineral supplements (41%, 44%, and 18%) and fortified foods (17%, 11%, and 1%). Foods with the highest nutrient density contributed most to total vitamin B6 intake only. To optimize nutrient intakes of elderly, combinations of natural food sources, fortified foods, and dietary supplements should be considered. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Adolescent girls' most common source of junk food away from home.

    Science.gov (United States)

    Cohen, Deborah A; Ghosh-Dastidar, Bonnie; Beckman, Robin; Lytle, Leslie; Elder, John; Pereira, Mark A; Veblen Mortenson, Sara; Pickrel, Julie; Conway, Terry L

    2012-09-01

    Contextual factors associated with adolescent girls' dietary behaviors could inform future interventions to improve diet. High school girls completed a 7-day diary, recording all trips made. In places other than home or school they recorded the food eaten. Girls made an average of 11.4 trips per week other than to home or school. Snacks high in solid oils, fats and added sugars (SOFAS) were frequently consumed. Girls reported eating an average of 3.5 servings per week of snacks high in SOFAS at someone else's house compared to 3.0 servings per week at retail food outlets. Findings demonstrate that low nutrient foods are ubiquitous and efforts should be made to reduce their availability in multiple settings. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. A NEW DESIGN METHOD FOR FLAT FOOTWEAR SOLES

    Directory of Open Access Journals (Sweden)

    IONESCU Cozmin

    2016-05-01

    Full Text Available Carried research regarding footwear soles reveald that by moulding footwear details can be obtained in a wide variety of models. Shoe soles are complex three dimensional objects and for attaching them with the uppers, the interor countour of the soles has to correspond to the featherline contour of the last. That’s why, is necessary that soles design to be done with high accuracy and in strict accordance to the last. Nowadays, there are specialized software applications which can perform various computer aided design processes for footwear. Among the high performance systems used for the design of footwear soles and injection moulds for shoe soles, we may mention: Delcam Shoe Solution, Delcam PowerSHAPE-e, Padsy II and Padsy III, Shoe Master System, Lectra System, Parmel System and ATOS II System. This paper presents a 3D design method, developed by the authors, for footwear flat soles using PowerSHAPE-e software programm from of Delcam Crispin. The computer-aided design technique used in this paper highlights several important advantages that include: increased design quality; three dimensional viewing of soles, which can lead to immediate decisions, regarding the acceptance of newly developed models; it can be appreciated the complexity of mould cavities execution, without the need of making prototypes; the outlines of construction templates are accurately obtained for the mould cavities and for all size numbers; calculations can easily be done for determining the soles volume for the entire size number, with implications on estimating polymer blend consumption and so on.

  20. Households across all income quintiles, especially the poorest, increased animal source food expenditures substantially during recent Peruvian economic growth.

    Science.gov (United States)

    Humphries, Debbie L; Behrman, Jere R; Crookston, Benjamin T; Dearden, Kirk A; Schott, Whitney; Penny, Mary E

    2014-01-01

    Relative to plant-based foods, animal source foods (ASFs) are richer in accessible protein, iron, zinc, calcium, vitamin B-12 and other nutrients. Because of their nutritional value, particularly for childhood growth and nutrition, it is important to identify factors influencing ASF consumption, especially for poorer households that generally consume less ASFs. To estimate differential responsiveness of ASF consumption to changes in total household expenditures for households with different expenditures in a middle-income country with substantial recent income increases. The Peruvian Young Lives household panel (n = 1750) from 2002, 2006 and 2009 was used to characterize patterns of ASF expenditures. Multivariate models with controls for unobserved household fixed effects and common secular trends were used to examine nonlinear relationships between changes in household expenditures and in ASF expenditures. Households with lower total expenditures dedicated greater percentages of expenditures to food (58.4% vs.17.9% in 2002 and 24.2% vs. 21.5% in 2009 for lowest and highest quintiles respectively) and lower percentages of food expenditures to ASF (22.8% vs. 33.9% in 2002 and 30.3% vs. 37.6% in 2009 for lowest and highest quintiles respectively). Average percentages of overall expenditures spent on food dropped from 47% to 23.2% between 2002 and 2009. Households in the lowest quintiles of expenditures showed greater increases in ASF expenditures relative to total consumption than households in the highest quintiles. Among ASF components, meat and poultry expenditures increased more than proportionately for households in the lowest quintiles, and eggs and fish expenditures increased less than proportionately for all households. Increases in household expenditures were associated with substantial increases in consumption of ASFs for households, particularly households with lower total expenditures. Increases in ASF expenditures for all but the top quintile of

  1. Dietary intake of energy-dense, nutrient-poor and nutrient-dense food sources in children with cystic fibrosis.

    Science.gov (United States)

    Sutherland, Rosie; Katz, Tamarah; Liu, Victoria; Quintano, Justine; Brunner, Rebecca; Tong, Chai Wei; Collins, Clare E; Ooi, Chee Y

    2018-04-30

    Prescription of a high-energy, high-fat diet is a mainstay of nutrition management in cystic fibrosis (CF). However, families may be relying on energy-dense, nutrient-poor (EDNP) foods rather than nutrient-dense (ND) foods to meet dietary targets. We aimed to evaluate the relative contribution of EDNP and ND foods to the usual diets of children with CF and identify sociodemographic factors associated with higher EDNP intakes. This is a cross-sectional comparison of children with CF aged 2-18 years and age- and gender-matched controls. Dietary intake was assessed using the Australian Child and Adolescent Eating Survey (ACAES) food frequency questionnaire. Children with CF (n = 80: 37 males; mean age 9.3 years) consumed significantly more EDNP foods than controls (mean age 9.8 years) in terms of both total energy (median [IQR]: 1301 kcal/day (843-1860) vs. 686 kcal/day (480-1032); p energy intake (median [IQR]: 44% (34-51) vs. 31% (24-43); p energy requirements (median [IQR]: 158% (124-187) vs. 112% (90-137); p energy- and fat-dense CF diet is primarily achieved by overconsumption of EDNP foods, rather than ND sources. This dietary pattern may not be optimal for the future health of children with CF, who are now expected to survive well into adulthood. Copyright © 2018 European Cystic Fibrosis Society. All rights reserved.

  2. Prospect of Sea Cucumber Culture in Indonesia as Potential Food Sources

    OpenAIRE

    Pangkey, Henneke; Lantu, Sartje; Manuand, Lusia; Mokolensang, JeffrieFredrik

    2012-01-01

    Sea cucumber is one of the sea treasures which has been used not only as luxury food for certain countries but also as medicines. Sea cucumber has become one of the most important products and it has high price in International market.For this reason, the exploitation of sea cucumber turns out to be excessive and disturbs its sustainability. Aquaculture is the best way to prevent this problem. The success of sea cucumber culture is very depend on seed availability and suitable food for larvae...

  3. Substrate composition and moisture in composting source-separated human faeces and food waste.

    Science.gov (United States)

    Niwagaba, C; Nalubega, M; Vinnerås, B; Sundberg, C; Jönsson, H

    2009-04-14

    The composting of a faeces/ash mixture and food waste in relative proportions of 1:0, 1:1 and 1:3 was studied in three successive experiments conducted in Kampala, Uganda in 216 L reactors insulated with 75 mm styrofoam or not insulated. The faeces/ash mixture alone exceeded 50 degrees C for composting and ways of decreasing substrate moisture should be investigated. The results obtained are applicable to the management of small- to medium-scale composting of faeces/ash and food waste at household and institution levels, e.g. schools and restaurants.

  4. Exploring origin of food as a source of meanings for Finnish consumers: A qualitative comparison of meanings in Swedish, German and French food

    OpenAIRE

    Luomala, Harri

    2004-01-01

    The findings show that Finnish consumers attach partly overlapping partly distinct cognitive, affective, and normative meanings to Swedish, German, and French food. Swedish and French foods are perceived healthier than German food. Finnish consumers also think that Swedish and French food is of high quality, safe and pure while in the case of German food consumers were more doubtful.

  5. Safety in Serbian animal source food industry and the impact of hazard analysis and critical control points: A review

    Science.gov (United States)

    Tomašević, I.; Đekić, I.

    2017-09-01

    There is a significant lack of HACCP-educated and/or HACCP-highly trained personnel within the Serbian animal source food workforces and veterinary inspectors, and this can present problems, particularly in hazard identification and assessment activities. However, despite obvious difficulties, HACCP benefits to the Serbian dairy industry are widespread and significant. Improving prerequisite programmes on the farms, mainly through infrastructural investments in milk collectors and transportation vehicles on one hand, and increasing hygiene awareness of farmers through training on the other hand has improved the safety of milk. The decline in bacterial numbers on meat contact surfaces, meat handlers’ hands and cooling facilities presents strong evidence of improved process hygiene and justifies the adoption of HACCP in Serbian meat establishments. Apart from the absence of national food poisoning statistics or national foodborne disease databases, the main obstacle to fully recognising the impact of HACCP on the safety of animal source food in Serbia is the lack of research regarding the occurrence of chemical and/or physical hazards interrelated with its production.

  6. Memory and disgust: Effects of appearance-congruent and appearance-incongruent information on source memory for food.

    Science.gov (United States)

    Mieth, Laura; Bell, Raoul; Buchner, Axel

    2016-01-01

    The present study was stimulated by previous findings showing that people preferentially remember person descriptions that violate appearance-based first impressions. Given that until now all studies used faces as stimuli, these findings can be explained by referring to a content-specific module for social information processing that facilitates social orientation within groups via stereotyping and counter-stereotyping. The present study tests whether the same results can be obtained with fitness-relevant stimuli from another domain--pictures of disgusting-looking or tasty-looking food, paired with tasty and disgusting descriptions. A multinomial model was used to disentangle item memory, guessing and source memory. There was an old-new recognition advantage for disgusting-looking food. People had a strong tendency towards guessing that disgusting-looking food had been previously associated with a disgusting description. Source memory was enhanced for descriptions that disconfirmed these negative, appearance-based impressions. These findings parallel the results from the social domain. Heuristic processing of stimuli based on visual appearance may be complemented by intensified processing of incongruent information that invalidates these first impressions.

  7. Companion Animals as a Source of Viruses for Human Beings and Food Production Animals

    NARCIS (Netherlands)

    Reperant, L. A.; Brown, I. H.; Haenen, O. L.; de Jong, M. D.; Osterhaus, A. D. M. E.; Papa, A.; Rimstad, E.; Valarcher, J.-F.; Kuiken, T.

    2016-01-01

    Companion animals comprise a wide variety of species, including dogs, cats, horses, ferrets, guinea pigs, reptiles, birds and ornamental fish, as well as food production animal species, such as domestic pigs, kept as companion animals. Despite their prominent place in human society, little is known

  8. Microplastics in aquatic food chain : sources, measurement, occurrence and potential health risks

    NARCIS (Netherlands)

    Hollman, P.C.H.; Bouwmeester, H.; Peters, R.J.B.

    2013-01-01

    Pollution of the environment with plastics is a growing problem, and is expected to persist for hundreds to thousands of years. As a result microplastics, plastic particles with size smaller than 5 mm, are ubiquitously present in the aquatic food chain. The present literature review shows that the

  9. Radioactive contamination of foods from fallout as a source of error in some animal experiments

    Energy Technology Data Exchange (ETDEWEB)

    Clayton, C G

    1957-01-01

    Radioactivity in control animals since 1956 has increased so as to vitiate experiments. The activity of foods used was measured. The counts are given for rat cubes, milk, peas, sugar, flour, cabbage, carrot, cauliflower, salt, semolina, and water. The high count of the cabbage is probably from /sup 137/Cs present as 4 micromicrocuries/g.

  10. Food animal transport: a potential source of community exposures to health hazards from industrial farming (CAFOs).

    Science.gov (United States)

    Rule, Ana M; Evans, Sean L; Silbergeld, Ellen K

    2008-01-01

    Use of antimicrobial feed additives in food animal production is associated with selection for drug resistance in bacterial pathogens, which can then be released into the environment through occupational exposures, high volume ventilation of animal houses, and land application of animal wastes. We tested the hypothesis that current methods of transporting food animals from farms to slaughterhouses may result in pathogen releases and potential exposures of persons in vehicles traveling on the same road. Air and surface samples were taken from cars driving behind poultry trucks for 17 miles. Air conditioners and fans were turned off and windows fully opened. Background and blank samples were used for quality control. Samples were analyzed for susceptible and drug-resistant strains. Results indicate an increase in the number of total aerobic bacteria including both susceptible and drug-resistant enterococci isolated from air and surface samples, and suggest that food animal transport in open crates introduces a novel route of exposure to harmful microorganisms and may disseminate these pathogens into the general environment. These findings support the need for further exposure characterization, and attention to improving methods of food animal transport, especially in highly trafficked regions of high density farming such as the Delmarva Peninsula.

  11. Perfluorinated substances in human food and other sources of human exposure

    NARCIS (Netherlands)

    D'Hollander, W.; de Voogt, P.; De Coen, W.; Bervoets, L.; de Voogt, P.

    2010-01-01

    Perfluorinated compounds (PFCs) are ubiquitous environmental contaminants, which persist and may bioaccumulate through the food chain (Haukås et al. 2007; Martin et al. 2004b; Taniyasu et al. 2003). As a consequence, several PFCs have been detected in different biota worldwide. In recent years, an

  12. Raw mechanically separated chicken meat and salmon protein hydrolysate as protein sources in extruded dog food

    DEFF Research Database (Denmark)

    Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.

    2017-01-01

    Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...

  13. Hydrothermal carbonization of food waste and associated packaging materials for energy source generation.

    Science.gov (United States)

    Li, Liang; Diederick, Ryan; Flora, Joseph R V; Berge, Nicole D

    2013-11-01

    Hydrothermal carbonization (HTC) is a thermal conversion technique that converts food wastes and associated packaging materials to a valuable, energy-rich resource. Food waste collected from local restaurants was carbonized over time at different temperatures (225, 250 and 275°C) and solids concentrations to determine how process conditions influence carbonization product properties and composition. Experiments were also conducted to determine the influence of packaging material on food waste carbonization. Results indicate the majority of initial carbon remains integrated within the solid-phase at the solids concentrations and reaction temperatures evaluated. Initial solids concentration influences carbon distribution because of increased compound solubilization, while changes in reaction temperature imparted little change on carbon distribution. The presence of packaging materials significantly influences the energy content of the recovered solids. As the proportion of packaging materials increase, the energy content of recovered solids decreases because of the low energetic retention associated with the packaging materials. HTC results in net positive energy balances at all conditions, except at a 5% (dry wt.) solids concentration. Carbonization of food waste and associated packaging materials also results in net positive balances, but energy needs for solids post-processing are significant. Advantages associated with carbonization are not fully realized when only evaluating process energetics. A more detailed life cycle assessment is needed for a more complete comparison of processes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Companion Animals as a Source of Viruses for Human Beings and Food Production Animals

    NARCIS (Netherlands)

    L.A. Reperant (Leslie); I.H. Brown (Ian); Haenen, O.L.; M.D. de Jong (Menno); A.D.M.E. Osterhaus (Albert); A. Papa (Anna); Rimstad, E.; Valarcher, J.-F.; T. Kuiken (Thijs)

    2016-01-01

    textabstractCompanion animals comprise a wide variety of species, including dogs, cats, horses, ferrets, guinea pigs, reptiles, birds and ornamental fish, as well as food production animal species, such as domestic pigs, kept as companion animals. Despite their prominent place in human society,

  15. How parental dietary behavior and food parenting practices affect children's dietary behavior. Interacting sources of influence?

    NARCIS (Netherlands)

    Larsen, J.K.; Hermans, R.C.J.; Sleddens, E.F.C.; Engels, R.C.M.E.; Fisher, J.O.; Kremers, S.P.J.

    2015-01-01

    Until now, the literatures on the effects of food parenting practices and parents' own dietary behavior on children's dietary behavior have largely been independent from one another. Integrating findings across these areas could provide insight on simultaneous and interacting influences on

  16. Genetic diversity and antibiogram profile of diarrhoeagenic Escherichia coli pathotypes isolated from human, animal, foods and associated environmental sources

    Directory of Open Access Journals (Sweden)

    Pankaj Dhaka

    2016-05-01

    Full Text Available Introduction: Infectious diarrhoea particularly due to pathogenic bacteria is a major health problem in developing countries, including India. Despite significant reports of diarrhoeagenic Escherichia coli (DEC pathotypes around the globe, studies which address genetic relatedness, antibiogram profile and their correlation with respect to their isolation from different sources are sparse. The present study determines isolation and identification of DEC pathotypes from different sources, their genetic characterisation, antibiogram profile and their correlation if any. Materials and methods: A total of 336 samples comprising diarrhoeic stool samples from infants (n=103, young animal (n=106, foods (n=68 and associated environmental sources (n=59 were collected from Bareilly region of India. All the samples were screened by using standard microbiological methods for the detection of E. coli. The identified E. coli were then confirmed as DEC pathotypes using polymerase chain reaction–based assays. Those DEC pathotypes identified as Enteroaggregative E. coli (EAEC were further confirmed using HEp-2 adherence assay. All the isolated DEC pathotypes were studied for their genetic diversity using pulsed-field gel electrophoresis (PFGE, and antimicrobial susceptibility testing was performed by using disc diffusion method as per Clinical Laboratory Standards Institute guidelines. Results and discussion: Of the four DEC pathotypes investigated, EAEC was found to be the predominant pathogen with an isolation rate of 16.5% from infants, 17.9% from young animals, 16.2% from foods and 3.4% from the associated environmental sources. These EAEC isolates, on further characterisation, revealed predominance of ‘atypical’ EAEC, with an isolation rate of 10.7% from infants, 15.1% from young animals, 16.2% from foods, and 3.4% from the associated environmental sources. On PFGE analysis, discrimination was evident within DEC pathotypes as 52 unique pulsotypes were

  17. MORPHOMETRIC EVIDENCE FOR NUTRITIONAL STRESS IN ENGLISH SOLE

    Science.gov (United States)

    We present an application of the powerful thin plate spline method of morphometric analysis to demonstrate its utility for detecting environmental stress in an estuarine flatfish. Juvenile English sole (Pleuronectes vetulus) were captured from Yaquina Bay, Oregon, photographed w...

  18. Disorders presenting with headache as the sole symptom ...

    African Journals Online (AJOL)

    Disorders presenting with headache as the sole symptom. ... Log in or Register to get access to full text downloads. ... probably do not require sophisticated neurological skills or investigations, failure to recognise an underlying disorder or an ...

  19. The role of similarity cues in the development of trust in sources of information about GM food.

    Science.gov (United States)

    Meijnders, Anneloes; Midden, Cees; Olofsson, Anna; Ohman, Susanna; Matthes, Jörg; Bondarenko, Olha; Gutteling, Jan; Rusanen, Maria

    2009-08-01

    In evaluating complex new technologies, people are usually dependent on information provided by others, for example, experts or journalists, and have to determine whether they can trust these information sources. This article focuses on similarity as the basis for trust. The first experiment (N = 261) confirmed that a journalist writing about genetically modified (GM) food was trusted more when his attitude was congruent with that of his readers. In addition, the experiment showed that this effect was mediated by the perceived similarity of the journalist. The second experiment (N = 172) revealed that trust in a journalist writing about the focal domain of GM food was even influenced by him expressing a congruent attitude in an unrelated domain. This result supports a general similarity account of the congruence effect on trust, as opposed to a confirmatory bias account.

  20. Basal Cell Carcinoma on the Sole: An Easily Missed Cancer

    Directory of Open Access Journals (Sweden)

    Natalie L. Hone

    2016-10-01

    Full Text Available Basal cell carcinoma (BCC is the most common skin cancer, and solar ultraviolet ray exposure is the most significant risk factor for its development. The plantar foot is infrequently exposed to the sun, thus the presence of BCC on the sole is rare. We report a case of BCC on the sole of the foot and its treatment in the hope to facilitate its detection.

  1. Major food sources contributing to energy intake--a nationwide survey of Brazilians aged 10 years and older.

    Science.gov (United States)

    Sichieri, Rosely; Bezerra, Ilana Nogueira; Araújo, Marina Campos; de Moura Souza, Amanda; Yokoo, Edna Massae; Pereira, Rosangela Alves

    2015-05-28

    Identification of major sources of energy in the diet helps to implement dietary recommendations to reduce obesity. To determine the food sources of energy consumed by Brazilians, we used the traditional method of ranking energy contribution of selected food groups and also compared days with and without consumption of specific food groups. Analysis was based on two non-consecutive days of dietary record from the Brazilian National Dietary Survey, conducted among 34,003 Brazilians (aged 10 years or more), taking into account the complex design of the survey. Comparison of days with and without consumption gave more consistent results, with sweets and cookies as the most important contributors to energy intake, increasing 992 kJ/d (95% CI 883, 1096) for those days when consumption of cakes, cookies and desserts was reported compared to days without their consumption. Savoury snacks, cheese and sugar-sweetened beverages (SSB) also increase energy intake by about 600 kJ. The only group associated with decreased energy intake was vegetable (-155 kJ; 95% CI -272, -37). Consumption of beans, milk and fruits increased the energy intake by about 210 kJ. In total, the mean energy intake of the group was 8000 kJ. Except for the consumption of vegetables, all of the other ten food groups analysed were associated with increased energy intake. Sweets and cookies may increase the energy intake by 12% and SSB by 7%, indicating that these two groups are major targets for improving healthy eating by reducing energy intake; whereas vegetable intake is associated with the reduction of energy content of the diet.

  2. Barriers to Maori sole mothers’ primary health care access

    Directory of Open Access Journals (Sweden)

    Lee R

    2013-12-01

    Full Text Available INTRODUCTION: International research consistently shows that sole mothers experience poorer health and suboptimal health care access. New Zealand studies on sole mothers' health report similar findings. The aim of this exploratory research was to better understand the experiences of Maori sole mothers' access to health services, particularly primary health care, for personal health needs. METHODS: This qualitative study employed a general inductive design informed by a Kaupapa Maori approach, providing guidance on appropriate cultural protocols for recruiting and engaging Maori participants. Distributing written information and snowballing techniques were used to purposively recruit seven Maori sole mothers. Data collection involved semi-structured interviews which were digitally recorded and transcribed verbatim. Data were analysed using general inductive thematic analysis to identify commonalities and patterns in participants' experiences. FINDINGS: The dominant themes that emerged captured and described participants' experiences in accessing health care. The major barrier to access reported was cost. Compounding cost, transport difficulties and location or scheduling of services were additional barriers to health service accessibility. Child-related issues also posed a barrier, including prioritising children's needs and childcare over personal health needs. CONCLUSION: The findings illuminate Maori sole mothers' experiences of accessing health care and the complex socioeconomic inequalities affecting access options and uptake of services. Further investigation of barriers to access is needed. The study has implications for addressing barriers to access at policy, funding and practice levels to improve health outcomes and equitable health care access for Maori sole mothers.

  3. Household dietary diversity and Animal Source Food consumption in Ethiopia: evidence from the 2011 Welfare Monitoring Survey.

    Science.gov (United States)

    Workicho, Abdulhalik; Belachew, Tefera; Feyissa, Garumma Tolu; Wondafrash, Beyene; Lachat, Carl; Verstraeten, Roosmarijn; Kolsteren, Patrick

    2016-11-25

    It is imperative to track dietary quality and progress in nutritional outcomes in a population to develop timely interventions. Dietary diversity is a commonly used proxy to assess dietary quality in low-income countries. This study identified predictors of household dietary diversity in Ethiopia and pattern of consumption of animal source food (ASF) among households. Secondary data were analyzed from the 2011 Ethiopian Welfare Monitoring Survey (WMS). This survey used a structured questionnaire to collect socio-demographic and economic data. Dietary data were collected using a dietary diversity questionnaire measuring dietary diversity over the past 1 week. A Household Dietary Diversity Score (HDDS) was constructed according to the Food and Agricultural Organization (FAO) guidelines. Consumption of ASFs is described by its distribution among the regions and by HDDS. Multiple logistic regression analysis was fitted to identify independent predictors for HDDS. A total of 27,995 households were included in the analyses. A little over half of the study households (52.2%) had more than four household members, and 75% of households were male headed. The mean HHDS was five food groups. Cereals were the most commonly (96%) consumed food groups. Fish, egg and fruits, on the other hand, were the least consumed food groups. ASFs were consumed in greater proportion among households with higher HDDS. Being part of the higher and middle socio economic strata (P < 0.001), literacy (P < 0.01), urban residence (P < 0.01), male headed household (P < 0.01), larger family size (P <0.01) and owning livestock (P < 0.01) were positively associated with higher HDDS. Considering these findings, nutrition sensitive interventions which address the problem through economic and educational empowerment and modern technologies supporting agricultural practices need to be designed to increase both local production and increased consumption.

  4. Nutrient Patterns and Their Food Sources in Older Persons from France and Quebec: Dietary and Lifestyle Characteristics

    Directory of Open Access Journals (Sweden)

    Benjamin Allès

    2016-04-01

    Full Text Available Background: Dietary and nutrient patterns have been linked to health outcomes related to aging. Food intake is influenced by environmental and genetic factors. The aim of the present study was to compare nutrient patterns across two elderly populations sharing a common ancestral cultural background, but living in different environments. Methods: The diet quality, lifestyle and socioeconomic characteristics of participants from the Three-City Study (3C, France, n = 1712 and the Québec Longitudinal Study on Nutrition and Successful Aging (NuAge, Quebec, Canada, n = 1596 were analyzed. Nutrient patterns and their food sources were identified in the two samples using principal component analysis. Diet quality was compared across sample-specific patterns by describing weekly food intake and associations with the Canadian Healthy Eating Index (C-HEI. Results: Three nutrient patterns were retained in each study: a healthy, a Western and a more traditional pattern. These patterns accounted for 50.1% and 53.5% of the total variance in 3C and NuAge, respectively. Higher education and non-physical occupations over lifetime were associated with healthy patterns in both studies. Other characteristics such as living alone, having a body mass index lower than 25 and being an ex-smoker were associated with the healthy pattern in NuAge. No association between these characteristics and the nutrient patterns was noted in 3C. The healthy and Western patterns from each sample also showed an inverse association with C-HEI. Conclusion: The two healthy patterns showed important similarities: adequate food variety, consumption of healthy foods and associations with common sociodemographic factors. This work highlights that nutrient patterns derived using a posteriori methods may be useful to compare the nutritional quality of the diet of distinct populations.

  5. Nutrient Patterns and Their Food Sources in Older Persons from France and Quebec: Dietary and Lifestyle Characteristics.

    Science.gov (United States)

    Allès, Benjamin; Samieri, Cécilia; Lorrain, Simon; Jutand, Marthe-Aline; Carmichael, Pierre-Hugues; Shatenstein, Bryna; Gaudreau, Pierrette; Payette, Hélène; Laurin, Danielle; Barberger-Gateau, Pascale

    2016-04-19

    Dietary and nutrient patterns have been linked to health outcomes related to aging. Food intake is influenced by environmental and genetic factors. The aim of the present study was to compare nutrient patterns across two elderly populations sharing a common ancestral cultural background, but living in different environments. The diet quality, lifestyle and socioeconomic characteristics of participants from the Three-City Study (3C, France, n = 1712) and the Québec Longitudinal Study on Nutrition and Successful Aging (NuAge, Quebec, Canada, n = 1596) were analyzed. Nutrient patterns and their food sources were identified in the two samples using principal component analysis. Diet quality was compared across sample-specific patterns by describing weekly food intake and associations with the Canadian Healthy Eating Index (C-HEI). Three nutrient patterns were retained in each study: a healthy, a Western and a more traditional pattern. These patterns accounted for 50.1% and 53.5% of the total variance in 3C and NuAge, respectively. Higher education and non-physical occupations over lifetime were associated with healthy patterns in both studies. Other characteristics such as living alone, having a body mass index lower than 25 and being an ex-smoker were associated with the healthy pattern in NuAge. No association between these characteristics and the nutrient patterns was noted in 3C. The healthy and Western patterns from each sample also showed an inverse association with C-HEI. The two healthy patterns showed important similarities: adequate food variety, consumption of healthy foods and associations with common sociodemographic factors. This work highlights that nutrient patterns derived using a posteriori methods may be useful to compare the nutritional quality of the diet of distinct populations.

  6. Agriculture and food animals as a source of antimicrobial-resistant bacteria

    Directory of Open Access Journals (Sweden)

    Economou V

    2015-04-01

    Full Text Available Vangelis Economou,1 Panagiota Gousia2 1Department of Hygiene and Technology of Food of Animal Origin, School of Veterinary Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greece; 2Food-Water Microbiology Unit, Department of Microbiology, Faculty of Medicine, School of Health Sciences, University of Ioannina, Ioannina, Greece Abstract: One of the major breakthroughs in the history of medicine is undoubtedly the discovery of antibiotics. Their use in animal husbandry and veterinary medicine has resulted in healthier and more productive farm animals, ensuring the welfare and health of both animals and humans. Unfortunately, from the first use of penicillin, the resistance countdown started to tick. Nowadays, the infections caused by antibiotic-resistant bacteria are increasing, and resistance to antibiotics is probably the major public health problem. Antibiotic use in farm animals has been criticized for contributing to the emergence of resistance. The use and misuse of antibiotics in farm animal settings as growth promoters or as nonspecific means of infection prevention and treatment has boosted antibiotic consumption and resistance among bacteria in the animal habitat. This reservoir of resistance can be transmitted directly or indirectly to humans through food consumption and direct or indirect contact. Resistant bacteria can cause serious health effects directly or via the transmission of the antibiotic resistance traits to pathogens, causing illnesses that are difficult to treat and that therefore have higher morbidity and mortality rates. In addition, the selection and proliferation of antibiotic-resistant strains can be disseminated to the environment via animal waste, enhancing the resistance reservoir that exists in the environmental microbiome. In this review, an effort is made to highlight the various factors that contribute to the emergence of antibiotic resistance in farm animals and to

  7. Food Sources of EPA and DHA in the Diets of American Children, NHANES 2003-2010

    OpenAIRE

    Kranz, Sibylle; Huss, Lyndsey R.; Dobbs-Oates, Jennifer

    2015-01-01

    Objective Dietary eicosapentaenoicacid (EPA) and docosahexaenoic acid (DHA) are found in the highest concentrations in fish and seafood. As important nutrients for brain and eye development and function, their consumption levels are of public health interest, especially in children. This study was conducted toexamine children’sreported consumption of fish and shellfish as well as EPA and DHA intake.Methods Secondary analysis of dietary intake (24-hour recall) and Food Frequency Questionnaire ...

  8. A study on the potential of insect protein and lipid as a food source

    NARCIS (Netherlands)

    Yi, L.

    2015-01-01

    Propositions

    Propositions belonging to the thesis, entitled:‘A study on the potential of insect protein and lipid as a food source’. Liya Yi

    Wageningen, 9 February 2015.High protein

  9. Combination of plant and insect eggs as food sources facilitates ovarian development in an omnivorous bug Apolygus lucorum (Hemiptera: Miridae).

    Science.gov (United States)

    Yuan, Wei; Li, Wenjing; Li, Yunhe; Wu, Kongming G

    2013-06-01

    Diet nutrient is considered as an important regulatory factor for reproduction of insects. To understand the effect of different food sources on the reproductive physiology of Apolygus lucorum (Meyer-Dür), the ovarian development in adult females was investigated when they were fed on green beans (Gb), combination of green beans Phaseolus vulgaris L and Helicoverpa armigera eggs (GbHe), or H. armigera eggs (He). A female of A. lucorum has two ovaries, and each ovary contained seven yellowish ovarioles. Females fed on Gb or GbHe had larger ovaries and the ovarioles contained larger numbers of oocytes compared with those fed on He. Females in GeHe treatment has significantly higher number of follicles per ovary throughout the whole adult period compared with those in Gb or He treatment. Furthermore, the length of the best developed ovariole was affected by the diet type. The females fed on GbHe had the most developed ovarioles, with significantly longer ovarioles than those fed on Gb or He. A method was described to quantitatively score the degree of ovarian development in the current study. Similarly, the ovarian development scores were significantly higher for females in GbHe treatment than those in other two diet treatments. The ovarian development significantly delayed for females fed on He. Our results demonstrate that A. lucorum, as an omnivorous insect species, can acquire nutrients from both plant and animal origin food sources, and the combination of plants and animal food sources can significantly facilitate the ovary development of its females.

  10. Vitamin D Intake among Premenopausal Women Living in Jeddah: Food Sources and Relationship to Demographic Factors and Bone Health

    Directory of Open Access Journals (Sweden)

    Tahani A. Zareef

    2018-01-01

    Full Text Available Background. Saudi women depend on food sources to maintain their serum 25(OH D concentrations because covering by traditional clothing and time spent indoors limit their sun exposure. Little is known about vitamin D intake and its main food sources in Saudi Arabia. In addition, the association between vitamin D and calcium intake and bone mineral density (BMD in young women is not well researched. Objectives. To assess the adequacy of vitamin D intake among Saudi women as compared to the estimated average requirements (EARs, to identify dietary vitamin D sources, to examine potential determinants of vitamin D intake, and to assess bone health and the association of calcium and vitamin D intake with BMD. Methods. This cross-sectional study was conducted in 257 premenopausal women aged 20–50 years in Jeddah, Saudi Arabia. Dietary vitamin D and calcium were assessed by the Semiquantitative Food Frequency Questionnaire. BMD was measured using dual-energy X-ray absorptiometry (DXA in a subset of women n=102 at the lumbar spine and femur neck. Results. Sixty-five percent of women were below the EAR for vitamin D, and 61% fell below the EAR for calcium. Dairy products, supplements, and fish contributed most to vitamin D intake. Increased age was an independent determinant of sufficient vitamin D intake p<0.001. The prevalence of osteopenia was 33% in the lumbar spine and 30% in the femur neck. There was a significant positive association between calcium intake and BMD at the lumbar spine p=0.043 after controlling for body mass index and energy intake. Vitamin D intake was not significantly different between women with low and normal bone mass. Conclusion. Premenopausal women in Jeddah have insufficient vitamin D and calcium intakes. Public health strategies to improve nutrition in young women are needed, and expanding fortification programs to include all dairy products would be useful.

  11. Natural Leishmania sp. reservoirs and phlebotomine sandfly food source identification in Ibitipoca State Park, Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Patrícia Flávia Quaresma

    2012-06-01

    Full Text Available Leishmania spp are distributed throughout the world and different species are associated with varying degrees of disease severity. However, leishmaniasis is thought to be confined to areas of the world where its insect vectors, sandflies, are present. Phlebotomine sandflies obtain blood meals from a variety of wild and domestic animals and sometimes from humans. These vectors transmit Leishmania spp, the aetiological agent of leishmaniasis. Identification of sandfly blood meals has generally been performed using serological methods, although a few studies have used molecular procedures in artificially fed insects. In this study, cytochrome b gene (cytB polymerase chain reaction (PCR was performed in DNA samples isolated from 38 engorged Psychodopygus lloydi and the expected 359 bp fragment was identified from all of the samples. The amplified product was digested using restriction enzymes and analysed for restriction fragment length polymorphisms (RFLPs. We identified food sources for 23 females; 34.8% yielded a primate-specific banding profile and 26.1% and 39.1% showed banding patterns specific to birds or mixed restriction profiles (rodent/marsupial, human/bird, rodent/marsupial/human, respectively. The food sources of 15 flies could not be identified. Two female P. lloydi were determined to be infected by Leishmania using internal transcribed spacer 1 and heat shock protein 70 kDa PCR-RFLP. The two female sandflies, both of which fed on rodents/marsupials, were further characterised as infected with Leishmania (Viannia braziliensis. These results constitute an important step towards applying methodologies based on cytB amplification as a tool for identifying the food sources of female sandflies.

  12. Radionuclide contents in food products from domestic and imported sources in Nigeria

    International Nuclear Information System (INIS)

    Jibiri, N N; Okusanya, A A

    2008-01-01

    Samples of some domestic and imported food products of nutritive importance to both the child population and the adult population in Nigeria were collected and analysed in order to determine their radionuclide contents. The samples were collected from open markets in major commercial cities in the country. Gamma-ray spectrometry was employed in the determination of the radionuclide contents in the products. The gamma-ray peaks observed with reliable regularity in all the samples analysed belong to naturally occurring radionuclides, namely 226 Ra, 228 Th and 40 K. The activity concentrations of these radionuclides in both the domestic and imported products were observed to be not significantly different. Essentially radioactive elements such as 137 Cs were not detected in any of the samples. The non-detection of 137 Cs in the imported products may be attributed to the suitably modified agricultural practices and countermeasures being employed to reduce caesium uptake by plants after the Chernobyl nuclear reactor accident. It seems unlikely that the elemental concentrations in the food products analysed will contribute significantly to public health risks in the country, as the cumulative ingestion effective dose values from 226 Ra and 228 Th were found to be low. Although 40 K has the highest activity concentrations in all the samples analysed, it is usually under homeostatic control in the body, and hence the concentrations are irrelevant to possible contamination in the food products analysed. (note)

  13. Food sources of energy and nutrients in Finnish girls and boys 6–8 years of age – the PANIC study

    Directory of Open Access Journals (Sweden)

    Aino-Maija Eloranta

    2016-09-01

    Full Text Available Background: Data on food sources of nutrients are needed to improve strategies to enhance nutrient intake among girls and boys in Western countries. Objective: To identify major food sources of energy, energy nutrients, dietary fibre, and micronutrients, and to study gender differences in these food sources among children. Design: We assessed food consumption and nutrient intake using 4-day food records in a population sample of Finnish girls (n=213 and boys (n=217 aged 6–8 years from the Physical Activity and Nutrition in Children Study. We calculated the percentual contribution of 55 food groups for energy and nutrient intake using the population proportion method. Results: Low-fibre grain products, skimmed milk, and high-fibre bread provided almost 23% of total energy intake. Skimmed milk was the top source of protein (18% of total intake, vitamin D (32%, potassium (20%, calcium (39%, magnesium (17%, and zinc (16%. Vegetable oils (15% and high-fat vegetable oil–based spreads (14% were the top sources of polyunsaturated fat. High-fibre bread was the top source of fibre (27% and iron (12%. Non-root vegetables were the top source of folate (14% and vitamin C (22%. Sugar-sweetened beverages provided 21% of sucrose intake. Pork was a more important source of protein and sausage was a more important source of total fat and monounsaturated fat in boys than in girls. Vegetable oils provided a higher proportion of unsaturated fat and vitamin E among boys, whereas high-fat vegetable oil–based spreads provided a higher proportion of these nutrients among girls. Conclusion: Commonly recommended foods, such as skimmed milk, high-fibre grain products, vegetables, vegetable oil, and vegetable oil–based spreads, were important sources of several nutrients, whereas sugar-sweetened beverages provided the majority of sucrose intake among children. This knowledge can be used in improving health among children by dietary interventions, nutrition education

  14. Food sources of energy and nutrients in Finnish girls and boys 6–8 years of age – the PANIC study

    Science.gov (United States)

    Eloranta, Aino-Maija; Venäläinen, Taisa; Soininen, Sonja; Jalkanen, Henna; Kiiskinen, Sanna; Schwab, Ursula; Lakka, Timo A.; Lindi, Virpi

    2016-01-01

    Background Data on food sources of nutrients are needed to improve strategies to enhance nutrient intake among girls and boys in Western countries. Objective To identify major food sources of energy, energy nutrients, dietary fibre, and micronutrients, and to study gender differences in these food sources among children. Design We assessed food consumption and nutrient intake using 4-day food records in a population sample of Finnish girls (n=213) and boys (n=217) aged 6–8 years from the Physical Activity and Nutrition in Children Study. We calculated the percentual contribution of 55 food groups for energy and nutrient intake using the population proportion method. Results Low-fibre grain products, skimmed milk, and high-fibre bread provided almost 23% of total energy intake. Skimmed milk was the top source of protein (18% of total intake), vitamin D (32%), potassium (20%), calcium (39%), magnesium (17%), and zinc (16%). Vegetable oils (15%) and high-fat vegetable oil–based spreads (14%) were the top sources of polyunsaturated fat. High-fibre bread was the top source of fibre (27%) and iron (12%). Non-root vegetables were the top source of folate (14%) and vitamin C (22%). Sugar-sweetened beverages provided 21% of sucrose intake. Pork was a more important source of protein and sausage was a more important source of total fat and monounsaturated fat in boys than in girls. Vegetable oils provided a higher proportion of unsaturated fat and vitamin E among boys, whereas high-fat vegetable oil–based spreads provided a higher proportion of these nutrients among girls. Conclusion Commonly recommended foods, such as skimmed milk, high-fibre grain products, vegetables, vegetable oil, and vegetable oil–based spreads, were important sources of several nutrients, whereas sugar-sweetened beverages provided the majority of sucrose intake among children. This knowledge can be used in improving health among children by dietary interventions, nutrition education, and

  15. Expansion and functional properties of extruded snacks enriched with nutrition sources from food processing by-products

    OpenAIRE

    Korkerd, Sopida; Wanlapa, Sorada; Puttanlek, Chureerat; Uttapap, Dudsadee; Rungsardthong, Vilai

    2015-01-01

    Rich sources of protein and dietary fiber from food processing by-products, defatted soybean meal, germinated brown rice meal, and mango peel fiber, were added to corn grit at 20 % (w/w) to produce fortified extruded snacks. Increase of total dietary fiber from 4.82 % (wb) to 5.92–17.80 % (wb) and protein from 5.03 % (wb) to 5.46–13.34 % were observed. The product indicated high expansion and good acceptance tested by sensory panels. There were 22.33–33.53 and 5.30–11.53 fold increase in the ...

  16. Food Sources of Energy and Nutrients in Infants, Toddlers, and Young Children from the Mexican National Health and Nutrition Survey 2012.

    Science.gov (United States)

    Denney, Liya; Afeiche, Myriam C; Eldridge, Alison L; Villalpando-Carrión, Salvador

    2017-05-13

    Food sources of nutrients in Mexican children are not well known. To fill the knowledge gap, dietary intake was assessed in 2057 children using a 24-hour dietary recall. All reported foods and beverages were assigned to one of 76 food groups. Percent contribution of each food group to nutrient intake was estimated for four age groups: 0-5.9, 6-11.9, 12-23.9, and 24-47.9 months. Breast milk, infant formula, and cow's milk were the top sources of energy and nutrients, especially in younger groups. Among infants aged 6-11.9 months, the top food sources of energy included soups and stews, cookies, fruit, tortillas, eggs and egg dishes, and traditional beverages. The same foods plus sweetened breads, dried beans, and sandwiches and tortas were consumed as the top sources of energy among toddlers and young children. Milk, soups, and stews were the top contributors for all nutrients and tortillas, eggs, and egg dishes were among the top contributors for iron and zinc. This study showed that low nutrient-dense cookies, sweetened breads, and traditional beverages were among the core foods consumed early in life in Mexico. This compromises the intake of more nutritious foods such as vegetables and fortified cereals and increases the risk of obesity.

  17. Attribution of the French human Salmonellosis cases to the main food-sources according to the type of surveillance data.

    Science.gov (United States)

    David, J M; Sanders, P; Bemrah, N; Granier, S A; Denis, M; Weill, F-X; Guillemot, D; Watier, L

    2013-05-15

    Salmonella are the most common bacterial cause of foodborne infections in France and ubiquitous pathogens present in many animal productions. Assessing the relative contribution of the different food-animal sources to the burden of human cases is a key step towards the conception, prioritization and assessment of efficient control policy measures. For this purpose, we considered a Bayesian microbial subtyping attribution approach based on a previous published model (Hald et al., 2004). It requires quality integrated data on human cases and on the contamination of their food sources, per serotype and microbial subtype, which were retrieved from the French integrated surveillance system for Salmonella. The quality of the data available for such an approach is an issue for many countries in which the surveillance system has not been designed for this purpose. In France, the sources are monitored simultaneously by an active, regulation-based surveillance system that produces representative prevalence data (as ideally required for the approach) and a passive system relying on voluntary laboratories that produces data not meeting the standards set by Hald et al. (2004) but covering a broader range of sources. These data allowed us to study the impact of data quality on the attribution results, globally and focusing on specific features of the data (number of sources and contamination indicator). The microbial subtyping attribution model was run using an adapted parameterization previously proposed (David et al., 2012). A total of 9076 domestic sporadic cases were included in the analyses as well as 9 sources among which 5 were common to the active and the passive datasets. The greatest impact on the attribution results was observed for the number of sources. Thus, especially in the absence of data on imported products, the attribution estimates presented here should be considered with caution. The results were comparable for both types of surveillance, leading to the

  18. Fabrication of 50-mg 252Cf neutron sources for the FDA [Food and Drug Administration] activation analysis facility

    International Nuclear Information System (INIS)

    Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.

    1987-01-01

    The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing

  19. Stiffness Effects in Rocker-Soled Shoes: Biomechanical Implications

    Science.gov (United States)

    Su, Pei-Fang; Chung, Chia-Hua; Hsia, Chi-Chun; Chang, Chih-Han

    2017-01-01

    Rocker-soled shoes provide a way to reduce the possible concentration of stress, as well as change movement patterns, during gait. This study attempts to examine how plantar force and spatio-temporal variables are affected by two rocker designs, one with softer and one with denser sole materials, by comparing them with the barefoot condition and with flat-soled shoes. Eleven subjects’ gait parameters during walking and jogging were recorded. Our results showed that compared with barefoot walking, plantar forces were higher for flat shoes while lower for both types of rocker shoes, the softer-material rocker being the lowest. The plantar force of flat shoes is greater than the vertical ground reaction force, while that of both rocker shoes is much less, 13.87–30.55% body weight. However, as locomotion speed increased to jogging, for all shoe types, except at the second peak plantar force of the denser sole material rocker shoes, plantar forces were greater than for bare feet. More interestingly, because the transmission of force was faster while jogging, greater plantar force was seen in the rocker-soled shoes with softer material than with denser material; results for higher-speed shock absorption in rocker-soled shoes with softer material were thus not as good. In general, the rolling phenomena along the bottom surface of the rocker shoes, as well as an increase in the duration of simultaneous curve rolling and ankle rotation, could contribute to the reduction of plantar force for both rocker designs. The possible mechanism is the conversion of vertical kinetic energy into rotational kinetic energy. To conclude, since plantar force is related to foot-ground interface and deceleration methods, rocker-design shoes could achieve desired plantar force reduction through certain rolling phenomena, shoe-sole stiffness levels, and locomotion speeds. PMID:28046009

  20. Stiffness Effects in Rocker-Soled Shoes: Biomechanical Implications.

    Directory of Open Access Journals (Sweden)

    Shih-Yun Lin

    Full Text Available Rocker-soled shoes provide a way to reduce the possible concentration of stress, as well as change movement patterns, during gait. This study attempts to examine how plantar force and spatio-temporal variables are affected by two rocker designs, one with softer and one with denser sole materials, by comparing them with the barefoot condition and with flat-soled shoes. Eleven subjects' gait parameters during walking and jogging were recorded. Our results showed that compared with barefoot walking, plantar forces were higher for flat shoes while lower for both types of rocker shoes, the softer-material rocker being the lowest. The plantar force of flat shoes is greater than the vertical ground reaction force, while that of both rocker shoes is much less, 13.87-30.55% body weight. However, as locomotion speed increased to jogging, for all shoe types, except at the second peak plantar force of the denser sole material rocker shoes, plantar forces were greater than for bare feet. More interestingly, because the transmission of force was faster while jogging, greater plantar force was seen in the rocker-soled shoes with softer material than with denser material; results for higher-speed shock absorption in rocker-soled shoes with softer material were thus not as good. In general, the rolling phenomena along the bottom surface of the rocker shoes, as well as an increase in the duration of simultaneous curve rolling and ankle rotation, could contribute to the reduction of plantar force for both rocker designs. The possible mechanism is the conversion of vertical kinetic energy into rotational kinetic energy. To conclude, since plantar force is related to foot-ground interface and deceleration methods, rocker-design shoes could achieve desired plantar force reduction through certain rolling phenomena, shoe-sole stiffness levels, and locomotion speeds.

  1. Poultry food products--a source of avian influenza virus transmission to humans?

    Science.gov (United States)

    Harder, T C; Buda, S; Hengel, H; Beer, M; Mettenleiter, T C

    2016-02-01

    Global human mobility and intercontinental connectivity, expansion of livestock production and encroachment of wildlife habitats by invasive agricultural land use contribute to shape the complexity of influenza epidemiology. The OneHealth approach integrates these and further elements into considerations to improve disease control and prevention. Food of animal origin for human consumption is another integral aspect; if produced from infected livestock such items may act as vehicles of spread of animal pathogens, and, in case of zoonotic agents, as a potential human health hazard. Notifiable zoonotic avian influenza viruses (AIV) have become entrenched in poultry populations in several Asian and northern African countries since 2003. Highly pathogenic (HP) AIV (e.g. H5N1) cause extensive poultry mortality and severe economic losses. HPAIV and low pathogenic AIV (e.g. H7N9) with zoonotic propensities pose risks for human health. More than 1500 human cases of AIV infection have been reported, mainly from regions with endemically infected poultry. Intense human exposure to AIV-infected poultry, e.g. during rearing, slaughtering or processing of poultry, is a major risk factor for acquiring AIV infection. In contrast, human infections through consumption of AIV-contaminated food have not been substantiated. Heating poultry products according to kitchen standards (core temperatures ≥70°C, ≥10 s) rapidly inactivates AIV infectivity and renders fully cooked products safe. Nevertheless, concerted efforts must ensure that poultry products potentially contaminated with zoonotic AIV do not reach the food chain. Stringent and sustained OneHealth measures are required to better control and eventually eradicate, HPAIV from endemic regions. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. The Content of Fat and Polyenoic Acids in the Major Food Sources of the Arctic Diet

    DEFF Research Database (Denmark)

    Shukla, V. K. S.; Clausen, Jytte Lene; Egsgaard, Helge

    1980-01-01

    In relation to the apparently low incidence of coronary heart diseases in Arctic populations the fatty acid pattern of muscle and fat tissue of the Arctic seal, birds and mammals were compared with the fatty acid pattern of the corresponding tissues of domestic animals normally used as meat sources...... in western countries. The triglyceride content of muscle samples was also estimated. A gas chromatography-mass spectrometry system was used for localizing the position of double bonds in the unsaturated acids, by means of their pyrrolidides. The fat tissue from the seal was the main source of polyenoic acids......, tri- and pentaenoic acids in the diet of the Arctic hunter. Those acids were derived metabolically from linolenic acid. In contrast polyenoic acids, linoleic acid and its derivatives in the nonarctic diet, were mainly supplied from muscle of nonruminant animals and from sources of vegetable origin...

  3. Effect of essential oils on Aspergillus spore germination, growth and mycotoxin production:a potential source of botanical food preservative

    Institute of Scientific and Technical Information of China (English)

    Negero Gemeda; Yimtubezinash Woldeamanuel; Daniel Asrat; Asfaw Debella

    2014-01-01

    Objective: To investigate effect of essential oils on Aspergillus spore germination, growth and mycotoxin production.Method: In vitro antifungal and antiaflatoxigenic activity of essential oils was carried out using poisoned food techniques, spore germination assay, agar dilution assay, and aflatoxin arresting assay on toxigenic strains of Aspergillus species.Results: Cymbopogon martinii, Foeniculum vulgare and Trachyspermum ammi (T. ammi) essential oils were tested against toxicogenic isolates of Aspergillus species. T. ammi oil showed highest antifungal activity. Absolute mycelial inhibition was recorded at 1 µl/mL by essential oils of T. ammi. The oil also showed, complete inhibition of spore germination at a concentration of 2 µl/mL. In addition, T. ammi oil showed significant antiaflatoxigenic potency by totally inhibiting aflatoxin production from Aspergillus niger and Aspergillus flavus at 0.5 and 0.75 µl/mL, respectively. Cymbopogon martinii, Foeniculum vulgare and T. ammi oils as antifungal were found superior over synthetic preservative. Moreover, a concentration of 5 336.297 µl/kg body weight was recorded for LC50 on mice indicating the low mammalian toxicity and strengthening its traditional reputations.Conclusions:In conclusion, the essential oils from T. ammi can be a potential source of safe natural food preservative for food commodities contamination by storage fungi.

  4. Are plasma homocysteine concentrations in Brazilian adolescents influenced by the intake of the main food sources of natural folate?

    Science.gov (United States)

    Bigio, Roberta Schein; Verly, Eliseu; de Castro, Michelle Alessandra; Cesar, Chester Luis Galvão; Fisberg, Regina Mara; Marchioni, Dirce Maria Lobo

    2013-01-01

    Folate, a B vitamin, has been associated with a reduced concentration of plasma homocysteine (phcy), a marker of cardiovascular disease. The contribution of fruits and vegetables (FV) and other natural folate-rich foods to folate intake and folate status in Brazilian adolescents has hardly been determined. To investigate the intake of FV and beans and its association with the concentration of phcy in adolescents. This was a cross-sectional population-based study with a complex sample survey, with 198 adolescents who completed two 24-hour dietary recalls, a food frequency questionnaire, and a fasting blood draw. Usual dietary intake estimates were derived applying the Multiple Source Method. Three different generalized linear models with a gamma distribution were developed for each sex to evaluate the relationship between phcy and tertiles of FV intake as well as to evaluate the relationship between phcy and tertiles of FV and bean intake. No association was found between phcy concentration and FV intake or between phcy and FV and beans. Serum folate and female sex were inversely related to phcy. Phcy was not related to FV or FV and beans; this may be attributable to a low intake of these food groups. Copyright © 2013 S. Karger AG, Basel.

  5. Food sources of vitamin D and their association with 25-hydroxyvitamin D status in Dutch older adults.

    Science.gov (United States)

    Vaes, A M M; Brouwer-Brolsma, E M; van der Zwaluw, N L; van Wijngaarden, J P; Berendsen, A A M; van Schoor, N; van der Velde, N; Uitterlinden, A; Lips, P; Dhonukshe-Rutten, R A M; de Groot, L C P G M

    2017-10-01

    Various populations are at increased risk of developing a low vitamin D status, in particular older adults. Whereas sun exposure is considered the main source of vitamin D, especially during summer, dietary contributions should not be underestimated. This study aims to identify food sources of vitamin D that associate most strongly with serum vitamin D concentration. Data of 595 Dutch adults, aged ≥65 years, were analysed. Vitamin D intake was assessed with a food frequency questionnaire and 25-hydroxyvitamin D (25(OH)D) was determined in serum. Associations of total vitamin D intake and vitamin D intake from specific food groups with serum 25(OH)D status were examined by P-for trend analyses over tertiles of vitamin D intake, prevalence ratios (PRs), and spline regression. The prevalence of vitamin D deficiency was high, with 36% of the participants having a 25(OH)D status D concentrations were more likely to be men and more likely to be younger than participants with vitamin D deficiency. Total median vitamin D intake was 4.3μg/day, of which 4.0μg/day was provided by foods. Butter and margarine were the leading contributors to total vitamin D intake with 1.8μg/day, followed by the intake of fish and shellfish with 0.56μg/day. Participants with higher intakes of butter and margarine were 21% more likely to have a sufficient 25(OH)D status after adjustment for covariates (T1 vs. T3: PR 1.0 vs. 1.21 (95%CI: 1.03-1.42), P-for trend 0.02). None of the other food groups showed a significant association with the probability of having a sufficient 25(OH)D status. This study shows that vitamin D intake was positively associated with total serum 25(OH)D concentration, with butter and margarine being the most important contributors to total vitamin D intake. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, D.; Teixeira, P. [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); Tavares, C.J. [Center of Physics, University of Minho, Campus de Azurém, 4800-058 Guimarães (Portugal); Azeredo, J., E-mail: jazeredo@deb.uminho.pt [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal)

    2013-04-01

    Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO{sub 2}) and, more recently, nitrogen-doped titanium dioxide (N-TiO{sub 2}) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO{sub 2} coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO{sub 2} coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10{sup 6} CFU/ml on glass and 2.37 × 10{sup 7} on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO{sub 2} coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly

  7. Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

    International Nuclear Information System (INIS)

    Rodrigues, D.; Teixeira, P.; Tavares, C.J.; Azeredo, J.

    2013-01-01

    Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO 2 ) and, more recently, nitrogen-doped titanium dioxide (N-TiO 2 ) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO 2 coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO 2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10 6 CFU/ml on glass and 2.37 × 10 7 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO 2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne

  8. Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

    Science.gov (United States)

    Rodrigues, D.; Teixeira, P.; Tavares, C. J.; Azeredo, J.

    2013-04-01

    Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO2) and, more recently, nitrogen-doped titanium dioxide (N-TiO2) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO2 coating on glass and stainless steel under two different sources of visible light - fluorescent and incandescent - and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 106 CFU/ml on glass and 2.37 × 107 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne pathogens and

  9. Clenbuterol - regional food contamination a possible source for inadvertent doping in sports.

    Science.gov (United States)

    Guddat, S; Fußhöller, G; Geyer, H; Thomas, A; Braun, H; Haenelt, N; Schwenke, A; Klose, C; Thevis, M; Schänzer, W

    2012-06-01

    The misuse of the sympathomimetic and anabolic agent clenbuterol has been frequently reported in professional sport and in the livestock industry. In 2010, a team of athletes returned from competition in China and regular doping control samples were taken within the next two days. All urine samples contained low amounts (pg/ml) of clenbuterol, drawing the attention to a well-known problem: the possibility of an unintended clenbuterol intake with food. A warning that Chinese meat is possibly contaminated with prohibited substances according to international anti-doping regulations was also given by Chinese officials just before the Bejing Olympic Games in 2008. To investigate if clenbuterol can be found in human urine, a study was initiated comprising 28 volunteers collecting urine samples after their return from China. For the quantification of clenbuterol at a low pg/ml level, a very sensitive and specific isotope dilution liquid chromatography-tandem mass spectrometry (LC-MS/MS) assay was developed using liquid/liquid re-extraction for clean-up with a limit of detection and quantification of 1 and 3 pg/ml, respectively. The method was validated demonstrating good precision (intra-day: 2.9-5.5 %; inter-day: 5.1-8.8%), accuracy (89.5-102.5%) and mean recovery (81.4%). Clenbuterol was detectable in 22 (79%) of the analyzed samples, indicating a general food contamination problem despite an official clenbuterol prohibition in China for livestock. Copyright © 2012 John Wiley & Sons, Ltd.

  10. Elaboration of microparticles of carotenoids from natural and synthetic sources for applications in food.

    Science.gov (United States)

    Rutz, Josiane K; Borges, Caroline D; Zambiazi, Rui C; da Rosa, Cleonice G; da Silva, Médelin M

    2016-07-01

    Carotenoids are susceptible to isomerization and oxidation upon exposure to oxygen, light and heat, which can result in loss of color, antioxidant activity, and vitamin activity. Microencapsulation helps retain carotenoid stability and promotes their release under specific conditions. Thus, the aim of the study was to encapsulate palm oil and β-carotene with chitosan/sodium tripolyphosphate or chitosan/carboxymethylcellulose and to assess the performance of these microparticles in food systems by analyzing their release profile under simulated gastric and intestinal conditions. Encapsulation efficiency was greater than 95%, and the yield of microparticles coated with chitosan/sodium tripolyphosphate was approximately 55%, while that of microparticles coated with chitosan/carboxymethylcellulose was 87%. Particles encapsulated with chitosan/carboxymethylcellulose exhibited ideal release behavior in water and gastric fluid, but showed low release in the intestinal fluid. However, when applied to food systems these particles showed enhanced carotenoid release but showed low release of carotenoids upon storage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Studies on chemical constituents and bioactivity of Rosa micrantha: an alternative antioxidants source for food, pharmaceutical, or cosmetic applications.

    Science.gov (United States)

    Guimarães, Rafaela; Barros, Lillian; Carvalho, Ana Maria; Ferreira, Isabel C F R

    2010-05-26

    Rose species have long been used for food and medicinal purposes. Rosa micrantha is one of the rose species that grow feral in the northeastern Portuguese region so-called Nordeste Transmontano. For the first time, chemical composition and bioactivity of their petals, fertilized flowers, unripe, ripening, and overripe hips were evaluated in order to valorize them as sources of important phytochemicals. Chemical characterization included determination of proteins, fats, ash, and carbohydrates, particularly sugars, by HPLC-RI, fatty acids by GC-FID, tocopherols by HPLC-fluorescence, and phenolics, flavonoids, carotenoids, and ascorbic acid by spectrophotometric techniques. Bioactivity was evaluated through screening of antioxidant properties: radical scavenging effects, reducing power, and inhibition of lipid peroxidation. Ripening and overripe hips showed high nutritional value including proteins, carbohydrates, omega-3 and omega-6 fatty acids, energy, sugars, particularly the reducing sugars fructose and glucose, and ascorbic acid (>693 mg/100 g). Fertilized flowers and petals revealed the highest antioxidant activity (EC(50) > 152 microg/mL) and phenolics, flavonoids, and tocopherols contents (>35 mg/100 g). Furthermore, petals, ripening, and overripe hips are important sources of carotenoid pigments (>64 mg/100 g). Because of the diversity and abundance of antioxidants found in this species, some food, cosmetic, and pharmaceutical applications could be explored.

  12. The role of similarity cues in the development of trustin sources of information about GM food

    NARCIS (Netherlands)

    Meijnders, Anneloes; Midden, Cees; Olofsson, Anna; Öhman, Susanna; Matthes, Jörg; Bondarenko, Olha; Gutteling, Jan; Rusanen, Maria

    In evaluating complex new technologies, people are usually dependent on information provided by others, for example, experts or journalists, and have to determine whether they can trust these information sources. This article focuses on similarity as the basis for trust. The first experiment (N =

  13. Low Dietary Diversity and Intake of Animal Source Foods among School Aged Children in Libo Kemkem and Fogera Districts, Ethiopia.

    Directory of Open Access Journals (Sweden)

    Zaida Herrador

    Full Text Available A low dietary diversity score (DDS and low consumption of food from animal sources (ASF are among the factors related to malnutrition in school-aged children living in Libo Kemkem and Fogera (Ethiopia.This study aimed to identify associated determinants for low dietary diversity and lack of consumption of ASF.In 2009, a cross-sectional survey was carried out in May, at the end of the lean season. Socio-demographic characteristics and diet habits were collected from 886 school-aged children. Additionally, 516 children from rural sites were followed up in the post-harvest season, in December of the same year. Bivariate and multivariable statistical methods were employed to assess low DDS and ASF intake and their association with different factors.Up to 80% and 60% of school-aged children living in rural and urban sites, respectively, ate ≤ 3 food groups the day before the survey. The percentage of children consuming ASF was significantly higher in urban settings (64% vs 18%. In the rural areas, if the head of the household was male (OR: 1.91; 95%CI: 1.00-3.65 and older than 40 years (OR: 1.56; 95%CI: 1.02-2.38 the child had a lower DDS in the lean season, while differences by socioeconomic indexes were observed in the post-harvest season. Males took more ASF than females in rural settings (OR: 1.73; 95%CI: 1.14-2.62 and differences by socioeconomic indexes were observed in both settings in the lean season, though not in post-harvest survey.The findings of this study revealed that the diet among school-aged children in Libo Kemkem and Fogera districts lacked diversity, and that the intake of foods from animal sources was low, especially among rural girls. To effectively tackle malnutrition, dietary diversification strategies oriented to the local needs are recommended.

  14. Food sources of fat may clarify the inconsistent role of dietary fat intake for incidence of type 2 diabetes.

    Science.gov (United States)

    Ericson, Ulrika; Hellstrand, Sophie; Brunkwall, Louise; Schulz, Christina-Alexandra; Sonestedt, Emily; Wallström, Peter; Gullberg, Bo; Wirfält, Elisabet; Orho-Melander, Marju

    2015-05-01

    Dietary fats could affect glucose metabolism and obesity development and, thereby, may have a crucial role in the cause of type 2 diabetes (T2D). Studies indicated that replacing saturated with unsaturated fats might be favorable, and plant foods might be a better choice than animal foods. Nevertheless, epidemiologic studies suggested that dairy foods are protective. We hypothesized that, by examining dietary fat and its food sources classified according to fat type and fat content, some clarification regarding the role of dietary fat in T2D incidence could be provided. A total of 26,930 individuals (61% women), aged 45-74 y, from the Malmö Diet and Cancer cohort were included in the study. Dietary data were collected by using a modified diet-history method. During 14 y of follow-up, 2860 incident T2D cases were identified. Total intake of high-fat dairy products (regular-fat alternatives) was inversely associated with incident T2D (HR for highest compared with lowest quintiles: 0.77; 95% CI: 0.68, 0.87; P-trend fat fermented milk (P-trend fat dairy products was associated with increased risk, but this association disappeared when low- and high-fat dairy were mutually adjusted (P-trend = 0.18). Intakes of both high-fat meat (P-trend = 0.04) and low-fat meat (P-trend fat content and T2D (P-trend = 0.24), but intakes of saturated fatty acids with 4-10 carbons, lauric acid (12:0), and myristic acid (14:0) were associated with decreased risk (P-trend fat dairy products suggests that dairy fat partly could have contributed to previously observed protective associations between dairy intake and T2D. Meat intake was associated with increased risk independently of the fat content. © 2015 American Society for Nutrition.

  15. A novel library-independent approach based on high-throughput cultivation in Bioscreen and fingerprinting by FTIR spectroscopy for microbial source tracking in food industry.

    Science.gov (United States)

    Shapaval, V; Møretrø, T; Wold Åsli, A; Suso, H P; Schmitt, J; Lillehaug, D; Kohler, A

    2017-05-01

    Microbiological source tracking (MST) for food industry is a rapid growing area of research and technology development. In this paper, a new library-independent approach for MST is presented. It is based on a high-throughput liquid microcultivation and FTIR spectroscopy. In this approach, FTIR spectra obtained from micro-organisms isolated along the production line and a product are compared to each other. We tested and evaluated the new source tracking approach by simulating a source tracking situation. In this simulation study, a selection of 20 spoilage mould strains from a total of six genera (Alternaria, Aspergillus, Mucor, Paecilomyces, Peyronellaea and Phoma) was used. The simulation of the source tracking situation showed that 80-100% of the sources could be correctly identified with respect to genus/species level. When performing source tracking simulations, the FTIR identification diverged for Phoma glomerata strain in the reference collection. When reidentifying the strain by sequencing, it turned out that the strain was a Peyronellaea arachidicola. The obtained results demonstrated that the proposed approach is a versatile tool for identifying sources of microbial contamination. Thus, it has a high potential for routine control in the food industry due to low costs and analysis time. The source tracking of fungal contamination in the food industry is an important aspect of food safety. Currently, all available methods are time consuming and require the use of a reference library that may limit the accuracy of the identification. In this study, we report for the first time, a library-independent FTIR spectroscopic approach for MST of fungal contamination along the food production line. It combines high-throughput microcultivation and FTIR spectroscopy and is specific on the genus and species level. Therefore, such an approach possesses great importance for food safety control in food industry. © 2016 The Society for Applied Microbiology.

  16. Sources

    International Nuclear Information System (INIS)

    Duffy, L.P.

    1991-01-01

    This paper discusses the sources of radiation in the narrow perspective of radioactivity and the even narrow perspective of those sources that concern environmental management and restoration activities at DOE facilities, as well as a few related sources. Sources of irritation, Sources of inflammatory jingoism, and Sources of information. First, the sources of irritation fall into three categories: No reliable scientific ombudsman to speak without bias and prejudice for the public good, Technical jargon with unclear definitions exists within the radioactive nomenclature, and Scientific community keeps a low-profile with regard to public information. The next area of personal concern are the sources of inflammation. This include such things as: Plutonium being described as the most dangerous substance known to man, The amount of plutonium required to make a bomb, Talk of transuranic waste containing plutonium and its health affects, TMI-2 and Chernobyl being described as Siamese twins, Inadequate information on low-level disposal sites and current regulatory requirements under 10 CFR 61, Enhanced engineered waste disposal not being presented to the public accurately. Numerous sources of disinformation regarding low level radiation high-level radiation, Elusive nature of the scientific community, The Federal and State Health Agencies resources to address comparative risk, and Regulatory agencies speaking out without the support of the scientific community

  17. Pathogenesis and Treatment of Sole Ulcers and White Line Disease.

    Science.gov (United States)

    Shearer, J K; van Amstel, Sarel R

    2017-07-01

    Sole ulcers and white line disease are 2 of the most common claw horn lesions in confined dairy cattle. Predisposing causes include unbalanced weight bearing, and metabolic, enzymatic, and hormonal changes. The white line serves as the junction between the sole and axial and abaxial wall. It is vulnerable to trauma and separation, permitting organic matter to become entrapped. Colonization contributes to retrograde movement of the infection to the solar and perioplic corium, where an abscess forms resulting in pain and lameness. Successful treatment requires an orthopedic foot block to the healthy claw and corrective trimming of the lesion. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Food Sources of Energy and Macronutrient Intakes among Infants from 6 to 12 Months of Age: The Growing Up in Singapore Towards Healthy Outcomes (GUSTO Study

    Directory of Open Access Journals (Sweden)

    Shan-Xuan Lim

    2018-03-01

    Full Text Available Adequate nutrition during complementary feeding is important for the growth, development and well-being of children. We aim to examine the energy and macronutrient intake composition and their main food sources in a mother–offspring cohort study in Singapore. The diets of infants were assessed by 24 h dietary recalls or food diaries collected from mothers when their offspring were 6 (n = 760, 9 (n = 893 and 12 (n = 907 months of age. Food sources of energy and macronutrients were determined using the population proportion methodology. Energy intakes per day (kcal; mean (standard deviation, SD of these infants were 640 (158 at 6 months, 675 (173 at 9 months, and 761 (208 at 12 months. Infant formula, breastmilk and infant cereals were the top three food sources of energy and macronutrient intakes in infants through the period 6 to 12 months. Other main energy and carbohydrate sources at 9 and 12 months of age were rice porridge, infant biscuits and fresh fruits, while fish, red meat and eggs were the other main protein and total fat sources. Breast-fed and mixed-fed infants had a more varied diet as compared to formula-fed infants. Formula-fed infants had consistently higher protein and lower total fat consumption compared to those who were breastfed. An understanding of these main food sources during complementary feeding can inform local dietary recommendations and policies.

  19. Food Sources of Energy and Macronutrient Intakes among Infants from 6 to 12 Months of Age: The Growing Up in Singapore Towards Healthy Outcomes (GUSTO) Study.

    Science.gov (United States)

    Lim, Shan-Xuan; Toh, Jia-Ying; van Lee, Linde; Han, Wee-Meng; Shek, Lynette Pei-Chi; Tan, Kok-Hian; Yap, Fabian; Godfrey, Keith M; Chong, Yap-Seng; Chong, Mary Foong-Fong

    2018-03-10

    Adequate nutrition during complementary feeding is important for the growth, development and well-being of children. We aim to examine the energy and macronutrient intake composition and their main food sources in a mother-offspring cohort study in Singapore. The diets of infants were assessed by 24 h dietary recalls or food diaries collected from mothers when their offspring were 6 (n = 760), 9 (n = 893) and 12 (n = 907) months of age. Food sources of energy and macronutrients were determined using the population proportion methodology. Energy intakes per day (kcal; mean (standard deviation, SD)) of these infants were 640 (158) at 6 months, 675 (173) at 9 months, and 761 (208) at 12 months. Infant formula, breastmilk and infant cereals were the top three food sources of energy and macronutrient intakes in infants through the period 6 to 12 months. Other main energy and carbohydrate sources at 9 and 12 months of age were rice porridge, infant biscuits and fresh fruits, while fish, red meat and eggs were the other main protein and total fat sources. Breast-fed and mixed-fed infants had a more varied diet as compared to formula-fed infants. Formula-fed infants had consistently higher protein and lower total fat consumption compared to those who were breastfed. An understanding of these main food sources during complementary feeding can inform local dietary recommendations and policies.

  20. Food Sources of Energy and Macronutrient Intakes among Infants from 6 to 12 Months of Age: The Growing Up in Singapore Towards Healthy Outcomes (GUSTO) Study

    Science.gov (United States)

    Lim, Shan-Xuan; Toh, Jia-Ying; Han, Wee-Meng; Shek, Lynette Pei-Chi; Yap, Fabian; Chong, Yap-Seng; Chong, Mary Foong-Fong

    2018-01-01

    Adequate nutrition during complementary feeding is important for the growth, development and well-being of children. We aim to examine the energy and macronutrient intake composition and their main food sources in a mother–offspring cohort study in Singapore. The diets of infants were assessed by 24 h dietary recalls or food diaries collected from mothers when their offspring were 6 (n = 760), 9 (n = 893) and 12 (n = 907) months of age. Food sources of energy and macronutrients were determined using the population proportion methodology. Energy intakes per day (kcal; mean (standard deviation, SD)) of these infants were 640 (158) at 6 months, 675 (173) at 9 months, and 761 (208) at 12 months. Infant formula, breastmilk and infant cereals were the top three food sources of energy and macronutrient intakes in infants through the period 6 to 12 months. Other main energy and carbohydrate sources at 9 and 12 months of age were rice porridge, infant biscuits and fresh fruits, while fish, red meat and eggs were the other main protein and total fat sources. Breast-fed and mixed-fed infants had a more varied diet as compared to formula-fed infants. Formula-fed infants had consistently higher protein and lower total fat consumption compared to those who were breastfed. An understanding of these main food sources during complementary feeding can inform local dietary recommendations and policies. PMID:29534442

  1. Physicochemical and Functional Properties of Vegetable and Cereal Proteins as Potential Sources of Novel Food Ingredients

    Directory of Open Access Journals (Sweden)

    Cintya Soria-Hernández

    2015-01-01

    Full Text Available Proteins from vegetable and cereal sources are an excellent alternative to substitute animal-based counterparts because of their reduced cost, abundant supply and good nutritional value. The objective of this investigation is to study a set of vegetable and cereal proteins in terms of physicochemical and functional properties. Twenty protein sources were studied: five soya bean flour samples, one pea flour and fourteen newly developed blends of soya bean and maize germ (fi ve concentrates and nine hydrolysates. The physicochemical characterization included pH (5.63 to 7.57, electrical conductivity (1.32 to 4.32 mS/cm, protein content (20.78 to 94.24 % on dry mass basis, free amino nitrogen (0.54 to 2.87 mg/g and urease activity (0.08 to 2.20. The functional properties showed interesting differences among proteins: water absorption index ranged from 0.41 to 18.52, the highest being of soya and maize concentrates. Nitrogen and water solubility ranged from 10.14 to 74.89 % and from 20.42 to 95.65 %, respectively. Fat absorption and emulsification activity indices ranged from 2.59 to 4.72 and from 3936.6 to 52 399.2 m2/g respectively, the highest being of pea flour. Foam activity (66.7 to 475.0 % of the soya and maize hydrolysates was the best. Correlation analyses showed that hydrolysis affected solubility-related parameters whereas fat-associated indices were inversely correlated with water-linked parameters. Foam properties were better of proteins treated with low heat, which also had high urease activity. Physicochemical and functional characterization of the soya and maize protein concentrates and hydrolysates allowed the identification of differences regarding other vegetable and cereal protein sources such as pea or soya bean.

  2. Potential for nutrient recovery and biogas production from blackwater, food waste and greywater in urban source control systems.

    Science.gov (United States)

    Kjerstadius, H; Haghighatafshar, S; Davidsson, Å

    2015-01-01

    In the last decades, the focus on waste and wastewater treatment systems has shifted towards increased recovery of energy and nutrients. Separation of urban food waste (FW) and domestic wastewaters using source control systems could aid this increase; however, their effect on overall sustainability is unknown. To obtain indicators for sustainability assessments, five urban systems for collection, transport, treatment and nutrient recovery from blackwater, greywater and FW were investigated using data from implementations in Sweden or northern Europe. The systems were evaluated against their potential for biogas production and nutrient recovery by the use of mass balances for organic material, nutrients and metals over the system components. The resulting indicators are presented in units suitable for use in future sustainability studies or life-cycle assessment of urban waste and wastewater systems. The indicators show that source control systems have the potential to increase biogas production by more than 70% compared with a conventional system and give a high recovery of phosphorus and nitrogen as biofertilizer. The total potential increase in gross energy equivalence for source control systems was 20-100%; the greatest increase shown is for vacuum-based systems.

  3. Observed and Modeled Tritium Concentrations in the Terrestrial Food Chain near a Continuous Atmospheric Source

    International Nuclear Information System (INIS)

    Davis, P.A.; Kim, S.B.; Chouhan, S.L.; Workman, W.J.G.

    2005-01-01

    Tritium concentrations were measured in a large number of environmental and biological samples collected during 2002 at two dairy farms and a hobby farm near Pickering Nuclear Generating Station in Ontario, Canada. The data cover most compartments of the terrestrial food chain in an agricultural setting and include detailed information on the diets of the local farm animals. Ratios of plant OBT concentration to air moisture HTO varied between 0.12 and 0.56, and were generally higher for the forage crops collected at the dairy farms than for the garden vegetables sampled at the hobby farm. Animal OBT to air HTO ratios were more uniform, ranging from 0.18 to 0.45, and were generally higher for the milk and beef samples from the dairy farms than for the chicken products from the hobby farm. The observed OBT concentrations in plants and animals were compared with predictions of IMPACT, the model used by the Canadian nuclear industry to calculate annual average doses due to routine releases. The model performed well on average for the animal endpoints but overestimated concentrations in plants by a factor of 2

  4. Evidence for validity of five secondary data sources for enumerating retail food outlets in seven American Indian Communities in North Carolina

    Science.gov (United States)

    2012-01-01

    Background Most studies on the local food environment have used secondary sources to describe the food environment, such as government food registries or commercial listings (e.g., Reference USA). Most of the studies exploring evidence for validity of secondary retail food data have used on-site verification and have not conducted analysis by data source (e.g., sensitivity of Reference USA) or by food outlet type (e.g., sensitivity of Reference USA for convenience stores). Few studies have explored the food environment in American Indian communities. To advance the science on measuring the food environment, we conducted direct, on-site observations of a wide range of food outlets in multiple American Indian communities, without a list guiding the field observations, and then compared our findings to several types of secondary data. Methods Food outlets located within seven State Designated Tribal Statistical Areas in North Carolina (NC) were gathered from online Yellow Pages, Reference USA, Dun & Bradstreet, local health departments, and the NC Department of Agriculture and Consumer Services. All TIGER/Line 2009 roads (>1,500 miles) were driven in six of the more rural tribal areas and, for the largest tribe, all roads in two of its cities were driven. Sensitivity, positive predictive value, concordance, and kappa statistics were calculated to compare secondary data sources to primary data. Results 699 food outlets were identified during primary data collection. Match rate for primary data and secondary data differed by type of food outlet observed, with the highest match rates found for grocery stores (97%), general merchandise stores (96%), and restaurants (91%). Reference USA exhibited almost perfect sensitivity (0.89). Local health department data had substantial sensitivity (0.66) and was almost perfect when focusing only on restaurants (0.91). Positive predictive value was substantial for Reference USA (0.67) and moderate for local health department data (0

  5. Food Sources of Energy and Nutrients among Children in the United States: National Health and Nutrition Examination Survey 2003–2006

    Science.gov (United States)

    Keast, Debra R.; Fulgoni III, Victor L.; Nicklas, Theresa A.; O’Neil, Carol E.

    2013-01-01

    Background: Recent detailed analyses of data on dietary sources of energy and nutrients in US children are lacking. The objective of this study was to identify food sources of energy and 28 nutrients for children in the United States. Methods: Analyses of food sources were conducted using a single 24-h recall collected from children 2 to 18 years old (n = 7332) in the 2003–2006 National Health and Nutrition Examination Survey. Sources of nutrients contained in foods were determined using nutrient composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from the total diet and from each food group were adjusted for the sample design using appropriate weights. Percentages of the total dietary intake that food sources contributed were tabulated by rank order. Results: The two top ranked food/food group sources of energy and nutrients were: energy—milk (7% of energy) and cake/cookies/quick bread/pastry/pie (7%); protein—milk (13.2%) and poultry (12.8%); total carbohydrate—soft drinks/soda (10.5%) and yeast bread/rolls (9.1%); total sugars—soft drinks/soda (19.2%) and yeast breads and rolls (12.7%); added sugars—soft drinks/soda (29.7%) and candy/sugar/sugary foods (18.6%); dietary fiber—fruit (10.4%) and yeast bread/rolls (10.3%); total fat—cheese (9.3%) and crackers/popcorn/pretzels/chips (8.4%); saturated fatty acids—cheese (16.3%) and milk (13.3%); cholesterol—eggs (24.2%) and poultry (13.2%); vitamin D—milk (60.4%) and milk drinks (8.3%); calcium—milk (33.2%) and cheese (19.4%); potassium—milk (18.8%) and fruit juice (8.0%); and sodium—salt (18.5%) and yeast bread and rolls (8.4%). Conclusions: Results suggest that many foods/food groupings consumed by children were energy dense, nutrient poor. Awareness of dietary sources of energy and nutrients can help health professionals design effective strategies to reduce energy consumption and increase the nutrient density of

  6. Food Sources of Energy and Nutrients among Children in the United States: National Health and Nutrition Examination Survey 2003–2006

    Directory of Open Access Journals (Sweden)

    Victor L. Fulgoni

    2013-01-01

    Full Text Available Background: Recent detailed analyses of data on dietary sources of energy and nutrients in US children are lacking. The objective of this study was to identify food sources of energy and 28 nutrients for children in the United States. Methods: Analyses of food sources were conducted using a single 24-h recall collected from children 2 to 18 years old (n = 7332 in the 2003–2006 National Health and Nutrition Examination Survey. Sources of nutrients contained in foods were determined using nutrient composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from the total diet and from each food group were adjusted for the sample design using appropriate weights. Percentages of the total dietary intake that food sources contributed were tabulated by rank order. Results: The two top ranked food/food group sources of energy and nutrients were: energy — milk (7% of energy and cake/cookies/quick bread/pastry/pie (7%; protein — milk (13.2% and poultry (12.8%; total carbohydrate — soft drinks/soda (10.5% and yeast bread/rolls (9.1%; total sugars — soft drinks/soda (19.2% and yeast breads and rolls (12.7%; added sugars — soft drinks/soda (29.7% and candy/sugar/sugary foods (18.6%; dietary fiber — fruit (10.4% and yeast bread/rolls (10.3%; total fat — cheese (9.3% and crackers/popcorn/pretzels/chips (8.4%; saturated fatty acids — cheese (16.3% and milk (13.3%; cholesterol — eggs (24.2% and poultry (13.2%; vitamin D — milk (60.4% and milk drinks (8.3%; calcium — milk (33.2% and cheese (19.4%; potassium — milk (18.8% and fruit juice (8.0%; and sodium — salt (18.5% and yeast bread and rolls (8.4%. Conclusions: Results suggest that many foods/food groupings consumed by children were energy dense, nutrient poor. Awareness of dietary sources of energy and nutrients can help health professionals design effective strategies to reduce energy consumption and increase the nutrient

  7. Food sources of energy and nutrients among children in the United States: National Health and Nutrition Examination Survey 2003–2006.

    Science.gov (United States)

    Keast, Debra R; Fulgoni, Victor L; Nicklas, Theresa A; O'Neil, Carol E

    2013-01-22

    Recent detailed analyses of data on dietary sources of energy and nutrients in US children are lacking. The objective of this study was to identify food sources of energy and 28 nutrients for children in the United States. Analyses of food sources were conducted using a single 24-h recall collected from children 2 to 18 years old (n = 7332) in the 2003-2006 National Health and Nutrition Examination Survey. Sources of nutrients contained in foods were determined using nutrient composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from the total diet and from each food group were adjusted for the sample design using appropriate weights. Percentages of the total dietary intake that food sources contributed were tabulated by rank order. The two top ranked food/food group sources of energy and nutrients were: energy - milk (7% of energy) and cake/cookies/quick bread/pastry/pie (7%); protein - milk (13.2%) and poultry (12.8%); total carbohydrate - soft drinks/soda (10.5%) and yeast bread/rolls (9.1%); total sugars - soft drinks/soda (19.2%) and yeast breads and rolls (12.7%); added sugars - soft drinks/soda (29.7%) and candy/sugar/sugary foods (18.6%); dietary fiber - fruit (10.4%) and yeast bread/rolls (10.3%); total fat - cheese (9.3%) and crackers/popcorn/pretzels/chips (8.4%); saturated fatty acids - cheese (16.3%) and milk (13.3%); cholesterol - eggs (24.2%) and poultry (13.2%); vitamin D - milk (60.4%) and milk drinks (8.3%); calcium - milk (33.2%) and cheese (19.4%); potassium - milk (18.8%) and fruit juice (8.0%); and sodium - salt (18.5%) and yeast bread and rolls (8.4%). Results suggest that many foods/food groupings consumed by children were energy dense, nutrient poor. Awareness of dietary sources of energy and nutrients can help health professionals design effective strategies to reduce energy consumption and increase the nutrient density of children's diets.

  8. sources

    Directory of Open Access Journals (Sweden)

    Shu-Yin Chiang

    2002-01-01

    Full Text Available In this paper, we study the simplified models of the ATM (Asynchronous Transfer Mode multiplexer network with Bernoulli random traffic sources. Based on the model, the performance measures are analyzed by the different output service schemes.

  9. Probing of brain states in real-time: Introducing the ConSole environment

    Directory of Open Access Journals (Sweden)

    Thomas eHartmann

    2011-03-01

    Full Text Available Recent years have seen huge advancements in the methods available and used in neuroscience employing EEG or MEG. However, the standard approach is to average a large number of trials for experimentally defined conditions in order to reduce intertrial-variability, i.e. treating it as a source of "noise". Yet it is now more and more accepted that trial-to-trial fluctuations bear functional significance, reflecting fluctuations of "brain states" that predispose perception and action. Such effects are often revealed in a pre-stimulus period, when comparing response variability to an invariant stimulus. However such offline analyses are disadvantageous as they are correlational by drawing conclusions in a posthoc-manner and stimulus presentation is random with respect to the feature of interest. A more direct test is to trigger stimulus presentation when the relevant feature is present. The current paper introduces ConSole (CONstance System for OnLine Eeg, a software package capable of analyzing ongoing EEG / MEG in real-time and presenting auditory and visual stimuli via internal routines. Stimulation via external devices (e.g. TMS or third-party software (e.g. Psyscope X is possible by sending TTL-triggers. With ConSole it is thus possible to target the stimulation at specific brain-states. In contrast to many available applications, ConSole is open-source. Its modular design enhances the power of the software as it can be easily adapted to new challenges and writing new experiments is an easy task. ConSole is already pre-equipped with modules performing standard signal processing steps. The software is also independent from the EEG / MEG system, as long as a driver can be written (currently 2 EEG systems are supported. Besides a general introduction, we present benchmark data regarding performance and validity of the calculations used, as well as three example applications of ConSole in different settings. ConSole can be downloaded at: http://console-kn.sf.net.

  10. pigmentation of the sole of the foot in rhodesian africans

    African Journals Online (AJOL)

    1971-01-23

    Jan 23, 1971 ... basal layer. (Photo by courtesy of Dr C. M. D. Ross.) Fig. 8. From a biopsy of a grade III area on the sole of the foot a section shows, apart from proliferated melanocytes in the basal layer, isolated pigmented cells extending through the stratum malpighii to the stratum granulosum above it, (Photo by courtesy ...

  11. Deaths among West African dwarf goats fed sole Dactyladaenia barteri

    African Journals Online (AJOL)

    Dactyladaema barteri is an important shrub utilized in fallow development and as a much-preferred ruminant browse by local farmers in Nigeria. We report the death of two 12 – 15 months old West African Dwarf (WAD) goats used in a digestibility trail with D. barteri as sole feed and in a mixed browse - grass diet in the ...

  12. Degloved foot sole successfully reconstructed with split thickness skin grafts

    NARCIS (Netherlands)

    Janssens, Loes; Holtslag, Herman R.; Schellekens, Pascal P A; Leenen, Luke P H

    2015-01-01

    Introduction The current opinion is that split thickness skin grafts are not suitable to reconstruct a degloved foot sole. The tissue is too fragile to carry full bodyweight; and therefore, stress lesions frequently occur. The treatment of choice is the reuse of the avulsed skin whenever possible,

  13. Recognition and Accountability: Sole Parent Postgraduates in University Conditions

    Science.gov (United States)

    Hook, Genine A.

    2015-01-01

    This paper aims to examine some of ways sole parents sought recognition as postgraduate students in Australian universities. Judith Butler's theory of recognition notes that recognition is always partial and any account we give of ourselves must be given to another. Participants articulated that supervisors were critical in the process of…

  14. Folic acid supplementation is not the sole factor in determining ...

    African Journals Online (AJOL)

    Folic acid supplementation is not the sole factor in determining neural tube defects: The possible role of autoantibodies. Keat Wei Loo, Siew Hua Gan. Abstract. Neural tube defects (NTDs) are severe but common congenital malformations. Neonates who suffer from NTDs may experience long-term complications throughout ...

  15. ELECTROCHEMICAL TECHNOLOGIES FOR OBTAINING MOULDS FOR SOLES OF SHOES

    Directory of Open Access Journals (Sweden)

    Cornelia LUCA

    2013-05-01

    Full Text Available The paper presents contributions in the designing of some electrochemical technologiesfor the manufacturing of the moulds used in the footwear soles obtaining. There are presented a fewmethods for the moulds obtaining, using electro-deposit processes. There are presented thetechnological phases of the obtaining process of the electrolytes and electrodes preparing and thetechnological stages of the moulds manufacturing.

  16. Yield Performance of Some Cowpea Varieties under Sole and ...

    African Journals Online (AJOL)

    Nekky Umera

    The mean number of pod/plant, pod weight and seed yield of the cowpea varieties ... pattern of peasant farmers in Nigeria. Some of the advantages ... in maize-pigeon pea intercropping system as compared to sole crops. While intercropping ...

  17. Evaluation of Deutzia x carnea (Lem. Rehd. as a food source to urban bees

    Directory of Open Access Journals (Sweden)

    Marzena Masierowska

    2012-12-01

    Full Text Available This 3-year study examined the flowering phenology, to- tal floral display, nectar and pollen production as well as bee visitation to the ornamental shrub Deutzia x carnea (Lem. Rehd. D. x carnea bloomed from early June until the middle of July. The total flower display reached 47927 flowers per plant. The number of developed flowers strongly depended on weather conditions before and during the flowering period and fluctuated significantly during the years of study. The flower of D. x carnea lived 5 days and the persistence of an inflorescence was 11 days. Nectar productivity per 10 flowers differed significantly between the years of study and ranged between 15.7 and 40.14 mg. Mean sugar content in nectar was 39.7%. The total sugar mass in nectar per 10 flowers averaged 9.91 mg (range: 3.81 – 18.91 mg. Pollen mass per 10 flowers was 16.89 mg. The estimated sugar and pollen productivity per plant was 36.8 g and 40 g, respectively. Among bees (Apoidea, honey bees were principal visitors on Deutzia flowers. The peak of daily activity of honey bees and bumblebees occurred between 11.00 and 15.00 hrs, whereas the presence of other wild bees was noted in the morning and in the late afternoon. All bees gathered mainly nectar, but pollen collectors were also noted. The mean daily visiting rate was 0.0809 visits per flower × min-1. The use of this shrub in gardens and parks should be encouraged in order to enrich food pasture for urban Apoidea. However, its cultivation is limited to areas of mild climate and adequate water supply.

  18. Identifying sources of children's consumption of junk food in Boston after-school programs, April-May 2011.

    Science.gov (United States)

    Kenney, Erica L; Austin, S Bryn; Cradock, Angie L; Giles, Catherine M; Lee, Rebekka M; Davison, Kirsten K; Gortmaker, Steven L

    2014-11-20

    Little is known about how the nutrition environment in after-school settings may affect children's dietary intake. We measured the nutritional quality of after-school snacks provided by programs participating in the National School Lunch Program or the Child and Adult Care Food Program and compared them with snacks brought from home or purchased elsewhere (nonprogram snacks). We quantified the effect of nonprogram snacks on the dietary intake of children who also received program-provided snacks during after-school time. Our study objective was to determine how different sources of snacks affect children's snack consumption in after-school settings. We recorded snacks served to and brought in by 298 children in 18 after-school programs in Boston, Massachusetts, on 5 program days in April and May 2011. We measured children's snack consumption on 2 program days using a validated observation protocol. We then calculated within-child change-in-change models to estimate the effect of nonprogram snacks on children's dietary intake after school. Nonprogram snacks contained more sugary beverages and candy than program-provided snacks. Having a nonprogram snack was associated with significantly higher consumption of total calories (+114.7 kcal, P < .001), sugar-sweetened beverages (+0.5 oz, P = .01), desserts (+0.3 servings, P < .001), and foods with added sugars (+0.5 servings; P < .001) during the snack period. On days when children brought their own after-school snack, they consumed more salty and sugary foods and nearly twice as many calories than on days when they consumed only program-provided snacks. Policy strategies limiting nonprogram snacks or setting nutritional standards for them in after-school settings should be explored further as a way to promote child health.

  19. Fructose and related food carbohydrates. Sources, intake, absorption, and clinical implications

    DEFF Research Database (Denmark)

    Rumessen, J J

    1992-01-01

    It is possible to point out subjects consuming considerable quantities of fructose and sorbitol, and the intake seems to be increasing both from added and natural sources. Studies of the absorption of fructose in animals are inconsistent, and the mechanisms of fructose uptake seem to vary...... in accordance with the species. In most species fructose absorption takes place by a specific carrier (facilitated transport), but it may be active in the rat. In vitro studies of human intestine are very scarce; there is no evidence of active intestinal fructose transport in the human intestine. By means...... interest. Fructans are not absorbed in the small intestine but are strongly fermented in the large bowel. Fructans may be of potential benefit for large-bowel function and blood glucose regulation....

  20. Food ordering for children in restaurants: multiple sources of influence on decision making

    Science.gov (United States)

    Castro, Iana A; Williams, Christine B; Madanat, Hala; Pickrel, Julie L; Jun, Hee-Jin; Zive, Michelle; Gahagan, Sheila; Ayala, Guadalupe X

    2017-01-01

    Objective Restaurants are playing an increasingly important role in children’s dietary intake. Interventions to promote healthy ordering in restaurants have primarily targeted adults. Much remains unknown about how to influence ordering for and by children. Using an ecological lens, the present study sought to identify sources of influence on ordering behaviour for and by children in restaurants. Design A mixed-methods study was conducted using unobtrusive observations of dining parties with children and post-order interviews. Observational data included: child’s gender, person ordering for the child and server interactions with the dining party. Interview data included: child’s age, restaurant visit frequency, timing of child’s decision making, and factors influencing decision making. Setting Ten independent, table-service restaurants in San Diego, CA, USA participated. Subjects Complete observational and interview data were obtained from 102 dining parties with 150 children (aged 3–14 years). Results Taste preferences, family influences and menus impacted ordering. However, most children knew what they intended to order before arriving at the restaurant, especially if they dined there at least monthly. Furthermore, about one-third of children shared their meals with others and all shared meals were ordered from adult (v. children’s) menus. Parents placed most orders, although parental involvement in ordering was less frequent with older children. Servers interacted frequently with children but generally did not recommend menu items or prompt use of the children’s menu. Conclusions Interventions to promote healthy ordering should consider the multiple sources of influence that are operating when ordering for and by children in restaurants. PMID:27334904

  1. Ethnic disparities among food sources of energy and nutrients of public health concern and nutrients to limit in adults in the United States: NHANES 2003-2006.

    Science.gov (United States)

    O'Neil, Carol E; Nicklas, Theresa A; Keast, Debra R; Fulgoni, Victor L

    2014-01-01

    Identification of current food sources of energy and nutrients among US non-Hispanic whites (NHW), non-Hispanic blacks (NHB), and Mexican American (MA) adults is needed to help with public health efforts in implementing culturally sensitive and feasible dietary recommendations. The objective of this study was to determine the food sources of energy and nutrients to limit [saturated fatty acids (SFA), added sugars, and sodium] and nutrients of public health concern (dietary fiber, vitamin D, calcium, and potassium) by NHW, NHB, and MA adults. This was a cross-sectional analysis of a nationally representative sample of NWH (n=4,811), NHB (2,062), and MA (n=1,950) adults 19+ years. The 2003-2006 NHANES 24-h recall (Day 1) dietary intake data were analyzed. An updated USDA Dietary Source Nutrient Database was developed using current food composition databases. Food grouping included ingredients from disaggregated mixtures. Mean energy and nutrient intakes from food sources were sample-weighted. Percentages of total dietary intake contributed from food sources were ranked. Multiple differences in intake among ethnic groups were seen for energy and all nutrients examined. For example, energy intake was higher in MA as compared to NHB; SFA, added sugars, and sodium intakes were higher in NHW than NHB; dietary fiber was highest in MA and lowest in NHB; vitamin D was highest in NHW; calcium was lowest in NHB; and potassium was higher in NHW as compared to NHB. Food sources of these nutrients also varied. Identification of intake of nutrients to limit and of public health concern can help health professionals implement appropriate dietary recommendations and plan interventions that are ethnically appropriate.

  2. EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control), 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014

    DEFF Research Database (Denmark)

    Helwigh, Birgitte; Porsbo, Lone Jannok; Boysen, Louise

    This report of the European Food Safety Authority and the European Centre for Disease Prevention and Control presents the results of the zoonoses monitoring activities carried out in 2014 in 32 European countries (28 Member States (MS) and four non-MS). Campylobacteriosis was the most commonly re......, molluscs and products thereof’. The report further summarises trends and sources along the food chain of tuberculosis due to Mycobacterium bovis, Brucella, Trichinella, Echinococcus, Toxoplasma, rabies, Coxiella burnetii (Q fever), West Nile virus and tularaemia....

  3. Evaluation of thermal properties of food materials at high pressures using a dual-needle line-heat-source method.

    Science.gov (United States)

    Zhu, S; Ramaswamy, H S; Marcotte, M; Chen, C; Shao, Y; Le Bail, A

    2007-03-01

    Thermal properties of food systems at high pressure (HP) are important in the design and operation of HP processing equipment. Available techniques for thermal property evaluation under HP conditions are still very limited. In this study, a dual-needle line-heat-source (DNL) device was installed in an HP vessel to evaluate thermal conductivity (k), diffusivity (alpha), and volumetric heat capacity (C(pV)) of foods at high pressure. The DNL probe was calibrated using glycerin (0.1 MPa) and 2% (w/w) agar gel (0.1 to 350 MPa) at 5 and 25 degrees C. Calibration results showed a good correlation with the reference data of pure water: R(2)= 0.966 for thermal conductivity and R(2)= 0.837 for diffusivity, and a small standard deviation of relative error (3.18%) for the volumetric heat capacity. Fresh potato and cheddar cheese were used as test samples at 5 degrees C at selected pressure levels (0.1 to 350 MPa). The potato samples gave thermal properties very close to those of pure water, but much higher than those of the cheese. The k and alpha values of both potato and cheese increased with pressure and a 2nd-order polynomial well fitted their pressure dependency. The volumetric heat capacity data did not show a clear pressure-dependency trend. The experimental system worked well for the evaluation of thermal properties at pressures up to 350 MPa.

  4. Red/Green Currant and Sea Buckthorn Berry Press Residues as Potential Sources of Antioxidants for Food Use.

    Science.gov (United States)

    Puganen, Anna; Kallio, Heikki P; Schaich, Karen M; Suomela, Jukka-Pekka; Yang, Baoru

    2018-04-04

    The potential for using extracts of press residues from black, green, red, and white currants and from sea buckthorn berries as sources of antioxidants for foods use was investigated. Press residues were extracted with ethanol in four consecutive extractions, and total Folin-Ciocalteu (F-C) reactive material and authentic phenolic compounds were determined. Radical quenching capability and mechanisms were determined from total peroxyl radical-trapping antioxidant capacity (TRAP) and oxygen radical absorbance capacity (ORAC) assays and from diphenylpicrylhydrazyl (DPPH) kinetics, respectively; specific activities were normalized to F-C reactive concentrations. Levels of total F-C reactive materials in press residue extracts were higher than in many fruits and showed significant radical quenching activity. Black currant had the highest authentic phenol content and ORAC, TRAP, and DPPH reactivity. Sea buckthorn grown in northern Finland showed extremely high total specific DPPH reactivity. These results suggest that berry press residues offer attractive value-added products that can provide antioxidants for use in stabilizing and fortifying foods.

  5. Occurrence of β-N-methylamino-l-alanine (BMAA and Isomers in Aquatic Environments and Aquatic Food Sources for Humans

    Directory of Open Access Journals (Sweden)

    Emilie Lance

    2018-02-01

    Full Text Available The neurotoxin β-N-methylamino-l-alanine (BMAA, a non-protein amino acid produced by terrestrial and aquatic cyanobacteria and by micro-algae, has been suggested to play a role as an environmental factor in the neurodegenerative disease Amyotrophic Lateral Sclerosis-Parkinsonism-Dementia complex (ALS-PDC. The ubiquitous presence of BMAA in aquatic environments and organisms along the food chain potentially makes it public health concerns. However, the BMAA-associated human health risk remains difficult to rigorously assess due to analytical challenges associated with the detection and quantification of BMAA and its natural isomers, 2,4-diamino butyric acid (DAB, β-amino-N-methyl-alanine (BAMA and N-(2-aminoethyl glycine (AEG. This systematic review, reporting the current knowledge on the presence of BMAA and isomers in aquatic environments and human food sources, was based on a selection and a score numbering of the scientific literature according to various qualitative and quantitative criteria concerning the chemical analytical methods used. Results from the best-graded studies show that marine bivalves are to date the matrix containing the higher amount of BMAA, far more than most fish muscles, but with an exception for shark cartilage. This review discusses the available data in terms of their use for human health risk assessment and identifies knowledge gaps requiring further investigations.

  6. Occurrence of β-N-methylamino-l-alanine (BMAA) and Isomers in Aquatic Environments and Aquatic Food Sources for Humans.

    Science.gov (United States)

    Lance, Emilie; Arnich, Nathalie; Maignien, Thomas; Biré, Ronel

    2018-02-14

    The neurotoxin β- N -methylamino-l-alanine (BMAA), a non-protein amino acid produced by terrestrial and aquatic cyanobacteria and by micro-algae, has been suggested to play a role as an environmental factor in the neurodegenerative disease Amyotrophic Lateral Sclerosis-Parkinsonism-Dementia complex (ALS-PDC). The ubiquitous presence of BMAA in aquatic environments and organisms along the food chain potentially makes it public health concerns. However, the BMAA-associated human health risk remains difficult to rigorously assess due to analytical challenges associated with the detection and quantification of BMAA and its natural isomers, 2,4-diamino butyric acid (DAB), β-amino- N -methyl-alanine (BAMA) and N -(2-aminoethyl) glycine (AEG). This systematic review, reporting the current knowledge on the presence of BMAA and isomers in aquatic environments and human food sources, was based on a selection and a score numbering of the scientific literature according to various qualitative and quantitative criteria concerning the chemical analytical methods used. Results from the best-graded studies show that marine bivalves are to date the matrix containing the higher amount of BMAA, far more than most fish muscles, but with an exception for shark cartilage. This review discusses the available data in terms of their use for human health risk assessment and identifies knowledge gaps requiring further investigations.

  7. Dietary Intake of Individual (Free and Intrinsic) Sugars and Food Sources in the Spanish Population: Findings from the ANIBES Study

    Science.gov (United States)

    Ruiz, Emma; Rodriguez, Paula; Valero, Teresa; Ávila, José M.; Aranceta-Bartrina, Javier; Gil, Ángel; González-Gross, Marcela; Ortega, Rosa M.; Serra-Majem, Lluis; Varela-Moreiras, Gregorio

    2017-01-01

    The consumption of total and individual sugars is controversial and little is known about consumption and dietary sources in Spain. The purpose was to examine free and intrinsic sugar intake and food and beverage sources. The ANIBES Study (Anthropometry, Intake and Energy Balance in Spain), a cross-sectional study of a representative sample of the Spanish population (9–75 years old; n = 2009) carried out in 2013, was used. Food and beverage records were obtained by a three-day dietary record by using a tablet device. The median total sugar intake was 71.5 g/day (17% Total Energy, TE), the intrinsic sugar intake was 38.3 g/day (9.6% TE), and the free sugar was 28.8 g/day (7.3% TE). Total sugar intake (free and intrinsic) was higher in men than in women for all age groups, although in terms of the contribution to total energy intake, the opposite was observed. Differences were observed for free sugar consumption dependent on age and marked differences (up to two-fold) were observed when considering the percent TE, which was much higher in children and adolescents. For the intrinsic sugar, however, a higher contribution to TE was observed in the elderly. The major sources of intrinsic sugars were fruits (31.8%), milks (19.6%), juices and nectars (11.1%), vegetables (9.89%), yogurt and fermented milk (7.18%), low-alcohol-content beverages (4,94%), bread (2.91%), and sugar soft drinks (2.24%), greater than 90% from diet contribution. As for free sugars, sources were sugar soft drinks (25.5%), sugar (17.8%), bakery and pastry items (15.2%), chocolates (11.4%), yogurt and fermented milk (6.44%), other dairy products (5.99%), jams (3.58%), juices and nectars (2.91%), and breakfast cereals and cereal bars (2.78%), summing up to 90% of the contribution. The present study demonstrates that only a moderate percentage of the Spanish population adhered to the present recommendations for total sugar intake, and urgent efforts are needed to improve diet quality in the youngest

  8. Dietary Intake of Individual (Free and Intrinsic Sugars and Food Sources in the Spanish Population: Findings from the ANIBES Study

    Directory of Open Access Journals (Sweden)

    Emma Ruiz

    2017-03-01

    Full Text Available The consumption of total and individual sugars is controversial and little is known about consumption and dietary sources in Spain. The purpose was to examine free and intrinsic sugar intake and food and beverage sources. The ANIBES Study (Anthropometry, Intake and Energy Balance in Spain, a cross-sectional study of a representative sample of the Spanish population (9–75 years old; n = 2009 carried out in 2013, was used. Food and beverage records were obtained by a three-day dietary record by using a tablet device. The median total sugar intake was 71.5 g/day (17% Total Energy, TE, the intrinsic sugar intake was 38.3 g/day (9.6% TE, and the free sugar was 28.8 g/day (7.3% TE. Total sugar intake (free and intrinsic was higher in men than in women for all age groups, although in terms of the contribution to total energy intake, the opposite was observed. Differences were observed for free sugar consumption dependent on age and marked differences (up to two-fold were observed when considering the percent TE, which was much higher in children and adolescents. For the intrinsic sugar, however, a higher contribution to TE was observed in the elderly. The major sources of intrinsic sugars were fruits (31.8%, milks (19.6%, juices and nectars (11.1%, vegetables (9.89%, yogurt and fermented milk (7.18%, low-alcohol-content beverages (4,94%, bread (2.91%, and sugar soft drinks (2.24%, greater than 90% from diet contribution. As for free sugars, sources were sugar soft drinks (25.5%, sugar (17.8%, bakery and pastry items (15.2%, chocolates (11.4%, yogurt and fermented milk (6.44%, other dairy products (5.99%, jams (3.58%, juices and nectars (2.91%, and breakfast cereals and cereal bars (2.78%, summing up to 90% of the contribution. The present study demonstrates that only a moderate percentage of the Spanish population adhered to the present recommendations for total sugar intake, and urgent efforts are needed to improve diet quality in the youngest

  9. Prescribed burning in a Eucalyptus woodland suppresses fruiting of hypogeous fungi, an important food source for mammals.

    Science.gov (United States)

    Trappe, James M; Nicholls, A O; Claridge, Andrew W; Cork, Steven J

    2006-11-01

    Fruit bodies of hypogeous fungi are an important food source for many small mammals and are consumed by larger mammals as well. A controversial hypothesis that prescribed burning increases fruiting of certain hypogeous fungi based on observations in Tasmania was tested in the Australian Capital Territory to determine if it applied in a quite different habitat. Ten pairs of plots, burnt and nonburnt, were established at each of two sites prescribe-burnt in May 1999. When sampled in early July, after autumn rains had initiated the fungal fruiting season, species richness and numbers of fruit bodies on the burnt plots were extremely low: most plots produced none at all. Both species richness and fruit body numbers were simultaneously high on nonburnt plots. One of the sites was resampled a year after the initial sampling. At that time species richness and fruit body abundance were still significantly less on burnt plots than on nonburnt, but a strong trend towards fungal recovery on the burnt plots was evident. This was particularly so when numbers of fruit bodies of one species, the hypogeous agaric Dermocybe globuliformis, were removed from the analysis. This species strongly dominated the nonburnt plots but was absent from burnt plots in both years. The trend towards recovery of fruit body abundance in the burnt plots one year after the burn was much more pronounced with exclusion of the Dermocybe data. The Tasmanian-based hypothesis was based mostly on the fruiting of two fire-adapted species in the Mesophelliaceae. Neither species occurred on our plots. Accordingly, the results and conclusions of the Tasmanian study cannot be extrapolated to other habitats without extensive additional study. Implications for management of habitat for fungi and the animals that rely on the fungi as a food source are discussed.

  10. Continuous fermentation of food waste leachate for the production of volatile fatty acids and potential as a denitrification carbon source.

    Science.gov (United States)

    Kim, Hakchan; Kim, Jaai; Shin, Seung Gu; Hwang, Seokhwan; Lee, Changsoo

    2016-05-01

    This study investigated the simultaneous effects of hydraulic retention time (HRT) and pH on the continuous production of VFAs from food waste leachate using response surface analysis. The response surface approximations (R(2)=0.895, p<0.05) revealed that pH has a dominant effect on the specific VFA production (PTVFA) within the explored space (1-4-day HRT, pH 4.5-6.5). The estimated maximum PTVFA was 0.26g total VFAs/g CODf at 2.14-day HRT and pH 6.44, and the approximation was experimentally validated by running triplicate reactors under the estimated optimum conditions. The mixture of the filtrates recovered from these reactors was tested as a denitrification carbon source and demonstrated superior performance in terms of reaction rate and lag length relative to other chemicals, including acetate and methanol. The overall results provide helpful information for better design and control of continuous fermentation for producing waste-derived VFAs, an alternative carbon source for denitrification. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Tracking Dietary Sources of Short- and Medium-Chain Chlorinated Paraffins in Marine Mammals through a Subtropical Marine Food Web.

    Science.gov (United States)

    Zeng, Lixi; Lam, James C W; Chen, Hui; Du, Bibai; Leung, Kenneth M Y; Lam, Paul K S

    2017-09-05

    Our previous study revealed an elevated accumulation of short-chain chlorinated paraffins (SCCPs) and medium-chain chlorinated paraffins (MCCPs) in marine mammals from Hong Kong waters in the South China Sea. To examine the bioaccumulation potential and biomagnification in these apex predators, we sampled the dietary items of marine mammals and tracked the sources of SCCPs and MCCPs through a marine food web in this region. Sixteen fish species, seven crustacean species, and four mollusk species were collected, and the main prey species were identified for two species of marine mammals. Concentrations of ∑SCCPs and ∑MCCPs in these collected species suggested a moderate pollution level in Hong Kong waters compared to the global range. Lipid content was found to mediate congener-specific bioaccumulation in these marine species. Significantly positive correlations were observed between trophic levels and concentrations of ∑SCCPs or ∑MCCPs (p mammals was observed. This is the first report of dietary source tracking of SCCPs and MCCPs in marine mammals. The elevated biomagnification between prey and marine mammals raises environmental concerns about these contaminants.

  12. Chicks change their pecking behaviour towards stationary and mobile food sources over the first 12 weeks of life: improvement and discontinuities

    OpenAIRE

    Murphy, Kenneth J.; Hayden, Thomas J.; Kent, John P.

    2014-01-01

    Chicks (Gallus gallus domesticus) learn to peck soon after hatching and then peck in rapid bursts or bouts with intervals of non-pecking activity. The food sources may be static such as seeds and chick crumb, or mobile such as a mealworm. Here, changes with age in pecking toward chick crumb and a mealworm were measured. Chicks were reared in pairs and their pecking of crumb food was video recorded in their pair housed environment, from food presentation, every third day from day 8 (wk 2) to d...

  13. A new approach for the determination of sulphur in food samples by high-resolution continuum source flame atomic absorption spectrometer.

    Science.gov (United States)

    Ozbek, N; Baysal, A

    2015-02-01

    The new approach for the determination of sulphur in foods was developed, and the sulphur concentrations of various fresh and dried food samples determined using a high-resolution continuum source flame atomic absorption spectrometer with an air/acetylene flame. The proposed method was optimised and the validated using standard reference materials, and certified values were found to be within the 95% confidence interval. The sulphur content of foods ranged from less than the LOD to 1.5mgg(-1). The method is accurate, fast, simple and sensitive. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. An application of the theory of planned behaviour to study the influencing factors of participation in source separation of food waste.

    Science.gov (United States)

    Karim Ghani, Wan Azlina Wan Ab; Rusli, Iffah Farizan; Biak, Dayang Radiah Awang; Idris, Azni

    2013-05-01

    Tremendous increases in biodegradable (food waste) generation significantly impact the local authorities, who are responsible to manage, treat and dispose of this waste. The process of separation of food waste at its generation source is identified as effective means in reducing the amount food waste sent to landfill and can be reused as feedstock to downstream treatment processes namely composting or anaerobic digestion. However, these efforts will only succeed with positive attitudes and highly participations rate by the public towards the scheme. Thus, the social survey (using questionnaires) to analyse public's view and influencing factors towards participation in source separation of food waste in households based on the theory of planned behaviour technique (TPB) was performed in June and July 2011 among selected staff in Universiti Putra Malaysia, Serdang, Selangor. The survey demonstrates that the public has positive intention in participating provided the opportunities, facilities and knowledge on waste separation at source are adequately prepared by the respective local authorities. Furthermore, good moral values and situational factors such as storage convenience and collection times are also encouraged public's involvement and consequently, the participations rate. The findings from this study may provide useful indicator to the waste management authorities in Malaysia in identifying mechanisms for future development and implementation of food waste source separation activities in household programmes and communication campaign which advocate the use of these programmes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Dual structures for the sole-proprietorship firm

    OpenAIRE

    Chambers, Robert G.; Quiggin, John

    2003-01-01

    This paper presents a dual representation of firm-level and market-level equilibrium behavior for a sole proprietorship economy with competitive and frictionless financial markets and stochastic production opportunities in a two-period setting. The dual equilibrium model is used to state conditions for the firms' production choices to be independent of their risk preferences in equilibrium. These conditions entail Pareto optimality, but do not require either that the firm's consumption choice...

  16. A Mole in the Sole: Case Report on Eccrine Poroma

    Directory of Open Access Journals (Sweden)

    Dr. Arnab Ghosh

    2007-01-01

    Full Text Available Eccrine poroma is a benign tumor which arises from the intraepidermal portion of the eccrine sweat glands. 81 year old diabetic grandma worried about her persistently uncontrolled blood sugar owing to a painless mole in the sole of right foot for 2 years. Excisional biopsy revealed a sweat duct benign eccrine poroma. A relationship with diabetes mellitus could not be clearly established in this case.

  17. Effect of ski mountaineering track on foot sole loading pattern.

    Science.gov (United States)

    Haselbacher, Matthias; Mader, Katharina; Werner, Maximiliane; Nogler, Michael

    2014-09-01

    Ski mountaineering is becoming a popular sport. The ascending techniques (tracks) can be divided into 3 different groups: flat field, direct ascent, and traversing. This study examines the relationship between different mechanical loads on the foot and the 4 different mountaineering ascending techniques. All subjects used the same pair of ski boots and the same skis while performing the 4 different ascending techniques. An in-shoe dynamic pressure measuring system was used to measure the mechanical load on the foot soles of each ski mountaineer. The foot sole was divided into 6 anatomic sections to measure the different loads in each section. Thirteen men with an average age of 29 years were enrolled in the study. The results showed small, not significant differences in the mechanical foot load in the flat field or in the direct ascent. The average mechanical foot load was highest on the valley side foot while traversing (179 kPa to 117 kPa). The higher load forces were in the medial ball of the foot and the longitudinal aspect of the foot side closer to the hill. The higher impact placed on the valley side foot and the concentration of force placed on the medial ball of the valley side foot suggested the influence of the track on the load pattern of the foot sole. This higher impact may result in upward forces that affect the force distribution in the ankle and knee joints. Copyright © 2014. Published by Elsevier Inc.

  18. Improving Quality of Shoe Soles Product using Six Sigma

    Science.gov (United States)

    Jesslyn Wijaya, Athalia; Trusaji, Wildan; Akbar, Muhammad; Ma’ruf, Anas; Irianto, Dradjad

    2018-03-01

    A manufacture in Bandung produce kind of rubber-based product i.e. trim, rice rollers, shoe soles, etc. After penetrating the shoe soles market, the manufacture has met customer with tight quality control. Based on the past data, defect level of this product was 18.08% that caused the manufacture’s loss of time and money. Quality improvement effort was done using six sigma method that included phases of define, measure, analyse, improve, and control (DMAIC). In the design phase, the object’s problem and definition were defined. Delphi method was also used in this phase to identify critical factors. In the measure phase, the existing process stability and sigma quality level were measured. Fishbone diagram and failure mode and effect analysis (FMEA) were used in the next phase to analyse the root cause and determine the priority issues. Improve phase was done by designing alternative improvement strategy using 5W1H method. Some improvement efforts were identified, i.e. (i) modifying design of the hanging rack, (ii) create pantone colour book and check sheet, (iii) provide pedestrian line at compound department, (iv) buying stop watch, and (v) modifying shoe soles dies. Some control strategies for continuous improvement were proposed such as SOP or reward and punishment system.

  19. Identifying Sources of Children’s Consumption of Junk Food in Boston After-School Programs, April–May 2011

    Science.gov (United States)

    Austin, S. Bryn; Cradock, Angie L.; Giles, Catherine M.; Lee, Rebekka M.; Davison, Kirsten K.; Gortmaker, Steven L.

    2014-01-01

    Introduction Little is known about how the nutrition environment in after-school settings may affect children’s dietary intake. We measured the nutritional quality of after-school snacks provided by programs participating in the National School Lunch Program or the Child and Adult Care Food Program and compared them with snacks brought from home or purchased elsewhere (nonprogram snacks). We quantified the effect of nonprogram snacks on the dietary intake of children who also received program-provided snacks during after-school time. Our study objective was to determine how different sources of snacks affect children’s snack consumption in after-school settings. Methods We recorded snacks served to and brought in by 298 children in 18 after-school programs in Boston, Massachusetts, on 5 program days in April and May 2011. We measured children’s snack consumption on 2 program days using a validated observation protocol. We then calculated within-child change-in-change models to estimate the effect of nonprogram snacks on children’s dietary intake after school. Results Nonprogram snacks contained more sugary beverages and candy than program-provided snacks. Having a nonprogram snack was associated with significantly higher consumption of total calories (+114.7 kcal, P snack period. Conclusion On days when children brought their own after-school snack, they consumed more salty and sugary foods and nearly twice as many calories than on days when they consumed only program-provided snacks. Policy strategies limiting nonprogram snacks or setting nutritional standards for them in after-school settings should be explored further as a way to promote child health. PMID:25412028

  20. Carbon and nitrogen stable isotope ratios analysis of food sources for Chironomus acerbiphilus larvae (Diptera Chironomidae) in strongly acidic lake Katanuma

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Hideyuki [Tohoku Univ., Sendai (Japan). Graduate School of Science; Kikuchi, Eisuke; Shikano, Shuichi

    2001-12-01

    The food sources for Chironomus acerbiphilus larvae (Diptera Chironomidae) were analyzed using carbon and nitrogen stable isotope ratios in Lake Katanuma. Lake Katanuma is a volcanic and strongly acidic lake (average pH 2.2). In Lake Katanuma, potential sources of diets for the chironomid larvae are limited including a benthic diatom (Pinnularia braunii), a phytoplankton (Chlamydomonas acidophila), sulfate oxidizing bacteria, and vascular plants supplied from vegetation surrounding the lake. Based on the average carbon and nitrogen isotope ratios among these potential sources and sediment, benthic diatoms were considered to be most probable food source of the chironomid larvae. {delta}{sup 13}C values of the chironomid were significantly different among seasons and habitat depths, suggesting that diet of C. acerbiphilus changed seasonally and with habitat depth. (author)

  1. Carbon and nitrogen stable isotope ratios analysis of food sources for Chironomus acerbiphilus larvae (Diptera Chironomidae) in strongly acidic lake Katanuma

    International Nuclear Information System (INIS)

    Doi, Hideyuki; Kikuchi, Eisuke; Shikano, Shuichi

    2001-01-01

    The food sources for Chironomus acerbiphilus larvae (Diptera Chironomidae) were analyzed using carbon and nitrogen stable isotope ratios in Lake Katanuma. Lake Katanuma is a volcanic and strongly acidic lake (average pH 2.2). In Lake Katanuma, potential sources of diets for the chironomid larvae are limited including a benthic diatom (Pinnularia braunii), a phytoplankton (Chlamydomonas acidophila), sulfate oxidizing bacteria, and vascular plants supplied from vegetation surrounding the lake. Based on the average carbon and nitrogen isotope ratios among these potential sources and sediment, benthic diatoms were considered to be most probable food source of the chironomid larvae. δ 13 C values of the chironomid were significantly different among seasons and habitat depths, suggesting that diet of C. acerbiphilus changed seasonally and with habitat depth. (author)

  2. Characteristics of Shiga toxin-producing Escherichia coli from meat and milk products of different origins and association with food producing animals as main contamination sources.

    Science.gov (United States)

    Martin, Annett; Beutin, Lothar

    2011-03-15

    Shiga toxin-producing strains of Escherichia coli (STEC) cause diarrhoea and haemorrhagic colitis in humans. Most human infections are attributed to consumption of STEC contaminated foodstuff. Food producing animals constitute important reservoirs of STEC and serve as source of food contamination. In this study, we have analyzed 593 foodborne STEC strains for their serotypes and for nine virulence genes (stx1, stx1c, stx1d, stx2, stx2b, stx2e, stx2g, E-hly and eae). The 593 STEC strains grouped into 215 serotypes, and 123 serotypes (57.2%) were represented each by only one STEC isolate. Fifteen serotypes (7.0%) were attributed to 198 (33.3%) of the 593 STEC strains. The foodborne STEC were grouped into different categories in relation to the species of the food producing animal (cattle, pigs, sheep, goats, red deer, wild-boar and hare). Univariate and multivariate statistical analyses revealed significant similarities between the animal origin of the food and the virulence markers of foodborne STEC. Significant associations (pfood producing animals. Virulence profiles and serotypes of STEC from food showed remarkable similarities to those of faecal STEC that were from the same animal species. The findings from our study clearly indicate that the food producing animals represent the most important source for the entry of STEC in the food chain. Sound hygiene measures implemented at critical stages of food production (milking, slaughtering, and evisceration) should be most effective in reducing the frequency of STEC contamination of food derived from domestic and wildlife animals. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Food Sources of Total Energy and Nutrients among U.S. Infants and Toddlers: National Health and Nutrition Examination Survey 2005–2012

    Directory of Open Access Journals (Sweden)

    Carley A. Grimes

    2015-08-01

    Full Text Available Understanding the dietary intakes of infants and toddlers is important because early life nutrition influences future health outcomes. The aim of this study was to determine the dietary sources of total energy and 16 nutrients in a nationally representative sample of U.S. infants and toddlers aged 0–24 months. Data from the 2005–2012 National Health and Nutrition Examination Survey were analyzed. Dietary intake was assessed in 2740 subjects using one 24-h dietary recall. The population proportion was used to determine the contribution of foods and beverages to nutrient intakes. Overall infant formulas and baby foods were the leading sources of total energy and nutrients in infants aged 0–11.9 months. In toddlers, the diversity of food groups contributing to nutrient intakes was much greater. Important sources of total energy included milk, 100% juice and grain based mixed dishes. A number of foods of low nutritional quality also contributed to energy intakes including sweet bakery products, sugar-sweetened beverages and savory snacks. Overall non-flavored milks and ready-to-eat cereals were the most important contributors to micronutrient intakes. In conclusion this information can be used to guide parents regarding appropriate food selection as well as inform targeted dietary strategies within public health initiatives to improve the diets of infants and toddlers.

  4. Food Sources of Total Energy and Nutrients among U.S. Infants and Toddlers: National Health and Nutrition Examination Survey 2005-2012.

    Science.gov (United States)

    Grimes, Carley A; Szymlek-Gay, Ewa A; Campbell, Karen J; Nicklas, Theresa A

    2015-08-14

    Understanding the dietary intakes of infants and toddlers is important because early life nutrition influences future health outcomes. The aim of this study was to determine the dietary sources of total energy and 16 nutrients in a nationally representative sample of U.S. infants and toddlers aged 0-24 months. Data from the 2005-2012 National Health and Nutrition Examination Survey were analyzed. Dietary intake was assessed in 2740 subjects using one 24-h dietary recall. The population proportion was used to determine the contribution of foods and beverages to nutrient intakes. Overall infant formulas and baby foods were the leading sources of total energy and nutrients in infants aged 0-11.9 months. In toddlers, the diversity of food groups contributing to nutrient intakes was much greater. Important sources of total energy included milk, 100% juice and grain based mixed dishes. A number of foods of low nutritional quality also contributed to energy intakes including sweet bakery products, sugar-sweetened beverages and savory snacks. Overall non-flavored milks and ready-to-eat cereals were the most important contributors to micronutrient intakes. In conclusion this information can be used to guide parents regarding appropriate food selection as well as inform targeted dietary strategies within public health initiatives to improve the diets of infants and toddlers.

  5. Sole ulcers in dairy-cattle - associations with season, cow characteristics, disease, and production

    DEFF Research Database (Denmark)

    Enevoldsen, Carsten; Grohn, Y T; Thysen, Iver

    1991-01-01

    lactation and body weight were positively associated with sole ulcer. Heel erosion was associated with sole ulcer depending on season of trimming and parity. Presence of sole ulcer but not heel erosion in a lactation increased the risk of sole ulcer in the subsequent lactation. The interval between...

  6. 77 FR 12226 - Sadex Corp.; Filing of Food Additive Petition (Animal Use); Electron Beam and X-Ray Sources for...

    Science.gov (United States)

    2012-02-29

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 579 [Docket No. FDA-2012-F-0178] Sadex Corp.; Filing of Food Additive Petition (Animal Use); Electron Beam and X-Ray... Sadex Corp. has filed a petition proposing that the food additive regulations be amended to provide for...

  7. Regional, temporal, and species patterns of mercury in Alaskan seabird eggs: Mercury sources and cycling or food web effects?

    International Nuclear Information System (INIS)

    Day, Rusty D.; Roseneau, David G.; Vander Pol, Stacy S.; Hobson, Keith A.; Donard, Olivier F.X.; Pugh, Rebecca S.; Moors, Amanda J.; Becker, Paul R.

    2012-01-01

    Mercury concentration ([Hg]), δ 15 N, and δ 13 C values were measured in eggs from common murres (Uria aalge), thick-billed murres (U. lomvia), glaucous gulls (Larus hyperboreus), and glaucous-winged gulls (L. glaucescens) collected in Alaska from 1999 to 2005. [Hg] was normalized to a common trophic level using egg δ 15 N values and published Hg trophic magnification factors. Egg [Hg] was higher in murres from Gulf of Alaska, Cook Inlet, and Norton Sound regions compared to Bering Sea and Bering Strait regions, independent of trophic level. We believe the Yukon River outflow and terrestrial Hg sources on the southern Seward Peninsula are responsible for the elevated [Hg] in Norton Sound eggs. Normalizing for trophic level generally diminished or eliminated differences in [Hg] among taxa, but temporal variability was unrelated to trophic level. Normalizing murre egg [Hg] by trophic level improves the confidence in regional comparisons of Hg sources and biogeochemical cycling in Alaska. - Highlights: ► Seabird eggs used for monitoring Hg in Alaskan marine environment. ► Egg Hg concentrations normalized to common trophic level using δ 15 N. ► Geographic Hg patterns persist independent of trophic normalization. ► Trophic normalization reduces difference among taxa, but not temporal variability. ► Measuring δ 15 N and δ 13 C improve interpretation of seabird mercury monitoring data. - Normalizing mercury concentrations in seabird eggs to a common trophic level reveals that geographic patterns of mercury contamination exist in the Alaskan marine environment that are independent of food web effects.

  8. Dietary Sodium Intakes and Food Sources of Sodium in Canadian-Born and Asian-Born Individuals of Chinese Ethnicity at a Canadian University Campus

    Science.gov (United States)

    Yu, Yan Han; Farmer, Anna; Mager, Diana; Willows, Noreen

    2014-01-01

    Objective: To document the sodium intake and food sources of sodium of Canadian-born Chinese (CBC) and Asian-born Chinese (ABC) individuals at a Canadian university campus. Participants: Healthy adults aged 18-58 years originating from Canada, China, Hong Kong, or Taiwan were recruited from the University of Alberta (n = 40 CBC, n = 41 ABC)…

  9. Intake of total, animal and plant proteins, and their food sources in 10 countries in the European Prospective Investigation into Cancer and Nutrition

    NARCIS (Netherlands)

    Halkjaer, J.; Olsen, A.; Bjerregaard, L. J.; Deharveng, G.; Tjonneland, A.; Welch, A. A.; Crowe, F. L.; Wirfalt, E.; Hellstrom, V.; Niravong, M.; Touvier, M.; Linseisen, J.; Steffen, A.; Ocke, M. C.; Peeters, P. H. M.; Chirlaque, M. D.; Larranaga, N.; Ferrari, P.; Contiero, P.; Frasca, G.; Engeset, D.; Lund, E.; Misirli, G.; Kosti, M.; Riboli, E.; Slimani, N.; Bingham, S.

    Objective: To describe dietary protein intakes and their food sources among 27 redefined centres in 10 countries participating in the European Prospective Investigation into Cancer and Nutrition (EPIC). Methods: Between 1995 and 2000, 36 034 persons, aged between 35 and 74 years, were administered a

  10. Expansion and functional properties of extruded snacks enriched with nutrition sources from food processing by-products.

    Science.gov (United States)

    Korkerd, Sopida; Wanlapa, Sorada; Puttanlek, Chureerat; Uttapap, Dudsadee; Rungsardthong, Vilai

    2016-01-01

    Rich sources of protein and dietary fiber from food processing by-products, defatted soybean meal, germinated brown rice meal, and mango peel fiber, were added to corn grit at 20 % (w/w) to produce fortified extruded snacks. Increase of total dietary fiber from 4.82 % (wb) to 5.92-17.80 % (wb) and protein from 5.03 % (wb) to 5.46-13.34 % were observed. The product indicated high expansion and good acceptance tested by sensory panels. There were 22.33-33.53 and 5.30-11.53 fold increase in the phenolics and antioxidant activity in the enriched snack products. The effects of feed moisture content, screw speed, and barrel temperature on expansion and nutritional properties of the extruded products were investigated by using response surface methodology. Regression equations describing the effect of each variable on the product responses were obtained. The snacks extruded with feed moisture 13-15 % (wb) and extrusion temperature at 160-180 °C indicated the products with high preference in terms of expansion ratio between insoluble dietary fiber and soluble dietary fiber balance. The results showed that the by-products could be successfully used for nutritional supplemented expanded snacks.

  11. Chicks change their pecking behaviour towards stationary and mobile food sources over the first 12 weeks of life: improvement and discontinuities

    Directory of Open Access Journals (Sweden)

    Kenneth J. Murphy

    2014-10-01

    Full Text Available Chicks (Gallus gallus domesticus learn to peck soon after hatching and then peck in rapid bursts or bouts with intervals of non-pecking activity. The food sources may be static such as seeds and chick crumb, or mobile such as a mealworm. Here, changes with age in pecking toward chick crumb and a mealworm were measured.Chicks were reared in pairs and their pecking of crumb food was video recorded in their pair housed environment, from food presentation, every third day from day 8 (wk 2 to day 65 (wk 10. Peck rate at crumb food reached maximum levels at day 32 (wk 5, and then declined, fitting a quadratic model, with no sex, sex of cagemate, or box order effects. Within bouts the peck rate was higher and it increased to day 41 (wk 6 and then declined, and here males pecked faster than females. A change in dietary protein concentration from 22% to 18% at day 28 (wk 4 had no effect on subsequent peck rate.Pecking at and consumption of a mealworm in pair housed chicks were measured weekly from wks [5 to 12]. The latency to first worm peck and latency to swallow decreased to wk 8 and increased thereafter. The peck rate to first wormpeck and number of pecks to swallow increased to wk 8 and then declined paralleling the changes with crumb food. The increase in peck rate is coupled with an increase in efficiency in worm catching.The results are consistent with the view that the improvement in pecking ability and accuracy compliments change in nutritional requirement best served by an invertebrate food (IF source requiring speed to achieve feeding success, especially with live prey. When this food source is no longer crucial these associated skill levels decline. An appreciation of the role of domestic fowl in controlling insect populations, at farm level, that are often vectors in disease spread is lacking.

  12. Chicks change their pecking behaviour towards stationary and mobile food sources over the first 12 weeks of life: improvement and discontinuities.

    Science.gov (United States)

    Murphy, Kenneth J; Hayden, Thomas J; Kent, John P

    2014-01-01

    Chicks (Gallus gallus domesticus) learn to peck soon after hatching and then peck in rapid bursts or bouts with intervals of non-pecking activity. The food sources may be static such as seeds and chick crumb, or mobile such as a mealworm. Here, changes with age in pecking toward chick crumb and a mealworm were measured. Chicks were reared in pairs and their pecking of crumb food was video recorded in their pair housed environment, from food presentation, every third day from day 8 (wk 2) to day 65 (wk 10). Peck rate at crumb food reached maximum levels at day 32 (wk 5), and then declined, fitting a quadratic model, with no sex, sex of cagemate, or box order effects. Within bouts the peck rate was higher and it increased to day 41 (wk 6) and then declined, and here males pecked faster than females. A change in dietary protein concentration from 22% to 18% at day 28 (wk 4) had no effect on subsequent peck rate. Pecking at and consumption of a mealworm in pair housed chicks were measured weekly from wks [5 to 12]. The latency to first worm peck and latency to swallow decreased to wk 8 and increased thereafter. The peck rate to first wormpeck and number of pecks to swallow increased to wk 8 and then declined paralleling the changes with crumb food. The increase in peck rate is coupled with an increase in efficiency in worm catching. The results are consistent with the view that the improvement in pecking ability and accuracy compliments change in nutritional requirement best served by an invertebrate food (IF) source requiring speed to achieve feeding success, especially with live prey. When this food source is no longer crucial these associated skill levels decline. An appreciation of the role of domestic fowl in controlling insect populations, at farm level, that are often vectors in disease spread is lacking.

  13. Sources of calicivirus contamination in foodborne outbreaks, Denmark, 2005-2011 - the role of the asymptomatic food handler

    DEFF Research Database (Denmark)

    Franck, Kristina T.; Lisby, Morten; Fonager, Jannik

    2015-01-01

    Background. Norovirus is the predominant cause of foodborne disease outbreaks. Virus contamination may occur during all steps of food processing from production to preparation and serving. The relative importance of these different routes of contamination is unknown. Methods. The purpose...... of contamination. Results. In 64 (34%) of the outbreaks, contamination from food handlers took place during preparation or serving of food. In the majority of these outbreaks (n=41; 64%), the food handlers were asymptomatic during food handling. Some had been in contact with ill household members before handling...... the food and remained asymptomatic; others developed symptoms shortly after or were post-symptomatic. In 51 (27%) of the outbreaks, contamination occurred during production of the food and in 55 (29%) of the outbreaks, contamination had supposedly occurred after serving via a guest at a self-serving buffet...

  14. The Remote Food Photography Method accurately estimates dry powdered foods—the source of calories for many infants

    Science.gov (United States)

    Duhé, Abby F.; Gilmore, L. Anne; Burton, Jeffrey H.; Martin, Corby K.; Redman, Leanne M.

    2016-01-01

    Background Infant formula is a major source of nutrition for infants with over half of all infants in the United States consuming infant formula exclusively or in combination with breast milk. The energy in infant powdered formula is derived from the powder and not the water making it necessary to develop methods that can accurately estimate the amount of powder used prior to reconstitution. Objective To assess the use of the Remote Food Photography Method (RFPM) to accurately estimate the weight of infant powdered formula before reconstitution among the standard serving sizes. Methods For each serving size (1-scoop, 2-scoop, 3-scoop, and 4-scoop), a set of seven test bottles and photographs were prepared including the recommended gram weight of powdered formula of the respective serving size by the manufacturer, three bottles and photographs containing 15%, 10%, and 5% less powdered formula than recommended, and three bottles and photographs containing 5%, 10%, and 15% more powdered formula than recommended (n=28). Ratio estimates of the test photographs as compared to standard photographs were obtained using standard RFPM analysis procedures. The ratio estimates and the United States Department of Agriculture (USDA) data tables were used to generate food and nutrient information to provide the RFPM estimates. Statistical Analyses Performed Equivalence testing using the two one-sided t- test (TOST) approach was used to determine equivalence between the actual gram weights and the RFPM estimated weights for all samples, within each serving size, and within under-prepared and over-prepared bottles. Results For all bottles, the gram weights estimated by the RFPM were within 5% equivalence bounds with a slight under-estimation of 0.05 g (90% CI [−0.49, 0.40]; p<0.001) and mean percent error ranging between 0.32% and 1.58% among the four serving sizes. Conclusion The maximum observed mean error was an overestimation of 1.58% of powdered formula by the RFPM under

  15. Use of Powder PEG-3350 as a Sole Bowel Preparation

    Science.gov (United States)

    Arora, Manish

    2008-01-01

    Objective: To assess the efficacy of low-volume powder polyethylene glycol (PEG)-3350 as a sole bowel preparation for colonoscopy. Methods: This case series examined 245 consecutive patients (a mixture of inpatients and outpatients undergoing screening colonoscopy) at a hospital endoscopy center over a 2-year period. The patients received powder PEG-3350 in the amount of 204 g dissolved in 32 oz of water and taken in 3 divided doses 1 hour apart with 8 oz of water in between each dose. Colon preparation scores (CPS) were used to assess the quality of colon cleansing. The results obtained from the 245 patients were collated and compared to those of patients receiving sodium phosphate, the historical control. Results: The mean CPS was calculated to be 3.43, with a standard deviation of 1.12. Of the 245 patients, 92 were scored with a grade of 4, and 5 patients had incomplete colonoscopies secondary to failure of bowel preparation (CPS=0). Among the remaining patients, 22 and 26 were graded as poor (CPS=1) or fair (CPS=2) bowel preparations, respectively. Conclusion: The low-volume powder PEG-3350 formula used in our case series showed effective colon cleansing and may be considered for use as a sole bowel preparation. PMID:21960925

  16. Trisomy 19 as the sole chromosomal anomaly in hematologic neoplasms.

    Science.gov (United States)

    Johansson, B; Billström, R; Mauritzson, N; Mitelman, F

    1994-05-01

    Trisomy 19 was found as the sole chromosomal aberration in three hematologic malignancies: one chronic myelomonocytic leukemia and two cases of of immunophenotypically immature acute myeloid leukemia (AML). A compilation of previously published hematologic neoplasms with +19 as the only change reveals that this anomaly is strongly associated with myeloid malignancies; 25 of 31 cases have been myelodysplastic syndromes (MDS) or AML. Eight of the 11 MDS cases have been either refractory anemia (RA) or RA with excess of blasts, and four of the 14 AML cases have had preleukemic myelodysplastic cases phase, with the +19 accruing during the time of leukemic transformation. The AML cases have, in general, been either or early maturation arrest, i.e. undifferentiated or AML-M1/M2, or of myelomonocytic-monoblastic origin, i.e., AML-M4/M5. None of the MDS or AML cases with +19 had had a previous history of radio- or chemotherapy. We conclude that trisomy 19, as the sole anomaly, is a characteristic abnormality in de novo myeloid malignancies. No clinical features seem to characterize patients with +19 AML and MDS and the prognostic impact of the aberration remains to be elucidated.

  17. A methodology for combining multiple commercial data sources to improve measurement of the food and alcohol environment: applications of geographical information systems

    Directory of Open Access Journals (Sweden)

    Dara D. Mendez

    2014-11-01

    Full Text Available Commercial data sources have been increasingly used to measure and locate community resources. We describe a methodology for combining and comparing the differences in commercial data of the food and alcohol environment. We used commercial data from two commercial databases (InfoUSA and Dun&Bradstreet for 2003 and 2009 to obtain infor- mation on food and alcohol establishments and developed a matching process using computer algorithms and manual review by applying ArcGIS to geocode addresses, standard industrial classification and North American industry classification tax- onomy for type of establishment and establishment name. We constructed population and area-based density measures (e.g. grocery stores and assessed differences across data sources and used ArcGIS to map the densities. The matching process resulted in 8,705 and 7,078 unique establishments for 2003 and 2009, respectively. There were more establishments cap- tured in the combined dataset than relying on one data source alone, and the additional establishments captured ranged from 1,255 to 2,752 in 2009. The correlations for the density measures between the two data sources was highest for alcohol out- lets (r = 0.75 and 0.79 for per capita and area, respectively and lowest for grocery stores/supermarkets (r = 0.32 for both. This process for applying geographical information systems to combine multiple commercial data sources and develop meas- ures of the food and alcohol environment captured more establishments than relying on one data source alone. This replic- able methodology was found to be useful for understanding the food and alcohol environment when local or public data are limited.

  18. The food choice kaleidoscope. A framework for structured description of product, place and person as sources of variation in food choices.

    Science.gov (United States)

    Jaeger, Sara R; Bava, Christina M; Worch, Thierry; Dawson, John; Marshall, David W

    2011-04-01

    Despite a wide range of research approaches already being used to study eating and drinking, this complex aspect of human activity lacks conceptualisation and methodology for structured description of food choices. This paper introduces a metaphoric framework--the food choice kaleidoscope--as an approach to such inquiry. It conceptualises individual food choice events (or eating occasions) as being shaped by three main factors--product, person and place--and provides a descriptive approach through which patterns and variability in food choice events can be observed. The factors can be studied separately or in combination to reveal the joint influence of product, place and/or person factors. The approach is 'data hungry' and requires information about large numbers of eating occasions obtained for a variety of foods/beverage in a variety of situations. Using information about ∼5800 eating occasions obtained from 25 New Zealand women who self-completed 24-h recall diaries, the kaleidoscopic approach is illustrated. The data are analysed in relation to 30 food/beverage categories and 37 contextual (or 'place') variables, and at the level of individual participants. Results are presented that document: product-to-product variability in who eats/drinks what and where/how it is consumed; place-to-place variation in what is consumed and by whom; and person-to-person variability in what is consumed and where/how it is consumed. The most significant insight to emerge is the considerable heterogeneity that is hidden beneath the average patterns, and that average values may be inappropriate/irrelevant for this type of data. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Mutagens from the cooking of food. III. Survey by Ames/Salmonella test of mutagen formation in secondary sources of cooked dietary protein

    Energy Technology Data Exchange (ETDEWEB)

    Bjeldanes, L F [Univ. of California, Berkeley; Morris, M M; Felton, J S; Healy, S; Stuermer, D; Berry, P; Timourian, H; Hatch, F T

    1982-01-01

    A survey of mutagen formation during the cooking of a variety of protein-rich foods that are minor sources of protein intake in the American diet is reported (see Bjeldanes, Morris, Felton et al. (1982) for survey of major protein foods). Milk, cheese, tofu and organ meats showed negligible mutagen formation except following high-temperature cooking for long periods of time. Even under the most extreme conditions, tofu, cheese and milk exhibited fewer than 500 Ames/Salmonella typhimurium revertants/100 g equivalents (wet weight of uncooked food), and organ meats only double that amount. Beans showed low mutagen formation after boiling followed by frying (with and without oil). Only boiling of beans followed by baking for 1 hr gave appreciable mutagenicity (3650 revertants/100 g equivalents). Seafood samples gave a variety of results: red snapper, salmon, trout, halibut and rock cod all gave more than 1000 revertants/100 g wet weight equivalents when pan-fried or griddle-fried for about 6 min/side. Baked or poached rock cod and deep-fried shrimp showed no significant mutagen formation. Broiled lamb chops showed mutagen formation similar to that in red meats tested in the preceding paper: 16,000 revertants/100 g equivalents. These findings show that as measured by bioassay in S. typhimurium, most of the food that are minor sources of protein in the American diet are also minor sources of cooking-induced mutagens.

  20. Mutagens from the cooking of food. III. Survey by Ames/Salmonella test of mutagen formation in secondary sources of cooked dietary protein.

    Science.gov (United States)

    Bjeldanes, L F; Morris, M M; Felton, J S; Healy, S; Stuermer, D; Berry, P; Timourian, H; Hatch, F T

    1982-08-01

    A survey of mutagen formation during the cooking of a variety of protein-rich foods that are minor sources of protein intake in the American diet is reported (see Bjeldanes, Morris, Felton et al. (1982) for survey of major protein foods). Milk, cheese, tofu and organ meats showed negligible mutagen formation except following high-temperature cooking for long periods of time. Even under the most extreme conditions, tofu, cheese and milk exhibited fewer than 500 Ames/Salmonella typhimurium revertants/100 g equivalents (wet weight of uncooked food), and organ meats only double that amount. Beans showed low mutagen formation after boiling and boiling followed by frying (with and without oil). Only boiling of beans followed by baking for 1 hr gave appreciable mutagenicity (3650 revertants/100g equivalents). Seafood samples gave a variety of results: red snapper, salmon, trout, halibut and rock cod all gave more than 1000 revertants/100 g wet weight equivalents when pan-fried or griddle-fried for about 6 min/side. Baked or poached rock and deep-fried shrimp showed no significant mutagen formation. Broiled lamb chops showed mutagen formation similar to that in red meats tested in the preceding paper: 16,000 revertants/100 g equivalents. These findings show that as measured by bioassay in S. typhimurium, most of the foods that are minor sources of protein in the American diet are also minor sources of cooking-induced mutagens.

  1. Safety assessment of freeze-dried powdered Tenebrio molitor larvae (yellow mealworm) as novel food source: Evaluation of 90-day toxicity in Sprague-Dawley rats.

    Science.gov (United States)

    Han, So-Ri; Lee, Byoung-Seok; Jung, Kyung-Jin; Yu, Hee-Jin; Yun, Eun-Young; Hwang, Jae Sam; Moon, Kyoung-Sik

    2016-06-01

    Worldwide demand for novel food source has grown and edible insects are a promising food sources for humans. Tenebrio molitor, as known as yellow mealworm, has advantages of being rich in protein, and easy to raise as a novel food source. The objective of this study was to evaluate subchronic toxicity, including potential hypersensitivity, of freeze-dried powdered T. molitor larvae (fdTML) in male and female Sprague-Dawley rats. The fdTML was administered orally once daily at dose levels of 0, 300, 1000 and 3000 mg/kg/day for 90 days. A toxicological assessment was performed, which included mortality, clinical signs, body and organ weights, food consumption, ophthalmology, urinalysis, hematology, serum chemistry, gross findings, histopathologic examination and allergic reaction. There were no fdTML- related findings in clinical signs, urinalysis, hematology and serum chemistry, gross examination, histopathologic examination or allergic reaction. In conclusion, the No Observed Adverse Effect Level (NOAEL) for fdTML was determined to be in excess of 3000 mg/kg/day in both sexes of rats under the experimental conditions of this study. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Energy intake from commercially-prepared meals by food source in Korean adults: Analysis of the 2001 and 2011 Korea National Health and Nutrition Examination Surveys

    Science.gov (United States)

    Choi, Injoo; Kim, Won Gyoung

    2017-01-01

    BACKGROUND/OBJECTIVES The commercial foodservice industry in Korea has shown rapid growth recently. This study examined Korean adults' consumption of commercially-prepared meals based on where the food was prepared. SUBJECTS/METHODS Data from a 24-hour dietary recall of the 2001 and 2011 Korea National Health and Nutrition Examination Surveys were analyzed. A total of 10,539 subjects (n = 6,152 in 2001; n = 4,387 in 2011) aged 19-64 years were included for analysis. Commercially-prepared meals were classified into four food source groups based on where the food was prepared: Korean restaurants, Chinese/Western/Japanese restaurants, fast-food restaurants, and retail stores. Subjects' energy intake, including the amount and proportion of calories, was examined for each food source. The analysis was also conducted by gender for age-stratified groups: 19-29, 30-49, and 50-64 years old. RESULTS Korean adults' energy intake from commercially-prepared meals increased in the amount of calories (551 kcal to 635 kcal, P food source of commercially-prepared meals was Korean restaurants in both years. The amount and proportion of calories from retail stores increased from 83 kcal to 143 kcal (P Korean adults consumed about one-fourth of their energy intake from commercially-prepared meals. In particular, males aged 30-49 years and females aged 19-29 years consumed more than one-third of their energy intake from commercially-prepared meals. Korean restaurants played a significant role in Korean adults' energy intake. Retail stores increased influence on Korean adults' energy intake. These results could be useful for developing health promotion policies and programs. PMID:28386389

  3. Energy intake and food sources of eight Latin American countries: results from the Latin American Study of Nutrition and Health (ELANS).

    Science.gov (United States)

    Kovalskys, Irina; Fisberg, Mauro; Gómez, Georgina; Pareja, Rossina G; Yépez García, Martha C; Cortés Sanabria, Lilia Y; Herrera-Cuenca, Marianella; Rigotti, Attilio; Guajardo, Viviana; Zalcman Zimberg, Ioná; Nogueira Previdelli, Agatha; Moreno, Luis A; Koletzko, Berthold

    2018-05-31

    Few previous studies in Latin America (LA) have provided data on dietary intake composition with a standardized methodology. The present study aimed to characterize energy intake (EI) and to describe the main food sources of energy in representative samples of the urban population from eight LA countries from the Latin American Study in Nutrition and Health (ELANS). Cross-sectional study. Usual dietary intake was assessed with two non-consecutive 24 h dietary recalls. Urban areas from eight countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Ecuador, Peru, Venezuela), September 2014 to July 2015. Adolescents and adults aged 15-65 years. Final sample comprised 9218 individuals, of whom 6648 (72·1 %) were considered plausible reporters. Overall, mean EI was 8196 kJ/d (1959 kcal/d), with a balanced distribution of macronutrients (54 % carbohydrate, 30 % fat, 16 % protein). Main food sources of energy were grains, pasta and bread (28 %), followed by meat and eggs (19 %), oils and fats (10 %), non-alcoholic homemade beverages (6 %) and ready-to-drink beverages (6 %). More than 25 % of EI was provided from food sources rich in sugar and fat, like sugary drinks, pastries, chips and candies. Meanwhile, only 18 % of EI was from food sources rich in fibre and micronutrients, such as whole grains, roots, fruits, vegetables, beans, fish and nuts. No critical differences were observed by gender or age. Public health efforts oriented to diminish consumption of refined carbohydrates, meats, oils and sugar and to increase nutrient dense-foods are a priority in the region to drive to a healthier diet.

  4. Livestock production, animal source food intake, and young child growth: the role of gender for ensuring nutrition impacts.

    Science.gov (United States)

    Jin, Minchao; Iannotti, Lora L

    2014-03-01

    Animal source foods (ASF) provide critical micronutrients in highly bioavailable forms, with the potential to efficiently address undernutrition among young children living in developing countries. There is limited evidence for how livestock ownership might increase ASF intake in poor households either through own-consumption or income generation. Along with lack of nutrition knowledge, gender dimensions may affect the pathways leading from livestock ownership to child ASF intake and ultimately to young child growth. Using data from a large-scale impact evaluation conducted in Kenya, this study tested the hypothesis that co-owned/female-owned livestock would be associated with improved child growth, mediated by increases in ASF consumption. Data were collected from September 2010 to January 2011 from households in six provinces in Kenya on a broad range of agricultural, economic, social, health and nutrition factors. Children ages 6-60 months were included in this analysis (n = 183). In this sample, co-owned/female-owned livestock was valued at 18,861 Kenyan shillings in contrast with male-owned livestock valued at 66,343 Kenyan shillings. Multivariate linear regression models showed a positive association between co-owned/female-owned livestock with child weight-for-age z score (WAZ) after adjusting for caregiver education level, income, child age, and child sex. A mediating effect by child ASF intake was evident, explaining 25% of the relationship of livestock ownership with child WAZ, by Sobel-Goodman test (p livestock and height-for-age z score (HAZ), and no effect was apparent for weight-for-height z score (WHZ). The partial mediating effect may be indicative of other factors inherent in co-owned/female-owned livestock such as higher status of females in these households with greater influence over other child care practices promoting growth. Nonetheless, our study suggests targeting females in livestock production programming may better ensure improvements

  5. Animal source food intake and association with blood cholesterol, glycerophospholipids and sphingolipids in a northern Swedish population

    Directory of Open Access Journals (Sweden)

    Wilmar Igl

    2013-08-01

    Full Text Available Background . The high intake of game meat in populations with a subsistence-based diet may affect their blood lipids and health status. Objective . To examine the association between diet and circulating levels of blood lipid levels in a northern Swedish population. Study design . We compared a group with traditional lifestyle (TLS based on reindeer herding (TLS group with those from the same area with a non-traditional lifestyle (NTLS typical of more industrialized regions of Sweden (NTLS group. The analysis was based on self-reported intake of animal source food (i.e. non-game meat, game meat, fish, dairy products and eggs and the serum blood level of a number of lipids [total cholesterol (TC, low-density lipoprotein cholesterol (LDL, high-density lipoprotein cholesterol (HDL, triglycerides (TG, glycerophospholipids and sphingolipids]. Results . The TLS group had higher cholesterol, LDL and HDL levels than the reference group. Of the TLS group, 65% had cholesterol levels above the threshold for increased risk of coronary heart disease (≥240 mg/dl, as compared to 38% of the NTLS group. Self-reported consumption of game meat was positively associated with TC and LDL. Conclusions . The high game meat consumption of the TLS group is associated with increased cholesterol levels. High intake of animal protein and fat and low fibre is known to increase the risk of cardiovascular disease, but other studies of the TLS in northern Sweden have shown comparable incidences of cardiovascular disease to the reference (NTLS group from the same geographical area. This indicates that factors other than TC influence disease risk. One such possible factor is dietary phospholipids, which are also found in high amounts specifically in game meat and have been shown to inhibit cholesterol absorption.

  6. Animal source food intake and association with blood cholesterol, glycerophospholipids and sphingolipids in a northern Swedish population.

    Science.gov (United States)

    Igl, Wilmar; Kamal-Eldin, Afaf; Johansson, Asa; Liebisch, Gerhard; Gnewuch, Carsten; Schmitz, Gerd; Gyllensten, Ulf

    2013-01-01

    The high intake of game meat in populations with a subsistence-based diet may affect their blood lipids and health status. To examine the association between diet and circulating levels of blood lipid levels in a northern Swedish population. We compared a group with traditional lifestyle (TLS) based on reindeer herding (TLS group) with those from the same area with a non-traditional lifestyle (NTLS) typical of more industrialized regions of Sweden (NTLS group). The analysis was based on self-reported intake of animal source food (i.e. non-game meat, game meat, fish, dairy products and eggs) and the serum blood level of a number of lipids [total cholesterol (TC), low-density lipoprotein cholesterol (LDL), high-density lipoprotein cholesterol (HDL), triglycerides (TG), glycerophospholipids and sphingolipids]. The TLS group had higher cholesterol, LDL and HDL levels than the reference group. Of the TLS group, 65% had cholesterol levels above the threshold for increased risk of coronary heart disease (≥ 240 mg/dl), as compared to 38% of the NTLS group. Self-reported consumption of game meat was positively associated with TC and LDL. The high game meat consumption of the TLS group is associated with increased cholesterol levels. High intake of animal protein and fat and low fibre is known to increase the risk of cardiovascular disease, but other studies of the TLS in northern Sweden have shown comparable incidences of cardiovascular disease to the reference (NTLS) group from the same geographical area. This indicates that factors other than TC influence disease risk. One such possible factor is dietary phospholipids, which are also found in high amounts specifically in game meat and have been shown to inhibit cholesterol absorption.

  7. Chemical compositions of the marine algae Gracilaria salicornia (Rhodophyta) and Ulva lactuca (Chlorophyta) as a potential food source.

    Science.gov (United States)

    Tabarsa, Mehdi; Rezaei, Masoud; Ramezanpour, Zohreh; Waaland, Joseph Robert

    2012-09-01

    The nutritional compositions of two edible red (Gracilaria salicornia) and green (Ulva lactuca) seaweeds were determined to evaluate their possible uses as potential food ingredients. In general, these species contained limited amounts of lipids ranging between 0.99 and 2.00 g 100 g(-1) dry weight) and considerably high amount of minerals, especially in G. salicornia (38.91 g 100 g(-1) d.w.). The crude protein values varied between 9.58 and 10.69 g 100 g(-1) d.w. Amounts for total amino acids were 889.78 ± 22.64 mg g(-1) protein d.w. in G. salicornia and 543.3 ± 15.14 mg g(-1) protein d.w. in U. lactuca. The most abundant fatty acids were C12:0, C16:0, C20:4 ω6 and C22:5 ω3, in addition to C18:1 in G. salicornia. Both seaweed species were balanced sources of ω3 and ω6 fatty acids with a ratio of ω6/ω3 that varied between 1.2 and 1.17. Between the seaweeds investigated, high levels of K (2414.02-11 380.06 mg 100 g(-1) d.w.) were observed and the amounts of Ca, Na and Fe were higher than those reported for land plants. Thus, G. salicornia and U. lactuca may be utilised as value-added products for human nutrition purposes. Copyright © 2012 Society of Chemical Industry.

  8. An application of the theory of planned behaviour to study the influencing factors of participation in source separation of food waste

    International Nuclear Information System (INIS)

    Karim Ghani, Wan Azlina Wan Ab.; Rusli, Iffah Farizan; Biak, Dayang Radiah Awang; Idris, Azni

    2013-01-01

    Highlights: ► Theory of planned behaviour (TPB) has been conducted to identify the influencing factors for participation in source separation of food waste using self administered questionnaires. ► The findings suggested several implications for the development and implementation of waste separation at home programme. ► The analysis indicates that the attitude towards waste separation is determined as the main predictors where this in turn could be a significant predictor of the repondent’s actual food waste separation behaviour. ► To date, none of similar have been reported elsewhere and this finding will be beneficial to local Authorities as indicator in designing campaigns to promote the use of waste separation programmes to reinforce the positive attitudes. - Abstract: Tremendous increases in biodegradable (food waste) generation significantly impact the local authorities, who are responsible to manage, treat and dispose of this waste. The process of separation of food waste at its generation source is identified as effective means in reducing the amount food waste sent to landfill and can be reused as feedstock to downstream treatment processes namely composting or anaerobic digestion. However, these efforts will only succeed with positive attitudes and highly participations rate by the public towards the scheme. Thus, the social survey (using questionnaires) to analyse public’s view and influencing factors towards participation in source separation of food waste in households based on the theory of planned behaviour technique (TPB) was performed in June and July 2011 among selected staff in Universiti Putra Malaysia, Serdang, Selangor. The survey demonstrates that the public has positive intention in participating provided the opportunities, facilities and knowledge on waste separation at source are adequately prepared by the respective local authorities. Furthermore, good moral values and situational factors such as storage convenience and

  9. An application of the theory of planned behaviour to study the influencing factors of participation in source separation of food waste

    Energy Technology Data Exchange (ETDEWEB)

    Karim Ghani, Wan Azlina Wan Ab., E-mail: wanaz@eng.upm.edu.my [Department of Chemical and Environmental Engineering, Faculty of Engineering, University Putra Malaysia, 43400 Serdang, Selangor Darul Ehsan (Malaysia); Rusli, Iffah Farizan, E-mail: iffahrusli@yahoo.com [Department of Chemical and Environmental Engineering, Faculty of Engineering, University Putra Malaysia, 43400 Serdang, Selangor Darul Ehsan (Malaysia); Biak, Dayang Radiah Awang, E-mail: dayang@eng.upm.edu.my [Department of Chemical and Environmental Engineering, Faculty of Engineering, University Putra Malaysia, 43400 Serdang, Selangor Darul Ehsan (Malaysia); Idris, Azni, E-mail: azni@eng.upm.edu.my [Department of Chemical and Environmental Engineering, Faculty of Engineering, University Putra Malaysia, 43400 Serdang, Selangor Darul Ehsan (Malaysia)

    2013-05-15

    Highlights: ► Theory of planned behaviour (TPB) has been conducted to identify the influencing factors for participation in source separation of food waste using self administered questionnaires. ► The findings suggested several implications for the development and implementation of waste separation at home programme. ► The analysis indicates that the attitude towards waste separation is determined as the main predictors where this in turn could be a significant predictor of the repondent’s actual food waste separation behaviour. ► To date, none of similar have been reported elsewhere and this finding will be beneficial to local Authorities as indicator in designing campaigns to promote the use of waste separation programmes to reinforce the positive attitudes. - Abstract: Tremendous increases in biodegradable (food waste) generation significantly impact the local authorities, who are responsible to manage, treat and dispose of this waste. The process of separation of food waste at its generation source is identified as effective means in reducing the amount food waste sent to landfill and can be reused as feedstock to downstream treatment processes namely composting or anaerobic digestion. However, these efforts will only succeed with positive attitudes and highly participations rate by the public towards the scheme. Thus, the social survey (using questionnaires) to analyse public’s view and influencing factors towards participation in source separation of food waste in households based on the theory of planned behaviour technique (TPB) was performed in June and July 2011 among selected staff in Universiti Putra Malaysia, Serdang, Selangor. The survey demonstrates that the public has positive intention in participating provided the opportunities, facilities and knowledge on waste separation at source are adequately prepared by the respective local authorities. Furthermore, good moral values and situational factors such as storage convenience and

  10. Dietary exposure of juvenile common sole (Solea solea L.) to polybrominated diphenyl ethers (PBDEs): Part 1. Bioaccumulation and elimination kinetics of individual congeners and their debrominated metabolites

    International Nuclear Information System (INIS)

    Munschy, C.; Heas-Moisan, K.; Tixier, C.; Olivier, N.; Gastineau, O.; Le Bayon, N.; Buchet, V.

    2011-01-01

    The uptake and elimination of six PBDE congeners (BDE-28, -47, -99, -100, -153, -209) were studied in juvenile common sole (Solea solea L.) exposed to spiked contaminated food over a three-month period, then depurated over a five-month period. The results show that all of the studied PBDEs accumulate in fish tissues, including the higher brominated congener BDE-209. Several additional PBDE congeners were identified in the tissues of exposed fish, revealing PBDE transformation, mainly via debromination. The identified congeners originating from PBDE debromination include BDE-49 and BDE-202 and a series of unidentified tetra-, penta-, and hepta- BDEs. Contaminant assimilation efficiencies (AEs) were related to their hydrophobicity (log K ow ) and influenced by PBDE biotransformation. Metabolism via debromination appears to be a major degradation route of PBDEs in juvenile sole in comparison to biotransformation into hydroxylated metabolites. - Juvenile sole exposed to artificially-contaminated food accumulate PBDEs, including the higher brominated congeners, and have a debromination capacity.

  11. 77 FR 26706 - Food Ingredients and Sources of Radiation Listed and Approved for Use in the Production of Meat...

    Science.gov (United States)

    2012-05-07

    ... Listed and Approved for Use in the Production of Meat and Poultry Products AGENCY: Food Safety and... the regulations prohibit for use in meat or poultry products. Under this proposal, new uses of these substances in meat or poultry products would continue to be approved by the Food and Drug Administration (FDA...

  12. 78 FR 14636 - Food Ingredients and Sources of Radiation Listed and Approved for Use in the Production of Meat...

    Science.gov (United States)

    2013-03-07

    ... Production of Meat and Poultry Products AGENCY: Food Safety and Inspection Service, USDA. ACTION: Final rule. SUMMARY: The Food Safety and Inspection Service (FSIS) is amending the Federal meat and poultry products... substances that the regulations prohibit for use in meat or poultry products. New uses of these substances in...

  13. The Selection and Prevalence of Natural and Fortified Calcium Food Sources in the Diets of Adolescent Girls

    Science.gov (United States)

    Rafferty, Karen; Watson, Patrice; Lappe, Joan M.

    2011-01-01

    Objective: To assess the impact of calcium-fortified food and dairy food on selected nutrient intakes in the diets of adolescent girls. Design: Randomized controlled trial, secondary analysis. Setting and Participants: Adolescent girls (n = 149) from a midwestern metropolitan area participated in randomized controlled trials of bone physiology…

  14. Protein source and quality in therapeutic foods affect the immune response and outcome in severe acute malnutrition

    Science.gov (United States)

    Protein is a vital component of therapeutic foods designed to treat severe acute malnutrition (SAM) in children; however there are still unknowns about the quality and quantity of the proteins to use in these foods. This review examines two recent studies investigating several different qualities an...

  15. Vegetable foods: a cheap source of proteins and peptides with antihypertensive, antioxidant, and other less occurrence bioactivities.

    Science.gov (United States)

    García, M C; Puchalska, P; Esteve, C; Marina, M L

    2013-03-15

    Despite less explored than foods from animal origin, plant derived foods also contain biologically active proteins and peptides. Bioactive peptides can be present as an independent entity in the food or, more frequently, can be in a latent state as part of the sequence of a protein. Release from that protein requires protein hydrolysis by enzymatic digestion, fermentation or autolysis. Different methodologies have been used to test proteins and peptides bioactivities. Fractionation, separation, and identification techniques have also been employed for the isolation and identification of bioactive proteins or peptides. In this work, proteins and peptides from plant derived foods exerting antihypertensive, antioxidant, hypocholesterolemic, antithrombotic, and immunostimulating capacities or ability to reduce food intake have been reviewed. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Intakes and sources of isoflavones, lignans, enterolignans, coumestrol and soya-containing foods in the Norfolk arm of the European Prospective Investigation into Cancer and Nutrition (EPIC-Norfolk), from 7 d food diaries, using a newly updated database.

    Science.gov (United States)

    Mulligan, Angela A; Kuhnle, Gunter G C; Lentjes, Marleen A H; van Scheltinga, Veronica; Powell, Natasha A; McTaggart, Alison; Bhaniani, Amit; Khaw, Kay-Tee

    2013-08-01

    A diet rich in phyto-oestrogens has been suggested to protect against a variety of common diseases but UK intake data on phyto-oestrogens or their food sources are sparse. The present study estimates the average intakes of isoflavones, lignans, enterolignans and coumestrol from 7 d food diaries and provides data on total isoflavone, lignan and phyto-oestrogen consumption by food group. Development of a food composition database for twelve phyto-oestrogens and analysis of soya food and phyto-oestrogen consumption in a populationbased study. Men and women, aged 40–79 years, from the general population participating in the Norfolk arm of the European Prospective Investigation into Cancer and Nutrition (EPIC-Norfolk) between 1993 and 1997, with nutrient and food data from 7 d food diaries. A subset of 20 437 participants. The median daily phyto-oestrogen intake for all men was 1199 mg (interquartile range 934–1537mg; mean 1504mg, SD 1502mg) and 888mg for all women (interquartile range 710–1135 mg; mean 1205 mg, SD 1701mg). In soya consumers, median daily intakes were higher: 2861 mg in men (interquartile range 1304–7269mg; mean 5051mg, SD 5031mg) and 3142 mg in women (interquartile range 1089–7327mg; mean 5396 mg, SD 6092 mg). In both men and women, bread made the greatest contribution to phyto-oestrogen intake – 40?8% and 35?6%, respectively. In soya consumers, vegetable dishes and soya/goat’s/sheep’s milks were the main contributors – 45?7% and 21?3% in men and 38?4% and 33?7% in women, respectively. The ability to estimate phyto-oestrogen intake in Western populations more accurately will aid investigations into their suggested effects on health.

  17. Depth and substrate as determinants of distribution of juvenile flathead sole (Hippoglossoides elassodon) and rock sole (Pleuronectes bilineatus), in Kachemak Bay, Alaska

    Science.gov (United States)

    Abookire, Alisa A.; Norcross, Brenda L.

    1998-01-01

    Three transects in Kachemak Bay, Alaska, were sampled in September 1994, May and August 1995, and February, May, and August 1996. Juvenile flathead sole, Hippoglossoides elassodon, and rock sole, Pleuronectes bilineatus, were the most abundant flatfishes, comprising 65-85% of all fiatfishes captured at any period. Collections of fish and sediments were made at regular depth contour intervals of l0 m. Habitat distribution was described by depth at 10 m increments and sediment percent weights of gravel, sand, and mud. Year-round habitat of flathead sole age-0 was primarily from 40 to 60 m, and age-1 habitat was primarily from 40 to 80 m. Summer habitat of rock sole age-0 and -1 was from 10 to 30 m, and in winter they moved offshore to depths of up to 150 m. Both age classes of flathead sole were most abundant on mixed mud sediments, while age-1 were also in high abundance on muddy sand sediments. Rock sole age-0 and -1 were most abundant on sand, though age-1 were also found on a variety of sediments both finer and coarser grained than sand. Flathead sole and rock sole had distinctive depth and sediment habitats. When habitat overlap occurred between the species, it was most often due to rock sole moving offshore in the winter. Abundances were not significantly different among seasons for age-1 flatfishes.

  18. Food Insecurity and Healthcare Costs: Research Strategies Using Local, State, and National Data Sources for Older Adults12

    Science.gov (United States)

    Lee, Jung Sun

    2013-01-01

    Food insecurity in older adults is a clinically relevant problem with important implications for healthcare costs; however, few studies have examined the relationship between food insecurity and the healthcare cost burden in older adults. It may be due in part to lack of appropriate data and methods to examine these issues in the existing datasets. It is critical to identify and obtain the data necessary for estimating healthcare costs associated with food insecurity and to explore specific mechanisms by which food insecurity is related to adverse health outcomes and associated healthcare costs. This paper discusses how to best utilize and link available, nationally representative datasets and develop infrastructure and procedures to establish state and local datasets. As an example, an innovative approach tested in Georgia to establish a state-level dataset in a sample of low-income, older adults in need of food assistance is discussed. In this approach, data from the state aging services client database and the Centers for Medicare and Medicaid Services data were linked. Such efforts are essential to estimate the healthcare cost burden of food-insecure older adults who have a particularly higher burden of chronic diseases and direct future research, program, and policy decisions to improve the food and healthcare security of low-income, older adults. PMID:23319122

  19. Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

    Directory of Open Access Journals (Sweden)

    Simone Parola

    2017-10-01

    Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

  20. The effect of major income sources on rural household food (in)security: Evidence from Swaziland and implications for policy.

    Science.gov (United States)

    Mabuza, Majola L; Ortmann, Gerald F; Wale, Edilegnaw; Mutenje, Munyaradzi J

    2016-01-01

    The aim of this article was to investigate the food (in)security effect of household income generated from major economic activities in rural Swaziland. From a sample of 979 households, the results of a multinomial treatment regression model indicated that gender of household head, labor endowment, education, size of arable land, and location significantly influenced the households' choice of primary economic activity. Further results suggested that off-farm-income-dependent households were less likely to be food insecure when compared with on-farm-income-dependent households. However, on-farm-income-dependent households had a better food security status than their counterparts who depended on remittances and nonfarm economic activities.

  1. Food preparation methods, drinking water source, and esophageal squamous cell carcinoma in the high-risk area of Golestan, Northeast Iran.

    Science.gov (United States)

    Golozar, Asieh; Etemadi, Arash; Kamangar, Farin; Fazeltabar Malekshah, Akbar; Islami, Farhad; Nasrollahzadeh, Dariush; Abedi-Ardekani, Behnoosh; Khoshnia, Masoud; Pourshams, Akram; Semnani, Shahriar; Marjani, Haji Amin; Shakeri, Ramin; Sotoudeh, Masoud; Brennan, Paul; Taylor, Philip; Boffetta, Paolo; Abnet, Christian; Dawsey, Sanford; Malekzadeh, Reza

    2016-03-01

    Cooking practices and water sources have been associated with an increased risk of cancer, mainly through exposure to carcinogens such as heterocyclic amines, polycyclic aromatic hydrocarbons, and nitrates. Using data from the Golestan case-control study, carried out between 2003 and 2007 in a high-risk region for esophageal squamous cell carcinoma (ESCC), we sought to investigate the association between food preparation and drinking water sources and ESCC. Information on food preparation methods, sources of drinking water, and dietary habits was gathered from 300 cases and 571 controls matched individually for age, sex, and neighborhood using a structured questionnaire and a semiquantitative food frequency questionnaire. Multivariate conditional logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CI) adjusted for potential confounders and other known risk factors including socioeconomic status and smoking. More than 95% of the participants reported eating meat, mostly red meat. Red meat consumption above the 75th percentile increased the odds of ESCC by 2.82-fold (95% CI: 1.21-6.57). Fish intake was associated with a significant 68% decrease in ESCC odds (26%, 86%). Among meat eaters, ORs (95% CI) for frying meat (red or white) and fish were 3.34 (1.32-8.45) and 2.62 (1.24-5.5). Drinking unpiped water increased ESCC odds by 4.25 times (2.23-8.11). The OR for each 10-year increase in the duration of drinking unpiped water was 1.47 (1.22-1.78). Our results suggest roles for red meat intake, drinking water source, and food preparation methods in ESCC, even after adjusting for a large number of potential confounders.

  2. [Influence of 175-m-impoundment in Three Gorges Reservoir area on the food web energy sources of main commercial fishes in backwater area of xiaojiang River].

    Science.gov (United States)

    Li, Bin; Wang, Zhi-Jian; Yue, Xing-Jian; Wang, Yong-Ming; Jin, Li; Zhang, Yao-Guang

    2013-06-01

    The impoundment in the Three Gorges Reservoir Area (TGRA) was first reached 175 m in 2010. To approach the influence of this impoundment on the food web energy sources of fishes in the tributaries of TRGA, an analysis was made on the food web energy sources of seven economically important fishes (Carassius auratus, Cyprinus carpio, Silurus asotus, Culter mongolicus mongolicus, Mystus macropterus, Pelteobagrus vachelli, and Pelteobagrus nitidus) in the backwater area of Xiaojiang River by using stable isotope method in combining with IsoSource Model. The results showed that before this impoundment (July 2010), microalgae were the main energy sources for the seven species. After this impoundment (December 2010), the contribution ratio of the microalgae decreased somewhat, while the relative contribution of terrestrial C4 plants had an obvious increase. Especially for crucian carp (C. auratus) and catfish (S. asotus), the contribution rate of the C4 plants reached 38-54% and 32-50%, respectively. After the impoundment, at least 30% of the energy resources of these two fishes were come from terrestrial C4 plants, suggesting that the impoundment in TGRA increased the contribution rate of exogenous terrestrial C4 plants as the energy sources of fishes.

  3. Invasive mussels alter the littoral food web of a large lake: stable isotopes reveal drastic shifts in sources and flow of energy.

    Directory of Open Access Journals (Sweden)

    Ted Ozersky

    Full Text Available We investigated how establishment of invasive dreissenid mussels impacted the structure and energy sources of the littoral benthic food web of a large temperate lake. We combined information about pre- and postdreissenid abundance, biomass, and secondary production of the littoral benthos with results of carbon and nitrogen stable isotope analysis of archival (predreissenid and recent (postdreissenid samples of all common benthic taxa. This approach enabled us to determine the importance of benthic and sestonic carbon to the littoral food web before, and more than a decade after dreissenid establishment. Long term dreissenid presence was associated with a 32-fold increase in abundance, 6-fold increase in biomass, and 14-fold increase in secondary production of the littoral benthos. Dreissenids comprised a large portion of the post-invasion benthos, making up 13, 38, and 56% of total abundance, biomass, and secondary production, respectively. The predreissenid food web was supported primarily by benthic primary production, while sestonic material was relatively more important to the postdreissenid food web. The absolute importance of both sestonic material and benthic primary production to the littoral benthos increased considerably following dreissenid establishment. Our results show drastic alterations to food web structure and suggest that dreissenid mussels redirect energy and material from the water column to the littoral benthos both through biodeposition of sestonic material as well as stimulation of benthic primary production.

  4. Healthier Traditional Food

    OpenAIRE

    Edward F. Millen

    2017-01-01

    The study of traditional food and healthy eating habits has been one of the fast growing areas. All humans, both men and women, require food for their survival. However, both men and women indulge in food as if it were their sole purpose of existence. Hence, eating disorders are common among men and women. Then media has played an effective role not only in establishing faulty standards for traditional healthy food but also it has highlighted the importance of healthy eating. It has brought t...

  5. Food sources of free sugars in children's diet and identification of lifestyle patterns associated with free sugars intake: the GRECO (Greek Childhood Obesity) study.

    Science.gov (United States)

    Farajian, Paul; Risvas, Grigoris; Panagiotakos, Demosthenes B; Zampelas, Antonis

    2016-09-01

    Excessive free sugars consumption has a possible role in health issues, diet quality and obesity development. The present cross-sectional study aimed to identify the major food sources of free sugars in Greek children's diet and investigate possible associations of dietary patterns with free sugars intake. Anthropometric measurements and information on dietary and physical activity habits were obtained. Energy and free sugars intake coming from foods were estimated and principal components analysis was applied to identify dietary patterns. The GRECO (Greek Childhood Obesity) study. Nationwide sample of 3089 children (aged 10-12 years). Adopting WHO criteria, 44·2 % of participants were categorized as having free sugars intake above 10 % of total energy intake. Mean contribution of free sugars to energy intake was 11·2 %, and the major food sources of free sugars differed from those of other childhood populations. Free sugars intake was not associated with overweight/obesity. Multiple linear regression analysis revealed that two lifestyle and dietary patterns, characterized by higher consumption of sweets, fast foods, fries, sugared drinks, frequently ordering/eating outside home and having meals in front of a screen (pattern 1) and higher consumption of whole fruits, 100 % fruit juices, vegetables, legumes and honey/jam (pattern 2), were positively associated with free sugars intake. A large proportion of children exceeded the recommended cut-off and free sugars intake was associated with lifestyle patterns rather than single foods. Public health programmes aiming to reduce free sugars consumption should be tailored on promoting the correct dietary habits of specific childhood populations.

  6. The concentration, source and potential human health risk of heavy metals in the commonly consumed foods in Bangladesh.

    Science.gov (United States)

    Islam, Md Saiful; Ahmed, Md Kawser; Habibullah-Al-Mamun, Md; Raknuzzaman, Mohammad

    2015-12-01

    Seven food items, namely, meat, egg, fish, milk, vegetables, cereals and fruits were collected from Bogra district, Bangladesh to evaluate the levels of heavy metal and associated health risk to the adults and children. The samples were analyzed for the quantification of selected heavy metals (Cr, Ni, Cu, As, Cd and Pb) on inductively coupled plasma mass spectrometer followed by acid digestion. In general, the highest concentrations of the studied metals were detected in vegetables, cereals, and fruits. The range of Cr, Ni, Cu, As, Cd, and Pb in the foods were 0.058-10, 0.036-25, 0.045-40, 0.005-7.1, 0.001-5.5 and 0.005-13 mg/kg fw, respectively. Multivariate principal component analysis (PCA) revealed three major groups of the studied metals and showed significant anthropogenic contributions of the Ni, Cu, and As in foods. Health risk assessment was evaluated in terms of target hazard quotient and target carcinogenic risk (TR) which showed that the intake of some metals through foods were higher than the recommended values, consequently consumption of the foods may be associated with non-carcinogenic health risks. Nonetheless, elevated levels of As and Pb were also found to be associated with lifetime carcinogenic risk to the consumers. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Urban-Rural Disparities in Energy Intake and Contribution of Fat and Animal Source Foods in Chinese Children Aged 4-17 Years.

    Science.gov (United States)

    Zhang, Ji; Wang, Dantong; Eldridge, Alison L; Huang, Feifei; Ouyang, Yifei; Wang, Huijun; Zhang, Bing

    2017-05-21

    Excessive energy intake and poor food choices are major health concerns associated with overweight and obesity risk. This study aims to explore disparities in energy intake and the contributions from fat and animal source foods among Chinese school-aged children and adolescents in different communities based on urbanization levels. Three consecutive 24 h recalls were used to assess dietary intake. Subjects' height and weight were measured using standard equipment. Standardized questionnaires were used to collect household demographic and socioeconomic characteristics by trained interviewers. The 2011 China Health and Nutrition Survey is part of an ongoing longitudinal household survey across 228 communities in nine provinces and three mega-cities in China. Subjects consisted of children aged 4-17 years ( n = 1866; 968 boys and 898 girls). The estimated average energy intake was 1604 kcal/day (1706 kcal/day for boys and 1493 kcal/day for girls). Proportions of energy from fat and animal source foods were 36.8% and 19.8% respectively and did not differ by gender. Total energy intake showed no significant disparity, but the proportion of energy from fat and animal source foods increased with increasing urbanization levels and increasing household income level. The largest difference in consumption percentages between children in rural areas and those in highly urban areas was for milk and dairy products (14.8% versus 74.4%) and the smallest difference was seen in percent consuming meat and meat products (83.1% versus 97.1%). Results of this study highlight the need for developing and implementing community-specific strategies to improve Chinese children's diet quality.

  8. A NEW 3D DESIGN METHOD FOR FOOTWEAR SOLES USING DELCAM PowerSHAPE-e SYSTEM

    Directory of Open Access Journals (Sweden)

    IONESCU Cozmin

    2016-05-01

    Full Text Available Design methods of soles and soles injection moulds must be accurate, timely and at the same time, accessible to a wide category of soles and injection moulds designers and manufacturers. For designing soles and injection moulds for soles, various dedicated CAD/CAM systems have been developed, such as: Delcam Shoe Solution (3D, Delcam PowerSHAPE-e (2D and 3D, Padsy II (2D and Padsy III (3D, Shoemaster System (2D and 3D, Lectra System (2D and 3D, Parmel System (2D and ATOS II System (3D. These systems are equipped with colour displays, plotters, digitizers, terminals and other equipment dedicated for computer aided design activities. Designing 3D soles models using computer systems enables the prevention of ambiguities inherited from 2D drawings, thus reducing errors and remanufacturing. Depending on the design complexity of soles, the technical means available for copying shoe soles and the technologies at the disposal of the soles manufacturers, soles and injection moulds designers adopt various design methods. Not all CAD/CAM systems are accessible for all users, because often their purchasing costs are high. Design method developed and presented in this paper, uses Delcam PowerSHAPE software program, which has the advantage that it can be accessed free of charge from the manufacturer's website. At the same time, this software program provides the user with all the necessary tools and instruments needed to design the most complex injection moulds and footwear sole.

  9. Protein as a sole source of nitrogen for in vitro grown tobacco plantlets

    Czech Academy of Sciences Publication Activity Database

    Synková, Helena; Hýsková, V.; Garčeková, K.; Křížová, S.; Ryšlavá, H.

    2016-01-01

    Roč. 60, č. 4 (2016), s. 635-644 ISSN 0006-3134 Institutional support: RVO:61389030 Keywords : glutamate-dehydrogenase * inorganic nitrogen * nitrate transport * organic nitrogen * amino-acids * metabolism * seedlings * leaves * roots * assimilation * ammonium * casein * chlorophyll fluorescence * nitrate * photosynthesis Subject RIV: EF - Botanics Impact factor: 1.551, year: 2016

  10. 78 FR 60875 - Assistant Secretary for Preparedness and Response; Notification of a Sole Source Cooperative...

    Science.gov (United States)

    2013-10-02

    ..., bridges, housing stock, commercial structures, etc) and/or business and commercial recovery.\\i\\ Oftentimes absent from consideration is the critical importance of health, and the public health, medical and social... development. Ecology and Society 13(1): 9. [online] URL: http://www.ecologyandsociety.org/vol13/iss1/art9...

  11. 78 FR 54652 - Sole Source Cooperative Agreement Award to the Association for State and Territorial Health...

    Science.gov (United States)

    2013-09-05

    ... coordinate their respective national health security roles and responsibilities to achieve community health... and territorial health officials, which play a critical role in building community health resilience... resilience. SHDs and territorial health officials are intimately familiar with the communities and...

  12. Focusing on fast food restaurants alone underestimates the relationship between neighborhood deprivation and exposure to fast food in a large rural area

    Directory of Open Access Journals (Sweden)

    Dean Wesley R

    2011-01-01

    Full Text Available Abstract Background Individuals and families are relying more on food prepared outside the home as a source for at-home and away-from-home consumption. Restricting the estimation of fast-food access to fast-food restaurants alone may underestimate potential spatial access to fast food. Methods The study used data from the 2006 Brazos Valley Food Environment Project (BVFEP and the 2000 U.S. Census Summary File 3 for six rural counties in the Texas Brazos Valley region. BVFEP ground-truthed data included identification and geocoding of all fast-food restaurants, convenience stores, supermarkets, and grocery stores in study area and on-site assessment of the availability and variety of fast-food lunch/dinner entrées and side dishes. Network distance was calculated from the population-weighted centroid of each census block group to all retail locations that marketed fast food (n = 205 fast-food opportunities. Results Spatial access to fast-food opportunities (FFO was significantly better than to traditional fast-food restaurants (FFR. The median distance to the nearest FFO was 2.7 miles, compared with 4.5 miles to the nearest FFR. Residents of high deprivation neighborhoods had better spatial access to a variety of healthier fast-food entrée and side dish options than residents of low deprivation neighborhoods. Conclusions Our analyses revealed that identifying fast-food restaurants as the sole source of fast-food entrées and side dishes underestimated neighborhood exposure to fast food, in terms of both neighborhood proximity and coverage. Potential interventions must consider all retail opportunities for fast food, and not just traditional FFR.

  13. Focusing on fast food restaurants alone underestimates the relationship between neighborhood deprivation and exposure to fast food in a large rural area.

    Science.gov (United States)

    Sharkey, Joseph R; Johnson, Cassandra M; Dean, Wesley R; Horel, Scott A

    2011-01-25

    Individuals and families are relying more on food prepared outside the home as a source for at-home and away-from-home consumption. Restricting the estimation of fast-food access to fast-food restaurants alone may underestimate potential spatial access to fast food. The study used data from the 2006 Brazos Valley Food Environment Project (BVFEP) and the 2000 U.S. Census Summary File 3 for six rural counties in the Texas Brazos Valley region. BVFEP ground-truthed data included identification and geocoding of all fast-food restaurants, convenience stores, supermarkets, and grocery stores in study area and on-site assessment of the availability and variety of fast-food lunch/dinner entrées and side dishes. Network distance was calculated from the population-weighted centroid of each census block group to all retail locations that marketed fast food (n = 205 fast-food opportunities). Spatial access to fast-food opportunities (FFO) was significantly better than to traditional fast-food restaurants (FFR). The median distance to the nearest FFO was 2.7 miles, compared with 4.5 miles to the nearest FFR. Residents of high deprivation neighborhoods had better spatial access to a variety of healthier fast-food entrée and side dish options than residents of low deprivation neighborhoods. Our analyses revealed that identifying fast-food restaurants as the sole source of fast-food entrées and side dishes underestimated neighborhood exposure to fast food, in terms of both neighborhood proximity and coverage. Potential interventions must consider all retail opportunities for fast food, and not just traditional FFR.

  14. Oil-in-oil emulsions stabilised solely by solid particles.

    Science.gov (United States)

    Binks, Bernard P; Tyowua, Andrew T

    2016-01-21

    A brief review of the stabilisation of emulsions of two immiscible oils is given. We then describe the use of fumed silica particles coated with either hydrocarbon or fluorocarbon groups in acting as sole stabilisers of emulsions of various vegetable oils with linear silicone oils (PDMS) of different viscosity. Transitional phase inversion of emulsions, containing equal volumes of the two oils, from silicone-in-vegetable (S/V) to vegetable-in-silicone (V/S) occurs upon increasing the hydrophobicity of the particles. Close to inversion, emulsions are stable to coalescence and gravity-induced separation for at least one year. Increasing the viscosity of the silicone oil enables stable S/V emulsions to be prepared even with relatively hydrophilic particles. Predictions of emulsion type from calculated contact angles of a silica particle at the oil-oil interface are in agreement with experiment provided a small polar contribution to the surface energy of the oils is included. We also show that stable multiple emulsions of V/S/V can be prepared in a two-step procedure using two particle types of different hydrophobicity. At fixed particle concentration, catastrophic phase inversion of emulsions from V/S to S/V can be effected by increasing the volume fraction of vegetable oil. Finally, in the case of sunflower oil + 20 cS PDMS, the study is extended to particles other than silica which differ in chemical type, particle size and particle shape. Consistent with the above findings, we find that only sufficiently hydrophobic particles (clay, zinc oxide, silicone, calcium carbonate) can act as efficient V/S emulsion stabilisers.

  15. Associations between Sugar Intake from Different Food Sources and Adiposity or Cardio-Metabolic Risk in Childhood and Adolescence: The Korean Child-Adolescent Cohort Study.

    Science.gov (United States)

    Hur, Yang-Im; Park, Hyesook; Kang, Jae-Heon; Lee, Hye-Ah; Song, Hong Ji; Lee, Hae-Jeung; Kim, Ok-Hyun

    2015-12-31

    The increasing prevalence of childhood obesity is a serious public health problem associated with co-morbidities in adulthood, as well as childhood. This study was conducted to identify associations between total sugar intake and sugar intake from different foods (fruit, milk, and sugar-sweetened beverages (SSBs)), and adiposity and continuous metabolic syndrome scores (cMetS) among Korean children and adolescents using cohort data. The study subjects were children (n = 770) who participated in the 4th year (2008) of the Korean Child-Adolescent Cohort Study (KoCAS). Dietary intake data were collected via three-day 24-h food records, and sugar intake was calculated for the total sugar content of foods using our database compiled from various sources. Anthropometric measurements, assessments of body composition, and blood sample analysis were performed at baseline and at follow-up four years later. The cMetS was calculated based on waist circumference, triglycerides, high-density lipoprotein cholesterol, glucose, and mean arterial blood pressure. According to multiple linear regression analysis, there were no significant associations between total sugar intake and adiposity and cMetS. However, higher intake of fruit sugar at baseline was significantly associated with lower body mass index (BMI) z-scores and body fat percentages at baseline (β = -0.10, p = 0.02 and β = -0.78, p target particular food groups. Consequently, this information could be of value to obesity- and metabolic disease-prevention strategies.

  16. Serum hepcidin is significantly associated with iron absorption from food and supplemental sources in healthy young woman

    Science.gov (United States)

    Hepcidin is a key regulator of iron homeostasis, but to date no studies have examined the effect of hepcidin on iron absorption in humans. Our objective was to assess relations between both serum hepcidin and serum prohepcidin with nonheme-iron absorption in the presence and absence of food with the...

  17. The Importance of Source: A Mixed Methods Analysis of Undergraduate Students' Attitudes toward Genetically Modified Food

    Science.gov (United States)

    Ruth, Taylor K.; Rumble, Joy N.; Gay, Keegan D.; Rodriguez, Mary T.

    2016-01-01

    Even though science says genetically modified (GM) foods are safe, many consumers remain skeptical of the technology. Additionally, the scientific community has trouble communicating to the public, causing consumers to make uninformed decisions. The Millennial Generation will have more buying power than any other generation before them, and more…

  18. Chemical composition, true nutrient digestibility, and true metabolizable energy of novel pet food protein sources using the precision-fed cecectomized rooster assay.

    Science.gov (United States)

    Deng, P; Utterback, P L; Parsons, C M; Hancock, L; Swanson, K S

    2016-08-01

    A wide variety of animal protein-based ingredients is commonly used in the pet food products. The raw ingredients and processing procedures used may greatly affect protein quality. Testing the quality of alternative protein sources is necessary and contributes to the sustainability of pet foods. The objective of this study was to test the chemical composition of 8 protein sources intended for use in dog and cat foods (calamari meal, pork peptone, alligator meal, lamb meal, venison meal, chicken meal, and 2 duck meals), and evaluate their true nutrient digestibility and nitrogen-corrected true ME (TMEn) using the precision-fed cecectomized rooster assay. Calamari meal and pork peptone had lower ash (4.4 and 3.6% of DM, respectively) but greater CP (88.1 and 80.5% of DM, respectively) and either greater or similar GE (5.6 and 5.3 kcal/g of DM, respectively) compared with alligator, lamb, venison, chicken, and duck meals (11.8 to 24.5% ash, 58.7 to 65.9% CP, and 4.6 to 5.3 kcal GE/g). Acid-hydrolyzed fat (AHF) was lower in calamari meal (8.7% of DM) compared with the other proteins tested (15.5-22.1% of DM). True nutrient digestibility was variable among the protein sources (52 to 79% of DM, 60 to 83% of OM, 78 to 92% of AHF, and 70 to 89% of GE) with pork peptone having the highest DM, AHF, and GE digestibility and calamari meal having the highest OM digestibility. True indispensable AA digestibility was highest for calamari meal, with all AA having a digestibility greater than 90%. Except for histidine, all indispensable AA had a digestibility over 85% for pork peptone. In contrast, true indispensable AA digestibility was lowest for lamb meal, with histidine having digestibility less than 70% and the other entire indispensable AA having digestibility between 72 and 88%. The TMEn of calamari meal (4.82 kcal/g DM and 86.9% of GE) was greater ( digestibility among protein sources intended for use in dog and cat foods and justifies further in vivo testing of novel

  19. Association between folate intake from different food sources in Norway and homocysteine status in a dietary intervention among young male adults.

    Science.gov (United States)

    Stea, Tonje Holte; Uglem, Solveig; Wandel, Margareta; Mansoor, Mohammad Azam; Frølich, Wenche

    2009-09-01

    The aim of the present investigation was to study the effect of a dietary intervention which combined nutrition information with increased availability of vegetables, fruits and wholegrain bread. The effect of the intervention was determined by changes in the intake of vegetables, fruits, wholegrain bread and estimated nutrients. Furthermore, the study investigated whether changes in relative contribution from different food sources of folate were related to changes in the concentration of plasma total homocysteine (p-tHcy). The 5-month intervention study included 376 male recruits from the Norwegian National Guard, Vaernes (intervention group) and 105 male recruits from the Norwegian National Guard, Heggelia (control group). The study resulted in an increase in the total consumption of vegetables, fruits, berries and juice (P food components. Reduction in the concentration of p-tHcy was significantly related to an increased folate intake due to an increased consumption of wholegrain bread.

  20. Alternative food sources and over wintering feeding behavior of the boll weevil, Anthonomus grandis boheman (coleoptera: curculionidae) under the tropical conditions of central Brazil

    International Nuclear Information System (INIS)

    Ribeiro, Paulina de A.; Sujii, Edison R.; Pires, Carmen S.S.; Fontes, Eliana M.G.; Diniz, Ivone R.; Salgado-Labouriau, Maria L.

    2010-01-01

    The boll weevil causes serious damage to the cotton crop in South America. Several studies have been published on this pest, but its phenology and behavior under the tropical conditions prevailing in Brazil are not well-known. In this study the feeding behavior and main food sources of adult boll weevils throughout the year in Central Brazil was investigated. The digestive tract contents of insects captured in pheromone traps in two cotton fields and two areas of native vegetation (gallery forest and cerrado sensu stricto) were analyzed. The insect was captured all through the year only in the cerrado. It fed on pollen of 19 different plant families, on Pteridophyta and fungi spores and algae cysts. Simpson Index test showed that the cerrado provided greater diversity of pollen sources. In the beginning of the cotton cycle, the plant families used for pollen feeding were varied: in cotton area 1, the weevil fed on Poaceae (50%), Malvaceae and Smilacaceae (25% each); in cotton area 2 the pollen sources were Malvaceae (50%), Asteraceae (25%) and Fabaceae and Clusiaceae (25% each); in the cerrado they were Chenopodiaceae (67%) and Scheuchzeriaceae (33%). No weevils were collected in the gallery forest in this period. After cotton was harvested, the family Smilacaceae was predominant among the food plants exploited in all the study areas. These results help to explain the survivorship of adult boll weevil during cotton fallow season in Central Brazil and they are discussed in the context of behavioral adaptations to the prevailing tropical environmental conditions. (author)

  1. Alternative food sources and over wintering feeding behavior of the boll weevil, Anthonomus grandis boheman (coleoptera: curculionidae) under the tropical conditions of central Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Paulina de A.; Sujii, Edison R.; Pires, Carmen S.S.; Fontes, Eliana M.G. [EMBRAPA Recursos Geneticos e Biotecnologia (CENARGEN), Brasilia, DF (Brazil)], e-mail: paulina723@hotmail.com, e-mail: sujii@cenargen.embrapa.br, e-mail: cpires@cenargen.embrapa.br, e-mail: eliana@cenargen.embrapa.br; Diniz, Ivone R. [Universidade de Brasilia (UnB), DF (Brazil). Dept. de Zoologia], e-mail: irdiniz@unb.br; Medeiros, Maria A. de; Branco, Marina C. [EMBRAPA Hortalicas, Brasilia, DF (Brazil)], e-mail: medeiros@cnph.embrapa.br, e-mail: marina@cnph.embrapa.br; Salgado-Labouriau, Maria L. [Universidade de Brasilia (UnB), DF (Brazil). Dept. de Geologia], e-mail: mlea@unb.br

    2010-01-15

    The boll weevil causes serious damage to the cotton crop in South America. Several studies have been published on this pest, but its phenology and behavior under the tropical conditions prevailing in Brazil are not well-known. In this study the feeding behavior and main food sources of adult boll weevils throughout the year in Central Brazil was investigated. The digestive tract contents of insects captured in pheromone traps in two cotton fields and two areas of native vegetation (gallery forest and cerrado sensu stricto) were analyzed. The insect was captured all through the year only in the cerrado. It fed on pollen of 19 different plant families, on Pteridophyta and fungi spores and algae cysts. Simpson Index test showed that the cerrado provided greater diversity of pollen sources. In the beginning of the cotton cycle, the plant families used for pollen feeding were varied: in cotton area 1, the weevil fed on Poaceae (50%), Malvaceae and Smilacaceae (25% each); in cotton area 2 the pollen sources were Malvaceae (50%), Asteraceae (25%) and Fabaceae and Clusiaceae (25% each); in the cerrado they were Chenopodiaceae (67%) and Scheuchzeriaceae (33%). No weevils were collected in the gallery forest in this period. After cotton was harvested, the family Smilacaceae was predominant among the food plants exploited in all the study areas. These results help to explain the survivorship of adult boll weevil during cotton fallow season in Central Brazil and they are discussed in the context of behavioral adaptations to the prevailing tropical environmental conditions. (author)

  2. Alternative food sources and overwintering feeding behavior of the boll weevil, Anthonomus grandis boheman (Coleoptera: Curculionidae) under the tropical conditions of Central Brazil.

    Science.gov (United States)

    Ribeiro, Paulina de A; Sujii, Edison R; Diniz, Ivone R; Medeiros, Maria A de; Salgado-Labouriau, Maria L; Branco, Marina C; Pires, Carmen S S; Fontes, Eliana M G

    2010-01-01

    The boll weevil causes serious damage to the cotton crop in South America. Several studies have been published on this pest, but its phenology and behavior under the tropical conditions prevailing in Brazil are not well-known. In this study the feeding behavior and main food sources of adult boll weevils throughout the year in Central Brazil was investigated. The digestive tract contents of insects captured in pheromone traps in two cotton fields and two areas of native vegetation (gallery forest and cerrado sensu stricto) were analyzed. The insect was captured all through the year only in the cerrado. It fed on pollen of 19 different plant families, on Pteridophyta and fungi spores and algae cysts. Simpson Index test showed that the cerrado provided greater diversity of pollen sources. In the beginning of the cotton cycle, the plant families used for pollen feeding were varied: in cotton area 1, the weevil fed on Poaceae(50%), Malvaceae and Smilacaceae (25% each); in cotton area 2 the pollen sources were Malvaceae (50%), Asteraceae (25%) and Fabaceae and Clusiaceae (25% each); in the cerrado they were Chenopodiaceae (67%) and Scheuchzeriaceae (33%). No weevils were collected in the gallery forest in this period. After cotton was harvested, the family Smilacaceae was predominant among the food plants exploited in all the study areas. These results help to explain the survivorship of adult boll weevil during cotton fallow season in Central Brazil and they are discussed in the context of behavioral adaptations to the prevailing tropical environmental conditions.

  3. Intake and Dietary Food Sources of Fibre in Spain: Differences with Regard to the Prevalence of Excess Body Weight and Abdominal Obesity in Adults of the ANIBES Study

    Science.gov (United States)

    González-Rodríguez, Liliana G.; Perea Sánchez, José Miguel; Aranceta-Bartrina, Javier; Gil, Ángel; González-Gross, Marcela; Serra-Majem, Lluis; Varela-Moreiras, Gregorio; Ortega, Rosa M.

    2017-01-01

    The aim was to study the intake and food sources of fibre in a representative sample of Spanish adults and to analyse its association with excess body weight and abdominal obesity. A sample of 1655 adults (18–64 years) from the ANIBES (“Anthropometric data, macronutrients and micronutrients intake, practice of physical activity, socioeconomic data and lifestyles”) cross-sectional study was analysed. Fibre intake and dietary food sources were determined by using a three-day dietary record. Misreporters were identified using the protocol of the European Food Safety Authority. Mean (standard deviation) fibre intake was 12.59 (5.66) g/day in the whole sample and 15.88 (6.29) g/day in the plausible reporters. Mean fibre intake, both in the whole sample and the plausible reporters, was below the adequate intake established by European Food Safety Authority (EFSA) and the Institute of Medicine of the United States (IOM). Main fibre dietary food sources were grains, followed by vegetables, fruits, and pulses. In the whole sample, considering sex, and after adjusting for age and physical activity, mean (standard error) fibre intake (adjusted by energy intake) was higher in subjects who had normal weight (NW) 13.40 (0.184) g/day, without abdominal obesity 13.56 (0.192) g/day or without excess body weight and/or abdominal obesity 13.56 (0.207) g/day compared to those who were overweight (OW) 12.31 (0.195) g/day, p obese (OB) 11.83 (0.266) g/day, p obesity 12.09 (0.157) g/day, p obesity 12.22 (0.148) g/day, p obesity or excess body weight and/or abdominal obesity in the plausible reporters. Fibre from afternoon snacks was higher in subjects with NW (6.92%) and without abdominal obesity (6.97%) or without excess body weight and/or abdominal obesity (7.20%), than those with OW (5.30%), p obesity (5.18%), p obesity (5.21%), p obesity only when the whole sample was considered. PMID:28346353

  4. Intake and Dietary Food Sources of Fibre in Spain: Differences with Regard to the Prevalence of Excess Body Weight and Abdominal Obesity in Adults of the ANIBES Study.

    Science.gov (United States)

    González-Rodríguez, Liliana G; Perea Sánchez, José Miguel; Aranceta-Bartrina, Javier; Gil, Ángel; González-Gross, Marcela; Serra-Majem, Lluis; Varela-Moreiras, Gregorio; Ortega, Rosa M

    2017-03-25

    The aim was to study the intake and food sources of fibre in a representative sample of Spanish adults and to analyse its association with excess body weight and abdominal obesity. A sample of 1655 adults (18-64 years) from the ANIBES ("Anthropometric data, macronutrients and micronutrients intake, practice of physical activity, socioeconomic data and lifestyles") cross-sectional study was analysed. Fibre intake and dietary food sources were determined by using a three-day dietary record. Misreporters were identified using the protocol of the European Food Safety Authority. Mean (standard deviation) fibre intake was 12.59 (5.66) g/day in the whole sample and 15.88 (6.29) g/day in the plausible reporters. Mean fibre intake, both in the whole sample and the plausible reporters, was below the adequate intake established by European Food Safety Authority (EFSA) and the Institute of Medicine of the United States (IOM). Main fibre dietary food sources were grains, followed by vegetables, fruits, and pulses. In the whole sample, considering sex, and after adjusting for age and physical activity, mean (standard error) fibre intake (adjusted by energy intake) was higher in subjects who had normal weight (NW) 13.40 (0.184) g/day, without abdominal obesity 13.56 (0.192) g/day or without excess body weight and/or abdominal obesity 13.56 (0.207) g/day compared to those who were overweight (OW) 12.31 (0.195) g/day, p obese (OB) 11.83 (0.266) g/day, p obesity 12.09 (0.157) g/day, p obesity 12.22 (0.148) g/day, p obesity or excess body weight and/or abdominal obesity in the plausible reporters. Fibre from afternoon snacks was higher in subjects with NW (6.92%) and without abdominal obesity (6.97%) or without excess body weight and/or abdominal obesity (7.20%), than those with OW (5.30%), p obesity (5.18%), p obesity (5.21%), p association with excess body weight and abdominal obesity only when the whole sample was considered.

  5. Nutrient intakes, major food sources and dietary inadequacies of Inuit adults living in three remote communities in Nunavut, Canada.

    Science.gov (United States)

    Sharma, S; Hopping, B N; Roache, C; Sheehy, T

    2013-12-01

    Inuit in Nunavut, Canada, are currently undergoing a nutritional transition that may contribute to an increased prevalence of chronic disease. Information is lacking about the extent to which contemporary Inuit diets are meeting current dietary recommendations. A culturally appropriate quantitative food frequency questionnaire (QFFQ) developed and validated for Inuit in Nunavut, Canada, was used to assess food and nutrient intake in a cross-sectional sample of adults. Participants included 175 women and 36 men with mean (SD) ages of 42.4 (13.2) and 42.1 (15.0) years, respectively. The response rate for those who completed the study was 79% with 208 QFFQs included for analysis. Reported mean daily energy intakes were: men 15,171 kJ (3626 kcal); women 11,593 kJ (2771 kcal). Dietary inadequacy was expressed as the percentage of participants reporting intakes below the sex- and age-specific estimated average requirements (EARs). For nutrients without EARs, adequate intakes were used. Energy and sodium intakes exceeded the recommendations. Less than 10% of participants met recommendations for dietary fibre intake. Vitamin E intakes were below EARs for ≥97% of participants, whereas >20% reported inadequate vitamin A, folate and magnesium intakes. Among women, >50% reported inadequate calcium and vitamin D intakes. Non-nutrient-dense foods contributed 30% of energy, 73% of sugars and 22% of fat. Traditional foods contributed 56% of protein and 49% of iron. The present study demonstrates a relatively high prevalence of inadequate nutrient intakes among Inuit. The results may be used to monitor the nutrition transition among Inuit, evaluate nutritional interventions, and inform public health policy decision-making. © 2013 The Authors Journal of Human Nutrition and Dietetics © 2013 The British Dietetic Association Ltd.

  6. Dietary intake and main food sources of vitamin D as a function of age, sex, vitamin D status, body composition, and income in an elderly German cohort

    Directory of Open Access Journals (Sweden)

    Alexandra Jungert

    2014-09-01

    Full Text Available Background: Elderly subjects are at risk of insufficient vitamin D status mainly because of diminished capacity for cutaneous vitamin D synthesis. In cases of insufficient endogenous production, vitamin D status depends on vitamin D intake. Objective: The purpose of this study is to identify the main food sources of vitamin D in elderly subjects and to analyse whether contributing food sources differ by sex, age, vitamin D status, body mass index (BMI, or household income. In addition, we analysed the factors that influence dietary vitamin D intake in the elderly. Design and subjects: This is a cross-sectional study in 235 independently living German elderly aged 66–96 years (BMI=27±4 kg/m2. Vitamin D intake was assessed by a 3-day estimated dietary record. Results: The main sources of dietary vitamin D were fish/fish products followed by eggs, fats/oils, bread/bakery products, and milk/dairy products. Differences in contributing food groups by sex, age, vitamin D status, and BMI were not found. Fish contributed more to vitamin D intake in subjects with a household income of <1,500 €/month compared to subjects with higher income. In multiple regression analysis, fat intake and frequency of fish consumption were positive determinants of dietary vitamin D intake, whereas household income and percentage total body fat negatively affected vitamin D intake. Other parameters, including age, sex, physical activity, smoking, intake of energy, milk, eggs and alcohol, showed no significant association with vitamin D intake. Conclusion: Low habitual dietary vitamin D intake does not affect vitamin D status in summer, and fish is the major contributor to vitamin D intake independent of sex, age, vitamin D status, BMI, and the income of subjects.

  7. Food sources of total omega 6 fatty acids (18:2 + 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

    Science.gov (United States)

    Food sources of total omega 6 fatty acids (18:2 + 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

  8. Food sources of alpha-linolenic acid (PFA 18:3), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

    Science.gov (United States)

    Food sources of alpha-linolenic acid (PFA 18:3), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

  9. Food sources of arachidonic acid (PFA 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

    Science.gov (United States)

    Food sources of arachidonic acid (PFA 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

  10. Ten-Year Trends in Fiber and Whole Grain Intakes and Food Sources for the United States Population: National Health and Nutrition Examination Survey 2001–2010

    Science.gov (United States)

    McGill, Carla R.; Fulgoni, Victor L.; Devareddy, Latha

    2015-01-01

    Current U.S. dietary guidance includes recommendations to increase intakes of both dietary fiber and whole grain (WG). This study examines fiber and WG intakes, food sources and trends from 2001 to 2010 based on National Health and Nutrition Examination Survey (NHANES) data for children/adolescents (n = 14,973) and adults (n = 24,809). Mean fiber intake for children/adolescents was 13.2 (±0.1) g/day. Mean fiber intake for adults 19–50 years (y) was 16.1 (±0.2) g/day and for adults 51+ was 16.1 (±0.2) g/day. There were significant increases in fiber intake from 2001–2010 for children/adolescents and for adults 51+ y. Mean WG intake for children/adolescents was 0.52 (±0.01) oz eq/day. Mean WG intake for adults 19–50 y was 0.61 (±0.02) oz eq/day and for adults 51+ 0.86 (±0.02) oz eq/day. There were no significant changes in WG intake for any age group from 2001–2010. The main food groups contributing to dietary fiber intake for children/adolescents were vegetables (16.6%), grain mixtures (16.3%), other foods (15.8%) and fruits (11.3%). For adults 19+ y, the main sources of dietary fiber were vegetables (22.6%), other foods (14.3%), grain mixtures (12.0%) and fruits (11.1%). Major WG sources for children/adolescents included ready-to-eat cereals (RTEC) (31%), yeast breads/rolls (21%) and crackers and salty grain snacks (21%). The main sources of WG for adults 19+ were yeast breads/rolls (27%), RTEC (23%) and pastas/cooked cereals/rice (21%). Recommending cereals, breads and grain mixtures with higher contents of both dietary fiber and WG, along with consumer education, could increase intakes among the United States (U.S.) population. PMID:25671414

  11. Ten-Year Trends in Fiber and Whole Grain Intakes and Food Sources for the United States Population: National Health and Nutrition Examination Survey 2001–2010

    Directory of Open Access Journals (Sweden)

    Carla R. McGill

    2015-02-01

    Full Text Available Current U.S. dietary guidance includes recommendations to increase intakes of both dietary fiber and whole grain (WG. This study examines fiber and WG intakes, food sources and trends from 2001 to 2010 based on National Health and Nutrition Examination Survey (NHANES data for children/adolescents (n = 14,973 and adults (n = 24,809. Mean fiber intake for children/adolescents was 13.2 (±0.1 g/day. Mean fiber intake for adults 19–50 years (y was 16.1 (±0.2 g/day and for adults 51+ was 16.1 (±0.2 g/day. There were significant increases in fiber intake from 2001–2010 for children/adolescents and for adults 51+ y. Mean WG intake for children/adolescents was 0.52 (±0.01 oz eq/day. Mean WG intake for adults 19–50 y was 0.61 (±0.02 oz eq/day and for adults 51+ 0.86 (±0.02 oz eq/day. There were no significant changes in WG intake for any age group from 2001–2010. The main food groups contributing to dietary fiber intake for children/adolescents were vegetables (16.6%, grain mixtures (16.3%, other foods (15.8% and fruits (11.3%. For adults 19+ y, the main sources of dietary fiber were vegetables (22.6%, other foods (14.3%, grain mixtures (12.0% and fruits (11.1%. Major WG sources for children/adolescents included ready-to-eat cereals (RTEC (31%, yeast breads/rolls (21% and crackers and salty grain snacks (21%. The main sources of WG for adults 19+ were yeast breads/rolls (27%, RTEC (23% and pastas/cooked cereals/rice (21%. Recommending cereals, breads and grain mixtures with higher contents of both dietary fiber and WG, along with consumer education, could increase intakes among the United States (U.S. population.

  12. Ten-year trends in fiber and whole grain intakes and food sources for the United States population: National Health and Nutrition Examination Survey 2001-2010.

    Science.gov (United States)

    McGill, Carla R; Fulgoni, Victor L; Devareddy, Latha

    2015-02-09

    Current U.S. dietary guidance includes recommendations to increase intakes of both dietary fiber and whole grain (WG). This study examines fiber and WG intakes, food sources and trends from 2001 to 2010 based on National Health and Nutrition Examination Survey (NHANES) data for children/adolescents (n=14,973) and adults (n=24,809). Mean fiber intake for children/adolescents was 13.2 (±0.1) g/day. Mean fiber intake for adults 19-50 years (y) was 16.1 (±0.2) g/day and for adults 51+ was 16.1 (±0.2) g/day. There were significant increases in fiber intake from 2001-2010 for children/adolescents and for adults 51+y. Mean WG intake for children/adolescents was 0.52 (±0.01) oz eq/day. Mean WG intake for adults 19-50 y was 0.61 (±0.02) oz eq/day and for adults 51+0.86 (±0.02) oz eq/day. There were no significant changes in WG intake for any age group from 2001-2010. The main food groups contributing to dietary fiber intake for children/adolescents were vegetables (16.6%), grain mixtures (16.3%), other foods (15.8%) and fruits (11.3%). For adults 19+y, the main sources of dietary fiber were vegetables (22.6%), other foods (14.3%), grain mixtures (12.0%) and fruits (11.1%). Major WG sources for children/adolescents included ready-to-eat cereals (RTEC) (31%), yeast breads/rolls (21%) and crackers and salty grain snacks (21%). The main sources of WG for adults 19+ were yeast breads/rolls (27%), RTEC (23%) and pastas/cooked cereals/rice (21%). Recommending cereals, breads and grain mixtures with higher contents of both dietary fiber and WG, along with consumer education, could increase intakes among the United States (U.S.) population.

  13. Food irradiation: contaminating our food

    International Nuclear Information System (INIS)

    Piccioni, R.

    1988-01-01

    The nuclear industry has promoted food irradiation as an effective and safe means of preserving food at minimum risk to the public. However, wide-scale food irradiation programmes such as that approved in the United States of America would have an adverse impact on public health in the following ways: through the consumption of carcinogenic substances generated in irradiated foods, through the use of irradiation to mask bacteriological contamination of spoiled food, through the replacement of fresh foods with nutritionally depleted foods, through accidents with leaks or mishandling of the radiation sources used and through the environmental damage resulting from reactor operation or spent fuel reprocessing necessary to produce the required isotopes for food irradiation. The food irradiation market is potentially enormous, requiring a large number of facilities and isotopes, some, such as caesium-137, would come from the production of nuclear weapons. Evidence of the presence of carcinogenic or mutagenic activity in irradiated foods is discussed. Although the US Federal Drug Administration (FDA) has approved a food irradiation programme it would actually be against the FDA's legal obligation which is to protect the health and safety of the American people. (UK)

  14. Effect of rocker-soled shoes on parameters of knee joint load in knee osteoarthritis.

    Science.gov (United States)

    Madden, Elizabeth G; Kean, Crystal O; Wrigley, Tim V; Bennell, Kim L; Hinman, Rana S

    2015-01-01

    This study evaluated the immediate effects of rocker-soled shoes on parameters of the knee adduction moment (KAM) and pain in individuals with knee osteoarthritis (OA). Three-dimensional gait analysis was performed on 30 individuals (mean (SD): age, 61 (7) yr; 15 (50%) male) with radiographic and symptomatic knee OA under three walking conditions in a randomized order: i) wearing rocker-soled shoes (Skechers Shape-ups), ii) wearing non-rocker-soled shoes (ASICS walking shoes), and iii) barefoot. Peak KAM and KAM angular impulse were measured as primary indicators of knee load distribution. Secondary measures included the knee flexion moment (KFM) and knee pain during walking. Peak KAM was significantly lower when wearing the rocker-soled shoes compared with that when wearing the non-rocker-soled shoes (mean difference (95% confidence interval), -0.27 (-0.42 to -0.12) N·m/BW × Ht%; P < 0.001). Post hoc tests revealed no significant difference in KAM impulse between rocker-soled and non-rocker-soled shoe conditions (P = 0.13). Both peak KAM and KAM impulse were significantly higher during both shoe conditions compared with those during the barefoot condition (P < 0.001). There were no significant differences in KFM (P = 0.36) or knee pain (P = 0.89) between conditions. Rocker-soled shoes significantly reduced peak KAM when compared with non-rocker-soled shoes, without a concomitant change in KFM, and thus may potentially reduce medial knee joint loading. However, KAM parameters in the rocker-soled shoes remained significantly higher than those during barefoot walking. Wearing rocker-soled shoes did not have a significant immediate effect on walking pain. Further research is required to evaluate whether rocker-soled shoes can influence symptoms and progression of knee OA with prolonged wear.

  15. Lycopene from two food sources does not affect antioxidant or cholesterol status of middle-aged adults.

    Science.gov (United States)

    Collins, J K; Arjmandi, B H; Claypool, P L; Perkins-Veazie, P; Baker, R A; Clevidence, B A

    2004-09-15

    Epidemiological studies have reported associations between reduced cardiovascular disease and diets rich in tomato and/or lycopene. Intervention studies have shown that lycopene-containing foods may reduce cholesterol levels and lipid peroxidation, factors implicated in the initiation of cardiovascular disease. The objective of this study was to determine whether consumption of lycopene rich foods conferred cardiovascular protection to middle-aged adults as indicated by plasma lipid concentrations and measures of ex vivo antioxidants. Ten healthy men and women consumed a low lycopene diet with no added lycopene (control treatment) or supplemented with watermelon or tomato juice each containing 20 mg lycopene. Subjects consumed each treatment for three weeks in a crossover design. Plasma, collected weekly was analyzed for total cholesterol, high density lipoprotein cholesterol (HDL-C) and triglyceride concentrations and for the antioxidant biomarkers of malondialdehyde formation products (MDA), plasma glutathione peroxidase (GPX) and ferric reducing ability of plasma (FRAP). Data were analyzed using Proc Mixed Procedure and associations between antioxidant and lipid measures were identified by Pearson's product moment correlation analysis. Compared to the control diet, the lycopene-containing foods did not affect plasma lipid concentrations or antioxidant biomarkers. Women had higher total cholesterol, HDL-C and triglyceride concentrations than did the men. Total cholesterol was positively correlated to MDA and FRAP while HDL-C was positively correlated to MDA and GPX. GPX was negatively correlated to triglyceride concentration. The inclusion of watermelon or tomato juice containing 20 mg lycopene did not affect plasma lipid concentrations or antioxidant status of healthy subjects. However, plasma cholesterol levels impacted the results of MDA and FRAP antioxidant tests.

  16. Lycopene from two food sources does not affect antioxidant or cholesterol status of middle-aged adults

    Directory of Open Access Journals (Sweden)

    Baker RA

    2004-09-01

    Full Text Available Abstract Background Epidemiological studies have reported associations between reduced cardiovascular disease and diets rich in tomato and/or lycopene. Intervention studies have shown that lycopene-containing foods may reduce cholesterol levels and lipid peroxidation, factors implicated in the initiation of cardiovascular disease. The objective of this study was to determine whether consumption of lycopene rich foods conferred cardiovascular protection to middle-aged adults as indicated by plasma lipid concentrations and measures of ex vivo antioxidants. Methods Ten healthy men and women consumed a low lycopene diet with no added lycopene (control treatment or supplemented with watermelon or tomato juice each containing 20 mg lycopene. Subjects consumed each treatment for three weeks in a crossover design. Plasma, collected weekly was analyzed for total cholesterol, high density lipoprotein cholesterol (HDL-C and triglyceride concentrations and for the antioxidant biomarkers of malondialdehyde formation products (MDA, plasma glutathione peroxidase (GPX and ferric reducing ability of plasma (FRAP. Data were analyzed using Proc Mixed Procedure and associations between antioxidant and lipid measures were identified by Pearson's product moment correlation analysis. Results Compared to the control diet, the lycopene-containing foods did not affect plasma lipid concentrations or antioxidant biomarkers. Women had higher total cholesterol, HDL-C and triglyceride concentrations than did the men. Total cholesterol was positively correlated to MDA and FRAP while HDL-C was positively correlated to MDA and GPX. GPX was negatively correlated to triglyceride concentration. Conclusions The inclusion of watermelon or tomato juice containing 20 mg lycopene did not affect plasma lipid concentrations or antioxidant status of healthy subjects. However, plasma cholesterol levels impacted the results of MDA and FRAP antioxidant tests.

  17. An assessment, using stable isotopes, of the importance of allochthonous organic carbon sources to the pelagic food web in Loch Ness

    Science.gov (United States)

    Jones, R. I.; Grey, J.; Sleep, D.; Quarmby, C.

    1998-01-01

    The natural abundance of stable isotopes (δ13C and δ1315N) was determined for components of the pelagic food web in Loch Ness, a deep oligotrophic lake in northern Scotland, and compared with values from the inflow rivers and the catchment vegetation. Phytoplankton δ13C was low compared to values reported from other lakes, possibly reflecting a high use of 13C-depleted carbon dioxide from respired organic matter before further isotopic fractionation during photosynthesis. Phytoplankton δ13C was appreciably lower than that of dissolved and particulate organic matter (DOM and POM) in the loch. The DOM and POM were evidently overwhelmingly of allochthonous origin and ultimately derived from terrestrial plant detritus. The distinctive δ13C values for phytoplankton and detritus in the loch allowed the use of food sources by grazing crustacean zooplankton to be assessed, and the contributions of phytoplankton carbon and detrital carbon to zooplankton total body carbon appeared to be about equal. Comparison of δ13C and δ15N values for zooplankton and fish allowed assessment of trophic structure in the loch. The very high dependence of the pelagic food web in Loch Ness on allochthonous organic matter inputs from the catchment may be exceptional in a large lake, but has important implications for our understanding of lake ecosystem processes as well as for lake management.

  18. Depletion of Essential Fatty Acids in the Food Source Affects Aerobic Capacities of the Golden Grey Mullet Liza aurata in a Warming Seawater Context.

    Science.gov (United States)

    Vagner, Marie; Lacoue-Labarthe, Thomas; Zambonino Infante, José-Luis; Mazurais, David; Dubillot, Emmanuel; Le Delliou, Hervé; Quazuguel, Patrick; Lefrançois, Christel

    2015-01-01

    The objective of this study was to evaluate the combined effects of thermal acclimation and n-3 highly unsaturated fatty acids (n-3 HUFA) content of the food source on the aerobic capacities of fish in a thermal changing environment. The model used was the golden grey mullet Liza aurata, a species of high ecological importance in temperate coastal areas. For four months, fish were exposed to two food sources with contrasting n-3 HUFA contents (4.8% ecosapentaenoic acid EPA + docosahexaenoic acid DHA on the dry matter DM basis vs. 0.2% EPA+DHA on DM) combined with two acclimation temperatures (12°C vs. 20°C). The four experimental conditions were LH12, LH20, HH12 and HH20. Each group was then submitted to a thermal challenge consisting of successive exposures to five temperatures (9°C, 12°C, 16°C, 20°C, 24°C). At each temperature, the maximal and minimal metabolic rates, metabolic scope, and the maximum swimming speed were measured. Results showed that the cost of maintenance of basal metabolic activities was particularly higher when n-3 HUFA food content was low. Moreover, fish exposed to high acclimation temperature combined with a low n-3 HUFA dietary level (LH20) exhibited a higher aerobic scope, as well as a greater expenditure of energy to reach the same maximum swimming speed as other groups. This suggested a reduction of the amount of energy available to perform other physiological functions. This study is the first to show that the impact of lowering n-3 HUFA food content is exacerbated for fish previously acclimated to a warmer environment. It raises the question of the consequences of longer and warmer summers that have already been recorded and are still expected in temperate areas, as well as the pertinence of the lowering n-3 HUFA availability in the food web expected with global change, as a factor affecting marine organisms and communities.

  19. Joining Forces for Food Security - Linking Earth Observation and Crowd-sourcing for improved Decision-support

    Science.gov (United States)

    Enenkel, M.; Dorigo, W.; See, L. M.; Vinck, P.; Papp, A.

    2014-12-01

    Droughts statistically exceed all other natural disasters in complexity, spatio-temporal extent and number of people affected. Triggered by crop failure, food insecurity is a major manifestation of agricultural drought and water scarcity. However, other socio-economic precursors, such as chronically low levels of disaster preparedness, hampered access to food security or a lack of social safety nets are equally important factors. We will present the first results of the SATIDA (Satellite Technologies for Improved Drought-Risk Assessment) project, which advances three complementary developments. First, an existing drought indicator is enhanced by replacing in-situ measurements on rainfall and surface air temperature with satellite-derived datasets. We identify the vegetation status via a new noise-corrected and gap-filled vegetation index. In addition, we introduce a soil moisture component to close the gap between rainfall deficiencies, extreme temperature and the first visible impacts of atmospheric anomalies on vegetation. Second, once calibrated, the index is forced with seasonal forecasts to quantify their uncertainty and added value in the regions of interest. Third, a mobile application is developed to disseminate relevant visualizations to decision-makers in affected areas, to collect additional information about socio-economic conditions and to validate the output of the drought index in real conditions. Involving Doctors without Borders (MSF) as a key user, SATIDA aims at decreasing uncertainties in decision-making via a more holistic risk framework, resulting in longer lead times for disaster logistics in the preparedness phase.

  20. Joining forces for food security - Linking earth observation and crowd-sourcing for improved decision-support to aid organizations

    Science.gov (United States)

    Enenkel, M.; Dorigo, W.; See, L. M.; Vinck, P.; Pham, P.

    2013-12-01

    Droughts statistically exceed all other natural disasters in spatio-temporal extent, number of people affected or financial loss. Triggered by crop failure, food insecurity is a major manifestation of agricultural drought and water scarcity. However, other socio-economic precursors, such as chronically low levels of disaster preparedness, hampered access to food security or a lack of social safety nets are equally important factors. Consequently, this study is focused on two complementary developments - a new satellite-derived agricultural drought index and a mobile phone application. The Combined Drought Index (CDI) is enhanced by replacing field measurements of temperature and rainfall modelled/assimilated data. The vegetation component is replaced by a smoothed NDVI dataset. A soil moisture component is introduced to close the gap between rainfall deficiencies and the first visible impacts of atmospheric anomalies on vegetation. The mobile phone application enables the validation of drought index outputs and gives aid organizations an opportunity to increase the speed of socio-economic vulnerability assessments. Supported by Doctors without Borders (MSF) this approach aims at decreasing uncertainties in decision-making via a more holistic risk framework.

  1. Comparison of Campylobacter jejuni isolates from human, food, veterinary and environmental sources in Iceland using PFGE, MLST and fla-SVR sequencing.

    Science.gov (United States)

    Magnússon, S H; Guðmundsdóttir, S; Reynisson, E; Rúnarsson, A R; Harðardóttir, H; Gunnarson, E; Georgsson, F; Reiersen, J; Marteinsson, V Th

    2011-10-01

    Campylobacter jejuni isolates from various sources in Iceland were genotyped with the aim of assessing the genetic diversity, population structure, source distribution and campylobacter transmission routes to humans. A collection of 584 Campylobacter isolates were collected from clinical cases, food, animals and environment in Iceland in 1999-2002, during a period of national Campylobacter epidemic in Iceland. All isolates were characterized by pulse field gel electrophoresis (PFGE), and selected subset of 52 isolates representing the diversity of the identified PFGE types was further genotyped using multilocus sequence typing (MLST) and fla-SVR sequencing to gain better insight into the population structure. The results show a substantial diversity within the Icelandic Campylobacter population. Majority of the human Campylobacter infections originated from domestic chicken and cattle isolates. MLST showed the isolates to be distributed among previously reported and common sequence type complexes in the MLST database. The genotyping of Campylobacter from various sources has not previously been reported from Iceland, and the results of the study gave a valuable insight into the population structure of Camp. jejuni in Iceland, source distribution and transmission routes to humans. The geographical isolation of Iceland in the north Atlantic provides new information on Campylobacter population dynamics on a global scale. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology No claim to Icelandic Government works.

  2. The role of similarity cues in the development of trust in sources of information about GM Food

    NARCIS (Netherlands)

    Meijnders, A.L.; Midden, C.J.H.; Öhman, S.; Matthes, J.

    2009-01-01

    In evaluating complex new technologies, people are usually dependent on information provided by others, for example, experts or journalists, and have to determine whether they can trust these information sources. This article focuses on similarity as the basis for trust. The first experiment (N =

  3. Olfactory transduction pathways in the Senegalese sole Solea senegalensis.

    Science.gov (United States)

    Velez, Z; Hubbard, P C; Barata, E N; Canário, A V M

    2013-09-01

    This study tested whether differences in sensitivity between the upper and lower olfactory epithelia of Solea senegalensis are associated with different odorant receptors and transduction pathways, using the electro-olfactogram. Receptor mechanisms were assessed by cross-adaptation with amino acids (L-cysteine, L-phenylalanine and 1-methyl-L-tryptophan) and bile acids (taurocholic acid and cholic acid). This suggested that relatively specific receptors exist for 1-methyl-L-tryptophan and L-phenylalanine (food-related odorants) in the lower epithelium, and for taurocholic acid (conspecific-derived odorant) in the upper. Inhibition by U73122 [a phospholipase C (PLC) inhibitor] suggested that olfactory responses to amino acids were mediated mostly, but not entirely, by PLC-mediated transduction (IC50 ; 15-55 nM), whereas bile acid responses were mediated by both PLC and adenylate cyclase-cyclic adenosine monophosphate (AC-cAMP) (using SQ-22536; an AC inhibitor). Simultaneous application of both drugs rarely inhibited responses completely, suggesting possible involvement of non-PLC and non-AC mediated mechanisms. For aromatic amino acids and bile acids, there were differences in the contribution of each transduction pathway (PLC, AC and non-PLC and non-AC) between the two epithelia. These results suggest that differences in sensitivity of the two epithelia are associated with differences in odorant receptors and transduction mechanisms. © 2013 The Fisheries Society of the British Isles.

  4. Field validation of secondary data sources: a novel measure of representativity applied to a Canadian food outlet database.

    Science.gov (United States)

    Clary, Christelle M; Kestens, Yan

    2013-06-19

    Validation studies of secondary datasets used to characterize neighborhood food businesses generally evaluate how accurately the database represents the true situation on the ground. Depending on the research objectives, the characterization of the business environment may tolerate some inaccuracies (e.g. minor imprecisions in location or errors in business names). Furthermore, if the number of false negatives (FNs) and false positives (FPs) is balanced within a given area, one could argue that the database still provides a "fair" representation of existing resources in this area. Yet, traditional validation measures do not relax matching criteria, and treat FNs and FPs independently. Through the field validation of food businesses found in a Canadian database, this paper proposes alternative criteria for validity. Field validation of the 2010 Enhanced Points of Interest (EPOI) database (DMTI Spatial®) was performed in 2011 in 12 census tracts (CTs) in Montreal, Canada. Some 410 food outlets were extracted from the database and 484 were observed in the field. First, traditional measures of sensitivity and positive predictive value (PPV) accounting for every single mismatch between the field and the database were computed. Second, relaxed measures of sensitivity and PPV that tolerate mismatches in business names or slight imprecisions in location were assessed. A novel measure of representativity that further allows for compensation between FNs and FPs within the same business category and area was proposed. Representativity was computed at CT level as ((TPs +|FPs-FNs|)/(TPs+FNs)), with TPs meaning true positives, and |FPs-FNs| being the absolute value of the difference between the number of FNs and the number of FPs within each outlet category. The EPOI database had a "moderate" capacity to detect an outlet present in the field (sensitivity: 54.5%) or to list only the outlets that actually existed in the field (PPV: 64.4%). Relaxed measures of sensitivity and PPV

  5. Food as a Source for Quorum Sensing Inhibitors: Iberin from Horseradish Revealed as a Quorum Sensing Inhibitor of Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Jakobsen, Tim Holm; Bragason, Steinn Kristinn; Phipps, Richard Kerry

    2012-01-01

    of traditional antibiotics to treat infections caused by bacterial biofilms and multidrug-resistant bacteria. Several QSIs of natural origin have been identified, and in this study, several common food products and plants were extracted and screened for QSI activity in an attempt to isolate and characterize...... to transcend problems with selective pressures for antibiotic resistance, is to interrupt bacterial communication, also known as quorum sensing (QS), by means of signal antagonists, the so-called QS inhibitors (QSIs). Furthermore, QSI agents offer a potential solution to the deficiencies associated with use......-diode array detector-mass spectrometry (LC-DAD-MS) and nuclear magnetic resonance (NMR) spectroscopy as iberin—an isothiocyanate produced by many members of the Brassicaceae family. Real-time PCR (RT-PCR) and DNA microarray studies showed that iberin specifically blocks expression of QS-regulated genes in P...

  6. Does Contemporary Neo-Kantianism Only Allow for Moral Realism or Constructivism? Elements for a Kantian Grounding of Morality Solely on the basis of the Idea of Freedom

    Directory of Open Access Journals (Sweden)

    Martín Fleitas González

    2015-12-01

    Full Text Available The article carries out a reflection on the sources of normativity in contemporary Neo-Kantianism, which has divided Neo-Kantians into realists and constructivists. After analyzing the constructivist Kantianism of Christine Korsgaard, we propose an alternative: that of grounding normativity solely on the idea of freedom, as an internal value or non-normative absolute, as Kant understands it. This proposal makes it possible to outline a Neo-Kantianism that articulates constructivist and realist models on the sole basis of the idea of freedom.

  7. Adaptation of benthic invertebrates to food sources along marine-terrestrial boundaries as indicated by carbon and nitrogen stable isotopes

    Science.gov (United States)

    Lange, G.; Haynert, K.; Dinter, T.; Scheu, S.; Kröncke, I.

    2018-01-01

    Frequent environmental changes and abiotic gradients of the Wadden Sea require appropriate adaptations of the local organisms and make it suitable for investigations on functional structure of macrozoobenthic communities from marine to terrestrial boundaries. To investigate community patterns and food use of the macrozoobenthos, a transect of 11 stations was sampled for species number, abundance and stable isotope values (δ13C and δ15N) of macrozoobenthos and for stable isotope values of potential food resources. The transect was located in the back-barrier system of the island of Spiekeroog (southern North Sea, Germany). Our results show that surface and subsurface deposit feeders, such as Peringia ulvae and different oligochaete species, dominated the community, which was poor in species, while species present at the transect stations reached high abundance. The only exception was the upper salt marsh with low abundances but higher species richness because of the presence of specialized semi-terrestrial and terrestrial taxa. The macrozoobenthos relied predominantly on marine resources irrespective of the locality in the intertidal zone, although δ13C values of the consumers decreased from - 14.1 ± 1.6‰ (tidal flats) to - 21.5 ± 2.4‰ (salt marsh). However, the ubiquitous polychaete Hediste diversicolor showed a δ15N enrichment of 2.8‰ (an increase of about one trophic level) from bare sediments to the first vegetated transect station, presumably due to switching from suspension or deposit feeding to predation on smaller invertebrates. Hence, we conclude that changes in feeding mode represent an important mechanism of adaptation to different Wadden Sea habitats.

  8. Effect of vitamin E intake from food and supplement sources on plasma α- and γ-tocopherol concentrations in a healthy Irish adult population.

    Science.gov (United States)

    Zhao, Yang; Monahan, Frank J; McNulty, Breige A; Gibney, Mike J; Gibney, Eileen R

    2014-11-14

    Vitamin E is believed to play a preventive role in diseases associated with oxidative stress. The aims of the present study were to quantify vitamin E intake levels and plasma concentrations and to assess dietary vitamin E adequacy in Irish adults. Intake data from the National Adult Nutrition Survey were used; plasma samples were obtained from a representative cohort of survey participants. Plasma α- and γ-tocopherol concentrations were measured by HPLC. The main sources of vitamin E in the diet were 'butter, spreadable fats and oils' and 'vegetables and vegetable dishes'. When vitamin E intake from supplements was taken into account, supplements were found to be the main contributor, making a contribution of 29·2 % to vitamin E intake in the total population. Supplement consumers had significantly higher plasma α-tocopherol concentrations and lower plasma γ-tocopherol concentrations when compared with non-consumers. Consumers of 'vitamin E' supplements had significantly higher vitamin E intake levels and plasma α-tocopherol concentrations compared with consumers of other types of supplements, such as multivitamin and fish oil. Comparison with the Institute of Medicine Estimated Average Requirement of 12 mg/d indicated that when vitamin E intake from food and supplement sources was taken into account, 100 % of the study participants achieved the recommended intake levels. When vitamin E intake from food sources was taken into account, only 68·4 % of the females were found to achieve the recommended intake levels compared with 99·2 % of the males. The results of the present study show that dietary vitamin E intake has a significant effect on plasma α- and γ-tocopherol concentrations. Furthermore, they show that the consumption of supplements is a major contributor to overall intake and has a significant effect on plasma vitamin E concentrations in the Irish population.

  9. Growth performances of juvenile sole Solea solea under environmental constraints of embayed nursery areas

    NARCIS (Netherlands)

    Laffargue, P.; Lagardere, F.; Rijnsdorp, A.D.; Fillon, A.; Amara, R.

    2007-01-01

    Tidal embayments in the Bay of Biscay (France) host nursery grounds where common sole, Solea solea, is the most abundant flatfish species. This study aimed to appraise the way those habitats function as nurseries through juvenile sole's responses in somatic growth and condition (Fulton's K) during

  10. 78 FR 51061 - TRICARE; Reimbursement of Sole Community Hospitals and Adjustment to Reimbursement of Critical...

    Science.gov (United States)

    2013-08-20

    ... DEPARTMENT OF DEFENSE 32 CFR Part 199 [DoD-2010-HA-0072] RIN 0720-AB41 TRICARE; Reimbursement of Sole Community Hospitals and Adjustment to Reimbursement of Critical Access Hospitals; Correction... TRICARE; Reimbursement of Sole Community Hospitals and Adjustment to Reimbursement of Critical Access...

  11. Variation in behaviour and growth of common sole : genetic and environmental influences

    NARCIS (Netherlands)

    Mas Muñoz, J.

    2013-01-01

    Common sole (Solea solea) has a high potential for commercial aquaculture because of its consumer popularity and high market values in Europe. However, a major economic constraint for the culture of sole is its slow and variable growth. The aim of this thesis was to investigate: 1) the

  12. The comparison of nitrogen use and leaching in sole cropped versus intercropped pea and barley

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, H.; Ambus, P.; Jensen, E.S.

    2003-01-01

    The effect of sole and intercropping of field pea (Pisum sativum L.) and spring barley (Hordeum vulgare L.) and of crop residue management on crop yield, NO3- leaching and N balance in the cropping system was tested in a 2-year lysimeter experiment on a temperate sandy loam soil. The crop rotation...... cropping. Crops received no fertilizer in the experimental period. Natural N-15 abundance techniques were used to determine pea N-2 fixation. The pea-barley intercrop yielded 4.0 Mg grain ha(-1), which was about 0.5 Mg lower than the yields of sole cropped pea but about 1.5 Mg greater than harvested...... was pea and barley sole and intercrops followed by winter-rye and a fallow period. The Land Equivalent Ratio (LER), which is defined as the relative land area under sole crops that is required to produce the yields achieved in intercropping, was used to compare intercropping performance relative to sole...

  13. Stabilized-solubilized ferric pyrophosphate as a new iron source for food fortification. Bioavailability studies by means of the prophylactic-preventive method in rats.

    Science.gov (United States)

    Salgueiro, M J; Arnoldi, S; Kaliski, M A; Torti, H; Messeri, E; Weill, R; Zubillaga, M; Boccio, J

    2009-02-01

    The purpose of the present work was to evaluate the iron bioavailability of a new ferric pyrophosphate salt stabilized and solubilized with glycine. The prophylactic-preventive test in rats, using ferrous sulfate as the reference standard, was applied as the evaluating methodology both using water and yogurt as vehicles. Fifty female Sprague-Dawley rats weaned were randomized into five different groups (group 1: FeSO(4); group 2: pyr; group 3: FeSO(4) + yogurt; group 4: pyr + yogurt and group 5: control). The iron bioavailability (BioFe) of each compound was calculated using the formula proposed by Dutra-de-Oliveira et al. where BioFe % = (HbFef - HbFei) x 100/ToFeIn. Finally, the iron bioavailability results of each iron source were also given as relative biological value (RBV) using ferrous sulfate as the reference standard. The results showed that both BioFe % and RBV % of the new iron source tested is similar to that of the reference standard independently of the vehicle employed for the fortification procedure (FeSO(4) 49.46 +/- 12.0% and 100%; Pyr 52.66 +/- 15.02% and 106%; FeSO(4) + yogurth 54.39 +/- 13.92% and 110%; Pyr + yogurt 61.97 +/- 13.54% and 125%; Control 25.30 +/- 6.60, p soluble ferric pyrophosphate may be considered as an optimal iron source for food fortification.

  14. In vitro evaluation of whole faba bean and its seed coat as a potential source of functional food components.

    Science.gov (United States)

    Çalışkantürk Karataş, Selen; Günay, Demet; Sayar, Sedat

    2017-09-01

    In vitro studies were conducted to evaluate the particular nutritional benefits of whole faba bean seed (WFB) and fava bean seed coat (FBSC). Total dietary fiber contents of WFB and FBSC were 27.5% and 82.3%, respectively. FBSC were contained much higher total phenolic substances, condensed tannins, and total antioxidant activity than WFB. Bile acid (BA)-binding capacities of in vitro digested samples and nutritionally important products produced by in vitro fermentation of digestion residues were also studied. The BA-binding capacities of WFB and FBSC were 1.94 and 37.50μmol/100mg, respectively. Total BA bound by FBSC was even higher than the positive standard cholestyramine. Lignin and other constituents of the Klason residue were found to influence BA-binding properties. Moreover, the extent of the in vitro fermentation process showed that, fermentability of FBSC residue was significantly lower than that of WFB residue. Overall, faba bean, especially its seed coat, has great potential as a functional food. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Sole validity of the radioimmunological TSH-estimate

    International Nuclear Information System (INIS)

    Mahlstedt, J.

    1982-01-01

    TSH-measurements in plasma as a single parameter for the evaluation of thyroid status need a highly sensitive radioimmunoassay, hitherto not available from commercial sources. The results, however, of such an assay allow to distinguish satisfactorily between suppressed, partially suppressed and normal regulation as well as overstimulation of the thyroid. For several indications, the TRH-test could be replaced by a basal TSH-value. Suppressed regulation without measurable TSH-levels is not to be identified automatically with clearcut hyperthyroidism because of several disturbing factors to be considered in clinical circumstances. Normally the positive TRH-test includes basal TSH-levels between 0.5 and 5 μU/ml thereby excluding significant hormone excess as a possible cause of clinical signs of hyperthyroidism; however, some exceptions do exist (TSH-secreting pineal tumors; partial TSH-resistance of the hypophysis; crossreacting immunoglobulins after microbial vaccination) and should be considered in case of conflicting results. From a clinical point of view a highly sensitive TSH-RIA would be very interesting but would require the use of most recent technologies. (orig.) [de

  16. Major food sources of calories, added sugars, and saturated fat and their contribution to essential nutrient intakes in the U.S. diet: data from the national health and nutrition examination survey (2003–2006)

    Science.gov (United States)

    2013-01-01

    Background The risk of chronic disease cannot be predicted simply by the content of a single nutrient in a food or food group in the diet. The contribution of food sources of calories, added sugars and saturated fat (SFA) to intakes of dietary fiber and micronutrients of public health importance is also relevant to understanding the overall dietary impact of these foods. Objective Identify the top food sources of calories, added sugars and SFA in the U.S. diet and quantify their contribution to fiber and micronutrient intakes. Methods Single 24-hour dietary recalls (Day 1) collected from participants ≥2 years (n = 16,822) of the What We Eat in America, National Health and Nutrition Examination Survey (WWEIA/NHANES 2003–2006) were analyzed. All analyses included sample weights to account for the survey design. Calorie and nutrient intakes from foods included contributions from disaggregated food mixtures and tabulated by rank order. Results No one food category contributes more than 7.2% of calories to the overall U.S. diet, but half of the top 10 contribute 10% or more of total dietary fiber and micronutrients. Three of the top 10 sources of calories and SFA (beef, milk and cheese) contribute 46.3% of the calcium, 49.5% of the vitamin D, 42.3% of the vitamin B12 as well as other essential nutrients to the American diet. On the other hand, foods categorized as desserts, snacks, or beverages, contribute 13.6% of total calories, 83% of added sugar intake, and provide little or no nutritional value. Including food components of disaggregated recipes more accurately estimated the contribution of foods like beef, milk or cheese to overall nutrient intake compared to “as consumed” food categorizations. Conclusions Some food sources of calories, added sugars and SFA make major contributions to American dietary fiber and micronutrient intakes. Dietary modifications targeting reductions in calories, added sugar, or SFA need to take these key micronutrient

  17. Major food sources of calories, added sugars, and saturated fat and their contribution to essential nutrient intakes in the U.S. diet: data from the National Health and Nutrition Examination Survey (2003-2006).

    Science.gov (United States)

    Huth, Peter J; Fulgoni, Victor L; Keast, Debra R; Park, Keigan; Auestad, Nancy

    2013-08-08

    The risk of chronic disease cannot be predicted simply by the content of a single nutrient in a food or food group in the diet. The contribution of food sources of calories, added sugars and saturated fat (SFA) to intakes of dietary fiber and micronutrients of public health importance is also relevant to understanding the overall dietary impact of these foods. Identify the top food sources of calories, added sugars and SFA in the U.S. diet and quantify their contribution to fiber and micronutrient intakes. Single 24-hour dietary recalls (Day 1) collected from participants ≥2 years (n = 16,822) of the What We Eat in America, National Health and Nutrition Examination Survey (WWEIA/NHANES 2003-2006) were analyzed. All analyses included sample weights to account for the survey design. Calorie and nutrient intakes from foods included contributions from disaggregated food mixtures and tabulated by rank order. No one food category contributes more than 7.2% of calories to the overall U.S. diet, but half of the top 10 contribute 10% or more of total dietary fiber and micronutrients. Three of the top 10 sources of calories and SFA (beef, milk and cheese) contribute 46.3% of the calcium, 49.5% of the vitamin D, 42.3% of the vitamin B12 as well as other essential nutrients to the American diet. On the other hand, foods categorized as desserts, snacks, or beverages, contribute 13.6% of total calories, 83% of added sugar intake, and provide little or no nutritional value. Including food components of disaggregated recipes more accurately estimated the contribution of foods like beef, milk or cheese to overall nutrient intake compared to "as consumed" food categorizations. Some food sources of calories, added sugars and SFA make major contributions to American dietary fiber and micronutrient intakes. Dietary modifications targeting reductions in calories, added sugar, or SFA need to take these key micronutrient sources into account so as not to have the unintended

  18. Phytase-producing capacity of yeasts isolated from traditional African fermented food products and PHYPk gene expression of Pichia kudriavzevii strains

    DEFF Research Database (Denmark)

    Greppi, Anna; Krych, Lukasz; Costantini, Antonella

    2015-01-01

    Phytate is known as a strong chelate of minerals causing their reduced uptake by the human intestine. Ninety-three yeast isolates from traditional African fermented food products, belonging to nine species (Pichia kudriavzevii, Saccharomyces cerevisiae, Clavispora lusitaniae, Kluyveromyces...... marxianus, Millerozyma farinosa, Candida glabrata, Wickerhamomyces anomalus, Hanseniaspora guilliermondii and Debaryomyces nepalensis) were screened for phytase production on solid and liquid media. 95% were able to grow in the presence of phytate as sole phosphate source, P. kudriavzevii being the best...

  19. Potato wound-healing tissues: A rich source of natural antioxidant molecules with potential for food preservation.

    Science.gov (United States)

    Dastmalchi, Keyvan; Wang, Isabel; Stark, Ruth E

    2016-11-01

    The need for safe, effective preservatives is a prominent issue in the food and drug industries, reflecting demand for natural alternatives to synthetic chemicals viewed as harmful to consumers and the environment. Thus, this study determined the identities and scavenging capacities of antioxidant metabolites produced as a response to potato tuber wounding, using activity-guided fractionation of polar extracts from a Yukon Gold cultivar that had previously exhibited exceptionally high radical-scavenging activity. Activity-guided fractionation using the ABTS(+) radical scavenging assay and LC-MS with TOF-MS for compositional analysis of the most potent antioxidant fractions yielded identification of nine constituents: coumaroylputrescine; feruloylquinic acid; isoferuloylputrescine; ferulic acid; 22,25-dimethoxy-3-[[2,3,4-tri-O-methyl-6-O-(2,3,4,6-tetra-O-methyl-β-d-glucopyranosyl)-β-d-glucopyranosyl]oxy]-(3β)-lanost-9(11)-en-24-one; 4-(2Z)-2-decen-1-yl-5-[1-(4-hydroxyphenyl)decyl]-1,2-benzenediol; 8-[(2E)-3,7-dimethyl-2,6-octadien-1-yl]-5-hydroxy-2,8-dimethyl-6-(3-methyl-2-buten-1-yl)-2H-1-benzopyran-4,7(3H,8H)-dione; 3-[(2-O-β-d-glucopyranosyl-β-d-glucopyranosyl)oxy]-20-[(6-O-β-d-xylopyranosyl-β-d-glucopyranosyl)oxy]-dammar-24-en-19-al; (3β)-28-oxo-28-(phenylmethoxy)oleanan-3-yl 2-O-β-d-galactopyranosyl-3-O-(phenylmethyl)-, butyl ester β-d-glucopyranosiduronic acid. A positive correlation was observed between the scavenging activities and the polarities of the active fractions. The antioxidant capacities of the fractions were also characterised by monitoring the activity throughout a 45-minute assay period. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Leishmania infection and blood food sources of phlebotomines in an area of Brazil endemic for visceral and tegumentary leishmaniasis

    Science.gov (United States)

    Guimarães-e-Silva, Antônia Suely; Silva, Soraia de Oliveira; Ribeiro da Silva, Rosa Cristina; Pinheiro, Valéria Cristina Soares; Rebêlo, José Manuel Macário; Melo, Maria Norma

    2017-01-01

    The aims of the study were to determine the blood feeding preferences of sandflies and to identify species of Leishmania that infected phlebotomines in Caxias, Maranhão, Brazil, an area that is highly endemic for leishmaniasis. Sandflies were captured in light traps located in the peridomiciliary environments of randomly selected houses in urban and rural settings between 1800 and 0600 hours on new moon days between March 2013 and February 2015. DNA extracts from 982 engorged female sandflies were submitted to fragment length polymorphism analysis to identify infecting species of Leishmania, and blood sources were identified for 778 of these specimens. Infection by Leishmania infantum was detected in Lutzomyia longipalpis, Lu. whitmani and Lu. termitophila; L. infantum/L. braziliensis in Lu. longipalpis, Lu. whitmani and Lu. trinidadensis; L. shawi in Lu. longipalpis; L. mexicana in Lu. longipalpis; L. braziliensis in Lu. longipalpis and Lu. whitmani; L. guyanensis in Lu. longipalpis and Lu. termitophila; L. amazonensis in Lu. longipalpis and L. lainsoni or L. naiffi in Lu. longipalpis, while Lu. longipalpis and Lu. trinidadensis were infected with unidentified Leishmania sp. Blood sources were identified in 573 individual phlebotomines and the preferred hosts were, in decreasing order, chicken, dog, rodent and human with lower preferences for pig, horse, opossum and cattle. Lu. longipalpis and Lu. whitmani performed mixed feeding on man, dog and rodent, while Lu. longipalpis was the most opportunistic species, feeding on the blood of all hosts surveyed, but preferably on dog/chicken, dog/rodent and rodent/chicken. Our findings reveal the concomitant circulation of Leishmania species that cause visceral leishmaniasis and tegumentary leishmaniasis in the study area, and explain the occurrence of autochthonous human cases of both clinical forms of leishmaniasis in Caxias, Maranhão. The results support our hypothesis that, in the municipality of Caxias, transmission

  1. Novel Natural Products for Healthy Ageing from the Mediterranean Diet and Food Plants of Other Global Sources-The MediHealth Project.

    Science.gov (United States)

    Waltenberger, Birgit; Halabalaki, Maria; Schwaiger, Stefan; Adamopoulos, Nicolas; Allouche, Noureddine; Fiebich, Bernd L; Hermans, Nina; Jansen-Dürr, Pidder; Kesternich, Victor; Pieters, Luc; Schönbichler, Stefan; Skaltsounis, Alexios-Leandros; Tran, Hung; Trougakos, Ioannis P; Viljoen, Alvaro; Wolfender, Jean-Luc; Wolfrum, Christian; Xynos, Nikos; Stuppner, Hermann

    2018-05-06

    There is a rapid increase in the percentage of elderly people in Europe. Consequently, the prevalence of age-related diseases will also significantly increase. Therefore, the main goal of MediHealth, an international research project, is to introduce a novel approach for the discovery of active agents of food plants from the Mediterranean diet and other global sources that promote healthy ageing. To achieve this goal, a series of plants from the Mediterranean diet and food plants from other origins are carefully selected and subjected to in silico, cell-based, in vivo (fly and mouse models), and metabolism analyses. Advanced analytical techniques complement the bio-evaluation process for the efficient isolation and identification of the bioactive plant constituents. Furthermore, pharmacological profiling of bioactive natural products, as well as the identification and synthesis of their metabolites, is carried out. Finally, optimization studies are performed in order to proceed to the development of innovative nutraceuticals, dietary supplements or herbal medicinal products. The project is based on an exchange of researchers between nine universities and four companies from European and non-European countries, exploiting the existing complementary multidisciplinary expertise. Herein, the unique and novel approach of this interdisciplinary project is presented.

  2. Intake of total, animal and plant proteins, and their food sources in 10 countries in the European Prospective Investigation into Cancer and Nutrition.

    Science.gov (United States)

    Halkjaer, J; Olsen, A; Bjerregaard, L J; Deharveng, G; Tjønneland, A; Welch, A A; Crowe, F L; Wirfält, E; Hellstrom, V; Niravong, M; Touvier, M; Linseisen, J; Steffen, A; Ocké, M C; Peeters, P H M; Chirlaque, M D; Larrañaga, N; Ferrari, P; Contiero, P; Frasca, G; Engeset, D; Lund, E; Misirli, G; Kosti, M; Riboli, E; Slimani, N; Bingham, S

    2009-11-01

    To describe dietary protein intakes and their food sources among 27 redefined centres in 10 countries participating in the European Prospective Investigation into Cancer and Nutrition (EPIC). Between 1995 and 2000, 36 034 persons, aged between 35 and 74 years, were administered a standardized 24-h dietary recall (24-HDR) using a computerized interview software programme (EPIC-SOFT). Intakes (g/day) of total, animal and plant proteins were estimated using the standardized EPIC Nutrient Database (ENDB). Mean intakes were adjusted for age, and weighted by season and day of recall. Mean total and animal protein intakes were highest in the Spanish centres among men, and in the Spanish and French centres among women; the lowest mean intakes were observed in the UK health-conscious group, in Greek men and women, and in women in Potsdam. Intake of plant protein was highest among the UK health-conscious group, followed by some of the Italian centres and Murcia, whereas Sweden and Potsdam had the lowest intake. Cereals contributed to the highest proportion of plant protein in all centres. The combined intake of legumes, vegetables and fruit contributed to a greater proportion of plant protein in the southern than in the northern centres. Total meat intake (with some heterogeneity across subtypes of meat) was, with few exceptions, the most important contributor to animal protein in all centres, followed by dairy and fish products. This study shows that intake of protein, especially of animal origin, differs across the 10 European countries, and also shows some differences in food sources of protein across Europe.

  3. GPS tracking of non-breeding ravens reveals the importance of anthropogenic food sources during their dispersal in the Eastern Alps.

    Science.gov (United States)

    Loretto, Matthias-Claudio; Schuster, Richard; Bugnyar, Thomas

    2016-08-01

    In many songbirds, the space use of breeders is well studied but poorly understood for non-breeders. In common ravens, some studies of non-breeders indicate high vagrancy with large individual differences in home range size, whereas others show that up to 40% of marked non-breeders can be regularly observed at the same anthropogenic food source over months to years. The aim of this study was to provide new insights on ravens' behavior during dispersal in the Eastern Alps. We deployed Global Positioning System (GPS) loggers on 10 individuals to gather accurate spatial and temporal information on their movements to quantify: 1) the dimension of the birds' space use (home range size with seasonal effects and daily/long-term travel distances), 2) how long they stayed in a dispersal stage of wandering as opposed to settling temporarily, and 3) their destination of movements. We recorded movements of up to 40 km per hour, more than 160 km within 1 day and more than 11,000 km within 20 months, indicating high vagrancy. Switching frequently between temporarily settling and travelling large distances in short time intervals leads to extensive home ranges, which also explains and combines the different findings in the literature. The destinations are rich anthropogenic food sources, where the birds spent on average 75% of their time. We discuss how ravens may find these "feeding hot spots" and which factors may influence their decision to stay/leave a site. The strong dependence on anthropogenic resources found in this population may have implications for site management and conservation issues.

  4. LC-MS/MS analytical procedure to quantify tris(nonylphenyl)phosphite, as a source of the endocrine disruptors 4-nonylphenols, in food packaging materials.

    Science.gov (United States)

    Mottier, Pascal; Frank, Nancy; Dubois, Mathieu; Tarres, Adrienne; Bessaire, Thomas; Romero, Roman; Delatour, Thierry

    2014-01-01

    Tris(nonylphenyl)phosphite, an antioxidant used in polyethylene resins for food applications, is problematic since it is a source of the endocrine-disrupting chemicals 4-nonylphenols (4NP) upon migration into packaged foods. As a response to concerns surrounding the presence of 4NP-based compounds in packaging materials, some resin producers and additive suppliers have decided to eliminate TNPP from formulations. This paper describes an analytical procedure to verify the "TNPP-free" statement in multilayer laminates used for bag-in-box packaging. The method involves extraction of TNPP from laminates with organic solvents followed by detection/quantification by LC-MS/MS using the atmospheric pressure chemical ionisation (APCI) mode. A further acidic treatment of the latter extract allows the release of 4NP from potentially extracted TNPP. 4NP is then analysed by LC-MS/MS using electrospray ionisation (ESI) mode. This two-step analytical procedure ensures not only TNPP quantification in laminates, but also allows the flagging of other possible sources of 4NP in such packaging materials, typically as non-intentionally added substances (NIAS). The limits of quantification were 0.50 and 0.48 µg dm⁻² for TNPP and 4NP in laminates, respectively, with recoveries ranging between 87% and 114%. Usage of such analytical methodologies in quality control operations has pointed to a lack of traceability at the packaging supplier level and cross-contamination of extrusion equipment at the converter level, when TNPP-containing laminates are processed on the same machine beforehand.

  5. Environmental radioactivity in Caithness and Sutherland. Pt. 1: Food-chain model validation and the attribution of radionuclide sources to deposition

    International Nuclear Information System (INIS)

    Rose, C.L.; Halliwell, C.M.

    1995-01-01

    This study is part of a continuing programme investigating the behaviour of environmental radioactivity in the vicinity of the AEA Technology establishment at Dounreay, Caithness and Sutherland. The study aims were to assess the applicability of a National Radiological Protection Board (NRPB) food-chain model to the Caithness and Sutherland area, and to determine the contribution of different radionuclide sources to activities in measured total deposition in the same region. The NRPB model predicts the movement of radionuclides through the food-chain, and in this study was validated by comparing model outputs with measured crop data (ryegrass and clover). Five radionuclides ( 137 Cs, 90 Sr, 239+240 Pu, 238 Pu, 241 Am) were considered. The contribution of different radionuclide sources to activities in total deposition were divided into three categories: Dounreay stack inputs, sea-to-land transfer, and the combined contribution from nuclear weapons testing and Chernobyl fallout. The analyses indicated that the contribution of the Dounreay stack to total deposition was very small for the radionuclides studied. The Chernobyl accident made a large impact on the total deposition of 137 Cs in the study area, and 90 Sr deposition was also affected by this, but to a much lesser extent. The Chernobyl accident appeared to have no effect on total Pu deposition in the region. The cessation of nuclear weapons testing and the length of time since Chernobyl meant that actual 137 Cs and 90 Sr deposition as a result of weapons/Chernobyl inputs had reached a low level by the end of the study period (summer 1987). It became evident that a contribution to total deposition was being made by additional factors, thought to be local resuspension of large particles for 137 Cs, and possibly deposition of plant material for 90 Sr. For Pu, sea-to-land transfer was probably an important contributor at coastal sites. (Author)

  6. Fun With Food Webs

    Science.gov (United States)

    Smith, Karl D.

    1977-01-01

    Explains an upper elementary game of tag that illustrates energy flow in food webs using candy bars as food sources. A follow-up field trip to a river and five language arts projects are also suggested. (CS)

  7. Diet-boosting foods

    Science.gov (United States)

    Obesity - diet-boosting foods; Overweight - diet-boosting foods ... Low-fat and nonfat milk, yogurt, and cottage cheese are healthy sources of calcium, vitamin D , and potassium. Unlike sweetened drinks with extra calories, milk ...

  8. Child hunger and the protective effects of Supplemental Nutrition Assistance Program (SNAP) and alternative food sources among Mexican-origin families in Texas border colonias.

    Science.gov (United States)

    Sharkey, Joseph R; Dean, Wesley R; Nalty, Courtney C

    2013-09-13

    Nutritional health is essential for children's growth and development. Many Mexican-origin children who reside in limited-resource colonias along the Texas-Mexico border are at increased risk for poor nutrition as a result of household food insecurity. However, little is known about the prevalence of child hunger or its associated factors among children of Mexican immigrants. This study determines the prevalence of child hunger and identifies protective and risk factors associated with it in two Texas border areas. This study uses 2009 Colonia Household and Community Food Resource Assessment (C-HCFRA) data from 470 mothers who were randomly recruited by promotora-researchers. Participants from colonias near two small towns in two South Texas counties participated in an in-home community and household assessment. Interviewer-administered surveys collected data in Spanish on sociodemographics, federal food assistance program participation, and food security status. Frequencies and bivariate correlations were examined while a random-effects logistic regression model with backward elimination was used to determine correlates of childhood hunger. Hunger among children was reported in 51% (n = 239) of households in this C-HCFRA sample. Bivariate analyses revealed that hunger status was associated with select maternal characteristics, such as lower educational attainment and Mexican nativity, and household characteristics, including household composition, reliance on friend or neighbor for transportation, food purchase at dollar stores and from neighbors, and participation in school-based nutrition programs. A smaller percentage of households with child hunger participated in school-based nutrition programs (51%) or used alternative food sources, while 131 households were unable to give their child or children a balanced meal during the school year and 145 households during summer months. In the random effects model (RE = small town), increased household

  9. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  10. Every apple has a voice: using stable isotopes to teach about food sourcing and the water cycle

    Science.gov (United States)

    Oerter, Erik; Malone, Molly; Putman, Annie; Drits-Esser, Dina; Stark, Louisa; Bowen, Gabriel

    2017-07-01

    Agricultural crops such as fruits take up irrigation and meteoric water and incorporate it into their tissue (fruit water) during growth, and the geographic origin of a fruit may be traced by comparing the H and O stable isotope composition (δ2H and δ18O values) of fruit water to the global geospatial distribution of H and O stable isotopes in precipitation. This connection between common fruits and the global water cycle provides an access point to connect with a variety of demographic groups to educate about isotope hydrology and the water cycle. Within the context of a 1-day outreach activity designed for a wide spectrum of participants (high school students, undergraduate students, high school science teachers) we developed introductory lecture materials, in-class participatory demonstrations of fruit water isotopic measurement in real time, and a computer lab exercise to couple actual fruit water isotope data with open-source online geospatial analysis software. We assessed learning outcomes with pre- and post-tests tied to learning objectives, as well as participant feedback surveys. Results indicate that this outreach activity provided effective lessons on the basics of stable isotope hydrology and the water cycle. However, the computer lab exercise needs to be more specifically tailored to the abilities of each participant group. This pilot study provides a foundation for further development of outreach materials that can effectively engage a range of participant groups in learning about the water cycle and the ways in which humans modify the water cycle through agricultural activity.

  11. Associations between Sugar Intake from Different Food Sources and Adiposity or Cardio-Metabolic Risk in Childhood and Adolescence: The Korean Child–Adolescent Cohort Study

    Directory of Open Access Journals (Sweden)

    Yang-Im Hur

    2015-12-01

    Full Text Available The increasing prevalence of childhood obesity is a serious public health problem associated with co-morbidities in adulthood, as well as childhood. This study was conducted to identify associations between total sugar intake and sugar intake from different foods (fruit, milk, and sugar-sweetened beverages (SSBs, and adiposity and continuous metabolic syndrome scores (cMetS among Korean children and adolescents using cohort data. The study subjects were children (n = 770 who participated in the 4th year (2008 of the Korean Child–Adolescent Cohort Study (KoCAS. Dietary intake data were collected via three-day 24-h food records, and sugar intake was calculated for the total sugar content of foods using our database compiled from various sources. Anthropometric measurements, assessments of body composition, and blood sample analysis were performed at baseline and at follow-up four years later. The cMetS was calculated based on waist circumference, triglycerides, high-density lipoprotein cholesterol, glucose, and mean arterial blood pressure. According to multiple linear regression analysis, there were no significant associations between total sugar intake and adiposity and cMetS. However, higher intake of fruit sugar at baseline was significantly associated with lower body mass index (BMI z-scores and body fat percentages at baseline (β = −0.10, p = 0.02 and β = −0.78, p < 0.01, respectively. At follow-up, sugar intake from fruit at baseline was still negatively associated with the above outcomes, but only the relationship with BMI z-scores retained statistical significance (β = −0.08, p < 0.05. There was a significant positive relationship between consumption of sugar from SSBs and cMetS at baseline (β = 0.04, p = 0.02, but that relationship was not observed at follow-up (p = 0.83. Differences in consumption sugars from fruit and SSBs might play an important role in the risk of adiposity and metabolic disease in children and

  12. Food Sources and Accessibility and Waste Disposal Patterns across an Urban Tropical Watershed: Implications for the Flow of Materials and Energy

    Directory of Open Access Journals (Sweden)

    Diana C. Garcia-Montiel

    2014-03-01

    Full Text Available Appraising the social-ecological processes influencing the inflow, transformation, and storage of materials and energy in urban ecosystems requires scientific attention. This appraisal can provide an important tool for assessing the sustainability of cities. Socioeconomic activities are mostly responsible for these fluxes, which are well manifested in the household unit. Human behavior associated with cultural traditions, belief systems, knowledge, and lifestyles are important drivers controlling the transfer of materials throughout the urban environment. Within this context, we explored three aspects of household consumption and waste disposal activities along the Río Piedras Watershed in the San Juan metropolitan area of Puerto Rico. These included: the source of food consumed by residents, recycling activities, and trends in connection to the municipality's sewerage system. We randomly interviewed 440 households at 6 sites along the watershed. We also conducted analysis to estimate accessibility to commercial food services for residents in the study areas. Our surveys revealed that nearly all interviewed households (~97% consumed products from supermarkets. In neighborhoods of the upper portion of the watershed, where residential density is low with large areas of vegetative cover, more than 60% of residents consumed food items cultivated in their yards. Less than 36% of residents in the in densely urbanized parts of the lower portion of the watershed consumed items from their yards. Accessibility to commercial stores for food consumption contrasted among study sites. Recycling activities were mostly carried out by residents in the lower portion of the watershed, with better access to recycling programs provided by the municipality. The surveys also revealed that only 4 to 17% of residences in the upper watershed are connected to the sewerage system whereas the large majority uses septic tanks for septic water disposal. For these residents

  13. Scientific Opinion on Review of the European Union Summary Report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks—Terms of reference 2 to 7

    OpenAIRE

    EFSA Panel on Animal Health and Welfare (AHAW)

    2013-01-01

    The Animal Health and Welfare (AHAW) Panel of the European Food Safety Authority (EFSA) has evaluated the European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks by EFSA and ECDC (the report) with regard to data needs and subsequent analyses that will minimise the impact of existing data gaps and inconsistencies. Specific assessments performed for bovine tuberculosis, echinococcosis, Q fever, brucellosis, rabies, cysticercosis and tularaemia s...

  14. Top food sources contributing to vitamin D intake and the association of ready-to-eat cereal and breakfast consumption habits to vitamin D intake in Canadians and United States Americans.

    Science.gov (United States)

    Hill, Kathleen M; Jonnalagadda, Satya S; Albertson, Ann M; Joshi, Nandan A; Weaver, Connie M

    2012-08-01

    This study aimed to determine dietary vitamin D intake of U.S. Americans and Canadians and contributions of food sources to total vitamin D intake. Total of 7- or 14-d food intake data were analyzed for vitamin D by a proprietary nutrient assessment methodology that utilized food intake data from the Natl. Eating Trends(®) service, portion size data from NHANES 1999-2004, and nutrient values using the Univ. of Minnesota's Nutrition Data System for Research software. Study participants were 7837 U.S. Americans and 4025 Canadians, ≥2-y-old males and females. The main outcome measures were total dietary vitamin D intake, percent contribution of foods to total vitamin D intake, and vitamin D intake by cereal and breakfast consumption habits. ANOVA was used to determine differences in means or proportions by age and gender and according to breakfast consumption habits. Mean vitamin D intake ranged from 152 to 220 IU/d. Less than 2% of participants in all age groups from the United States and Canada met the 2011 Recommended Daily Allowance (RDA) for vitamin D from foods. Milk, meat, and fish were the top food sources for vitamin D for both Americans and Canadians. Ready-to-eat (RTE) cereal was a top 10 source of vitamin D for Americans but not Canadians. Vitamin D intake was higher with more frequent RTE cereal and breakfast consumption in both countries, largely attributable to greater milk intake. Most U.S. Americans and Canadians do not meet the 2011 Inst. of Medicine recommended daily allowance (RDA) for vitamin D for their age groups from foods. Increasing breakfast and cereal consumption may be a useful strategy to increase dietary vitamin D intake to help individuals meet the RDA for vitamin D, particularly by increasing milk intake. However, it is likely that additional food fortification or vitamin D supplementation is required to achieve the RDA. © 2012 Institute of Food Technologists®

  15. Every apple has a voice: using stable isotopes to teach about food sourcing and the water cycle

    Directory of Open Access Journals (Sweden)

    E. Oerter

    2017-07-01

    Full Text Available Agricultural crops such as fruits take up irrigation and meteoric water and incorporate it into their tissue (fruit water during growth, and the geographic origin of a fruit may be traced by comparing the H and O stable isotope composition (δ2H and δ18O values of fruit water to the global geospatial distribution of H and O stable isotopes in precipitation. This connection between common fruits and the global water cycle provides an access point to connect with a variety of demographic groups to educate about isotope hydrology and the water cycle. Within the context of a 1-day outreach activity designed for a wide spectrum of participants (high school students, undergraduate students, high school science teachers we developed introductory lecture materials, in-class participatory demonstrations of fruit water isotopic measurement in real time, and a computer lab exercise to couple actual fruit water isotope data with open-source online geospatial analysis software. We assessed learning outcomes with pre- and post-tests tied to learning objectives, as well as participant feedback surveys. Results indicate that this outreach activity provided effective lessons on the basics of stable isotope hydrology and the water cycle. However, the computer lab exercise needs to be more specifically tailored to the abilities of each participant group. This pilot study provides a foundation for further development of outreach materials that can effectively engage a range of participant groups in learning about the water cycle and the ways in which humans modify the water cycle through agricultural activity.

  16. Comparison of congener profiles of polychlorinated biphenyls between Yu-cheng children and a potential food source

    Energy Technology Data Exchange (ETDEWEB)

    Lung Shih-Chun Candice [Research Center for Environmental Changes, Academia Sinica, Taipei (Taiwan); Guo Yu-Liang Leon; Chang Ho-Yuan [Dept. of Environmental and Occupational Health, Coll. of Medicine, National Cheng Kung Univ., Tainan (Taiwan)

    2004-09-15

    In 1979, about two thousand people in central Taiwan were intoxicated by consumption of the rice oil that was contaminated with polychlorinated biphenyls (PCBs). This ''Yu-cheng'' incident was one of the two human tragedies which people ingested substantial amounts of PCBs within a short period of time. Some of the follow-up epidemiological studies focused on the children born to the exposed mothers, the Yu-cheng children, since they could be exposed to PCBs via breast-feeding or transplacental transfer. This report presents the results of the serum PCB levels of the 21 Yu-cheng children with a congener-specific analysis. On the other hand, fish consumption is thought to be the single most important exposure route to PCBs to the general public; thus, it is crucial to understand PCB exposure from fish consumption. In a separated study to assess PCB contamination in fish, PCB congener concentrations in tilapia (Oreochromis hybrids), the most popular fish in Taiwan, were evaluated. The consumption quantity of tilapia is the highest throughout the Island. It is mostly farmed in fresh water but can also be bred in saltwater. This report presents the concentrations and profiles in the serums of the Yu-cheng children. The congener profile is compared with PCB profile in the serum of Yu-cheng women reported previously and that in one of the potentially significant exposure source, tilapia, conducted in a separated work. Remarkable similarity between the profile of Yu-cheng children and that of the tilapia is revealed and discussed.

  17. Need and seek for dietary micronutrients: endogenous regulation, external signalling and food sources of carotenoids in new world vultures.

    Directory of Open Access Journals (Sweden)

    Guillermo Blanco

    Full Text Available Among birds, vultures show low concentrations of plasma carotenoids due to the combination of their large size, general dull colouration and a diet based on carrion. We recorded the concentration of each carotenoid type present in plasma of the Andean condor (Vultur gryphus according to age and sex, that determine colour signalling and dominance hierarchies in the carcasses. We compared the carotenoid profile in wild condors with that of captive condors fed with a controlled diet of flesh to test the hypothesis that wild individuals could acquire extra carotenoids from vegetal matter contained in carcass viscera and fresh vegetation. Wild American black vultures (Coragyps atratus were also sampled to evaluate the potential influence of colouration in the integument on absorption and accumulation patterns of plasma carotenoids. A remarkably higher concentration of lutein than β-carotene was found in wild condors, while the contrary pattern was recorded in American black vultures and captive condors. We found a consistent decrease in all plasma carotenoids with age, and a lower concentration of most xanthophylls in male compared to female wild condors. Positive correlations of all carotenoids indicated general common absorption and accumulation strategies or a single dietary source containing all pigments found in plasma. The comparatively low total concentration of carotenoids, and especially of lutein rather than β-carotene, found in captive condors fed with a diet restricted to flesh supports the hypothesis that Andean condors can efficiently acquire carotenoids from vegetal matter in the wild. Andean condors seem to be physiologically more competent in the uptake or accumulation of xanthophylls than American black vultures, which agrees with the use of colour-signalling strategies in sexual and competitive contexts in the Andean condor. This study suggests that vultures may use dietary vegetal supplements that provide pigments and

  18. Need and Seek for Dietary Micronutrients: Endogenous Regulation, External Signalling and Food Sources of Carotenoids in New World Vultures

    Science.gov (United States)

    Blanco, Guillermo; Hornero-Méndez, Dámaso; Lambertucci, Sergio A.; Bautista, Luis M.; Wiemeyer, Guillermo; Sanchez-Zapata, José A.; Garrido-Fernández, Juan; Hiraldo, Fernando; Donázar, José A.

    2013-01-01

    Among birds, vultures show low concentrations of plasma carotenoids due to the combination of their large size, general dull colouration and a diet based on carrion. We recorded the concentration of each carotenoid type present in plasma of the Andean condor (Vultur gryphus) according to age and sex, that determine colour signalling and dominance hierarchies in the carcasses. We compared the carotenoid profile in wild condors with that of captive condors fed with a controlled diet of flesh to test the hypothesis that wild individuals could acquire extra carotenoids from vegetal matter contained in carcass viscera and fresh vegetation. Wild American black vultures (Coragyps atratus) were also sampled to evaluate the potential influence of colouration in the integument on absorption and accumulation patterns of plasma carotenoids. A remarkably higher concentration of lutein than β-carotene was found in wild condors, while the contrary pattern was recorded in American black vultures and captive condors. We found a consistent decrease in all plasma carotenoids with age, and a lower concentration of most xanthophylls in male compared to female wild condors. Positive correlations of all carotenoids indicated general common absorption and accumulation strategies or a single dietary source containing all pigments found in plasma. The comparatively low total concentration of carotenoids, and especially of lutein rather than β-carotene, found in captive condors fed with a diet restricted to flesh supports the hypothesis that Andean condors can efficiently acquire carotenoids from vegetal matter in the wild. Andean condors seem to be physiologically more competent in the uptake or accumulation of xanthophylls than American black vultures, which agrees with the use of colour-signalling strategies in sexual and competitive contexts in the Andean condor. This study suggests that vultures may use dietary vegetal supplements that provide pigments and micronutrients that are

  19. Nuclear radiation and agricultural production - the food chain as a pathway for radionuclide (toxic trace elements) migration from the source to the ecosystem

    Energy Technology Data Exchange (ETDEWEB)

    Giacintov, P [Statni Veterinarni Ustav, Brno (Czechoslovakia)

    1978-01-01

    The transport of /sup 131/I from the source into the atmosphere, its concentration in the atmosphere above agricultural land, its deposition in the vegetative cover and factors which affect the deposition rate, its retention and the effects of weather conditions are described as an example of the transport of radionuclides from the source to the ecosystem and into the human body. The relation is given for the calculation of the effective half-life of /sup 131/I retention in plants. In steady state during permanent /sup 131/I release the effective life-time is 7.2 days on the average. The transport is described of /sup 131/I from the vegetation into the organism of the cow, into milk and from there into the human body. The intake of /sup 131/I depends on the amount of milk consumed which again depends on age, sex and dietary habits. For children the maximum permissible concentration of /sup 131/I in milk is 15 to 40 pCi/l, based on a dose limit of 90 mrem/y to the thyroid. The knowledge of all factors related to /sup 131/I transport through the food chain to the human body allows determining the permissible level of /sup 131/I release from a nuclear power plant.

  20. Effects of de-oiled palm kernel cake based fertilizers on sole maize ...

    African Journals Online (AJOL)

    AJL

    2012-03-08

    Mar 8, 2012 ... formulations on the yield of sole maize and cassava crops. Two de-oiled palm ..... establishment of nitrogen fixing bacteria in the rhizosphere. Microb ... Biological, and Social Sciences Research, 2nd Edition. Optimal Publ.

  1. AFSC/RACE/GAP/Nichol: Archival tag depth and temperature data from northern rock sole

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Depth data from archival tags on northern rock sole (Lepidopsetta polyxystra) were examined to assess whether fish used tidal currents to aid horizontal migration....

  2. Clinical application of platelet-rich fibrin as the sole grafting material in periodontal intrabony defects

    Directory of Open Access Journals (Sweden)

    Yu-Chao Chang

    2011-09-01

    Conclusions: From a clinical and radiologic point of view at 6 months after surgery, the use of PRF as the sole grafting material seems to be an effective modality of regenerative treatment for periodontal intrabony defects.

  3. 31 CFR 353.36 - Payment during life of sole owner.

    Science.gov (United States)

    2010-07-01

    ...) FISCAL SERVICE, DEPARTMENT OF THE TREASURY BUREAU OF THE PUBLIC DEBT REGULATIONS GOVERNING DEFINITIVE... of sole owner. A savings bond registered in single ownership form (i.e., without a coowner or...

  4. 31 CFR 315.36 - Payment during life of sole owner.

    Science.gov (United States)

    2010-07-01

    ...) FISCAL SERVICE, DEPARTMENT OF THE TREASURY BUREAU OF THE PUBLIC DEBT REGULATIONS GOVERNING U.S. SAVINGS... § 315.36 Payment during life of sole owner. A savings bond registered in single ownership form (i.e...

  5. Amyotrophic Lateral Sclerosis Presenting Respiratory Failure as the Sole Initial Manifestation

    Directory of Open Access Journals (Sweden)

    Fuyuki Tateno

    2014-08-01

    Full Text Available It is rare that amyotrophic lateral sclerosis (ALS presents with respiratory failure as the sole initial manifestation. A 72-year-old man with mild chronic obstructive pulmonary disease developed exertional dyspnea for 13 months. He then progressed to limb weakness that led to the diagnosis of ALS. Although rare, ALS can present with respiratory failure as the sole initial manifestation more than 1 year prior to limb weakness.

  6. Structural evolution of the Semail Ophiolite metamorphic sole, Wadi Hawasina and Northern Jebel Nakhl Culmination, Oman

    Science.gov (United States)

    Hurtado, C.; Bailey, C.; Visokay, L.; Scharf, A.

    2017-12-01

    The Semail ophiolite is the world's largest and best-exposed ophiolite sequence, however the processes associated with both oceanic detachment and later emplacement onto the Arabian continental margin remain enigmatic. This study examines the upper mantle section of the ophiolite, its associated metamorphic sole, and the autochthonous strata beneath the ophiolite at two locations in northern Oman. Our purpose is to understand the structural history of ophiolite emplacement and evaluate the deformation kinematics of faulted and sheared rocks in the metamorphic sole. At Wadi Hawasina, the base of the ophiolite is defined by a 5- to 15-m thick zone of penetratively-serpentinized mylonitic peridotite. Kinematic indicators record top-to-the SW (reverse) sense-of-shear with a triclinic deformation asymmetry. An inverted metamorphic grade is preserved in the 300- to 500-m thick metamorphic sole that is thrust over deep-water sedimentary rocks of the Hawasina Group. The study site near Buwah, in the northern Jebel Nakhl culmination, contains a N-to-S progression of mantle peridotite, metamorphic sole, and underlying Jurassic carbonates. Liswanite crops out in NW-SE trending linear ridges in the peridotite. The metamorphic sole includes well-foliated quartzite, metachert, and amphibolite. Kinematic evidence indicates that the liswanite and a serpentinized mélange experienced top to-the north (normal) sense-of-shear. Two generations of E-W striking, N-dipping normal faults separate the autochthonous sequence from the metamorphic sole, and also cut out significant sections of the metamorphic sole. Fabric analysis reveals that the metamorphic sole experienced flattening strain (K<0.2) that accumulated during pure shear-dominated general shear (Wk<0.4). Normal faulting and extension at the Buwah site indicates that post-ophiolite deformation is significant in the Jebel Akhdar and Jebel Nakhl culminations.

  7. Simulating the Behavioural Effects of Welfare Reforms among Sole Parents in Australia

    OpenAIRE

    Alan Duncan; Mark N. Harris

    2001-01-01

    This paper derives and estimates an econometric model of labour supply among sole parents in Australia, using modelling techniques which treat the labour supply decision as a utility maximising choice between a given number of discrete states. In estimation, we control for random preference heterogeneity as well as Þxed and search costs. Using our econometric model, we look at the e.ects of actual and hypothetical welfare policy reforms on the employment choices of sole parents in Australia. ...

  8. CONTRIBUTIONS TO DIVERSIFY SOLES MOULDS THAT FORMS DIRECTLY ON FACES SHOES

    Directory of Open Access Journals (Sweden)

    IONESCU Cozmin

    2015-05-01

    Full Text Available The classical moulds which are currently used for forming the soles directly on the uppers, allow obtaining one sole model. One mould for each foot is made, and at least one mould for each size number in the size number series. To manufacture one single sole model in the sizes series an average set of 16 moulds are needed. Changing the model implies the entire production of a new set of moulds. Therefore, a large diversification of the soles requires the manufacturing a quantity of moulds sets equal with the quantity of sole models. In this paper are presented solutions to obtain more cavity shapes in the same mould, through the use of modular interchangeable pieces. The moulds with versatile cavities have the same functional characteristics as the moulds with unique cavities, are usable on the same type of machines and can be used independently or together with the classical moulds. A brief analysis on the technological processes for manufacturing moulds with versatile cavities reveals a significant lowering of the manufacturing time for moulds in which will be obtained other sole models. This is due to the fact that some of the mould parts are reused. In co