Bacillus effect on the germination and growth of tomato seedlings (Solanum lycopersicum L.

Directory of Open Access Journals (Sweden)

Teresa Cabra Cendales

2017-01-01

Full Text Available The capacity to solubilize phosphate and to produce indole compounds Indole Acetic Acid type, was evaluated in 15 strains isolated from castor bean lignocellulosic residues (Ricinus communis. To determine the solubilizing activity of phosphates a qualitative test by using Pikovskaya culture medium was employed and for the evaluation of the production of indole compounds (IAA a Salkowsky colorimetric analysis technique was applied. Among the microorganisms tested, the Bacillus pumilus GIBI 206 demonstrated capacity to solubilize phosphates and Bacillus subtilis GIBI 200 showed of capacity to solubilize phosphates and to produce Indoleacetic Acid (IAA. To determine the effect of the Bacillus subtilis strain on germination and growth promotion, tomato seeds (Solanum lycopersicum ‘Santa Clara’ were inoculated; the inoculation of the seeds along with the microorganism revealed statistically significant differences, during the germination stage compared to the control treatment. Nevertheless, it revealed a positive influence on the development of tomato plants, originating a significant increase on the mass and length of its stem and root. The results of this research offer the possibility of using the Bacillus subtilis as a growth promoter in tomato seedlings and in the formulation of bio-products.

Transformation of PRT6 RNAi construct into tomato (Solanum lycopersicum) cv. Micro-Tom

Science.gov (United States)

Suka, Intan Elya; Chew, Bee Lynn; Goh, Hoe-Han; Isa, Nurulhikma Md

2018-04-01

PROTEOLYSIS 6 plays major role in the N-end rule pathway as N-recognin which functions as E3 ligase enzyme. It mediates ubiquitin processes that lead to degradation of unstable substrate protein. The aim of the current study is to transform the PRT6 gene into tomato (Solanum lycopersicum) from the cultivar Micro-Tom and to investigate its function in regulating ripening in tomato fruits. The PRT6_RNAi construct was successfully transformed into Agrobacterium C58 via heat shock method and transformed into seven days old cotyledon explants. Factors affecting transformation efficiency such as co-cultivation time and type of plant growth regulator combination were evaluated. Results from this study found that pre-cultured cotyledons from seven days old seedlings incubated for 2 days in co-cultivation medium increased shoot regeneration. Plant growth hormones zeatin combine with auxin produced a higher number of callus formation but lower shoot proliferation and transformation frequency compared to treatments of single plant hormone in the selection medium. Polymerase chain reaction (PCR) was performed on the regenerated shoots to confirm the integration of PRT6 fragment into the genome of transgenic plants. Based on PCR analysis, all putative shoots were positive transformants.

Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum.

Science.gov (United States)

Huang, Shengxiong; Gao, Yongfeng; Liu, Jikai; Peng, Xiaoli; Niu, Xiangli; Fei, Zhangjun; Cao, Shuqing; Liu, Yongsheng

2012-06-01

The WRKY transcription factors have been implicated in multiple biological processes in plants, especially in regulating defense against biotic and abiotic stresses. However, little information is available about the WRKYs in tomato (Solanum lycopersicum). The recent release of the whole-genome sequence of tomato allowed us to perform a genome-wide investigation for tomato WRKY proteins, and to compare these positively identified proteins with their orthologs in model plants, such as Arabidopsis and rice. In the present study, based on the recently released tomato whole-genome sequences, we identified 81 SlWRKY genes that were classified into three main groups, with the second group further divided into five subgroups. Depending on WRKY domains' sequences derived from tomato, Arabidopsis and rice, construction of a phylogenetic tree demonstrated distinct clustering and unique gene expansion of WRKY genes among the three species. Genome mapping analysis revealed that tomato WRKY genes were enriched on several chromosomes, especially on chromosome 5, and 16 % of the family members were tandemly duplicated genes. The tomato WRKYs from each group were shown to share similar motif compositions. Furthermore, tomato WRKY genes showed distinct temporal and spatial expression patterns in different developmental processes and in response to various biotic and abiotic stresses. The expression of 18 selected tomato WRKY genes in response to drought and salt stresses and Pseudomonas syringae invasion, respectively, was validated by quantitative RT-PCR. Our results will provide a platform for functional identification and molecular breeding study of WRKY genes in tomato and probably other Solanaceae plants.

EFFECTS OF NITROGEN NUTRIENT ON THE PHOTOSYNTHETIC PIGMENTS ACCUMULATION AND YIELD OF SOLANUM LYCOPERSICUM

Directory of Open Access Journals (Sweden)

Adekunle Ajayi ADELUSI

2015-12-01

Full Text Available This study investigated photosynthetic pigment accumulation and yield of Solanum lycopersicum so as to ascertain the maximum concentration of nitrogen needed for optimum production. Seeds of S. lycopersicum tagged with VG-TH-017 were firstly raised in nursery bed. At the end of 28th day after sowing, the seedlings with uniform height were transplanted into experimental pots with 4 seedlings per pot under greenhouse. All the experimental pots were 40 in total, 4 levels of nitrogen (KNO3 and NH4NO3 treatment (n, N, 5N, 10N with 10 replicates. All the plants in the four treatments received 200ml of distilled water at 6a.m. in the morning every day. At 6p.m. in the evening, 100 ml of the differential treatments were applied. The photosynthetic pigments were determined spectrophotometrically. The number of flowers and fruits per plant per pot were counted and recorded. The fruit lengths and fruit diameters in each treatment were determined with the use of a Vernier Caliper. The fruits biomass were also determined. The 10N-plants and 5N-plants had leaves with deep-green colouration indicating an increase in chlorophyll content as well as an increase in the photosynthetic capacity. The highest number of flowers and early flowering discovered in 10N-plants and 5N-plants. The best yield was obtained in the treatments for the 5N-plants in which the concentration of nitrogen in the nutrient solution had been increased to a factor of 5. It is therefore suggested that when the seeds of tomato plants VG-TH-017 are to be grown, the 5N treatment is the most suitable level of application.

Phytochrome Interacting Factors (PIFs in Solanum lycopersicum: Diversity, Evolutionary History and Expression Profiling during Different Developmental Processes.

Directory of Open Access Journals (Sweden)

Daniele Rosado

Full Text Available Although the importance of light for tomato plant yield and edible fruit quality is well known, the PHYTOCHROME INTERACTING FACTORS (PIFs, main components of phytochrome-mediated light signal transduction, have been studied almost exclusively in Arabidopsis thaliana. Here, the diversity, evolution and expression profile of PIF gene subfamily in Solanum lycopersicum was characterized. Eight tomato PIF loci were identified, named SlPIF1a, SlPIF1b, SlPIF3, SlPIF4, SlPIF7a, SlPIF7b, SlPIF8a and SlPIF8b. The duplication of SlPIF1, SlPIF7 and SlPIF8 genes were dated and temporally coincided with the whole-genome triplication event that preceded tomato and potato divergence. Different patterns of mRNA accumulation in response to light treatments were observed during seedling deetiolation, dark-induced senescence, diel cycle and fruit ripening. SlPIF4 showed similar expression profile as that reported for A. thaliana homologs, indicating an evolutionary conserved function of PIF4 clade. A comprehensive analysis of the evolutionary and transcriptional data allowed proposing that duplicated SlPIFs have undergone sub- and neofunctionalization at mRNA level, pinpointing the importance of transcriptional regulation for the maintenance of duplicated genes. Altogether, the results indicate that genome polyploidization and functional divergence have played a major role in diversification of the Solanum PIF gene subfamily.

Assessment of reference gene stability influenced by extremely divergent disease symptoms in Solanum lycopersicum L.

Science.gov (United States)

Wieczorek, Przemysław; Wrzesińska, Barbara; Obrępalska-Stęplowska, Aleksandra

2013-12-01

Tomato (Solanum lycopersicum L.) is one of the most important vegetables of great worldwide economic value. The scientific importance of the vegetable results from the fact that the genome of S. lycopersicum has been sequenced. This allows researchers to study fundamental mechanisms playing an essential role during tomato development and response to environmental factors contributing significantly to cell metabolism alterations. Parallel with the development of contemporary genetics and the constant increase in sequencing data, progress has to be aligned with improvement of experimental methods used for studying genes functions and gene expression levels, of which the quantitative polymerase chain reaction (qPCR) is still the most reliable. As well as with other nucleic acid-based methods used for comparison of the abundance of specific RNAs, the RT-qPCR data have to be normalised to the levels of RNAs represented stably in a cell. To achieve the goal, the so-called housekeeping genes (i.e., RNAs encoding, for instance, proteins playing an important role in the cell metabolism or structure maintenance), are used for normalisation of the target gene expression data. However, a number of studies have indicated the transcriptional instability of commonly used reference genes analysed in different situations or conditions; for instance, the origin of cells, tissue types, or environmental or other experimental conditions. The expression of ten common housekeeping genes of S. lycopersicum, namely EF1α, TUB, CAC, EXP, RPL8, GAPDH, TBP, ACT, SAND and 18S rRNA were examined during viral infections of tomato. Changes in the expression levels of the genes were estimated by comparison of the non-inoculated tomato plants with those infected with commonly known tomato viral pathogens, Tomato torrado virus, Cucumber mosaic virus, Tobacco mosaic virus and Pepino mosaic virus, inducing a diverse range of disease symptoms on the common host, ranging from mild leaves chlorosis to

cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

Directory of Open Access Journals (Sweden)

Krittaya Supathaweewat

2013-10-01

Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

Science.gov (United States)

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Phenotypic and molecular characterization of a tomato (Solanum lycopersicum L.) F2 population segregation for improving shelf life.

Science.gov (United States)

Yogendra, K N; Ramanjini Gowda, P H

2013-02-27

Breeding for better quality fruits is a major focus for tomatoes, which are continuously subjected to post-harvest losses. Several methods have been used to improve the fruit shelf life of tomatoes, including the use of ripening gene mutants of Solanum lycopersicum. We developed extended shelf-life tomato hybrids with better quality fruits using ripening mutants. Nine tomato crosses were developed using 3 fruit ripening gene mutants of S. lycopersicum [alcobaca (alc), non-ripening, and ripening inhibitor] and 3 agronomically superior Indian cultivars ('Sankranti', 'Vaibhav', and 'Pusaruby') with short shelf life. The hybrid progenies developed from alc x 'Vaibhav' had the highest extended shelf life (up to 40 days) compared with that of other varieties and hybrids. Further, the F(2) progenies of alc x 'Vaibhav' were evaluated for fruit quality traits and yield parameters. A wide range of genetic variability was observed in shelf life (5-106 days) and fruit firmness (0.55-10.65 lbs/cm(2)). The potential polymorphic simple sequence repeat markers underlying shelf life traits were identified in an F(2) mapping population. The marker association with fruit quality traits and yield was confirmed with single-marker analysis and composite interval mapping. The genetic parameters analyzed in the parents and F(1) and F(2) populations indicated that the cross between the cultivar 'Vaibhav' and ripening gene mutant alc yielded fruit with long shelf life and good quality.

Pollination deficit in open-field tomato crops (Solanum lycopersicum L., Solanaceae in Rio de Janeiro state, Southeast Brazil

Directory of Open Access Journals (Sweden)

Maria Cristina Gaglianone

2013-10-01

Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.

Pollination deficit in open-field tomato crops (Solanum lycopersicum L., Solanaceae in Rio de Janeiro state, Southeast Brazil

Directory of Open Access Journals (Sweden)

Mariana Scaramussa Deprá

2014-02-01

Full Text Available More than 70% of world’s crops benefit from biotic pollination, and bees are their main pollinators. Despite the fact that some of these insects have been broadly studied, understanding the interactions between plant crops and their pollinators with a local scale approach is necessary when aiming to apply proper protective and management measures to pollinators and their respective crops. In this context, we analyzed the pollination status of open-field tomato crops (Solanum lycopersicum L., regarding fruit-set, visitation rate and the quality of fruits. We recorded the formation of fruits through spontaneous self-pollination and open-pollination, and the occurrence of pollinators in 24 areas of open-field tomato crops. We performed experiments of apomixis, spontaneous self-pollination, manual cross pollination and supplemental cross pollination (simulating the pollinator behavior in a greenhouse. The fruit quality was evaluated according to circumference, weight, volume and number of seeds. Higher production of fruits after open-pollination compared to spontaneous self-pollination indicates the importance of pollinators to increment productivity of S. lycopersicum in the study area. The circumference and the number of seeds from tomatoes of the greenhouse plantation did not differ between spontaneous self-pollination and the manual cross pollination. In the open-field crops the number of seeds was higher for fruits resulting from open-pollination. Our results indicate that the importance of bees is mainly related to the increase in fruit production, thus incrementing the productivity of tomato crops.

Respiratory behavior of turning stage mature tomato (Solanum lycopersicum L. under closed system at different temperature

Directory of Open Access Journals (Sweden)

Ranjeet Singh

2013-01-01

Full Text Available The respiration rate and respiratory quotient of mature tomato (Solanum lycopersicum L. cv. ‘Himsona’ fruits harvested at the turning stage were determined under closed system at 5, 10, 15, 20, 25 and 35 °C (ambient temperatures. The rate of respiration was higher at the start of the experiment and gradually declined as the storage period prolonged, before becoming almost constant. The steady-state respiration rate for CO2 evolution were observed to be 14.35, 15.04,19.95, 21.7 and 20.3 ml/kg-h at 10 °C, 15 °C, 20 °C, 25 °C and 35 °C, respectively. The RQ values for tomato varied from 0.55 to 1.10 with time under the experimental conditions. The respiration rate at steady state based on carbon dioxide evolution and oxygen consumption in closed condition decreased by about 46 % and 73 %, respectively relative to initial respiration rate values at normal air atmosphere. The results suggest that the respiration rate of tomato increased with temperature and decrease with storage time.

[Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

Science.gov (United States)

Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

2016-05-01

Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

Diversity, distribution and dynamics of full-length Copia and Gypsy LTR retroelements in Solanum lycopersicum.

Science.gov (United States)

Paz, Rosalía Cristina; Kozaczek, Melisa Eliana; Rosli, Hernán Guillermo; Andino, Natalia Pilar; Sanchez-Puerta, Maria Virginia

2017-10-01

Transposable elements are the most abundant components of plant genomes and can dramatically induce genetic changes and impact genome evolution. In the recently sequenced genome of tomato (Solanum lycopersicum), the estimated fraction of elements corresponding to retrotransposons is nearly 62%. Given that tomato is one of the most important vegetable crop cultivated and consumed worldwide, understanding retrotransposon dynamics can provide insight into its evolution and domestication processes. In this study, we performed a genome-wide in silico search of full-length LTR retroelements in the tomato nuclear genome and annotated 736 full-length Gypsy and Copia retroelements. The dispersion level across the 12 chromosomes, the diversity and tissue-specific expression of those elements were estimated. Phylogenetic analysis based on the retrotranscriptase region revealed the presence of 12 major lineages of LTR retroelements in the tomato genome. We identified 97 families, of which 77 and 20 belong to the superfamilies Copia and Gypsy, respectively. Each retroelement family was characterized according to their element size, relative frequencies and insertion time. These analyses represent a valuable resource for comparative genomics within the Solanaceae, transposon-tagging and for the design of cultivar-specific molecular markers in tomato.

Genome-wide identification and characterization of GRAS transcription factors in tomato (Solanum lycopersicum).

Science.gov (United States)

Niu, Yiling; Zhao, Tingting; Xu, Xiangyang; Li, Jingfu

2017-01-01

Solanum lycopersicum , belonging to Solanaceae, is one of the commonly used model plants. The GRAS genes are transcriptional regulators, which play a significant role in plant growth and development, and the functions of several GRAS genes have been recognized, such as, axillary shoot meristem formation, radial root patterning, phytohormones (gibberellins) signal transduction, light signaling, and abiotic/biotic stress; however, only a few of these were identified and functionally characterized. In this study, a gene family was analyzed comprehensively with respect to phylogeny, gene structure, chromosomal localization, and expression pattern; the 54 GRAS members were screened from tomato by bioinformatics for the first time. The GRAS genes among tomato, Arabidopsis , rice, and grapevine were rebuilt to form a phylogenomic tree, which was divided into ten groups according to the previous classification of Arabidopsis and rice. A multiple sequence alignment exhibited the typical GRAS domain and conserved motifs similar to other gene families. Both the segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in tomato; the expression patterns across a variety of tissues and biotic conditions revealed potentially different functions of GRAS genes in tomato development and stress responses. Altogether, this study provides valuable information and robust candidate genes for future functional analysis for improving the resistance of tomato growth.

Detection of biosynthetic gene and phytohormone production by endophytic actinobacteria associated with Solanum lycopersicum and their plant-growth-promoting effect.

Science.gov (United States)

Passari, Ajit Kumar; Chandra, Preeti; Zothanpuia; Mishra, Vineet Kumar; Leo, Vincent Vineeth; Gupta, Vijai Kumar; Kumar, Brijesh; Singh, Bhim Pratap

2016-10-01

In the present study, fifteen endophytic actinobacterial isolates recovered from Solanum lycopersicum were studied for their antagonistic potential and plant-growth-promoting (PGP) traits. Among them, eight isolates showed significant antagonistic and PGP traits, identified by amplification of the 16S rRNA gene. Isolate number DBT204, identified as Streptomyces sp., showed multiple PGP traits tested in planta and improved a range of growth parameters in seedlings of chili (Capsicum annuum L.) and tomato (S. lycopersicum L.). Further, genes of indole acetic acid (iaaM) and 1-aminocyclopropane-1-carboxylate (ACC) deaminase (acdS) were successively amplified from five strains. Six antibiotics (trimethoprim, fluconazole, chloramphenicol, nalidixic acid, rifampicin and streptomycin) and two phytohormones [indole acetic acid (IAA) and kinetin (KI)] were detected and quantified in Streptomyces sp. strain DBT204 using UPLC-ESI-MS/MS. The study indicates the potential of these PGP strains for production of phytohormones and shows the presence of biosynthetic genes responsible for production of secondary metabolites. It is the first report showing production of phytohormones (IAA and KI) by endophytic actinobacteria having PGP and biosynthetic potential. We propose Streptomyces sp. strain DBT204 for inoculums production and development of biofertilizers for enhancing growth of chili and tomato seedlings. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Osmotic Effect of Conditioning on Seeds of Tomato (Solanum Lycopersicum L. Santa Clara Variety

Directory of Open Access Journals (Sweden)

Brigitte Liliana Moreno Medina

2013-12-01

Full Text Available The tomato (Solanum lycopersicum L. is one of the most important vegetables in the world, taking into account its nutritional potential and high economic value. In this crop the quality of seed depends on various factors, one of which is its physiology, which is determined by a germination and viability test. Osmotic seed conditioning is reported to be a technique for improving the physiological quality through the uniformity of the germination percentage. For this reason, the objective of this research was to evaluate the osmotic conditioning on tomato seeds of the Santa Clara variety. Using treatments of four doses of potassium nitrate (0, 100, 200 and 400 mg L-1 , the seeds were imbibitioned for 24 hours in solution and then washed with distilled water. They were placed in petri dishes in random order with three replications for a total of 12 experimental units, consisting of 35 seeds. The method seeks to hydrate the seeds with a solution of given concentration and for a period of time, in order to activate the seed metabolism. The best result was obtained with the treatment of 200 mg L-1 of potassium nitrate, followed by 400 mg L-1 , represented by a lower TMG , lower and higher PG VMG.

Characterization of WRKY transcription factors in Solanum lycopersicum reveals collinearity and their expression patterns under cold treatment.

Science.gov (United States)

Chen, Lin; Yang, Yang; Liu, Can; Zheng, Yanyan; Xu, Mingshuang; Wu, Na; Sheng, Jiping; Shen, Lin

2015-08-28

WRKY transcription factors play an important role in cold defense of plants. However, little information is available about the cold-responsive WRKYs in tomato (Solanum lycopersicum). In the present study, a complete characterization of this gene family was described. Eighty WRKY genes in the tomato genome were identified. Almost all WRKY genes contain putative stress-responsive cis-elements in their promoter regions. Segmental duplications contributed significantly to the expansion of the SlWRKY gene family. Transcriptional analysis revealed notable differential expression in tomato tissues and expression patterns under cold stress, which indicated wide functional divergence in this family. Ten WRKYs in tomato were strongly induced more than 2-fold during cold stress. These genes represented candidate genes for future functional analysis of WRKYs involved in the cold-related signal pathways. Our data provide valuable information about tomato WRKY proteins and form a foundation for future studies of these proteins, especially for those that play an important role in response to cold stress. Copyright © 2015 Elsevier Inc. All rights reserved.

EVALUATING THE FRUIT PRODUCTION AND QUALITY OF CHERRY TOMATO (Solanum lycopersicum var. cerasiforme EVALUACIÓN DE LA PRODUCCIÓN Y CALIDAD DEL FRUTO DEL TOMATE CEREZA Solanum lycopersicum var. cerasiforme

Directory of Open Access Journals (Sweden)

Nelson Ceballos Aguirre

2012-06-01

Full Text Available Abstract. The greatest genetic diversity of tomato (Solanum lycopersicum L. in terms of fruit quality characteristics such as flavor, aroma, color, and lycopene and b-carotene contents is found in wild species. This study evaluated the agronomic characteristics and fruit quality of 30 cherry tomato introductions of the germplasm bank of the Universidad Nacional de Colombia - Sede Palmira in trials conducted at the Montelindo experimental farm of the Universidad de Caldas (1010 m above sea level, average temperature 22.8 °C, average annual rainfall 2200 mm, 76% relative humidity. A 5 x 6 rectangular lattice experimental design was used with 30 treatments (introductions and a commercial control (Sweet Million, 4 replicates/treatment, and 5 plants/replicate as experimental unit. The descriptors used were those suggested by the former International Plant Genetic Resources Institute, now Bioversity International. Data were statistically analyzed by ANOVA and Duncan's means test using the SAS program. In addition, principal component and cluster dendrogram analyses using the SAS Princom and Cluster procedure (SAS Institute, Cary, NC were performed. Six principal components accounted for 80.39% of the morphological variability of the introductions evaluated. The most promising materials in terms of average fruit weight, yield per plant and per hectare, and soluble solids, vitamin C and lycopene contents were IAC1624, IAC391, IAC3652, LA2131, IAC424, IAC1621, IAC426, LA1480 and IAC1688. The broad phenotypic variability observed in the evaluated introductions favors the potential selection and breeding of tomato for traits associated with fruit production and quality.Resumen. La mayor diversidad genética del tomate (Solanum lycopersicum L. en términos de características de calidad del fruto como sabor, aroma, coloración y contenidos de licopeno y b-caroteno se encuentra en especies silvestres. Este estudio evaluó las características agronómicas y

Oxidative stress and antioxidative mechanisms in tomato (solanum lycopersicum l.) plants sprayed with different pesticides

International Nuclear Information System (INIS)

Yildiztekin, M.; Kaya, C.

2015-01-01

A glasshouse experiment was conducted to appraise the influence of exogenously applied pesticides such as abamectin, thiamethoxam, pyriproxyfen and acetamiprid on oxidative defence system and some key physiological attributes in tomato (Solanum lycopersicum L.). Each of these pesticides was applied in three doses (recommended dose, twice and three times higher than the recommended dose). Higher doses of pesticides sprayed to the plants resulted in marked increase in leaf free proline content and electrolyte leakage, but in a decrease in shoot dry matter, chl a, chl b and chl a+b in tomato plants as compared to those plants not sprayed with pesticides. These reductions were greater in tomato plants sprayed with highest doses of thiamethoxam (144 mg L-1), whereas the reverse was true for proline content and electrolyte leakage. The foliar application of pesticides at the highest levels caused enhanced accumulation of malondialdehyde (MDA) in most cases, and these being greater in treatment of foliar application of thiamethoxam at the highest level. The highest doses of pesticides promoted the activities of catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD) in most cases. The results clearly indicate that application of pesticides at higher doses than recommended doses provoked both oxidative and antioxidative systems in tomato plants. (author)

Keanekaragaman, aktivitas kunjungan, dan keefektifan lebah penyerbuk pada tanaman tomat (Solanum lycopersicum L: Solanaceae

Directory of Open Access Journals (Sweden)

Andi Gita Maulidyah Indraswari

2016-12-01

Full Text Available Tomato (Solanum lycopersicum L. is a hermaphrodite plant and capable of auto pollination. However it still need pollinators to maximize pollination success. This research was aimed to determine the diversity, foraging activity of pollinator bees and its effectiveness on seeds and fruits formation of tomato. Scan sampling method was used to determine the diversity of pollinators and focal sampling method was used to observe visiting behavior of the bees. We conducted two experiments i.e., screen caged plants and open plants to compare the effect of the bee pollinators on fruits and seeds set formation. Results showed that eleven species of bees were found, i.e., Megachile conjuncta Smith, Megachile fulfifrons Smith, Megachile unbripennis Smith, Xylocopa confusa Latreille, Xylocopa latipes Drury, Xylocopa caerulea Fabricius, Ceratina cognata Latreille, Nomia quadridentata Bingham, Amegilla cyrtandrae Lieftinck, Amegilla burneensis Friese, and Apis cerana Fabricius. Three species of bees were dominant, i.e., X. confusa, A. cyrtandrae, and C. cognata. Bee, X. confusa visited more flowers per minute, followed by A. cyrtandrae and C. cognata. The longest species visiting in plants were C. cognata, followed by X. confusa and A. cyrtandrae. Bee pollinators increase 8.92% of fruiting, 43% of fruit size, 189% of number of seeds per fruit, and 355% of weight of seeds of tomato plants.

Linkage mapping of candidate genes for induce resistance and growth promotion by trichoderma koningiopsis (th003) in tomato solanum lycopersicum

International Nuclear Information System (INIS)

Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella

2011-01-01

Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.

Sequence-based SSR marker development and their application in defining the Introgressions of LA0716 (Solanum pennellii in the background of cv. M82 (Solanum lycopersicum.

Directory of Open Access Journals (Sweden)

Wenbo Long

Full Text Available The introgression lines (ILs from cv. M82 (Solanum lycopersicum × LA0716 (S. pennellii have been proven to be exceptionally useful for genetic analysis and gene cloning. The introgressions were originally defined by RFLP markers at their development. The objectives of this study are to develop polymorphic SSR markers, and to re-define the DNA introgression from LA0716 in the ILs. Tomato sequence data was scanned by software to generate SSR markers. In total, 829 SSRs, which could be robustly amplified by PCR, were developed. Among them, 658 SSRs were dinucleotide repeats, 162 were trinucleotide repeats, and nine were tetranucleotide repeats. The 829 SSRs together with 96 published RFLPs were integrated into the physical linkage map of S. lycopersicum. Introgressions of DNA fragments from LA0716 were re-defined among the 75 ILs using the newly developed SSRs. A specific introgression of DNA fragment from LA0716 was identified in 72 ILs as described previously by RFLP, whereas the specific DNA introgression described previously were not detected in the ILs LA4035, LA4059 and LA4091. The physical location of each investigated DNA introgression was finely determined by SSR mapping. Among the 72 ILs, eight ILs showed a shorter and three ILs (IL3-2, IL12-3 and IL12-3-1 revealed a longer DNA introgression than that framed by RFLPs. Furthermore, 54 previously undefined segments were found in 21 ILs, ranging from 1 to 11 DNA introgressions per IL. Generally, the newly developed SSRs provide additional markers for genetic studies of tomatoes, and the fine definition of DNA introgressions from LA0716 would facilitate the use of the ILs for genetic analysis and gene cloning.

Metals and metalloids in fruits of tomatoes (Solanum lycopersicum) and their cultivation soils in the Basque Country: concentrations and accumulation trends.

Science.gov (United States)

Rodriguez-Iruretagoiena, Azibar; Trebolazabala, Josu; Martinez-Arkarazo, Irantzu; de Diego, Alberto; Madariaga, Juan Manuel

2015-04-15

The concentrations of several elements (Al, Fe, As, Cu, Cd, Co, Cr, Mn, Ni, Pb, Sn, V, and Zn) were measured in soils and the edible part of different vegetables (tomatoes (Solanum lycopersicum "Raf") peppers (Capsicum annuum), chards (Betavulgaris var. cicla), artichokes (Cynarascholymus)) and fruits (Raspberries (Rubusidaeus)) from 13 orchards in the Basque Country affected by different pollution sources. Multivariate analysis of data was used to look for possible correlations between metals in soil and metals in the edible part of the plant. Only manganese showed a correlation significantly different from zero. The metal concentrations found in the edible part were always below the upper limits recommended by the European legislation in force. The Bioaccumulation Index was used to investigate how efficient the plant is to uptake an element from the cultivation soil and to preserve its edible part from the element. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genetic relatedness among Solanum L. species assayed by seed morphology and isozyme markers

International Nuclear Information System (INIS)

Ahmed, S.M.; Fadl, M.A.

2016-01-01

In spite of their economic and medicinal value, no adequate attention has been paid to the diversity, characterization and taxonomical identification of Solanum L. species in Saudi Arabia. In this study, Scanning Electron Microscopy (SEM) of seed coat morphology and isozyme electrophoresis were employed for studying the genetic variability and relationships among seven Solanum L. species namely; S. incanum L., S. nigrum L., S. villosum L., S. schemprianum Hochst, S. galabratum Dunal, S. lycopersicum L. and S. melongena L. collected from Taif highlands. Scanning Electron Microscope (SEM) investigation of seed coat sculpturing showed three basic patterns namely; rugulate, reticulate and levigate. The analyses on six enzymes were coded by 19 loci. The number of alleles ranged from one to three with a mean of 1.58 alleles per locus. The proportion of polymorphic loci for Solanum L. species ranged from 0.87 for S. nigrum L. and S. villosum L. to 0.80 for S. lycopersicum L. The mean observed heterozygosity varied from 0.00 to 1.00, while mean expected heterozygosity ranged between 0.00 and 0.5. The UPGMA phenogram confirmed the extensive genetic diversity existed in the studied Solanum L. species and showed the close relationship between S. incanum L. and S. melongena L. (author)

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

Science.gov (United States)

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Enhancing Brassinosteroid Signaling via Overexpression of Tomato (Solanum lycopersicum SlBRI1 Improves Major Agronomic Traits

Directory of Open Access Journals (Sweden)

Shuming Nie

2017-08-01

Full Text Available Brassinosteroids (BRs play important roles in plant growth, development, and stress responses through the receptor, Brassinosteroid-insensitive 1 (BRI1, which perceives BRs and initiates BR signaling. There is considerable potential agricultural value in regulating BR signaling in crops. In this study, we investigated the effects of overexpressing the tomato (Solanum lycopersicum BRI1 gene, SlBRI1, on major agronomic traits, such as seed germination, vegetative growth, fruit ethylene production, carotenoid accumulation, yield, and quality attributes. SlBRI1 overexpression enhanced the endogenous BR signaling intensity thereby increasing the seed germination rate, lateral root number, hypocotyl length, CO2 assimilation, plant height, and flower size. The transgenic plants also showed an increase in fruit yield and fruit number per plant, although the mean weight of individual fruit was reduced, compared with wild type. SlBRI1 overexpression also promoted fruit ripening and ethylene production, and caused an increase in levels of carotenoids, ascorbic acid, soluble solids, and soluble sugars during fruit ripening. An increased BR signaling intensity mediated by SlBRI1 overexpression was therefore positively correlated with carotenoid accumulation and fruit nutritional quality. Our results indicate that enhancing BR signaling by overexpression of SlBRI1 in tomato has the potential to improve multiple major agronomic traits.

Metabolic and molecular changes of the phenylpropanoid pathway in tomato (Solanum lycopersicum lines carrying different Solanum pennellii wild chromosomal regions

Directory of Open Access Journals (Sweden)

Maria Manuela Rigano

2016-10-01

Full Text Available Solanum lycopersicum represents an important dietary source of bioactive compounds including the antioxidants flavonoids and phenolic acids. We previously identified two genotypes (IL7-3 and IL12-4 carrying loci from the wild species Solanum pennellii, which increased antioxidants in the fruit. Successively, these lines were crossed and two genotypes carrying both introgressions at the homozygous condition (DHO88 and DHO88-SL were selected. The amount of total antioxidant compounds was increased in DHOs compared to both ILs and the control genotype M82. In order to understand the genetic mechanisms underlying the positive interaction between the two wild regions pyramided in DHO genotypes, detailed analyses of the metabolites accumulated in the fruit were carried out by colorimetric methods and LC/MS/MS. These analyses evidenced a lower content of flavonoids in DHOs and in ILs, compared to M82. By contrast, in the DHOs the relative content of phenolic acids increased, particularly the fraction of hexoses, thus evidencing a redirection of the phenylpropanoid flux towards the biosynthesis of phenolic acid glycosides in these genotypes. In addition, the line DHO88 exhibited a lower content of free phenolic acids compared to M82. Interestingly, the two DHOs analyzed differ in the size of the wild region on chromosome 12. Genes mapping in the introgression regions were further investigated. Several genes of the phenylpropanoid biosynthetic pathway were identified, such as one 4-coumarate:CoA ligase and two UDP-glycosyltransferases in the region 12-4 and one chalcone isomerase and one UDP-glycosyltransferase in the region 7-3. Transcriptomic analyses demonstrated a different expression of the detected genes in the ILs and in the DHOs compared to M82.These analyses, combined with biochemical analyses, suggested a central role of the 4-coumarate:CoA ligase in redirecting the phenylpropanoid pathways towards the biosynthesis of phenolic acids in the

The construction of a Solanum habrochaites LYC4 introgression line population and the identification of QTLs for resistance to Botrytis cinerea

NARCIS (Netherlands)

Finkers, H.J.; Heusden, van A.W.; Meijer-Dekens, R.G.; Kan, van J.A.L.; Maris, P.C.; Lindhout, P.

2007-01-01

Tomato (Solanum lycopersicum) is susceptible to grey mold (Botrytis cinerea). Partial resistance to this fungus has been identified in accessions of wild relatives of tomato such as Solanum habrochaites LYC4. In a previous F-2 mapping study, three QTLs conferring resistance to B. cinerea (Rbcq1,

"You Say Tomato, I Say Solanum Lycopersicum Containing Beta-ionone and Phenylacetaldehyde": an Analysis of Connecticut's GMO Labeling Legislation.

Science.gov (United States)

Nunziato, Travis

2014-01-01

"You Say Tomato, I Say Solanum Lycopersicum Containing Beta-ionone and Phenylacetaldehyde" discusses the importance of requiring labels on products that contain genetically modified organisms, focusing on Connecticut's GMO Labeling statutes, as it is they are the first of their kind in the nation. The article will compare Connecticut's law to the legislation found in Australia, highlighting the positive aspects of Connecticut's bill and identifying its key weaknesses, namely the "trigger clause" found in the statute. Part I will provide an overview of Genetic Modification and provide a brief history of Biotechnology. It will also provide a brief overview of the federal regulatory framework in biotechnology, as well as evaluate the United States Food and Drug Association's role of regulating genetic modification. Part I will conclude by discussing how the American public has shown that labeling GMOs is important, and something that should occur. Part II of this article will explore Connecticut's recent legislation requiring labels on products that contain GMOs. Part III will explore Australia's legislation requiring labels on products containing GMOs, comparing Australia's law to Connecticut's legislation.

Comparative genetics of hybrid incompatibility: sterility in two Solanum species crosses.

Science.gov (United States)

Moyle, Leonie C; Nakazato, Takuya

2008-07-01

The genetic basis of hybrid sterility can provide insight into the genetic and evolutionary origins of species barriers. We examine the genetics of hybrid incompatibility between two diploid plant species in the plant clade Solanum sect. Lycopersicon. Using a set of near-isogenic lines (NILs) representing the wild species Solanum pennellii (formerly Lycopersicon pennellii) in the genetic background of the cultivated tomato S. lycopersicum (formerly L. esculentum), we found that hybrid pollen and seed infertility are each based on a modest number of loci, male (pollen) and other (seed) incompatibility factors are roughly comparable in number, and seed-infertility QTL act additively or recessively. These findings are remarkably consistent with our previous analysis in a different species pair, S. lycopersicum x S. habrochaites. Data from both studies contrast strongly with data from Drosophila. Finally, QTL for pollen and seed sterility from the two Solanum studies were chromosomally colocalized, indicating a shared evolutionary history for these QTL, a nonrandom genomic distribution of loci causing sterility, and/or a proclivity of certain genes to be involved in hybrid sterility. We show that comparative mapping data can delimit the probable timing of evolution of detected QTL and discern which sterility loci likely evolved earliest among species.

Effect of reciprocating agitation thermal processing (RA-TP) on quality of canned tomato (Solanum lycopersicum) puree.

Science.gov (United States)

Pratap Singh, Anubhav; Singh, Anika; Ramaswamy, Hosahalli S

2017-06-01

Reciprocating agitation thermal processing (RA-TP) is a recent innovation in the field of canning for obtaining high-quality canned food. The objective of this study was to compare RA-TP processing with conventional non-agitated (still) processing with respect to the impact on quality (color, antioxidant capacity, total phenols, carotenoid and lycopene contents) of canned tomato (Solanum lycopersicum) puree. Owing to a 63-81% reduction in process times as compared with still processing, tomato puree with a brighter red color (closer to fresh) was obtained during RA-TP. At 3 Hz reciprocation frequency, the loss of antioxidant, lycopene and carotenoid contents could be reduced to 34, 8 and 8% respectively as compared with 96, 41 and 52% respectively during still processing. In fact, the phenolic content for RA-TP at 3 Hz was 5% higher than in fresh puree. Quality retention generally increased with an increase in frequency, although the differences were less significant at higher reciprocation frequencies (between 2 and 3 Hz). Research findings indicate that RA-TP can be effective to obtain thermally processed foods with high-quality attribute retention. It can also be concluded that a very high reciprocation frequency (>3 Hz) is not necessarily needed and significant quality improvement can be obtained at lower frequencies (∼2 Hz). © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Effect on tomato (Solanum lycopersicum L. of different doses of organic fertilizer bocashi under agroecological conditions

Directory of Open Access Journals (Sweden)

Ana Boudet Antomarchi

2017-10-01

Full Text Available The research work was carried out in areas of the Agricultural Production Cooperative "Carlos Bastida Argüello" in Cauto Cristo municipality of Cuban province of Granma in the period between November 2013 and February 2014, on a fluvisol soil at a plantation distance of 0.90 x 0.30 m, in order to evaluate the effect of different doses of organic manure bocashi on the productive response of tomato (Solanum lycopersicum L. variety "Vyta". The treatments consisted of the application of three doses of manure "bocashi" and a control without application. A randomized complete block design with three repetitions was used and the evaluated variables were: the yield and its components (number of bunches per plant, number of fruits per plant, mass of fruits per plant, polar and equatorial diameter of the fruit and mesocarp thickness. The data obtained were submitted to a variance analysis of double classification with the use of SPSS version 22. In case of significant differences between treatments a Tukey test was performed for comparison of means. The results showed that treatment with application of organic manure had a positive influence on the yield and majority of yield components values. The yields values were higher in the three doses of organic manure than in the control treatment and yield increased with the increase of dosage of organic manure.

Plant nutritional status modulates glutamine synthetase levels in ripe tomatoes (Solanum lycopersicum cv. Micro-Tom).

Science.gov (United States)

Scarpeci, Telma E; Marro, Martin L; Bortolotti, Santiago; Boggio, Silvana B; Valle, Estela M

2007-02-01

Tomato (Solanum lycopersicum) fruit ripening implies that chloroplastic proteins are degraded and new proteins are synthesized. Supplementary nutrition is frequently required when tomato plants begin to fruit and continues until the end of the plant's life cycle. Ammonium assimilation is crucial in these fruit maturation and ripening processes. Glutamine synthetase (GS; EC 6.3.1.2), the main ammonium-fixing enzyme in plants, could not be detected in red fruits of several tomato varieties when growing under standard nutrition. In this paper, we analyze the influence of the nutritional status on the ammonium assimilation capacity of ripe tomato (cv. Micro-Tom) fruit. For this purpose, GS expression and protein profiles were followed in mature green and red fruits harvested from plants grown under standard or supplemented nutrition. Under standard nutrient regime (weekly supplied with 0.5 x Hoagland solution) GS activity was found in chloroplasts (GS2) of mature green fruits, but it was not detected either in the chromoplasts or in the cytosol of red fruits. When plants were shifted to a supplemented nutritional regime (daily supplied with 0.5 x Hoagland solution), GS was found in red fruits. Also, cytosolic transcripts (gs1) preferentially accumulated in red fruits under high nutrition. These results indicate that mature green Micro-Tom fruits assimilate ammonia through GS2 under standard nutrition, while ripe red fruits accumulate GS1 under high nutrition, probably in order to assimilate the extra N-compounds made available through supplemented nutrition.

Oxidative Stress and Antioxidants in Tomato (Solanum lycopersicum) Plants Subjected to Boron Toxicity

Science.gov (United States)

Cervilla, Luis M.; Blasco, Begoña; Ríos, Juan J.; Romero, Luis; Ruiz, Juan M.

2007-01-01

Background and Aims Boron (B) toxicity triggers the formation of reactive oxygen species in plant tissues. However, there is still a lack of knowledge as to how B toxicity affects the plant antioxidant defence system. It has been suggested that ascorbate could be important against B stress, although existing information is limited in this respect. The objective of this study was to analyse how ascorbate and some other components of the antioxidant network respond to B toxicity. Methods Two tomato (Solanum lycopersicum) cultivars (‘Kosaco’ and ‘Josefina’) were subjected to 0·05 (control), 0·5 and 2 mm B. The following were studied in leaves: dry weight; relative leaf growth rate; total and free B; H2O2; malondialdehyde; ascorbate; glutathione; sugars; total non-enzymatic antioxidant activity, and the activity of superoxide dismutase, catalase, ascorbate peroxidase, monodehydroascorbate reductase, dehydroascorbate reductase, glutathione reductase, ascorbate oxidase and l-galactose dehydrogenase. Key Results The B-toxicity treatments diminished growth and boosted the amount of B, malondialdehyde and H2O2 in the leaves of the two cultivars, these trends being more pronounced in ‘Josefina’ than in ‘Kosaco’. B toxicity increased ascorbate concentration in both cultivars and increased glutathione only in ‘Kosaco’. Activities of antioxidant- and ascorbate-metabolizing enzymes were also induced. Conclusions High B concentration in the culture medium provokes oxidative damage in tomato leaves and induces a general increase in antioxidant enzyme activity. In particular, B toxicity increased ascorbate pool size. It also increased the activity of l-galactose dehydrogenase, an enzyme involved in ascorbate biosynthesis, and the activity of enzymes of the Halliwell–Asada cycle. This work therefore provides a starting point towards a better understanding of the role of ascorbate in the plant response against B stress. PMID:17660516

Effect of irrigation and fertilization on the distribution and fate of nitrogen in greenhouse tomato (solanum lycopersicum l.)

International Nuclear Information System (INIS)

Wang, X.; Xing, Y.

2017-01-01

A greenhouse experiment using tomato (Solanum lycopersicum L., cv. 'Jinpeng 10') was conducted to investigate the fate and transport of nitrogen using different methods of irrigation and fertilization. Three treatments were designed with two irrigation methods (drip irrigation and furrow irrigation) and two fertilizer application methods (fertigation and conventional fertilization). Tomato fruit yield and biomass in the fertigation treatment were significantly higher than those in the conventional fertilization treatment. The highest total uptake of nitrogen by tomato was obtained with drip fertigation and increased significantly in the conventional fertilization and CK treatments. With an increase in nitrate uptake by the fruit, the uptake of the leaf nitrogen also increased in both years of the study. The distribution of the soil nitrate-N concentration tended to be symmetrical along the center of the emitter for drip irrigation and the furrows. The nitrate-N concentration in the CK treatment was 2.85-fold higher than that in the drip fertigation treatment. The proportion of nitrogen uptake of the total nitrogen input varied from 25.38% and 53.73% in two consecutive years, and the residual nitrogen in the fertigation treatment was 48.20% and 44.64% lower than that in the CK treatment in the same two respective years. (author)

Agrobacterium rhizogenes rolB gene affects photosynthesis and chlorophyll content in transgenic tomato (Solanum lycopersicum L.) plants.

Science.gov (United States)

Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa

2016-10-01

Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.

The Solanum lycopersicum WRKY3 Transcription Factor SlWRKY3 Is Involved in Salt Stress Tolerance in Tomato

Directory of Open Access Journals (Sweden)

Imène Hichri

2017-07-01

Full Text Available Salinity threatens productivity of economically important crops such as tomato (Solanum lycopersicum L.. WRKY transcription factors appear, from a growing body of knowledge, as important regulators of abiotic stresses tolerance. Tomato SlWRKY3 is a nuclear protein binding to the consensus CGTTGACC/T W box. SlWRKY3 is preferentially expressed in aged organs, and is rapidly induced by NaCl, KCl, and drought. In addition, SlWRKY3 responds to salicylic acid, and 35S::SlWRKY3 tomatoes showed under salt treatment reduced contents of salicylic acid. In tomato, overexpression of SlWRKY3 impacted multiple aspects of salinity tolerance. Indeed, salinized (125 mM NaCl, 20 days 35S::SlWRKY3 tomato plants displayed reduced oxidative stress and proline contents compared to WT. Physiological parameters related to plant growth (shoot and root biomass and photosynthesis (stomatal conductance and chlorophyll a content were retained in transgenic plants, together with lower Na+ contents in leaves, and higher accumulation of K+ and Ca2+. Microarray analysis confirmed that many stress-related genes were already up-regulated in transgenic tomatoes under optimal conditions of growth, including genes coding for antioxidant enzymes, ion and water transporters, or plant defense proteins. Together, these results indicate that SlWRKY3 is an important regulator of salinity tolerance in tomato.

Aplicación de cubierta de cama con plástico polietileno en la producción de tomate orgánico (Solanum lycopersicum l.) variedad río grande, como alternativa de sostenibilidad medioambiental Pucallpa – 2015

OpenAIRE

Chuyma Tomaylla, Manuel Mario

2015-01-01

El presente trabajo trata de los aspectos más trascendentales del tratamiento de camas de cultivo con el uso del polietileno como acolchado en el cultivo del tomate, el cual es un aporte al ámbito del desarrollo sostenible medioambiental y agrícola, tiene como objetivo: Determinar el efecto de la cubierta de cama con polietileno en la producción de tomate orgánico (Solanum lycopersicum L.) variedad río grande, bajo condiciones de Pucallpa-2015. Los resultados mostraron que las camas con acolc...

One-Pot Fabrication and Characterization of Silver Nanoparticles Using Solanum lycopersicum: An Eco-Friendly and Potent Control Tool against Rose Aphid, Macrosiphum rosae

International Nuclear Information System (INIS)

Bhattacharyya, A.; Prasad, R.; Buhroo, A. A.; Yousuf, I.; Khanday, A. L.; Duraisamy, P.; Umadevi, M.; Bindhu, M. R.; Govindarajan, M.

2016-01-01

The espousal of nano technology is a current come-up of the present revolution. As we know that the rose aphid, Macrosiphum rosae (Hemiptera: Aphididae), is a key pest on rose plant in Kashmir Valley, India, it exhibits a worldwide distribution. In the present study, we have synthesized biologically silver nanoparticles (Ag NPs) from Solanum lycopersicum and characterized them by UV-vis spectroscopy, TEM, and X-RD analysis. The experiment was performed by leaf dip method. Insecticidal solutions of different Ag NPs concentrations, namely, 200, 300, 400, and 500 ppm, were tested on M. rosae. For assessment purposes, leaves were treated with distilled water (used as control). Aphid mortality data revealed that the Ag NPs were effective at 500 ppm concentration. As the concentration and day’s treatment increased, the aphid mortality rate also increased. There were statistically significant differences in M. rosae mortality between concentrations by LSD at 5%. In wrapping up, the use of Ag NPs in pest control processes will be the most novel eco-friendly approach in the Kashmir Valley, India, in future.

Integrated effect of nutrients from a recirculation aquaponic system and foliar nutrition on the yield of tomatoes Solanum lycopersicum L. and Solanum pimpinellifolium.

Science.gov (United States)

Gullian Klanian, Mariel; Delgadillo Diaz, Mariana; Aranda, Javier; Rosales Juárez, Carolina

2018-04-20

The objective of this study was to evaluate the potential of tomato plants to efficiently use the nitrogen (N) of a recirculation aquaponic system (RAS) and to evaluate the effects of foliar fertilization as a complement to the water nutrition on the growth of the two tomato cultivars. The significant effect of six macro- and seven micronutrients was evaluated on the plant growth and on the fruit yield. Two experiments were performed in a nutrient film aquaponic unit. The first experiment was designed to study the effects of foliar fertilization on the seedlings of two tomato cultivars Costoluto Genovese (CG) (Solanum lycopersicum L.) and Currant tomato (Ct) (Solanum pimpinellifolium) with 8% of weekly water exchange (WE8%-RAS). The foliar fertilizer was formulated with N restriction in the last 11 weeks (TF1). In the second experiment, two other foliar fertilization treatments (TF2 and TF3) were applied with a concentration of nutrients twice and triple that in TF1, but with a lower proportion of NPK ratio. These treatments were tested on the cultivar CG in a RAS with zero water exchange (WE0%-RAS). The data from the 1st experiment showed a positive effect of the foliar fertilization on the yield of both cultivars. The fertilization markedly influenced the dry matter weight of the CG; however, this effect was not observed in the Ct. The root length of both cultivars was positively influenced by the P content, whereas the plant height was affected by the excess of Co and S. According to the results from the 2nd experiment, the TF2 plants had the highest number of fruits with a high mean weight. The system was efficient in utilizing N from fish tank; the water K favored the yield of the CG fruit and the foliar K favored the growth of the TF2 plants. With a decrease in the foliar N, the CG plants were able to absorb 27.5% of the NO 3 - and 7.06% of total ammonia nitrogen from water. The absolute and relative growth rate of Nile tilapia was not affected by the rate

Phenetic analysis of medicinally important species of the genus solanum from Pakistan

International Nuclear Information System (INIS)

Yousaf, Z.; Shinwari, Z.K.; Khan, M.A.

2010-01-01

Solanum is one of the largest and hyper diverse genera of the family Solanaceae. In Pakistan Solanum is represented by 15 species, of which 11 species have the medicinal properties. Taxonomically this is a complex genus because of the presence of number of hybrid and controversial taxonomic status of S. nigrum complex. In the present study numerical techniques were utilized to evaluate the taxonomic status of the genus Solanum. Cluster analysis was employed to work out the relationship among the taxa of the genus Solanum. The Euclidean distance measured similarity matrix and a dendrogram was constructed by using the complete linkage method. This analysis showed that all the species of genus Solanum can easily be divided into two groups at hundred percentage linkage distance. Co-relation of quantitative characters showed that floral characters had highly significant relationship with the stem characters, these characters plays a significant role in the identification of the species of the genus Solanum. (author)

Biogenic synthesis, characterization of silver nanoparticles using multani mitti (fullers earth), tomato (solanum lycopersicum) seeds, rice husk (oryza sativa) and evaluation of their potential antimicrobial activity

International Nuclear Information System (INIS)

Dar, P.; Hina, A.; Anwar, J.

2016-01-01

The synthesis of silver nanoparticles of three different biogenic materials Multani mitti (Fullers earth), Tomato (Solanum lycopersicum) seeds, Rice Husk (Oryza sativa) was carried out. The possible presence and variability of comprehensive biomolecules in these materials turned as capping and reducing agents which optimize the reduction rate and stabilization of silver nanoparticles. Characterizations were determined by using ultraviolet-visible (UV-Vis) spectroscopy, Scanning electron microscope (SEM), Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD). Stable silver nanoparticles of average size 4.6, 41.1 and 10.6 nm were obtained for Multani mitti, tomato seeds and rice husk respectively. Phenolic and carboxylic biomolecules were identified as active reducing agents of Ag+2 to Ag0. The antimicrobial activity was carried out against Klebsiella pneumonia, Salmonella enterica, Escherichia coli and Staphylococcus aureus strains by using well diffusion method. Maximum zone of inhibition (ZOI) was found against Staphylococcus aureus by all of the three biogenic materials. (author)

COMPORTAMIENTO DE LÍNEAS AVANZADAS DE TOMATE ( Solanum lycopersicum L. A FITOPATÓGENOS EN CHAPINGO, MÉXICO

Directory of Open Access Journals (Sweden)

Santos Gerardo Leyva-Mir

2013-01-01

Full Text Available Con el objetivo de evaluar la respuesta de 18 líneas experimentales y dos genotipos comerciales de tomate ( Solanum lycopersicum L. ante la infección natural de patógenos ( Alternaria solani, Phytophthora infestans, Fusarium oxysporum, Nacobbus spp . y Meloidogyne spp . de importancia económica, se realizó un ensayo en el campo agrícola experimental de la Universidad Autónoma Chapingo con el diseño experimental bloques completos al azar con cuatro repeticiones. Se evaluó el grado de severidad de cinco patógenos sobre las plantas de los genotipos considerados. Previo a la evaluación se identificó a cada patógeno en laboratorio por medio de la morfología de sus estructuras reproductivas. Se aplicó la prueba no paramétrica de Friedman a los datos obtenidos y posteriormente se realizó la comparación múltiple de rangos. Se detectaron fuentes de resistencia para Alternaria solani con severidad final del 35 %, en comparación con los genotipos susceptibles que fue del 80 %. En el caso de Phytopthora infestans la severidad final alcanzó 60 %, mientras que la susceptibilidad correspondió a 100 %. En el caso de Fusarium oxysporum se obtuvo un valor de 10 % de daño contra los susceptibles con 40 % . Con respecto a nematodos ( Nacobbus spp. y Meloidogyne spp., se determinó tolerancia con registros de 30 % de agallamiento y 76 % en líneas susceptibles.

Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum).

Science.gov (United States)

Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh

2014-02-01

Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.

Sample (S): SE40_S24 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE40_S24 Solanum lycopersicum Kyotemari fruit Solanum lycopersicum NCBI taxonomy:40...81 Solanum lycopersicum Kyotemari fruit are grown in greenhouses of the Experimental Farm of Kyoto University (Takatsuki, Osaka, Japan) from winter 2013 to spring 2014. ...

Uji Efektivitas Antihiperglikemia Kombinasi Jus Pare (Momordica charantia L dan Jus Tomat (Solanum lycopersicum L pada Tikus Wistar Jantan dengan Metode Toleransi Glukosa

Directory of Open Access Journals (Sweden)

Wulandari

2016-12-01

Full Text Available Diabetes melitus (DM is a metabolic disorder condition characterized by hyperglycemia. Bitter melon (Momordica charantia L and tomato (Solanum lycopersicum L are plant that have actvity antihiperglicemic actvity that contain triterpenoid, flavonoid, alkaloid, and saponin. The purpose of this study was to determine the effect of the combination antihiperglicemic bitter melon juice and tomato juice on male Wistar rats that was induced sucrose. Animals were divided into 6 groups. Blood glucose levels was measured at 30th, 60th, 90th and 120th minutes with enzymatic method using a glucometer. Data were analyzed statistically by Kruskal-Wallis and Mann-Whitney with a 95% confidence level. The research showed a blood glucose level of negative group differ significantly from the other group (P>0.05 and did not differ significantly with group 6 (P>0.05. Group 5 (bitter melon juice 17.4 g/KgBW and tomato juice 16.8 g/KgBW has a significant difference (P<0.05 with other groups and more effectively lowering blood glucose levels from minute 90th to minute 120th. Group 5 has the lowering effect of blood glucose levels than single juice.

Interactions of zinc and cadmium toxicity in their effects on growth and in antioxidative systems in tomato plants (Solanum lycopersicum)

Institute of Scientific and Technical Information of China (English)

Jaouhra Cherif; Chamseddine Mediouni; Wided Ben Ammar; Fatma Jemal

2011-01-01

The interaction between zinc and cadmium was investigated in tomato plants (Solanum lycopersicum).Ten-day-old seedlings were treated with 10 μmol/L CdCl2 associated to different concentrations of ZnCl2 (10, 50, 100, and 150 μmol/L).Zn supply clearly reduced Cd accumulation in leaves and simultaneously increased Zn concentration.Cd induced oxidative stress in leaves as indicated by an increase in thiobarbituric acid-reactive substances (TBARS) level and chlorophyll breakdown.Furthermore, compared with control, Cdtreated plants had significantly higher activities of superoxide dismutase (SOD, EC 1.15.1.1), whereas, catalase (CAT, EC 1.111.1.6),ascorbate peroxidase (APX, EC 1.11.1.11), and glutathione reductase (GR, EC 1.6.4.2) activities were significantly suppressed by Cd addition.Zn supplementation, at low level, restored and enhanced the functional activity of these enzymes (SOD, CAT, APX and GR) as compared to Cd-alone-treated plants.The beneficial effect of adequate Zn level on Cd toxicity was confirmed by a significant decrease in TBARS level and restoration of chlorophyll content.However, when Zn was added at high level in combination with Cd there was an accumulation of oxidative stress, which was higher than that for Cd or excess Zn alone treatments.These results suggested that higher Zn concentrations and Cd are synergistic in their effect on plant growth parameters and oxidative stress.

Sample (S): SE3_S02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02 Solanum lycopersicum House Momotaro fruit Solanum lycopersicum NCBI taxonom...y:4081 Solanum lycopersicum House Momotaro (ref: http://www.e-taneya.com/item/914.html) are grown at agricultural field under normal film in natural conditions. ...

Effectiveness of Neutral Electrolyzed Water on Incidence of Fungal Rot on Tomato Fruits ( Solanum lycopersicum L.).

Science.gov (United States)

Vásquez-López, Alfonso; Villarreal-Barajas, Tania; Rodríguez-Ortiz, Gerardo

2016-10-01

We assessed the effect of neutral electrolyzed water (NEW) on the incidence of rot on tomato ( Solanum lycopersicum L.) fruits inoculated with Fusarium oxysporum , Galactomyces geotrichum , and Alternaria sp. at sites with lesions. The inoculated fruits were treated with NEW at 10, 30, and 60 mg liter -1 active chlorine, with copper oxychloride fungicide, and with sterile distilled water (control) for 3, 5, and 10 min. In the experiment with F. oxysporum , 50 to 80% of the control fruits and 50 to 60% of the fruits treated with the fungicide exhibited symptoms of rot at the inoculated sites. The lowest incidence recorded was 30% for fruits treated with NEW at 60 mg liter -1 active chlorine with an immersion time of 5 min. In the experiment with G. geotrichum , incidence of rot on control fruits was 70 to 90%, and for treatment with fungicide rot incidence was 50 to 90%. NEW at 60 mg liter -1 active chlorine significantly reduced incidence of symptomatic fruit: only 30% of the inoculated fruits washed for 5 min had damage from rot. In the experiment with Alternaria sp., 60 to 90% of the fruits in the control group and 60 to 70% of the fruits in the fungicide group were symptomatic. The lowest incidence was recorded for the treatment in which the fruits were submerged in NEW with 60 mg liter -1 active chlorine for 3 min. In this group, 40 to 50% of the fruits exhibited symptoms of rot. These results were obtained 8 days after inoculation. NEW, with 60 mg liter -1 active chlorine, significantly reduced incidence of rot symptoms on fruits inoculated with one of the experimental fungi relative to the control (P ≤ 0.05). NEW at 60 mg liter -1 is effective in the control of fungal rot in tomatoes.

Physiological and Proteomic Analysis in Chloroplasts of Solanum lycopersicum L. under Silicon Efficiency and Salinity Stress

Directory of Open Access Journals (Sweden)

Sowbiya Muneer

2014-11-01

Full Text Available Tomato plants often grow in saline environments in Mediterranean countries where salt accumulation in the soil is a major abiotic stress that limits its productivity. However, silicon (Si supplementation has been reported to improve tolerance against several forms of abiotic stress. The primary aim of our study was to investigate, using comparative physiological and proteomic approaches, salinity stress in chloroplasts of tomato under silicon supplementation. Tomato seedlings (Solanum lycopersicum L. were grown in nutrient media in the presence or absence of NaCl and supplemented with silicon for 5 days. Salinity stress caused oxidative damage, followed by a decrease in silicon concentrations in the leaves of the tomato plants. However, supplementation with silicon had an overall protective effect against this stress. The major physiological parameters measured in our studies including total chlorophyll and carotenoid content were largely decreased under salinity stress, but were recovered in the presence of silicon. Insufficient levels of net-photosynthesis, transpiration and stomatal conductance were also largely improved by silicon supplementation. Proteomics analysis of chloroplasts analyzed by 2D-BN-PAGE (second-dimensional blue native polyacrylamide-gel electrophoresis revealed a high sensitivity of multiprotein complex proteins (MCPs such as photosystems I (PSI and II (PSII to the presence of saline. A significant reduction in cytochrome b6/f and the ATP-synthase complex was also alleviated by silicon during salinity stress, while the complex forms of light harvesting complex trimers and monomers (LHCs were rapidly up-regulated. Our results suggest that silicon plays an important role in moderating damage to chloroplasts and their metabolism in saline environments. We therefore hypothesize that tomato plants have a greater capacity for tolerating saline stress through the improvement of photosynthetic metabolism and chloroplast proteome

Transcriptome analysis reveals regulatory networks underlying differential susceptibility to Botrytis cinerea in response to nitrogen availability in Solanum lycopersicum.

Directory of Open Access Journals (Sweden)

Andrea eVega

2015-11-01

Full Text Available Nitrogen (N is one of the main limiting nutrients for plant growth and crop yield. It is well documented that changes in nitrate availability, the main N source found in agricultural soils, influences a myriad of developmental programs and processes including the plant defense response. Indeed, many agronomical reports indicate that the plant N nutritional status influences their ability to respond effectively when challenged by different pathogens. However, the molecular mechanisms involved in N-modulation of plant susceptibility to pathogens are poorly characterized. In this work, we show that Solanum lycopersicum defense response to the necrotrophic fungus Botrytis cinerea is affected by plant N availability, with higher susceptibility in nitrate-limiting conditions. Global gene expression responses of tomato against B. cinerea under contrasting nitrate conditions reveals that plant primary metabolism is affected by the fungal infection regardless of N regimes. This result suggests that differential susceptibility to pathogen attack under contrasting N conditions is not only explained by a metabolic alteration. We used a systems biology approach to identify the transcriptional regulatory network implicated in plant response to the fungus infection under contrasting nitrate conditions. Interestingly, hub genes in this network are known key transcription factors involved in ethylene and jasmonic acid signaling. This result positions these hormones as key integrators of nitrate and defense against B. cinerea in tomato plants. Our results provide insights into potential crosstalk mechanisms between necrotrophic defense response and N status in plants.

Modelling central metabolic fluxes by constraint-based optimization reveals metabolic reprogramming of developing Solanum lycopersicum (tomato) fruit.

Science.gov (United States)

Colombié, Sophie; Nazaret, Christine; Bénard, Camille; Biais, Benoît; Mengin, Virginie; Solé, Marion; Fouillen, Laëtitia; Dieuaide-Noubhani, Martine; Mazat, Jean-Pierre; Beauvoit, Bertrand; Gibon, Yves

2015-01-01

Modelling of metabolic networks is a powerful tool to analyse the behaviour of developing plant organs, including fruits. Guided by our current understanding of heterotrophic metabolism of plant cells, a medium-scale stoichiometric model, including the balance of co-factors and energy, was constructed in order to describe metabolic shifts that occur through the nine sequential stages of Solanum lycopersicum (tomato) fruit development. The measured concentrations of the main biomass components and the accumulated metabolites in the pericarp, determined at each stage, were fitted in order to calculate, by derivation, the corresponding external fluxes. They were used as constraints to solve the model by minimizing the internal fluxes. The distribution of the calculated fluxes of central metabolism were then analysed and compared with known metabolic behaviours. For instance, the partition of the main metabolic pathways (glycolysis, pentose phosphate pathway, etc.) was relevant throughout fruit development. We also predicted a valid import of carbon and nitrogen by the fruit, as well as a consistent CO2 release. Interestingly, the energetic balance indicates that excess ATP is dissipated just before the onset of ripening, supporting the concept of the climacteric crisis. Finally, the apparent contradiction between calculated fluxes with low values compared with measured enzyme capacities suggest a complex reprogramming of the metabolic machinery during fruit development. With a powerful set of experimental data and an accurate definition of the metabolic system, this work provides important insight into the metabolic and physiological requirements of the developing tomato fruits. © 2014 The Authors The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

Interactions between 2-Cys peroxiredoxins and ascorbate in autophagosome formation during the heat stress response in Solanum lycopersicum.

Science.gov (United States)

Cheng, Fei; Yin, Ling-Ling; Zhou, Jie; Xia, Xiao-Jian; Shi, Kai; Yu, Jing-Quan; Zhou, Yan-Hong; Foyer, Christine Helen

2016-03-01

2-Cys peroxiredoxins (2-CPs) function in the removal of hydrogen peroxide and lipid peroxides but their precise roles in the induction of autophagy have not been characterized. Here we show that heat stress, which is known to induce oxidative stress, leads to the simultaneous accumulation of transcripts encoding 2-CPs and autophagy proteins, as well as autophagosomes, in tomato (Solanum lycopersicum) plants. Virus-induced gene silencing of the tomato peroxiredoxin genes 2-CP1, 2-CP2, and 2-CP1/2 resulted in an increased sensitivity of tomato plants to heat stress. Silencing 2-CP2 or 2-CP1/2 increased the levels of transcripts associated with ascorbate biosynthesis but had no effect on the glutathione pool in the absence of stress. However, the heat-induced accumulation of transcripts associated with the water-water cycle was compromised by the loss of 2-CP1/2 functions. The transcript levels of autophagy-related genes ATG5 and ATG7 were higher in plants with impaired 2-CP1/2 functions, and the formation of autophagosomes increased, together with an accumulation of oxidized and insoluble proteins. Silencing of ATG5 or ATG7 increased the levels of 2-CP transcripts and protein but decreased heat stress tolerance. These results demonstrate that 2-CPs fulfil a pivotal role in heat stress tolerance in tomato, via interactions with ascorbate-dependent pathways and autophagy. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Streptomyces sp. Sebagai Biofungisida Patogen Fusarium oxysporum (Schlecht. f.sp. lycopersici (Sacc. Snyd. et Hans. Penyebab Penyakit Layu Pada Tanaman Tomat (Solanum lycopersicum L.

Directory of Open Access Journals (Sweden)

NURI MANDAN SARI

2014-01-01

Full Text Available A research was conducted to isolate Streptomyces sp. of soil Udayana University campus in theBukit-Jimbaran, to obtain the most effective Streptomyces sp. which is effective in inhibit the growth ofFusarium oxysporum f.sp. lycopersici, and to test response of tomato plants with Streptomyces sp.culture against Fusarium wilt desease. Implementation phases of the research consisted of isolation andidentification of Streptomyces sp, test the inhibition against F. oxysporum f.sp. lycopersici, and in vivotest used by dyeing the roots of the tomato plant (Solanum lycopersicum with Fusarium spores andafter 30 seconds the roots were dyeing Streptomyces culture. Furthermore, sterile soil in polybagwatered by Fusarium spores and Streptomyces culture at the same time. Based on morphologicalcharacteristic it found five isolates of Streptomyces sp.. The antagonist test showed Streptomyces sp.1 had ability (75% against Fusarium, Streptomyces sp 2 (68,3%, Streptomyces sp. 3 (71,6%,Streptomyces sp. 4 (63,3%, and Streptomyces sp. 5 (21,6%. All Streptomyces suppressed thegrowth of Fusarium on tomato plants in glass house (p<0,05. Streptomyces sp.3 suppressed Fusariumwilt disease in tomato from 88% in control to 20%.

Cytological observation of solanum pimpinellifolium l. microspore development

International Nuclear Information System (INIS)

Qu, H.; Rylosona, J.S.

2015-01-01

Tomato (Solanum lycopersicum L.) is one of the most important horticultural crops worldwide, and has also been adapted as a model plant in a wide range of research disciplines. However, stamen development in tomato is less known than other model species, such as Arabidopsis thaliana and Oryza sativa L. (rice). In order to understand tomato flower development in more detail, the key goal of this study was to establish a precise correlation between visual morphological features and cytological events. To this end, we characterized a wild tomato species, S. pimpinellifolium (accession LA1585), to define stamen developmental stages using semi-thin sectioning. Based on distinct stages of flower development, S. pimpinellifolium anther/stamen development was divided into ten stages, and characteristic morphological and cytological features in stamens at each developmental stage were identified. In this way, flower characteristics and microspore development were correlated. In addition, specific cytological key events in S. pimpinellifolium were compared with those in A. thaliana and rice at corresponding stages, as well as with those in domesticated tomato (S. lycopersicum L.), and the differences are discussed. (author)

Effect of Blue Light on Endogenous Isopentenyladenine and Endoreduplication during Photomorphogenesis and De-Etiolation of Tomato (Solanum lycopersicum L.) Seedlings

Science.gov (United States)

Bergougnoux, Véronique; Zalabák, David; Jandová, Michaela; Novák, Ondřej; Wiese-Klinkenberg, Anika; Fellner, Martin

2012-01-01

Light is one of the most important factor influencing plant growth and development all through their life cycle. One of the well-known light-regulated processes is de-etiolation, i.e. the switch from skotomorphogenesis to photomorphogenesis. The hormones cytokinins (CKs) play an important role during the establishment of photomorphogenesis as exogenous CKs induced photomorphogenesis of dark-grown seedlings. Most of the studies are conducted on the plant model Arabidopsis, but no or few information are available for important crop species, such as tomato (Solanum lycopersicum L.). In our study, we analyzed for the first time the endogenous CKs content in tomato hypocotyls during skotomorphogenesis, photomorphogenesis and de-etiolation. For this purpose, two tomato genotypes were used: cv. Rutgers (wild-type; WT) and its corresponding mutant (7B-1) affected in its responses to blue light (BL). Using physiological and molecular approaches, we identified that the skotomorphogenesis is characterized by an endoreduplication-mediated cell expansion, which is inhibited upon BL exposure as seen by the accumulation of trancripts encoding CycD3, key regulators of the cell cycle. Our study showed for the first time that iP (isopentenyladenine) is the CK accumulated in the tomato hypocotyl upon BL exposure, suggesting its specific role in photomorphogenesis. This result was supported by physiological experiments and gene expression data. We propose a common model to explain the role and the relationship between CKs, namely iP, and endoreduplication during de-etiolation and photomorphogenesis. PMID:23049779

A GC-ECD method for estimation of free and bound amino acids, gamma-aminobutyric acid, salicylic acid, and acetyl salicylic acid from Solanum lycopersicum (L.).

Science.gov (United States)

Meher, Hari Charan; Gajbhiye, Vijay T; Singh, Ghanendra

2011-01-01

A gas chromatograph with electron capture detection method for estimation of selected metabolites--amino acids (free and bound), gamma-aminobutyric acid (GABA), salicylic acid (SA), and acetyl salicylic acid (ASA) from tomato--is reported. The method is based on nitrophenylation of the metabolites by 1-fluoro-2, 4-dinitrobenzene under aqueous alkaline conditions to form dinitophenyl derivatives. The derivatives were stable under the operating conditions of GC. Analysis of bound amino acids comprised perchloric acid precipitation of protein, alkylation (carboxymethylation) with iodoacetic acid, vapor-phase hydrolysis, and derivatization with 1-fluoro-2,4-dinitrobenzene in that order. The metabolites were resolved in 35 min, using a temperature-programmed run. The method is rapid, sensitive, and precise. It easily measured the typical amino acids (aspartate, asparagine, glutamate, glutamine, alanine, leucine, lysine, and phenylalanine) used for identification and quantification of a protein, resolved amino acids of the same mass (leucine and isoleucine), satisfactorily measured sulfur amino acid (methionine, cystine, and cysteine), and quantified GABA, SA, and ASA, as well. The developed method was validated for specificity, linearity, and precision. It has been applied and recommended for estimation of 25 metabolites from Solanum lycopersicum (L.).

Effect of Post-Infiltration Soil Aeration at Different Growth Stages on Growth and Fruit Quality of Drip-Irrigated Potted Tomato Plants (Solanum lycopersicum).

Science.gov (United States)

Li, Yuan; Jia, Zongxia; Niu, Wenquan; Wang, Jingwei; Zhang, Mingzhi

2015-01-01

Soil hydraulic principles suggest that post-infiltration hypoxic conditions would be induced in the plant root-zone for drip-irrigated tomato production in small pots filled with natural soil. No previous study specifically examined the response of tomato plants (Solanum lycopersicum) at different growth stages to low soil aeration under these conditions. A 2 × 6 factorial experiment was conducted to quantify effects of no post-infiltration soil aeration versus aeration during 5 different periods (namely 27-33, 34-57, 58-85, 86-99, and 27-99 days after sowing), on growth and fruit quality of potted single tomato plants that were sub-surface trickle-irrigated every 2 days at 2 levels. Soil was aerated by injecting 2.5 liters of air into each pot through the drip tubing immediately after irrigation. Results showed that post-infiltration aeration, especially during the fruit setting (34-57 DAS) and enlargement (58-85 DAS) growth stages, can positively influence the yield, root dry weight and activity, and the nutritional (soluble solids and vitamin C content), taste (titratable acidity), and market quality (shape and firmness) of the tomato fruits. Interactions between irrigation level and post-infiltration aeration on some of these fruit quality parameters indicated a need for further study on the dynamic interplay of air and water in the root zone of the plants under the conditions of this experiment.

Effect of Post-Infiltration Soil Aeration at Different Growth Stages on Growth and Fruit Quality of Drip-Irrigated Potted Tomato Plants (Solanum lycopersicum.

Directory of Open Access Journals (Sweden)

Yuan Li

Full Text Available Soil hydraulic principles suggest that post-infiltration hypoxic conditions would be induced in the plant root-zone for drip-irrigated tomato production in small pots filled with natural soil. No previous study specifically examined the response of tomato plants (Solanum lycopersicum at different growth stages to low soil aeration under these conditions. A 2 × 6 factorial experiment was conducted to quantify effects of no post-infiltration soil aeration versus aeration during 5 different periods (namely 27-33, 34-57, 58-85, 86-99, and 27-99 days after sowing, on growth and fruit quality of potted single tomato plants that were sub-surface trickle-irrigated every 2 days at 2 levels. Soil was aerated by injecting 2.5 liters of air into each pot through the drip tubing immediately after irrigation. Results showed that post-infiltration aeration, especially during the fruit setting (34-57 DAS and enlargement (58-85 DAS growth stages, can positively influence the yield, root dry weight and activity, and the nutritional (soluble solids and vitamin C content, taste (titratable acidity, and market quality (shape and firmness of the tomato fruits. Interactions between irrigation level and post-infiltration aeration on some of these fruit quality parameters indicated a need for further study on the dynamic interplay of air and water in the root zone of the plants under the conditions of this experiment.

Eco-Friendly Nets and Floating Row Covers Reduce Pest Infestation and Improve Tomato (Solanum lycopersicum L. Yields for Smallholder Farmers in Kenya

Directory of Open Access Journals (Sweden)

Elisha O. Gogo

2014-01-01

Full Text Available Tomato (Solanum lycopersicum L. is an important vegetable for supplying vitamins, minerals and fiber in human diets worldwide. Successful open field production of tomato in the tropics is limited by insect pests among other constraints. Two trials were conducted at the Horticulture Research and Teaching Field, Egerton University, Kenya with the objective of evaluating the effects of agricultural nets (agronets herein called eco-friendly nets (EFNs and floating row covers (FRCs on pest population and yield of tomatoes. A randomized complete block design with five replications was used. Tomato plants were protected with either fine mesh EFN (0.4-mm pore diameter, large mesh EFN (0.9-mm pore diameter or FRC. The EFN and FRC were maintained permanently closed or opened thrice a week from 9 am to 3 pm. Two control treatments were used: open unsprayed (untreated control or open and sprayed with alpha-cypermethrin based insecticide (treated control. The use of EFN and FRC helped to manage pests with the lowest pest population obtained under FRC maintained permanently covered and the highest population recorded in the untreated control. Covering tomato plants with EFN or FRC also resulted in more marketable fruit and lower yield losses compared with the unprotected systems. The EFN and FRC offer great potential as part of integrated systems for pest management and yield improvement in tomato production in regions with a tropical climate.

Semi-determinate growth habit adjusts the vegetative-to-reproductive balance and increases productivity and water-use efficiency in tomato (Solanum lycopersicum).

Science.gov (United States)

Vicente, Mateus Henrique; Zsögön, Agustin; de Sá, Ariadne Felicio Lopo; Ribeiro, Rafael V; Peres, Lázaro E P

2015-04-01

Tomato (Solanum lycopersicum) shows three growth habits: determinate, indeterminate and semi-determinate. These are controlled mainly by allelic variation in the self-pruning (SP) gene family, which also includes the "florigen" gene single flower TRUSS (SFT). Determinate cultivars have synchronized flower and fruit production, which allows mechanical harvesting in the tomato processing industry, whereas indeterminate ones have more vegetative growth with continuous flower and fruit formation, being thus preferred for fresh market tomato production. The semi-determinate growth habit is poorly understood, although there are indications that it combines advantages of determinate and indeterminate growth. Here, we used near-isogenic lines (NILs) in the cultivar Micro-Tom (MT) with different growth habit to characterize semi-determinate growth and to determine its impact on developmental and productivity traits. We show that semi-determinate genotypes are equivalent to determinate ones with extended vegetative growth, which in turn impacts shoot height, number of leaves and either stem diameter or internode length. Semi-determinate plants also tend to increase the highly relevant agronomic parameter Brix × ripe yield (BRY). Water-use efficiency (WUE), evaluated either directly as dry mass produced per amount of water transpired or indirectly through C isotope discrimination, was higher in semi-determinate genotypes. We also provide evidence that the increases in BRY in semi-determinate genotypes are a consequence of an improved balance between vegetative and reproductive growth, a mechanism analogous to the conversion of the overly vegetative tall cereal varieties into well-balanced semi-dwarf ones used in the Green Revolution. Copyright © 2015 Elsevier GmbH. All rights reserved.

Response to nitrate/ammonium nutrition of tomato (Solanum lycopersicum L.) plants overexpressing a prokaryotic NH4(+)-dependent asparagine synthetase.

Science.gov (United States)

Martínez-Andújar, Cristina; Ghanem, Michel Edmond; Albacete, Alfonso; Pérez-Alfocea, Francisco

2013-05-01

Nitrogen availability is an important limiting factor for plant growth. Although NH4(+) assimilation is energetically more favorable than NO3(-), it is usually toxic for plants. In order to study if an improved ammonium assimilatory metabolism could increase the plant tolerance to ammonium nutrition, tomato (Solanum lycopersicum L. cv P-73) plants were transformed with an NH4(+)-dependent asparagine synthetase (AS-A) gene from Escherichia coli (asnA) under the control of a PCpea promoter (pea isolated constitutive promotor). Homozygous (Hom), azygous (Az) asnA and wild type (WT) plants were grown hydroponically for 6 weeks with normal Hoagland nutrition (NO3(-)/NH4(+)=6/0.5) and high ammonium nutrition (NO3(-)/NH4(+)=3.5/3). Under Hoagland's conditions, Hom plants produced 40-50% less biomass than WT and Az plants. However, under NO3(-)/NH4(+)=3.5/3 the biomass of Hom was not affected while it was reduced by 40-70% in WT and Az plants compared to Hoagland, respectively. The Hom plants accumulated 1.5-4 times more asparagine, glycine, serine and soluble proteins and registered higher glutamine synthetase (GS) and glutamate synthase (GOGAT) activities in the light-adapted leaves than the other genotypes, but had similar NH4(+) and NO3(-) levels in all conditions. In the dark-adapted leaves, a protein catabolism occurred in the Hom plants with a concomitant 25-40% increase in organic acid concentration, while asparagine accumulation registered the highest values. The aforementioned processes might be responsible for a positive energetic balance as regards the futile cycle of the transgenic protein synthesis and catabolism. This explains growth penalty under standard nutrition and growth stability under NO3(-)/NH4(+)=3.5/3, respectively. Copyright © 2013 Elsevier GmbH. All rights reserved.

Genome-wide systematic characterization of the bZIP transcriptional factor family in tomato (Solanum lycopersicum L.).

Science.gov (United States)

Li, Dayong; Fu, Fuyou; Zhang, Huijuan; Song, Fengming

2015-10-12

Transcription factors of the basic leucine zipper (bZIP) family represent exclusively in eukaryotes and have been shown to regulate diverse biological processes in plant growth and development as well as in abiotic and biotic stress responses. However, little is known about the bZIP family in tomato (Solanum lycopersicum L.). The SlbZIP genes were identified using local BLAST and hidden Markov model profile searches. The phylogenetic trees, conserved motifs and gene structures were generated by MEGA6.06, MEME tool and gene Structure Display Server, respectively. The syntenic block diagrams were generated by the Circos software. The transcriptional gene expression profiles were obtained using Genevestigator tool and quantitative RT-PCR. In the present study, we carried out a genome-wide identification and systematic analyses of 69 SlbZIP genes that distributes unevenly on the tomato chromosomes. This family can be divided into 9 groups according to the phylogenetic relationship among the SlbZIP proteins. Six kinds of intron patterns (a-f) within the basic and hinge regions are defined. The additional conserved motifs and their presence of the group specificity were also identified. Further, we predicted the DNA-binding patterns and the dimerization property on the basis of the characteristic features in the basic and hinge regions and the leucine zipper, respectively, which supports our classification greatly and helps to classify 24 distinct subfamilies. Within the SlbZIP family, a total of 40 SlbZIP genes are located in the segmental duplicate regions in the tomato genome, suggesting that the segment chromosomal duplications contribute greatly to the expansion of the tomato SlbZIP family. Expression profiling analyses of 59 SlbZIP genes using quantitative RT-PCR and publicly available microarray data indicate that the tomato SlbZIP genes have distinct and diverse expression patterns in different tissues and developmental stages and many of the tomato bZIP genes

Solanum americanum: reservoir for Potato virus Y and Cucumber mosaic virus in sweet pepper crops

Directory of Open Access Journals (Sweden)

Monika Fecury Moura

2014-03-01

Full Text Available Weeds can act as important reservoirs for viruses. Solanum americanum (Black nightshade is a common weed in Brazil and samples showing mosaic were collected from sweet pepper crops to verify the presence of viruses. One sample showed mixed infection between Cucumber mosaic virus (CMV and Potato virus Y (PVY and one sample showed simple infection by PVY. Both virus species were transmitted by plant extract and caused mosaic in tomato (Solanum lycopersicum cv. Santa Clara, sweet pepper (Capsicum annuum cv. Magda, Nicotiana benthamiana and N. tabaccum TNN, and local lesions on Chenopodium quinoa, C. murale and C. amaranticolor. The coat protein sequences for CMV and PVY found in S. americanum are phylogenetically more related to isolates from tomato. We conclude that S. americanum can act as a reservoir for different viruses during and between sweet pepper crop seasons.

Pollen morphology and study of the visitors (Hymenoptera, Apidae of Solanum stramoniifolium Jacq. (Solanaceae in Central Amazon Morfologia polínica e estudo dos visitantes (Hymenoptera, Apidae de Solanum stramoniifolium Jacq. (Solanaceae na Amazônia Central

Directory of Open Access Journals (Sweden)

Alexandre Coletto da Silva

2004-09-01

Full Text Available The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The pollen of S. stramoniifolium is tricolporate and psilate or without ornamentation. In a word, S. stramoniifolium constitutes a potential source of pollen for different species of bees with and without sting, providing an interesting field for germination studies, insect-plant interactions and floral biology that are already under way.A família Solanaceae tem ampla distribuição, principalmente nas áreas tropicais e subtropicais da América do Sul. Solanum L. é um dos mais importantes gêneros desta família com aproximadamente 1.200 espécies. O objetivo deste trabalho foi o de estudar a biologia floral com enfoque na morfologia polínica e no registro de algumas abelhas visitantes de S. stramoniifolium. Dados preliminares indicam a presença de uma espécie de abelha com ferrão e quatro espécies sem ferrão como visitantes de S. stramoniifolium. O pólen de S. stramoniifolium é tricolporado e psilado, ou seja, sem ornamentação. Conclui-se, após o estudo da biologia floral, que S. stramoniifolium constitui fonte potencial de pólen para diferentes espécies de abelhas com e sem ferrão, representando interessante campo para estudos de germinação, interações inseto-planta e biologia floral.

Characterizing nutrient uptake kinetics for efficient crop production during Solanum lycopersicum var. cerasiforme Alef. growth in a closed indoor hydroponic system.

Science.gov (United States)

Lee, Ju Yeon; Rahman, Arifur; Azam, Hossain; Kim, Hyung Seok; Kwon, Man Jae

2017-01-01

A balanced nutrient supply is essential for the healthy growth of plants in hydroponic systems. However, the commonly used electrical conductivity (EC)-based nutrient control for plant cultivation can provide amounts of nutrients that are excessive or inadequate for proper plant growth. In this study, we investigated the kinetics of major and minor nutrient uptake in a nutrient solution during the growth of tomato (Solanum lycopersicum var. cerasiforme Alef.) in a closed hydroponic system. The concentrations of major and minor ions in the nutrient solution were determined by various analytical methods including inductively coupled plasma-optical emission spectroscopy (ICP-OES), ion chromatography (IC), ion specific electrodes, and/or colorimetric methods. The concentrations of the individual nutrient ions were compared with changes in the EC. The EC of the nutrient solution varied according to the different growth stages of tomato plants. Variation in the concentrations of NO3-, SO42-, Mg2+, Ca2+, and K+ was similar to the EC variation. However, in the cases of PO43-, Na+, Cl-, dissolved Fe and Mn, Cu2+, and Zn2+, variation did not correspond with that of EC. These ions were generally depleted (to 0 mg L-1) during tomato growth, suggesting that these specific ions should be monitored individually and their supply increased. Nutrient uptake rates of major ions increased gradually at different growth stages until harvest (from 15 mg L-1 d-1). Saturation indices determined by MINEQL+ simulation and a mineral precipitation experiment demonstrated the potential for amorphous calcium phosphate precipitation, which may facilitate the abiotic adsorptive removal of dissolved Fe, dissolved Mn, Cu2+, and Zn2+.

Phytohormones enabled endophytic fungal symbiosis improve aluminum phytoextraction in tolerant Solanum lycopersicum: An examples of Penicillium janthinellum LK5 and comparison with exogenous GA3.

Science.gov (United States)

Khan, Abdul Latif; Waqas, Muhammad; Hussain, Javid; Al-Harrasi, Ahmed; Hamayun, Muhammad; Lee, In-Jung

2015-09-15

This work investigates the potentials of fungal-endophyte Penicillium janthinellum LK5 (PjLK5) and its inherent gibberellic acid (GA3) as reference to enhance aluminum (Al) induced toxicity in tolerant tomato (Solanum lycopersicum) plants. Initial screening showed significantly higher uptake of Al by PjLK5. Aluminum stress (100 μM) significantly retarted plant growth in control plants. Conversely PjLK5 and GA3 application significantly increased morphological attributes of Al-tolerant tomato plants with or without Al-stress. PjLK5 inoculation with and without Al-stress maintained the plant growth whilst extracting and translocating higher Al in shoot (∼ 1 92 mg/kg) and root (∼ 296 mg/kg). This was almost similar in GA3 treatments as well. In addition, PjLK5 inoculation extended protective effects to tomato plants by maintaining reduced cellular superoxide anions in Al stress. Al-induced oxidative stress was further reduced due to significantly higher activity of metal-responsive reduced glutathione. The functional membrane was less damaged in PjLK5 and GA3 treatments because the plants synthesized reduced levels of malondialdhyde, lenolenic and linoleic acids. Defense-related endogenous phytohormone salicylic acid was significantly up-regulated to counteract the adverse effects of Al-stress. In conclusion, the PjLK5 possess a similar bio-prospective potential as of GA3. Application of such biochemically active endophyte could increase metal phytoextraction whilst maintaining crop physiological homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

International Nuclear Information System (INIS)

Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

2016-01-01

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

Energy Technology Data Exchange (ETDEWEB)

Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

2016-01-15

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

Inoculación de rizobacterias promotoras del crecimiento vegetal en tomate (Solanum lycopersicum L. cv. afrodita en invernadero

Directory of Open Access Journals (Sweden)

Bernardo Espinosa Palomeque

2017-04-01

Full Text Available La producción de los cultivos agrícolas, entre otros factores, es impactada por el clima, el suelo, el agua y los microorganismos rizosféricos. De estos últimos, las rizobacterias promotoras del crecimiento vegetal (RPCV, desempeñan funciones importantes para las plantas como es la producción de reguladores del crecimiento vegetal y disminuir o prevenir los efectos de microorganismos f itopatógenos. El objetivo de este estudio fue evaluar el efecto de la inoculación de tres RPCV: Bacillus spp., Aeromonas spp., y Pseudomonas lini Delorme, utilizando dos sustratos: 1 compost+arena de río+perlita; y 2 arena de río; y como testigos ambos sustratos sin RPCV (lo que dio un total de 8 tratamientos, sobre el rendimiento y calidad de frutos de tomate (Solanum lycopersicum L. cv. Afrodita desarrollado bajo condiciones de invernadero. El diseño experimental utilizado fue bloques completamente al azar con cinco repeticiones, con arreglo factorial 2 × 4, los factores fueron: A sustratos y B RPCV. Las variables evaluadas en fruto fueron: diámetro polar y ecuatorial, espesor de pericarpio, contenido de sólidos solubles, firmeza, fenoles totales y capacidad antioxidante, así como rendimiento total. Los datos fueron analizados estadísticamente por análisis de varianza y las comparaciones de medias mediante la prueba de DMS 0.05%. Los frutos del tratamiento T1 (50 compost + 40 arena de río + 10 perlita + Bacillus spp. presentaron los mayores diámetros polar y ecuatorial, contenido de sólidos solubles, firmeza, contenido de fenoles totales y capacidad antioxidante, 6.54 cm, 5.50 cm, 5.94 ºBrix, 12.54 N, 51.70 mg de AG 100 g-1 FF y 66.68 µM Trolox g-1 FF, respectivamente; en comparación con el resto de los tratamientos. La aplicación de RPCV y la utilización de sustratos a base de compost podrían ser una alternativa de manejo en la producción de tomate en invernadero para incrementar el rendimiento y la calidad nutracéutica de los

Oligonucleotide array discovery of polymorphisms in cultivated tomato (Solanum lycopersicum L. reveals patterns of SNP variation associated with breeding

Directory of Open Access Journals (Sweden)

Zhu Tong

2009-10-01

Full Text Available Abstract Background Cultivated tomato (Solanum lycopersicum L. has narrow genetic diversity that makes it difficult to identify polymorphisms between elite germplasm. We explored array-based single feature polymorphism (SFP discovery as a high-throughput approach for marker development in cultivated tomato. Results Three varieties, FL7600 (fresh-market, OH9242 (processing, and PI114490 (cherry were used as a source of genomic DNA for hybridization to oligonucleotide arrays. Identification of SFPs was based on outlier detection using regression analysis of normalized hybridization data within a probe set for each gene. A subset of 189 putative SFPs was sequenced for validation. The rate of validation depended on the desired level of significance (α used to define the confidence interval (CI, and ranged from 76% for polymorphisms identified at α ≤ 10-6 to 60% for those identified at α ≤ 10-2. Validation percentage reached a plateau between α ≤ 10-4 and α ≤ 10-7, but failure to identify known SFPs (Type II error increased dramatically at α ≤ 10-6. Trough sequence validation, we identified 279 SNPs and 27 InDels in 111 loci. Sixty loci contained ≥ 2 SNPs per locus. We used a subset of validated SNPs for genetic diversity analysis of 92 tomato varieties and accessions. Pairwise estimation of θ (Fst suggested significant differentiation between collections of fresh-market, processing, vintage, Latin American (landrace, and S. pimpinellifolium accessions. The fresh-market and processing groups displayed high genetic diversity relative to vintage and landrace groups. Furthermore, the patterns of SNP variation indicated that domestication and early breeding practices have led to progressive genetic bottlenecks while modern breeding practices have reintroduced genetic variation into the crop from wild species. Finally, we examined the ratio of non-synonymous (Ka to synonymous substitutions (Ks for 20 loci with multiple SNPs (≥ 4 per

The influence of salinity and drought stress on sodium,potassium and proline content of solanum lycopersicum l. cv. rio grande

International Nuclear Information System (INIS)

Ali, S.; Rab, A.

2017-01-01

The influence of salinity and drought stress on sodium (Na+), potassium (K+) and proline content of Solanum lycopersicum L. (tomato) cv. Rio Grande was investigated by exposing the plants to five salinity levels i.e., 0 (control), 50, 100, 150 and 200 mM NaCl and four drought regimes i.e. 0 (Control), 2, 4 and 6 days, applied from seedling (4-5 true leaves) to the harvesting stage. The means across salinity levels showed an increase in proline content and Na+ concentration but a reduced K+ concentrations, resulting in high Na+/K+ ratios in shoot and root tissue. In contrast, drought stress decreased the Na+ and K+ content, Na+/K+ ratio but increased the proline content in both the root and shoot tissue. The interaction of salinity and drought significantly affected the sodium (Na+) and potassium (K+) contents, Na+/K+ and proline content of the shoot but K+ content and proline accumulation were not significant. The root and shoot tissue of control plants (0 mMNaCl + 0 Days drought stress) had the minimum Na+ content (2316 and 3490 mu M/g D.wt.), Na+/ K+ ratio (0.399 and 0.364) and proline content (0.72 and 1.91 mu M/g F.wt.) but the highest K+ content (6399 and 9603 mu M/g D.wt.). Whereas, the Na+ content increased with salinity, the K+ content declined. It resulted in the maximum Na+/K+ ratio of the root (1.26) and shoot (0.76) with 200 mMNaCl + 0 Days drought stress. The drought stress also increased the Na+/K+ ratio. Thus, the highest Na+/K+ ratio of root (0.78) and shoot (0.77) was recorded in plants grown under 200 mMNaCl+ 6 Days drought stress. The proline content of the root and shoot were 0.462 and 1.904 mu M/g F.wt. respectively in control plants which increased with increasing salinity and drought stress duration. Thus, the maximum proline content of root (10.61 mu M/g F.wt.) and shoot (28.05 mu M/g F.wt.) was recorded in plants exposed to 200 mMNaCl + 6 days drought stress combination. (author)

SlMAPK3 enhances tolerance to tomato yellow leaf curl virus (TYLCV) by regulating salicylic acid and jasmonic acid signaling in tomato (Solanum lycopersicum).

Science.gov (United States)

Li, Yunzhou; Qin, Lei; Zhao, Jingjing; Muhammad, Tayeb; Cao, Hehe; Li, Hailiang; Zhang, Yan; Liang, Yan

2017-01-01

Several recent studies have reported on the role of mitogen-activated protein kinase (MAPK3) in plant immune responses. However, little is known about how MAPK3 functions in tomato (Solanum lycopersicum L.) infected with tomato yellow leaf curl virus (TYLCV). There is also uncertainty about the connection between plant MAPK3 and the salicylic acid (SA) and jasmonic acid (JA) defense-signaling pathways. The results of this study indicated that SlMAPK3 participates in the antiviral response against TYLCV. Tomato seedlings were inoculated with TYLCV to investigate the possible roles of SlMAPK1, SlMAPK2, and SlMAPK3 against this virus. Inoculation with TYLCV strongly induced the expression and the activity of all three genes. Silencing of SlMAPK1, SlMAPK2, and SlMAPK3 reduced tolerance to TYLCV, increased leaf H2O2 concentrations, and attenuated expression of defense-related genes after TYLCV infection, especially in SlMAPK3-silenced plants. Exogenous SA and methyl jasmonic acid (MeJA) both significantly induced SlMAPK3 expression in tomato leaves. Over-expression of SlMAPK3 increased the transcript levels of SA/JA-mediated defense-related genes (PR1, PR1b/SlLapA, SlPI-I, and SlPI-II) and enhanced tolerance to TYLCV. After TYLCV inoculation, the leaves of SlMAPK3 over-expressed plants compared with wild type plants showed less H2O2 accumulation and greater superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) activity. Overall, the results suggested that SlMAPK3 participates in the antiviral response of tomato to TYLCV, and that this process may be through either the SA or JA defense-signaling pathways.

SlMAPK3 enhances tolerance to tomato yellow leaf curl virus (TYLCV by regulating salicylic acid and jasmonic acid signaling in tomato (Solanum lycopersicum.

Directory of Open Access Journals (Sweden)

Yunzhou Li

Full Text Available Several recent studies have reported on the role of mitogen-activated protein kinase (MAPK3 in plant immune responses. However, little is known about how MAPK3 functions in tomato (Solanum lycopersicum L. infected with tomato yellow leaf curl virus (TYLCV. There is also uncertainty about the connection between plant MAPK3 and the salicylic acid (SA and jasmonic acid (JA defense-signaling pathways. The results of this study indicated that SlMAPK3 participates in the antiviral response against TYLCV. Tomato seedlings were inoculated with TYLCV to investigate the possible roles of SlMAPK1, SlMAPK2, and SlMAPK3 against this virus. Inoculation with TYLCV strongly induced the expression and the activity of all three genes. Silencing of SlMAPK1, SlMAPK2, and SlMAPK3 reduced tolerance to TYLCV, increased leaf H2O2 concentrations, and attenuated expression of defense-related genes after TYLCV infection, especially in SlMAPK3-silenced plants. Exogenous SA and methyl jasmonic acid (MeJA both significantly induced SlMAPK3 expression in tomato leaves. Over-expression of SlMAPK3 increased the transcript levels of SA/JA-mediated defense-related genes (PR1, PR1b/SlLapA, SlPI-I, and SlPI-II and enhanced tolerance to TYLCV. After TYLCV inoculation, the leaves of SlMAPK3 over-expressed plants compared with wild type plants showed less H2O2 accumulation and greater superoxide dismutase (SOD, peroxidase (POD, catalase (CAT, and ascorbate peroxidase (APX activity. Overall, the results suggested that SlMAPK3 participates in the antiviral response of tomato to TYLCV, and that this process may be through either the SA or JA defense-signaling pathways.

The identification of a gene (Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit.

Science.gov (United States)

Hovav, Ran; Chehanovsky, Noam; Moy, Michal; Jetter, Reinhard; Schaffer, Arthur A

2007-11-01

One of the most intriguing phenomena of fleshy fruit is the ability to maintain high water content at maturity, even following harvest. This is accomplished by a fruit cuticle that is highly impermeable to water diffusion. In this paper, we report on a novel genotype of tomato, developed via introgression from the wild species Solanum habrochaites, which is characterized by microfissuring of the fruit cuticle and dehydration of the mature fruit. The microfissure/dehydration phenotype is inherited as a single gene, termed Cwp1 (cuticular water permeability). The gene was fine mapped, and its identity was determined by map-based cloning and differential expression analysis in near-isogenic lines. Causality of the Cwp1 gene was shown by the heterologous transgenic expression of the gene in the cultivated tomato, which caused a microfissured fruit cuticle leading to dehydrated fruit. Cwp1 encodes for a protein of unidentified function in the DUF833 domain family. The gene is expressed in the fruit epidermis of the dehydrating genotype harbouring the wild-species introgression, but not in the cultivated tomato. It is expressed only in the primitive green-fruited wild tomato species, but is not expressed in the cultivated Solanum lycopersicum and the closely related Solanum cheesmaniae and Solanum pimpinellifolium, indicating a pre-adaptive role for Cwp1 silencing in the evolution and domestication of the cultivated tomato.

Cameroun

African Journals Online (AJOL)

SARAH

30 juin 2014 ... yohimbe, Rauvolfia vomitoria, Solanum lycopersicum,. Solanum nigrum, Solanum tuberosum, Voacanga africana, Voacanga thouarsii, Zingiber officinale. Les espèces exotiques sont : Acanthus montanus,. Ageratum conyzoides, Aloe vera, Allium sativum,. Apium graveolens, Amaranthus hybridus, Ananas.

The Epl1 and Sm1 proteins from Trichoderma atroviride and Trichoderma virens differentially modulate systemic disease resistance against different life style pathogens in Solanum lycopersicum

Directory of Open Access Journals (Sweden)

Miguel Angel eSalas-Marina

2015-02-01

Full Text Available Fungi belonging to the genus Trichoderma, commonly found in soil or colonizing plant roots, exert beneficial effects on plants, including the promotion of growth and the induction of resistance to disease. T. virens and T. atroviride secrete the proteins Sm1 and Epl1, respectively, which elicit local and systemic disease resistance in plants. In this work, we show that these fungi promote growth in tomato (Solanum lycopersicum plants. T. virens was more effective than T. atroviride in promoting biomass gain, and both fungi were capable of inducing systemic protection in tomato against Alternaria solani, Botrytis cinerea, and Pseudomonas syringae pv. tomato (Pst DC3000. Deletion (KO of epl1 in T. atroviride resulted in diminished systemic protection against A. solani and B. cinerea, whereas the T. virens sm1 KO strain was less effective in protecting tomato against Pst DC3000 and B. cinerea. Importantly, over-expression (OE of epl1 and sm1 led to an increase in disease resistance against all tested pathogens. Although the Trichoderma WT strains induced both systemic acquired resistance (SAR- and induced systemic resistance (ISR-related genes in tomato, inoculation of plants with OE and KO strains revealed that Epl1 and Sm1 play a minor role in the induction of these genes. However, we found that Epl1 and Sm1 induce the expression of a peroxidase and an α-dioxygenase encoding genes, respectively, which could be important for tomato protection by Trichoderma spp. Altogether, these observations indicate that colonization by beneficial and/or infection by pathogenic microorganisms dictates many of the outcomes in plants, which are more complex than previously thought.

The wild tomato species Solanum chilense shows variation in pathogen resistance between geographically distinct populations.

Science.gov (United States)

Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

2017-01-01

Wild tomatoes are a valuable source of disease resistance germplasm for tomato ( Solanum lycopersicum ) breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense , both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense . We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens ( Alternaria solani , Phytophthora infestans and a Fusarium sp .) and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense , resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved.

Pollen morphology and study of the visitors (Hymenoptera, Apidae) of Solanum stramoniifolium Jacq. (Solanaceae) in Central Amazon

OpenAIRE

Silva,Alexandre Coletto da; Kinupp,Valdely Ferreira; Absy,Maria Lucia; Kerr,Warwick Estevam

2004-01-01

The Solanaceae family has a wide distribution, mainly in the tropical and subtropical areas of South America. Solanum L. is one of the most important genera of the family with approximately 1,200 species. The objective of this work was to study the floral biology, pollen morphology as well as to investigate the bee visitors of S. stramoniifolium. Preliminary data indicate the presence of one species of stinging bee and four species of stingless bees as visitors to S. stramoniifolium. The poll...

Effect of biologically synthesized copper oxide nanoparticles on metabolism and antioxidant activity to the crop plants Solanum lycopersicum and Brassica oleracea var. botrytis.

Science.gov (United States)

Singh, Ajey; Singh, N B; Hussain, Imtiyaz; Singh, Himani

2017-11-20

Study on the ecological effect of metal oxide nanomaterials (NMs) has quickly amplified over the precedent years because it is assumed that these NMs will sooner or later be released into the environment. The present study deals with biologically oriented process for the green synthesis of copper oxide nanoparticles (CuO NPs) by using Morus alba leaf extract as reducing agent. Powder X-ray diffraction (XRD) and transmission electron microscope (TEM) analysis revealed the monoclinic phase and 20-40nm size respectively. The presence of reducing and capping agents revealed by Fourier transform infrared (FTIR) spectroscopy. The seedlings of Brassica oleracea var. botrytis and Solanum lycopersicum were exposed to 10, 50, 100, and 500mgL -1 concentrations of CuO NPs in the sand medium. Bioaccumulation of Cu was also investigated by atomic absorption spectroscopy (AAS). Plant exposure to 100 and 500mgL -1 of CuO NPs has resulted in significant reduction of total chlorophyll and sugar content in the two test plants while 10mgL -1 of NPs slightly increased the pigment and sugar content in tomato plants only. Augmentation of lipid peroxidation, electrolyte leakage, and antioxidant enzyme activity was observed in a dose dependent manner upon plants exposure to CuO NPs. Deposition of lignin in roots of both plants treated with the highest concentration of CuO NPs was observed. Histochemical analysis of leaves of treated plant with nitroblue tetrazolium and 3 ' 3 ' diaminobenzidine showed a concentration dependent increase in superoxide and hydrogen peroxide formation in leaves. The green synthesis of CuO NPs was carried out by using Morus alba leaf extract. Accumulation of NPs more actively by tomato plants as compared to cauliflower was possibly due to the difference in root morphology. The histochemical visualization highlights the spatial organization of oxidant biochemistry occurring in response to metal stress. Copyright © 2017 Elsevier B.V. All rights reserved.

Floral induction, floral hormones and flowering

NARCIS (Netherlands)

Pol, van de P.A.

1972-01-01

The factors, influencing the synthesis and action of floral hormones, and possible differences between floral hormones in different plants were studied. The experimental results are summarized in the conclusions 1-20, on pages 35-36 (Crassulaceae'); 21-39 on pages

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

Science.gov (United States)

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Caracterización morfológica y evaluación de resistencia a Fusarium oxysporum en especies silvestres del género Solanum sección Lycopersicon

Directory of Open Access Journals (Sweden)

Maria Natalia Morales Palacio

2014-01-01

Título corto: Caracterización morfológica y evaluación de resistencia a Fusarium oxysporum Resumen:  Con el objetivo de evaluar la variación morfológica y la resistencia a Fusarium oxysporum en la colección del banco de germoplasma de la Universidad Nacional de Loja (UNL, 146 accesiones de cuatro especies silvestres fueron seleccionadas (Solanum pimpinellifolium, S. neorickii, S. habrochaites, S. lycopersicum var. cerasiforme; y, 20 accesiones de tomate cultivado (S. lycopersicum. Un total de 723 plántulas se transplantaron al campo y se evaluaron morfológicamente durante todo su ciclo biológico, con un descriptor que incluyó 20 caracteres cuantitativos y 25 cualitativos. Se estimó la variabilidad morfológica y se detectaron diferencias fenotípicas relacionadas con el fruto, características vegetativas de las plantas y los componentes del rendimiento. Las variables morfológicas mostraron que S. habrochaites es la especie más diferenciada con relación a las restantes. La podredumbre vascular causada por F. oxysporum es responsable de enormes pérdidas en la producción de tomate en el mundo; sin embargo, las especies silvestres que originaron las variedades cultivadas poseen genes de interés agronómico, utilizados por décadas para la generación de variedades resistentes. Por ello, entre 64 y 228 individuos por especie, se evaluaron por tres procedimientos de inoculación. Todas las especies fueron significativamente diferentes en los niveles de resistencia, tolerancia o susceptibilidad. S. neorickii fue más resistente y tolerante, seguida de S. pimpinellifolium y S. lycopersicum var. cerasiforme, mientras que todas las variedades cultivadas (S. lycopersicum fueron susceptibles. Tales circunstancias permitieron determinar sin lugar a dudas, que las plantas sobrevivientes y tolerantes poseen un genotipo particular que determina esa característica. Palabras clave:  Ecuador, tomate, tolerancia, susceptibilidad, inoculación. Abstract: In order

The wild tomato species Solanum chilense shows variation in pathogen resistance between geographically distinct populations

Directory of Open Access Journals (Sweden)

Remco Stam

2017-01-01

Full Text Available Wild tomatoes are a valuable source of disease resistance germplasm for tomato (Solanum lycopersicum breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense, both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense. We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens (Alternaria solani, Phytophthora infestans and a Fusarium sp. and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense, resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved.

The wild tomato species Solanum chilense shows variation in pathogen resistance between geographically distinct populations

Science.gov (United States)

Scheikl, Daniela; Tellier, Aurélien

2017-01-01

Wild tomatoes are a valuable source of disease resistance germplasm for tomato (Solanum lycopersicum) breeders. Many species are known to possess a certain degree of resistance against certain pathogens; however, evolution of resistance traits is yet poorly understood. For some species, like Solanum chilense, both differences in habitat and within species genetic diversity are very large. Here we aim to investigate the occurrence of spatially heterogeneous coevolutionary pressures between populations of S. chilense. We investigate the phenotypic differences in disease resistance within S. chilense against three common tomato pathogens (Alternaria solani, Phytophthora infestans and a Fusarium sp.) and confirm high degrees of variability in resistance properties between selected populations. Using generalised linear mixed models, we show that disease resistance does not follow the known demographic patterns of the species. Models with up to five available climatic and geographic variables are required to best describe resistance differences, confirming the complexity of factors involved in local resistance variation. We confirm that within S. chilense, resistance properties against various pathogens show a mosaic pattern and do not follow environmental patterns, indicating the strength of local pathogen pressures. Our study can form the basis for further investigations of the genetic traits involved. PMID:28133579

Patterning of inflorescences and flowers by the F-Box protein DOUBLE TOP and the LEAFY homolog ABERRANT LEAF AND FLOWER of petunia.

Science.gov (United States)

Souer, Erik; Rebocho, Alexandra B; Bliek, Mattijs; Kusters, Elske; de Bruin, Robert A M; Koes, Ronald

2008-08-01

Angiosperms display a wide variety of inflorescence architectures differing in the positions where flowers or branches arise. The expression of floral meristem identity (FMI) genes determines when and where flowers are formed. In Arabidopsis thaliana, this is regulated via transcription of LEAFY (LFY), which encodes a transcription factor that promotes FMI. We found that this is regulated in petunia (Petunia hybrida) via transcription of a distinct gene, DOUBLE TOP (DOT), a homolog of UNUSUAL FLORAL ORGANS (UFO) from Arabidopsis. Mutation of DOT or its tomato (Solanum lycopersicum) homolog ANANTHA abolishes FMI. Ubiquitous expression of DOT or UFO in petunia causes very early flowering and transforms the inflorescence into a solitary flower and leaves into petals. Ectopic expression of DOT or UFO together with LFY or its homolog ABERRANT LEAF AND FLOWER (ALF) in petunia seedlings activates genes required for identity or outgrowth of organ primordia. DOT interacts physically with ALF, suggesting that it activates ALF by a posttranslational mechanism. Our findings suggest a wider role than previously thought for DOT and UFO in the patterning of flowers and indicate that the different roles of LFY and UFO homologs in the spatiotemporal control of floral identity in distinct species result from their divergent expression patterns.

Evaluation of a SUMO E2 conjugating enzyme involved in resistance to Clavibacter michiganensis subsp. michiganensis in Solanum peruvianum, through a tomato mottle virus VIGS assay

Directory of Open Access Journals (Sweden)

Mayra Janeth Esparza-Araiza

2015-12-01

Full Text Available Clavibacter michiganensis subsp. michiganensis (Cmm causes bacterial wilt and canker of tomato. Currently, no Solanum lycopersicum resistant varieties are commercially available, but some degree of Cmm resistance has been identified in Solanum peruvianum. Previous research showed up-regulation of a SUMO E2 conjugating enzyme (SCEI transcript in resistant S. peruvianum compared to susceptible S. lycopersicum following infection by Cmm. In order to test the role of SCEI in resistance to Cmm, a fragment of the gene from S. peruvianum was cloned into a novel virus-induced gene-silencing (VIGS vector based on the geminivirus Tomato Mottle Virus (ToMoV. Using biolistic inoculation, the ToMoV-based VIGS vector was shown to be effective in S. peruvianum by silencing the magnesium chelatase gene, which resulted in leaf bleaching. The ToMoV_SCEI construct resulted in approx. 61% silencing of SCEI in leaves of S. peruvianum as determined by quantitative RT-PCR. VIGS of SCEI in S. peruvianum resulted in unilateral wilting (15 dpi and subsequent death (20 dpi of the entire plant after Cmm inoculation, whereas empty vector-treated plants only showed wilting in the Cmm-inoculated leaf. SCEI-silenced plants also showed higher Cmm colonization with an average of 4.5 times more damaged tissue compared to the empty vector control plants. SCEI appears to play an important role in the innate immunity of S. peruvianum against Cmm, perhaps through the regulation of WRKY transcription factors, which may lead to expression of proteins involved in salicylic acid-dependent defense responses.

Detection of an inversion in the Ty-2 region between S. lycopersicum and S. habrochaites by a combination of de novo genome assembly and BAC cloning.

Science.gov (United States)

Wolters, Anne-Marie A; Caro, Myluska; Dong, Shufang; Finkers, Richard; Gao, Jianchang; Visser, Richard G F; Wang, Xiaoxuan; Du, Yongchen; Bai, Yuling

2015-10-01

A chromosomal inversion associated with the tomato Ty - 2 gene for TYLCV resistance is the cause of severe suppression of recombination in a tomato Ty - 2 introgression line. Among tomato and its wild relatives inversions are often observed, which result in suppression of recombination. Such inversions hamper the transfer of important traits from a related species to the crop by introgression breeding. Suppression of recombination was reported for the TYLCV resistance gene, Ty-2, which has been introgressed in cultivated tomato (Solanum lycopersicum) from the wild relative S. habrochaites accession B6013. Ty-2 was mapped to a 300-kb region on the long arm of chromosome 11. The suppression of recombination in the Ty-2 region could be caused by chromosomal rearrangements in S. habrochaites compared with S. lycopersicum. With the aim of visualizing the genome structure of the Ty-2 region, we compared the draft de novo assembly of S. habrochaites accession LYC4 with the sequence of cultivated tomato ('Heinz'). Furthermore, using populations derived from intraspecific crosses of S. habrochaites accessions, the order of markers in the Ty-2 region was studied. Results showed the presence of an inversion of approximately 200 kb in the Ty-2 region when comparing S. lycopersicum and S. habrochaites. By sequencing a BAC clone from the Ty-2 introgression line, one inversion breakpoint was identified. Finally, the obtained results are discussed with respect to introgression breeding and the importance of a priori de novo sequencing of the species involved.

Phytohormone profiling in relation to osmotic adjustment in NaCl-treated plants of the halophyte tomato wild relative species Solanum chilense comparatively to the cultivated glycophyte Solanum lycopersicum

Czech Academy of Sciences Publication Activity Database

Gharbi, E.; Martínez, J. L.; Benahmed, H.; Hichri, I.; Dobrev, Petre; Motyka, Václav; Quineta, M.; Lutts, S.

2017-01-01

Roč. 258, MAY (2017), s. 77-89 ISSN 0168-9452 R&D Projects: GA ČR(CZ) GA16-14649S Institutional support: RVO:61389030 Keywords : antioxidant enzyme-activities * improves salinity tolerance * enhances salt tolerance * abscisic-acid * water-stress * na+-exclusion * accumulation * ethylene * growth * arabidopsis * Osmotic adjustment * Halophyte * Salinity * Solanum chilense * Hormone * Tomato Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 3.437, year: 2016

Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics.

Science.gov (United States)

Aoki, Koh; Yano, Kentaro; Suzuki, Ayako; Kawamura, Shingo; Sakurai, Nozomu; Suda, Kunihiro; Kurabayashi, Atsushi; Suzuki, Tatsuya; Tsugane, Taneaki; Watanabe, Manabu; Ooga, Kazuhide; Torii, Maiko; Narita, Takanori; Shin-I, Tadasu; Kohara, Yuji; Yamamoto, Naoki; Takahashi, Hideki; Watanabe, Yuichiro; Egusa, Mayumi; Kodama, Motoichiro; Ichinose, Yuki; Kikuchi, Mari; Fukushima, Sumire; Okabe, Akiko; Arie, Tsutomu; Sato, Yuko; Yazawa, Katsumi; Satoh, Shinobu; Omura, Toshikazu; Ezura, Hiroshi; Shibata, Daisuke

2010-03-30

The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs) was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706) was estimated to be 0.061%. The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the tomato whole-genome sequence and aid in tomato functional

Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum cultivar Micro-Tom, a reference system for the Solanaceae genomics

Directory of Open Access Journals (Sweden)

Kikuchi Mari

2010-03-01

Full Text Available Abstract Background The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. Results To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706 was estimated to be 0.061%. Conclusion The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the

Cross-species BAC-FISH painting of the tomato and potato chromosome 6 reveals undescribed chromosomal rearrangements

NARCIS (Netherlands)

Tang, X.; Szinay, D.; Ramanna, M.S.; Vossen, van der E.A.G.; Datema, E.; Klein Lankhorst, R.M.; Boer, de J.M.; Peters, S.A.; Bachem, C.W.B.; Stiekema, W.J.; Visser, R.G.F.; Jong, de J.H.; Bai, Y.

2008-01-01

Ongoing genomics projects of tomato (Solanum lycopersicum ) and potato (Solanum tuberosum) are providing unique tools for comparative mapping studies in Solanaceae. At the chromosomal level, BACs can be positioned on pachytene comple-ments by fluorescent in situ hybridization (FISH) on homoeologous

UFO: an Arabidopsis gene involved in both floral meristem and floral organ development.

Science.gov (United States)

Levin, J Z; Meyerowitz, E M

1995-05-01

We describe the role of the UNUSUAL FLORAL ORGANS (UFO) gene in Arabidopsis floral development based on a genetic and molecular characterization of the phenotypes of nine ufo alleles. UFO is required for the proper identity of the floral meristem and acts in three different aspects of the process that distinguishes flowers from shoots. UFO is involved in establishing the whorled pattern of floral organs, controlling the determinacy of the floral meristem, and activating the APETALA3 and PISTILLATA genes required for petal and stamen identity. In many respects, UFO acts in a manner similar to LEAFY, but the ufo mutant phenotype also suggests an additional role for UFO in defining boundaries within the floral primordia or controlling cell proliferation during floral organ growth. Finally, genetic interactions that prevent flower formation and lead to the generation of filamentous structures implicate UFO as a member of a new, large, and diverse class of genes in Arabidopsis necessary for flower formation.

Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit colour

NARCIS (Netherlands)

Ballester, A.R.; Molthoff, J.W.; Vos, de C.H.; Lintel Hekkert, B.; Orzaez, D.; Fernandez-Moreno, J.P.; Tripodi, S.; Grandillo, S.; Martin, C.; Heldens, J.; Ykema, M.; Granell, A.; Bovy, A.G.

2010-01-01

The color of tomato fruit is mainly determined by carotenoids and flavonoids. Phenotypic analysis of an introgression line (IL) population derived from a cross between Solanum lycopersicum 'Moneyberg' and the wild species Solanum chmielewskii revealed three ILs with a pink fruit color. These lines

Floral development and floral phyllotaxis in Anaxagorea (Annonaceae).

Science.gov (United States)

Endress, Peter K; Armstrong, Joseph E

2011-10-01

Background and Aims Anaxagorea is the phylogenetically basalmost genus in the large tropical Annonaceae (custard apple family) of Magnoliales, but its floral structure is unknown in many respects. The aim of this study is to analyse evolutionarily interesting floral features in comparison with other genera of the Annonaceae and the sister family Eupomatiaceae. Methods Live flowers of Anaxagorea crassipetala were examined in the field with vital staining, liquid-fixed material was studied with scanning electron microscopy, and microtome section series were studied with light microscopy. In addition, herbarium material of two other Anaxagorea species was cursorily studied with the dissecting microscope. Key Results Floral phyllotaxis in Anaxagorea is regularly whorled (with complex whorls) as in all other Annonaceae with a low or medium number of floral organs studied so far (in those with numerous stamens and carpels, phyllotaxis becoming irregular in the androecium and gynoecium). The carpels are completely plicate as in almost all other Annonaceae. In these features Anaxagorea differs sharply from the sister family Eupomatiaceae, which has spiral floral phyllotaxis and ascidiate carpels. Flat stamens and the presence of inner staminodes differ from most other Annonaceae and may be plesiomorphic in Anaxagorea. However, the inner staminodes appear to be non-secretory in most Anaxagorea species, which differs from inner staminodes in other families of Magnoliales (Eupomatiaceae, Degeneriacae, Himantandraceae), which are secretory. Conclusions Floral phyllotaxis in Anaxagorea shows that there is no signature of a basal spiral pattern in Annonaceae and that complex whorls are an apomorphy not just for a part of the family but for the family in its entirety, and irregular phyllotaxis is derived. This and the presence of completely plicate carpels in Anaxagorea makes the family homogeneous and distinguishes it from the closest relatives in Magnoliales.

Assessment of Salinity Effect on Germination, Growth and Yield of Solanum lycopersicum (L.

Directory of Open Access Journals (Sweden)

Joshua D. BUAH

2016-09-01

Full Text Available This study was aimed at unraveling the morphological effect of salinity on germination, growth and yield of S. lycopersicum, through inducement of salinity (0, 4, 6, 8, and 10 g NaCl. All the parameters considered: germination percentage, leaves number, stem girth, plant height and fruit quality, were significantly affected by NaCl treatments (salinity compared with the control (no salinity. 100% germination was recorded only in control and 4 g NaCl concentration, though the percentage of germination was faster in control than within the 4 g NaCl. ‘Tomato UC-83-B’ plants’ growth till maturity, shed leaves, chlorosis and leaf burns around edges occurred due to osmotic imbalance and water deficit caused by salinity, which invariably had effect on leaf area, although the reduction in leaf area varied among tested NaCl concentrations. Fruits yield and quality of ‘Tomato UC-83-B’ treated with NaCl was poor and relative to the degree of saline inducements, with 10 g NaCl treatment producing the least fruits. Chlorophyll contents were also significantly reduced by increasing saline concentrations. Ca and K were the predominant elements found in the digested fruit samples observed under Atomic Absorption Spectrometry (AAS at different NaCl concentrations, while Mg, Na and P were significantly less. Salinity is a major abiotic factor that hampered the overall performance of tomato crop in salient ways and must therefore be curbed in order to meet its increasing global demand.

Morphology and biomass variations in root system of young tomato plants (Solanum sp.)

International Nuclear Information System (INIS)

Álvarez Gil, Marta A.; Fernández, Ana Fita; Ruiz Sánchez, María del C.; Bolarín Jiménez, María del C.

2016-01-01

The scarce exploitation of genotypic variability present in plant roots is an attractive breeding choice with regard to abiotic stresses and supports the objective of this work, which is to identify genotypic variation in root system traits of tomato genotypes (Solanum sp.). Thus, five tomato genotypes were studied: the commercial hybrid cultivar Jaguar (S. lycopersicum), Pera, Volgogradiskij and PE-47 entry (S. pennellii), which were collected in Peru, and the interspecific hybrid PeraxPE-47. Plants were grown in hydroponics for 26 days since germination; their roots were extracted and images were digitalized on scanner to evaluate total length, average diameter, the projected area and root length, following the categories per diameter of the whole root system through software Win Rhizo Pro 2003. The dry mass of roots and aerial parts was also recorded. Results indicated that genotypes differed in morphology, length according to diameter, root system spatial configuration and biomass, mainly with respect to the wild salinity resistant species PE-47. The interspecific hybrid PxPE-47 could be used as a rootstock to increase salt tolerance of susceptible cultivars. (author)

Floral development and floral phyllotaxis in Anaxagorea (Annonaceae)

OpenAIRE

Endress, Peter K.; Armstrong, Joseph E.

2011-01-01

Background and Aims Anaxagorea is the phylogenetically basalmost genus in the large tropical Annonaceae (custard apple family) of Magnoliales, but its floral structure is unknown in many respects. The aim of this study is to analyse evolutionarily interesting floral features in comparison with other genera of the Annonaceae and the sister family Eupomatiaceae. Methods Live flowers of Anaxagorea crassipetala were examined in the field with vital staining, liquid-fixed material was studied with...

Dependency on floral resources determines the animals' responses to floral scents.

Science.gov (United States)

Junker, Robert R; Blüthgen, Nico

2010-08-01

Animal-pollinated angiosperms either depend on cross-pollination or may also reproduce after self-pollination - the former are thus obligately, the latter facultatively dependent on the service of animal-pollinators. Analogously, flower visitors either solely feed on floral resources or complement their diet with these, and are hence dependent or not on the flowers they visit. We assume that obligate flower visitors evolved abilities that enable them to effectively forage on flowers including mechanisms to bypass or tolerate floral defences such as morphological barriers and repellent / deterrent secondary metabolites. Facultative flower visitors, in contrast, are supposed to lack these adaptations and are often prevented to consume floral resources by defence mechanisms. In cases where obligate flower visitors are mutualists and facultative ones are antagonists, this dichotomy provides a solution for the plants' dilemma to attract pollinators and simultaneously repel exploiters. In a meta-analysis, we recently supported this hypothesis: obligate flower visitors are attracted to floral scents, while facultative ones are repelled. Here, we add empirical evidence to these results: bumblebees and ants, obligate and facultative flower visitors, respectively, responded as predicted by the results of the meta-analysis to synthetic floral scent compounds.

Diverse responses of wild and cultivated tomato to BABA, oligandrin and Oidium neolycopersici infection

Czech Academy of Sciences Publication Activity Database

Satková, P.; Starý, T.; Plešková, E.; Zapletalová, M.; Kašparovský, T.; Činčalová-Kubienová, L.; Luhová, L.; Mieslerová, B.; Mikulík, Jaromír; Lochman, J.; Petřivalský, M.

2017-01-01

Roč. 119, č. 5 (2017), s. 829-840 ISSN 0305-7364 Institutional support: RVO:61389030 Keywords : baba * Defence genes * Ethylene * Oidium neolycopersici * Oligandrin * Powdery mildew * Resistance * Solanum habrochaites * Solanum lycopersicum * Tomato Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection OBOR OECD: Plant sciences, botany Impact factor: 4.041, year: 2016

Resposta à mosca-branca (Bemisia tabaci e ao Tomato severe rugose virus de acessos de Solanum subgênero Leptostemonum Reaction to whitefly (Bemisia tabaci and Tomato severe rugose virus of Solanum subgenus Leptostemonum accessions

Directory of Open Access Journals (Sweden)

Miguel Michereff-Filho

2012-09-01

Full Text Available A mosca-branca (Bemisia tabaci e a infecção por espécies de Begomovirus são dois graves problemas fitossanitários que afetam a produção e qualidade do tomateiro (Solanum lycopersicum e de outras solanáceas de importância econômica. O presente trabalho foi conduzido sob condições controladas, em casa de vegetação, visando avaliar a resposta ao Tomato severe rugose virus (ToSRV e à mosca-branca (B. tabaci biótipo B de 36 acessos de espécies relacionadas ao gênero Solanum subgênero Leptostemonum (= grupo das solanáceas providas de espinhos. A inoculação de ToSRV foi realizada em mudas (43 dias após o semeio utilizando-se um colônia virulífera de B. tabaci biótipo B. Duas cultivares de tomateiro foram incluídas como testemunhas suscetíveis. A avaliação ao ToSRV foi feita de acordo com uma escala de severidade de sintomas e a presença de infecção sistêmica foi verificada via reação em cadeia da polimerase (PCR com 'primers' universais para espécies de Begomovirus. A maioria dos acessos apresentou uma resposta do tipo resistência ou quase imunidade ao ToSRV, não apresentando sintomas evidentes e nenhum indício de infecção sistêmica ou acumulação viral. Um grupo reduzido de acessos de S. stramonifolium, S. asperolanatum e S. jamaiscense apresentou uma resposta do tipo tolerância, caracterizada por baixa acumulação viral e sintomas suaves. O acesso S. mammosum 'CNPH 035', embora tolerante, foi o único que apresentou sintomas mais evidentes de infecção viral e acumulação de ToSRV. O mesmo grupo de 36 acessos foi avaliado em relação à colonização por B. tabaci em testes de livre escolha. Diferenças significativas foram observadas entre acessos para oviposição e o número de ninfas no quarto instar, indicando a presença de fatores de resistência ao inseto. Dez acessos de S. asperolanatum, S. stramonifolium, S. paniculatum e S. syssimbriifolium se mostraram completamente livres de oviposi

Identificação de genótipos do gênero Solanum (secção Lycopersicon com resistência a Stemphylium solani e S. lycopersici Identification of Solanum (section Lycopersicon accessions with resistance to Stemphylium solani and S. lycopersici

Directory of Open Access Journals (Sweden)

Bruno Eduardo C de Miranda

2010-06-01

Full Text Available A mancha-de-estenfílio do tomateiro, causada pelos fungos Stemphylium solani e S. lycopersici, foi considerada, por muito tempo, como uma doença secundária devido à utilização combinada de fungicidas e variedades resistentes. Recentemente, severas epidemias da mancha-de-estenfilio têm sido relatadas nas várias regiões produtoras sugerindo a necessidade de retomar o emprego de cultivares com resistência a esta enfermidade. O objetivo do presente trabalho foi avaliar a reação de genótipos cultivados e silvestres de tomateiro [Solanum (secção Lycopersicon] frente a isolados destas duas espécies de Stemphylium. Na primeira etapa do trabalho, 109 genótipos de Solanum (secção Lycopersicon foram avaliados via inoculação com uma suspensão de 10(4 conídios/mL dos isolados 'EH-1740' (S. solani e 'EH-1749' (S. lycopersici. As plantas foram transplantadas aos 18 dias da semeadura e inoculadas sete dias depois. A avaliação da resposta dos genótipos foi feita 15 dias após a inoculação. Cinqüenta e oito genótipos considerados promissores foram novamente avaliados (com os mesmos isolados em um segundo experimento. Neste experimento a reação dos genótipos foi avaliada cada dois dias utilizando como critérios o período de incubação e a severidade da doença através de uma escala de notas de 0 a 5. Com os valores de severidade, nas diferentes leituras, foi calculada a área abaixo da curva de progresso da doença e o índice de doença. Foram identificadas 35 fontes de resistência às duas espécies de Stemphylium em genótipos das espécies S. lycopersicum, S. habrochaites, S. peruvianum e S. pimpinellifolium. Os genótipos de S. lycopersicum e S. pimpinellifolium resistentes possuem, provavelmente, o gene de resistência Sm. No entanto, os genótipos de S. peruvianum e S. habrochaites podem representar fontes de novos genes/alelos que conferem resistência às duas espécies fúngicas. Esta potencial diversidade de fatores

Estudo farmacobotânico comparativo de folhas de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St.-Hil., Solanaceae The pharmacobotanical comparative study of leaves of Solanum crinitum Lam., Solanum gomphodes Dunal and Solanum lycocarpum A. St-Hil, (Solanaceae

Directory of Open Access Journals (Sweden)

Nathalia Diniz Araújo

2010-11-01

Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.In this work, a pharmacobotanical study of Solanum crinitum Lam., S. gomphodes Dunal and S. lycocarpum A. St-Hil., all belonging to the Solanum sect. Crinitum Child. has been realized with the objective of providing a macroscopical and microscopical morphodiagnosis for their characterizations. The three species are commonly named "jurubeba", "fruta-de-lobo" and "lobeira", and they are used in the folk medicine for the treatment of diabetes and others diseases. The three species studied share various morphological characters, like shrub and tree forms, the velutinous abaxial indument, the presence of bristles, the flower with stellate-pentagonal corollas ranging from violet to purple, and the fruit reaching up to 5 cm in diameter. The principal parameters to distinct the three species studied were the morphology of petiole and base of the blade leaf, the indument of adaxial surface, the anatomy of mesophyll, the types of stomata and the leaf margin.

Organic production of tomatoes in the amazon region by plants grafted on wild Solanum rootstocks

Directory of Open Access Journals (Sweden)

Elaine Aparecida de Paula Farias

2013-08-01

Full Text Available The production of organically grown tomatoes in the Amazonian region of Brazil is difficult due to inherent phytosanitary issues. The objectives of the present investigation were to evaluate the productivity of grafted tomato plants (Solanumlycopersicum cv. Santa Adélia grown organically in Rio Branco, Acre, Brazil, and to assess scion/rootstock compatibility under organic growth conditions. The Solanum species employed as rootstocks were S. gilo (jiló, S. lycocarpum (jurubebão, S. stramonifolium (jurubeba vermelha and S. viarum (joá, while the susceptible S.lycopersicum cultivar Santa Adélia was the scion. Ungrafted tomato plants and tomato grafted on tomato rootstock were employed as controls. The experiment was arranged in a completely randomized block design with six treatments and five repetitions of five plants each. Data were submitted to analysis of variance and the significance of differences between treatments were determined using the Tukey test (P<0.05. All ungrafted tomato plants and those comprising tomato grafted on S.lycopersicum rootstock became infected by brown rot and perished. The total numbers of fruits, numbers of marketable fruits, mean masses of fruits, total productivities and productivities of marketable fruits associated with tomato grafted on S. gilo, S. lycocarpum and S. stramonifolium rootstocks were significantly higher (P<0.05 than the equivalent values obtained with tomato grafted on S. viarum rootstock. S. gilo exhibited the best compatibility index (1.11 of all rootstock/scion combinations studied. It is concluded that tomato grafted on S. gilo, S. lycocarpum and S. stramonifolium rootstocks represent viable alternatives for the production of organic tomatoes in the Amazon region.

An analysis of sensitivity of CLIMEX parameters in mapping species potential distribution and the broad-scale changes observed with minor variations in parameters values: an investigation using open-field Solanum lycopersicum and Neoleucinodes elegantalis as an example

Science.gov (United States)

da Silva, Ricardo Siqueira; Kumar, Lalit; Shabani, Farzin; Picanço, Marcelo Coutinho

2018-04-01

A sensitivity analysis can categorize levels of parameter influence on a model's output. Identifying parameters having the most influence facilitates establishing the best values for parameters of models, providing useful implications in species modelling of crops and associated insect pests. The aim of this study was to quantify the response of species models through a CLIMEX sensitivity analysis. Using open-field Solanum lycopersicum and Neoleucinodes elegantalis distribution records, and 17 fitting parameters, including growth and stress parameters, comparisons were made in model performance by altering one parameter value at a time, in comparison to the best-fit parameter values. Parameters that were found to have a greater effect on the model results are termed "sensitive". Through the use of two species, we show that even when the Ecoclimatic Index has a major change through upward or downward parameter value alterations, the effect on the species is dependent on the selection of suitability categories and regions of modelling. Two parameters were shown to have the greatest sensitivity, dependent on the suitability categories of each species in the study. Results enhance user understanding of which climatic factors had a greater impact on both species distributions in our model, in terms of suitability categories and areas, when parameter values were perturbed by higher or lower values, compared to the best-fit parameter values. Thus, the sensitivity analyses have the potential to provide additional information for end users, in terms of improving management, by identifying the climatic variables that are most sensitive.

From introduced American weed to Cape Verde Islands endemic: the case of Solanum rigidum Lam. (Solanaceae, Solanum subgenus Leptostemonum).

Science.gov (United States)

Knapp, Sandra; Vorontsova, Maria S

2013-01-01

A Solanum species long considered an American introduction to the Cape Verde Islands off the west coast of Africa is identified as Solanum rigidum, a member of the Eggplant clade of Old World spiny solanums (Solanum subgenus Leptostemonum) and is probably endemic to the Cape Verde Islands. Collections of this species from the Caribbean are likely to have been introduced from the Cape Verde Islands on slave ships. We discuss the complex nomenclatural history of this plant and provide a detailed description, illustration and distribution map. The preliminary conservation status of Solanum rigidum is Least Concern, but needs to be reassessed in light of its endemic rather than introduced status.

Why Do Floral Perfumes Become Different? Region-Specific Selection on Floral Scent in a Terrestrial Orchid

Science.gov (United States)

Gross, Karin; Sun, Mimi; Schiestl, Florian P.

2016-01-01

Geographically structured phenotypic selection can lead to adaptive divergence. However, in flowering plants, such divergent selection has rarely been shown, and selection on floral signals is generally little understood. In this study, we measured phenotypic selection on display size, floral color, and floral scent in four lowland and four mountain populations of the nectar-rewarding terrestrial orchid Gymnadenia odoratissima in two years. We also quantified population differences in these traits and pollinator community composition. Our results show positive selection on display size and positive, negative, or absence of selection on different scent compounds and floral color. Selection on the main scent compounds was consistently stronger in the lowlands than in the mountains, and lowland plants emitted higher amounts of most of these compounds. Pollinator community composition also differed between regions, suggesting different pollinators select for differences in floral volatiles. Overall, our study is the first to document consistent regional differences in selection on floral scent, suggesting this pattern of selection is one of the evolutionary forces contributing to regional divergence in floral chemical signaling. PMID:26886766

Estudo farmacobotânico comparativo de folhas de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St.-Hil., Solanaceae

Directory of Open Access Journals (Sweden)

Nathalia Diniz Araújo

2010-09-01

Full Text Available Neste trabalho realizou-se um estudo farmacobotânico de Solanum crinitum Lam., Solanum gomphodes Dunal e Solanum lycocarpum A. St-Hil, espécies pertencentes à Solanum sect. Crinitum Child, com o objetivo de efetuar morfodiagnoses macroscópicas e microscópicas que possibilitem suas caracterizações. As três espécies são conhecidas popularmente como "jurubeba", fruta-de-lobo" e "lobeira" e usadas na medicina popular contra o diabetes e também para outros fins. Essas espécies compartilham vários caracteres morfológicos, dentre os quais se destacam o hábito arbustivo a arbóreo, o indumento velutino às vezes cerdoso, a corola é pentagonal-estrelada, roxa a púrpura, e o fruto globoso acima de 5 cm de diâmetro. Entretanto, apesar da grande semelhança morfológica entre as espécies estudadas, destacaram-se como parâmetros distintivos: a morfologia do pecíolo, a base do limbo, o indumento da face adaxial, a anatomia do mesofilo, os tipos de estômatos e a morfologia do bordo foliar.

Floral Sonication is an Innate Behaviour in Bumblebees that can be Fine-Tuned with Experience in Manipulating Flowers.

Science.gov (United States)

Morgan, Tan; Whitehorn, Penelope; Lye, Gillian C; Vallejo-Marín, Mario

Bumblebees demonstrate an extensive capacity for learning complex motor skills to maximise exploitation of floral rewards. This ability is well studied in nectar collection but its role in pollen foraging is less well understood. Floral sonication is used by bees to extract pollen from some plant species with anthers which must be vibrated (buzzed) to release pollen. Pollen removal is determined by sonication characteristics including frequency and amplitude, and thus the ability to optimise sonication should allow bees to maximise the pollen collection. We investigated the ability of the buff-tailed bumblebee ( Bombus terrestris ) to modify the frequency and amplitude of their buzzes with increasing experience manipulating flowers of the buzz-pollinated plant Solanum rostratum . We analysed flight and feeding vibrations generated by naïve workers across feeding bouts. Feeding buzzes were of a higher frequency and a lower amplitude than flight buzzes. Both flight and feeding buzzes had reduced amplitudes with increasing number of foraging trips. However, the frequency of their feeding buzzes was reduced significantly more than their flight buzzes as bumblebee workers gained experience manipulating flowers. These results suggest that bumblebees are able to modify the characteristics of their buzzes with experience manipulating buzz-pollinated flowers. We discuss our findings in the context of bumblebee learning, and the current understanding of the optimal sonication characteristics for releasing pollen in buzz-pollinated species. Our results present a tantalising insight into the potential role of learning in floral sonication, paving the way for future research in this area.

SOLANUM LYCOPERSICUM QUANTITATIVE THING LAYER CHROMATOGRAPHY FOR EVALUATION OF CAROTENOID COMPOSITION OF TOMATOES SOLANUM LYCOPERSICUM

Directory of Open Access Journals (Sweden)

N. A. Golubkina

2017-01-01

Full Text Available Qualitative and quantitative evaluation of tomatoes carote-noid composition is considered to be the basis of tomato selection. Among known methods of identification and carotenoid content determination thing layer chromatography (TLC is characterized by inexpensive, quick and availab-le method of analysis. Comparison of individual tomato carotenoid content data obtained using wellknown empirical formulas and based of TLC separation on chromatoraphic paper was achieved. Empirical formulas for the determination of lycopene and beta-carotene concentrations were shown to give high variations in beta-carotene content and decreased values of total carotenoids concentration values. Developed conditions of chromatographic separation and identification of selected carotenoids are based on different polarity of individual pigments and specific absorption spectra of the latter. Method of thin layer chromatography may serve as a quick and effective method for quality evaluation of tomato fruit of different color and determination of beta-carotene, ζ-carotene, neurosporene, lycopene and lutein content.

Diversity between and within farmers' varieties of tomato from Eritrea

African Journals Online (AJOL)

user

2011-03-21

Mar 21, 2011 ... Key words: Farmers' varieties, genetic diversity, genetic purity, rapid rural appraisal, Solanum lycopersicum, seed mixing ... expressed sequence tag; PCR, polymerase chain reaction; ...... Yam and cowpea diversity manage-.

Involvement of potato (Solanum tuberosum L.) MKK6 in response to potato virus Y.

Science.gov (United States)

Lazar, Ana; Coll, Anna; Dobnik, David; Baebler, Spela; Bedina-Zavec, Apolonija; Zel, Jana; Gruden, Kristina

2014-01-01

Mitogen-activated protein kinase (MAPK) cascades have crucial roles in the regulation of plant development and in plant responses to stress. Plant recognition of pathogen-associated molecular patterns or pathogen-derived effector proteins has been shown to trigger activation of several MAPKs. This then controls defence responses, including synthesis and/or signalling of defence hormones and activation of defence related genes. The MAPK cascade genes are highly complex and interconnected, and thus the precise signalling mechanisms in specific plant-pathogen interactions are still not known. Here we investigated the MAPK signalling network involved in immune responses of potato (Solanum tuberosum L.) to Potato virus Y, an important potato pathogen worldwide. Sequence analysis was performed to identify the complete MAPK kinase (MKK) family in potato, and to identify those regulated in the hypersensitive resistance response to Potato virus Y infection. Arabidopsis has 10 MKK family members, of which we identified five in potato and tomato (Solanum lycopersicum L.), and eight in Nicotiana benthamiana. Among these, StMKK6 is the most strongly regulated gene in response to Potato virus Y. The salicylic acid treatment revealed that StMKK6 is regulated by the hormone that is in agreement with the salicylic acid-regulated domains found in the StMKK6 promoter. The involvement of StMKK6 in potato defence response was confirmed by localisation studies, where StMKK6 accumulated strongly only in Potato-virus-Y-infected plants, and predominantly in the cell nucleus. Using a yeast two-hybrid method, we identified three StMKK6 targets downstream in the MAPK cascade: StMAPK4_2, StMAPK6 and StMAPK13. These data together provide further insight into the StMKK6 signalling module and its involvement in plant defence.

GRAFT TAKES OF TOMATO ON OTHER SOLANACEOUS PLANTS

Directory of Open Access Journals (Sweden)

ANDRÉ RICARDO ZEIST

2017-01-01

Full Text Available This paper aimed to assess tomato grafting on different solanaceous species through two grafting methods. Scions were cut from cultivar Santa Cruz Kada seedlings. A fully randomized experimental design was carried out with treatments in a 9 x 2 factorial scheme. As rootstocks, four accessions of mini - tomatoes (0224 - 53, RVTC 57, RVTC 20 and 6889 - 50 - Solanum lycopersicum L; two species of wild tomato ( Solanum habrochaites var hirsutum ‘PI - 127826’ and Solanum pennellii ‘LA716’; other two tomato species [ Solanum, cocona ( Solanum sessiliflorum and physalis ( Physalis peruviana ] and a control with cultivar Santa Cruz Kada (auto - graft rootstocks were used. In addition, two grafting methods were evaluated full cleft and approach graft. Fifteen days after grafting, plants were assessed for graft - take percentage; root length; plant height; leaf number; foliar area; root, stem and leaf dry matter; and ratio between shoot and root dry matter. Based on the results, we may state rootstock and grafting interaction had effect on both graft - take rate and plant development. Overall, the studied plants should be recommended as rootstock, except for 6889 - 50 mini - tomato ( S. lycopersicum L. and S. pennellii . Full cleft grafting was most suitable for cocona and physalis, while the approach method showed better results for the mini - tomato accessions 0224 - 53, RVTC 57 and RVTC 20, as well as for S. habrochaites .

Identification of tomato introgression lines with enhanced susceptibility or resistance to infection by parasitic giant dodder (Cuscuta reflexa).

Science.gov (United States)

Krause, Kirsten; Johnsen, Hanne R; Pielach, Anna; Lund, Leidulf; Fischer, Karsten; Rose, Jocelyn K C

2018-02-01

The parasitic flowering plant genus Cuscuta (dodder) is a parasitic weed that infects many important crops. Once it winds around the shoots of potential host plants and initiates the development of penetration organs, called haustoria, only a few plant species have been shown to deploy effective defense mechanisms to ward off Cuscuta parasitization. However, a notable exception is Solanum lycopersicum (tomato), which exhibits a local hypersensitive reaction when attacked by giant dodder (Cuscuta reflexa). Interestingly, the closely related wild desert tomato, Solanum pennellii, is unable to stop the penetration of its tissue by the C. reflexa haustoria. In this study, we observed that grafting a S. pennellii scion onto the rootstock of the resistant S. lycopersicum did not change the susceptibility phenotype of S. pennellii. This suggests that hormones, or other mobile substances, produced by S. lycopersicum do not induce a defense reaction in the susceptible tissue. Screening of a population of introgression lines harboring chromosome fragments from S. pennellii in the genome of the recurrent parent S. lycopersicum, revealed that most lines exhibit the same defense reaction as shown by the S. lycopersicum parental line. However, several lines showed different responses and exhibited either susceptibility, or cell death that extended considerably beyond the infection site. These lines will be valuable for the future identification of key loci involved in the perception of, and resistance to, C. reflexa and for developing strategies to enhance resistance to infection in crop species. © 2017 Scandinavian Plant Physiology Society.

Sample Set (SE): SE14 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE14 Effect of agricultural films for tomato fruit metabolites Investigation of Sol...anum lycopersicum fruit metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultura

Regulation of Floral Stem Cell Termination in Arabidopsis

Directory of Open Access Journals (Sweden)

Toshiro eIto

2015-02-01

Full Text Available In Arabidopsis, floral stem cells are maintained only at the initial stages of flower development, and they are terminated at a specific time to ensure proper development of the reproductive organs. Floral stem cell termination is a dynamic and multi-step process involving many transcription factors, chromatin remodeling factors and signaling pathways. In this review, we discuss the mechanisms involved in floral stem cell maintenance and termination, highlighting the interplay between transcriptional regulation and epigenetic machinery in the control of specific floral developmental genes. In addition, we discuss additional factors involved in floral stem cell regulation, with the goal of untangling the complexity of the floral stem cell regulatory network.

Floral biology of candeia (Eremanthus erythropappus, Asteraceae Biologia floral da candeia (Eremanthus erythropappus, Asteraceae

Directory of Open Access Journals (Sweden)

Fábio de Almeida Vieira

2012-12-01

Full Text Available Floral biology and pollinators of candeia (Eremanthus erythropappus were analyzed in a natural population. We studied anthesis, flower morphology, stigmatic receptivity, pollen viability and floral visitors. The small flowers (10.17 mm in length are pink, hermaphrodites and organized in dense capitula (mean = 29 flowers. We observed a large percentage of viable pollen (77.25% and relatively scarce nectar availability for floral visitors (0.63 μL. The bees Apis mellifera and Trigona sp. were the most frequent visitors. The length of the bud, style and flowers varied significantly among plants. O objetivo deste trabalho foi examinar e documentar a biologia floral e os polinizadores da candeia (Eremanthus erythropappus em uma população natural, sendo estudados a antese, a morfologia floral, a receptividade estigmática, a viabilidade de pólen e os visitantes florais. As flores pequenas (10,17 mm de comprimento são cor de rosa, hermafroditas e organizadas em densos capítulos (média = 29 flores. Foi observada alta porcentagem de pólen viável (77,25% e relativamente pouca disponibilidade de néctar para os visitantes florais (0,63 μL. As abelhas Apis mellifera e Trigona sp. foram os visitantes mais frequentes. Os comprimentos dos botões, estiletes e flores variaram significativamente entre plantas.

Tomato strigolactones are derived from carotenoids and their biosynthesis is promoted by phosphate starvation

NARCIS (Netherlands)

Lopez Raez, J.A.; Charnikhova, T.; Gomez-Roldan, M.V.; Matusova, R.; Kohlen, W.; Vos, de C.H.; Verstappen, F.W.A.; Puech-Pages, V.; Becard, G.; Mulder, P.P.J.; Bouwmeester, H.J.

2008-01-01

Strigolactones are rhizosphere signalling compounds that mediate host location in arbuscular mycorrhizal (AM) fungi and parasitic plants. Here, the regulation of the biosynthesis of strigolactones is studied in tomato (Solanum lycopersicum). Strigolactone production under phosphate starvation, in

Genome-wide identification, sequence characterization, and protein-protein interaction properties of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat family members in Solanum lycopersicum.

Science.gov (United States)

Zhu, Yunye; Huang, Shengxiong; Miao, Min; Tang, Xiaofeng; Yue, Junyang; Wang, Wenjie; Liu, Yongsheng

2015-06-01

One hundred DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family genes were identified in the S. lycopersicum genome. The DWD genes encode proteins presumably functioning as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. These findings provide candidate genes and a research platform for further gene functionality and molecular breeding study. A subclass of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family proteins has been demonstrated to function as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. However, little information is available about the cognate subfamily genes in tomato (S. lycopersicum). In this study, based on the recently released tomato genome sequences, 100 tomato genes encoding DWD proteins that potentially interact with DDB1 were identified and characterized, including analyses of the detailed annotations, chromosome locations and compositions of conserved amino acid domains. In addition, a phylogenetic tree, which comprises of three main groups, of the subfamily genes was constructed. The physical interaction between tomato DDB1 and 14 representative DWD proteins was determined by yeast two-hybrid and co-immunoprecipitation assays. The subcellular localization of these 14 representative DWD proteins was determined. Six of them were localized in both nucleus and cytoplasm, seven proteins exclusively in cytoplasm, and one protein either in nucleus and cytoplasm, or exclusively in cytoplasm. Comparative genomic analysis demonstrated that the expansion of these subfamily members in tomato predominantly resulted from two whole-genome triplication events in the evolution history.

Marker list: QM109927 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available ulation VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109927 Solanum lycopersicum Solanaceae L16L Others ATAGTGTCTACTTCAGGG CCATCAAACAGTTCTCT S. peruvianum pop

Marker list: QM109928 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available GATGGCGTT S. peruvianum population VWP2 x VWP4 and pseudo-F2 population ... Chr12 ... 10.1007/s00438-005-1149-2 16021467 ... QM109928 Solanum lycopersicum Solanaceae DH8R Others TAGAGAGACTATCCTTTA CACATTCAGT

QTL list: SpRg-7 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available entage concerning shoot regeneration 2 ME10-141 ... Chr07 19.51 6.84 ... 10.1186/1471-2229-11-140 22014149 ... QT73653 Solanum lycopersicum Solanaceae SpRg-7 In vitro plant regeneraion bud perc

Comparative metabolite profiling of Solanum tuberosum against six wild Solanum species with Colorado potato beetle resistance.

Science.gov (United States)

Tai, Helen H; Worrall, Kraig; Pelletier, Yvan; De Koeyer, David; Calhoun, Larry A

2014-09-10

The Colorado potato beetle Leptinotarsa decemlineata (Say) (CPB) is a coleopteran herbivore that feeds on the foliage on Solanum species, in particular, potato. Six resistant wild Solanum species were identified, and two of these species had low levels of glycoalkaloids. Comparative analysis of the untargeted metabolite profiles of the foliage using UPLC-qTOF-MS was done to find metabolites shared between the wild species but not with Solanum tuberosum (L.) to identify resistance-related metabolites. It was found that only S. tuberosum produced the triose glycoalkaloids solanine and chaconine. Instead, the six wild species produced glycoalkaloids that shared in common tetrose sugar side chains. Additionally, there were non-glycoalkaloid metabolites associated with resistance including hydroxycoumarin and a phenylpropanoid, which were produced in all wild species but not in S. tuberosum.

Exploiting wild relatives of S. lycopersicum for quality traits

NARCIS (Netherlands)

Víquez Zamora, A.M.

2015-01-01

Exploiting wild relatives of S. lycopersicum for quality traits Ana Marcela Víquez Zamora Tomatoes are consumed worldwide and became a model for crop plant research. A part of the research aims at expanding genetic diversity in tomato; this can be done by incorporating

The floral transcriptome of Eucalyptus grandis

CSIR Research Space (South Africa)

Vining, KJ

2015-10-01

Full Text Available As a step toward functional annotation of genes required for floral initiation and development within the Eucalyptus genome, we used short read sequencing to analyze transcriptomes of floral buds from early and late developmental stages...

Bee Diversity and Solanum didymum (Solanaceae Flower–Visitor Network in an Atlantic Forest Fragment in Southern Brazil

Directory of Open Access Journals (Sweden)

Francieli Lando

2018-01-01

Full Text Available Brazil’s Atlantic Forest biome is currently undergoing forest loss due to repeated episodes of devastation. In this biome, bees perform the most frequent pollination system. Over the last decade, network analysis has been extensively applied to the study of plant–pollinator interactions, as it provides a consistent view of the structure of plant–pollinator interactions. The aim of this study was to use palynological studies to obtain an understanding of the relationship between floral visitor bees and the pioneer plant S. didymum in a fragment of the Atlantic Forest, and also learn about the other plants that interact to form this network. Five hundred bees were collected from 32 species distributed into five families: Andrenidae, Apidae, Colletidae, Megachilidae, and Halictidae. The interaction network consisted of 21 bee species and 35 pollen types. The Solanum-type bee species with the highest number of interactions were Anthrenoides sp. 1, Augochlora sp. 2, and Augochloropsis notophos, representing 71.78% of their interactions. Augochloropsis notophos and Augochlora sp. 2 were the only common species in the flowers of S. didymum. Given the results of our study, we conclude that Solanum is an important source of pollen grains for several native bee species, mainly for the solitary species that are more diverse in the south of Brazil. Moreover, our results indicate that bees from the families Halictidae (A. notophos, Augochlora and Andrenidae (Anthrenoides are the pollinators of S. didymum.

The mismatch repair protein MLH1 marks a subset of strongly interfering crossovers in tomato

NARCIS (Netherlands)

Lhuissier, F.G.P.; Offenberg, H.H.; Wittich, P.E.; Vischer, N.O.E.; Heyting, C.

2007-01-01

In most eukaryotes, the prospective chromosomal positions of meiotic crossovers are marked during meiotic prophase by protein complexes called late recombination nodules (LNs). In tomato (Solanum lycopersicum), a cytological recombination map has been constructed based on LN positions. We

Effets des extraits ou de la poudre de Spirulina platensis et Jatropha ...

African Journals Online (AJOL)

SARAH

30 juin 2015 ... générale, les extraits ou la poudre de Spirulina platensis ont eu des ... Mots clés: Biostimulant, croissance, Spirulina platensis, Jatropha curcas, Solanum lycopersicum .... Le test de ..... in antioxidant metabolites, enzymes, and.

QTL list: RXopJ4 resistance locus [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT62244 Solanum lycopersicum Solanaceae RXopJ4 resistance locus resistance to bacterial spot... disease resistance to bacterial spot disease (Xanthomonas perforans (Xp)) 3 J350 ... Chr06 ... 10.1007/s00122-012-2004-6 23117718

Possible role of jasmonic acid in the regulation of floral induction, evocation and floral differentiation in Lemna minor L.

Science.gov (United States)

Krajncic, B; Kristl, J; Janzekovic, I

2006-01-01

Jasmonic acid (JA) is implicated in a wide variety of developmental and physiological processes in plants. Here, we studied the effects of JA and the combination of JA and ethylenediamine-dio-hydroxyphenyl-acetic acid (EDDHA) on flowering in Lemna minor in axenical cultures. JA (0.475-47.5 nmol l(-1)) enhanced floral induction in L. minor under long-day (LD) conditions. Under the same conditions, at a concentration of 237.5 nmol l(-1), JA inhibited floral induction, and at a concentration of 475 nmol l(-1) it prevented floral induction. Under LD conditions with LD preculture, a combination of EDDHA (20,500 nmol l(-1)) and JA (47.5 nmol l(-1)) had a synergistic effect on the promotion of floral induction. Floral induction was enhanced to the greatest extent in experiments with LD precultures. Microscopic examination of microphotographs of histological sections showed that JA and, to an even greater extent, JA+EDDHA at optimal concentrations promote apical floral induction (evocation). Furthermore, JA, and to an even greater extent JA in combination with EDDHA in an optimal concentration, also promote flower differentiation, especially the development of stamens, as is evident from the microphotographs. The experimental results show that JA promotes floral induction in other species of Lemnaceae from various groups according to their photoperiodic response. The results support our hypothesis that, in addition to previously ascribed functions, JA may regulate floral induction, evocation and floral differentiation. Our hypothesis is supported also by the results obtained by quantitative determination of endogenous JA levels in L. minor at three growth stages. The levels of endogenous JA decreased from 389 ng JA g(-1) (fresh weight) of L. minor during the vegetative stage to 217 ng JA g(-1) during the evocation stage, and to 37.5 ng JA g(-1) during the flowering stage, which proves that JA is used for flowering.

Floral colour versus phylogeny in structuring subalpine flowering communities.

Science.gov (United States)

McEwen, Jamie R; Vamosi, Jana C

2010-10-07

The relative number of seeds produced by competing species can influence the community structure; yet, traits that influence seed production, such as pollinator attraction and floral colour, have received little attention in community ecology. Here, we analyse floral colour using reflectance spectra that include near-UV and examined the phylogenetic signal of floral colour. We found that coflowering species within communities tended to be more divergent in floral colour than expected by chance. However, coflowering species were not phylogenetically dispersed, in part due to our finding that floral colour is a labile trait with a weak phylogenetic signal. Furthermore, while we found that locally rare and common species exhibited equivalent floral colour distances from their coflowering neighbours, frequent species (those found in more communities) exhibited higher colour distances from their coflowering neighbours. Our findings support recent studies, which have found that (i) plant lineages exhibit frequent floral colour transitions; and (ii) traits that influence local population dynamics contribute to community structure.

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75069 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr06 101.1-107.3 3.68 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75066 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr04 65.1-81.9 2.15 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75072 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr08 72.6-87.8 2.32 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75075 Solanum lycopersicum Solanaceae ... Seed quality_germination rate mean germination... rate (reciprocal of the mean germination time; MGT-1) 2 ... Chr12 49.5-63.0 2.54 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Circumscription of the anthracnose pathogens Colletotrichum lindemuthianum and C. nigrum

NARCIS (Netherlands)

Liu, F.; Cai, L.; Crous, P.W.; Damm, U.

2013-01-01

The anthracnose pathogen of common bean (Phaseolus vulgaris) is usually identified as Colletotrichum lindemuthianum, while anthracnose of potato (Solanum tuberosum), peppers (Capsicum annuum), tomato (S. lycopersicum) and several other crop plants is often attributed to C. coccodes. In order to

Parameter estimation in tree graph metabolic networks

NARCIS (Netherlands)

Astola, Laura; Stigter, Hans; Gomez Roldan, Maria Victoria; Eeuwijk, van Fred; Hall, Robert D.; Groenenboom, Marian; Molenaar, Jaap J.

2016-01-01

We study the glycosylation processes that convert initially toxic substrates to nu- tritionally valuable metabolites in the flavonoid biosynthesis pathway of tomato (Solanum lycopersicum) seedlings. To estimate the reaction rates we use ordinary differential equations (ODEs) to model the enzyme

A role for differential glycoconjugation in the emission of phenylpropanoid volatiles from tomato fruit discovered using a metabolic data fusion approach.

NARCIS (Netherlands)

Tikunov, Y.M.; Vos, de C.H.; Gonzalez Paramas, A.M.; Hall, R.D.; Bovy, A.G.

2010-01-01

A role for differential glycoconjugation in the emission of phenylpropanoid volatiles from ripening tomato fruit (Solanum lycopersicum) upon fruit tissue disruption has been discovered in this study. Application of a multiinstrumental analytical platform for metabolic profiling of fruits from a

Floral colour versus phylogeny in structuring subalpine flowering communities

OpenAIRE

McEwen, Jamie R.; Vamosi, Jana C.

2010-01-01

The relative number of seeds produced by competing species can influence the community structure; yet, traits that influence seed production, such as pollinator attraction and floral colour, have received little attention in community ecology. Here, we analyse floral colour using reflectance spectra that include near-UV and examined the phylogenetic signal of floral colour. We found that coflowering species within communities tended to be more divergent in floral colour than expected by chanc...

Palinologia de espécies de Solanum L. (Solanaceae A. Juss. ocorrentes nas restingas do Estado do Rio de Janeiro, Brasil Palynology of species of Solanum L. (Solanaceae A. Juss. from the restingas of Rio de Janeiro State, Brazil

Directory of Open Access Journals (Sweden)

Carla Patrícia Rodrigues Batista-Franklim

2008-09-01

Full Text Available Foram estudados 21 táxons de Solanum L., com o objetivo de caracterizá-los palinologicamente e, assim, contribuir para a elaboração de um catálogo polínico da flora das restingas do Estado do Rio de Janeiro. Os táxons examinados foram Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum cordifolium Dunal, Solanum curvispinum Dunal, Solanum echidnaeforme Dunal, Solanum gardneri Sendtn.,Solanum indigoferum A. St.-Hil., Solanum insidiosum Mart., Solanum mauritianum Scop., Solanum paludosum Moric., Solanum paniculatum L., Solanum paratyense Vell., Solanum pseudoquina A.St.-Hil., Solanum sisymbriifolium Lam., Solanum torvum Sw., Solanum velleum Sw. Os grãos de pólen foram acetolisados, mensurados, descritos e fotomicrografados. A análise sob microscopia eletrônica de varredura foi utilizada, em grãos de pólen não acetolisados, para confirmar as descrições feitas sob microscopia de luz e, em alguns casos para confirmar as descrições de abertura e ornamentação. Constatou-se que os grãos de pólen são pequenos ou médios, isopolares, subprolatos a oblato-esferoidais, 3-colporados, sexina granulada, rugulado-granulada ou escabrada. Pela análise dos resultados obtidos pôde-se concluir que os táxons analisados apresentam certa heterogeneidade polínica, quanto à forma, aos atributos das aberturas e à ornamentação da sexina, podendo-se usar estes caracteres na taxonomia do gênero.In this study 21 taxa of Solanum L. were investigated for palynological characterization and to contribute to the Pollen Catalog of the Flora of the Rio de Janeiro restingas. The taxa analysed were Solanum affine Sendtn., Solanum americanum Mill. var. americanum,Solanum argenteum Dunal ex Poir., Solanum aturense Dunal, Solanum caavurana Vell., Solanum capsicoides All., Solanum carautae Carv., Solanum

Expression of Two Functionally Distinct Plant Endo-ß-1,4-Glucanases Is Essential for the Compatible Interaction Between Potato Cyst Nematode and Its Hosts

NARCIS (Netherlands)

Karczmarek, A.; Fudali, S.; Lichocka, M.; Sobczak, M.; Kurek, W.; Janakowski, S.; Roosien, J.; Golinowski, W.; Bakker, J.; Goverse, A.; Helder, J.

2008-01-01

For the proliferation of their feeding sites (syncytia), the potato cyst nematode Globodera rostochiensis is thought to recruit plant endo-ß-1,4-glucanases (EGases, EC. 3.2.1.4). Reverse-transcription polymerase chain reaction experiments on tomato (Solanum lycopersicum) indicated that the

Naturally occurring broad-spectrum powdery mildw resistance in a central American tomato accession is caused by loss of Mlo function

NARCIS (Netherlands)

Bai, Y.; Pavan, S.N.C.; Zheng, Z.; Zappel, N.F.; Reinstadler, A.; Lotti, C.; Giovanni, de C.; Ricciardi, L.; Lindhout, P.; Visser, R.G.F.; Theres, K.; Panstruga, R.

2008-01-01

The resistant cherry tomato (Solanum lycopersicum var. cerasiforme) line LC-95, derived from an accession collected in Ecuador, harbors a natural allele (ol-2) that confers broad-spectrum and recessively inherited resistance to powdery mildew (Oidium neolycopersici). As both the genetic and

The Tomato Hybrid Proline-Rich Protein regulates the abcission zone competence to respond to ethylene signals

Science.gov (United States)

The Tomato Hybrid Proline-Rich Protein (THyPRP) gene was specifically expressed in the tomato (Solanum lycopersicum) flower abscission zone (FAZ), and its stable antisense silencing under the control of an abscission zone (AZ)-specific promoter, Tomato Abscission Polygalacturonase4,significantly inh...

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75103 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 102.7-108.3 5.59 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75102 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr06 38.9-56.2 3.42 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75104 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 10% of germina...tion of viable seeds (h-1) 2 ... Chr09 100.8-112.7 2.78 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Overexpression of homologous phytochrome genes in tomato: exploring the limits in photoperception

NARCIS (Netherlands)

Husaineid, S.H.; Kok, R.A.; Schreuder, M.E.L.; Plas, van der L.H.W.; Krol, van der A.R.

2007-01-01

Transgenic tomato [Lycopersicon esculentum (=Solanum lycopersicum)] lines overexpressing tomato PHYA, PHYB1, or PHYB2, under control of the constitutive double-35S promoter from cauliflower mosaic virus (CaMV) have been generated to test the level of saturation in individual phytochrome-signalling

Genetic difference in macro-element mineral concentrations among 52 historically important tomato varieties

Science.gov (United States)

Tomato (Solanum lycopersicum) fruit quality and yield are highly dependent on adequate uptake of nutrients. Potassium, magnesium and calcium are essential elements that influence fruit quality traits such as color, uniformity of ripening, hollow fruit, fruit shape, firmness, and acidity. Sodium is n...

Flexible tools for gene expression and silencing in tomato

NARCIS (Netherlands)

Fernandez, A.I.; Viron, N.; Alhagdow, M.; Karimi, M.; Jones, M.; Amsellem, Z.; Sicard, A.; Czerednik, A.; Angenent, G.C.; Grierson, D.; May, S.; Seymour, G.; Eshed, Y.; Lemaire-Chamley, M.; Rothan, C.; Hilson, P.

2009-01-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed

Three-dimensional microscale modelling of CO2 transport and light propagation in tomato leaves enlightens photosynthesis

NARCIS (Netherlands)

Ho, Q.T.; Berghuijs, H.N.C.; Watté, R.; Verboven, P.; Herremans, E.; Yin, X.; Retta, M.A.; Aernouts, B.; Saeys, W.; Helfen, L.; Farquhar, G.D.; Struik, P.C.; Nicolai, B.

2016-01-01

We present a combined three-dimensional (3-D) model of light propagation, CO2 diffusion and photosynthesis in tomato (Solanum lycopersicum L.) leaves. The model incorporates a geometrical representation of the actual leaf microstructure that we obtained with synchrotron radiation X-ray laminography,

Identification of QTLs for Botrytis cinerea Resistance in S. Habrochaites LYC4

NARCIS (Netherlands)

Finkers, H.J.; Heusden, van A.W.; Have, van der A.J.; Kan, van J.A.L.; Lindhout, P.

2006-01-01

BOTRYTIS cinerea Pers:Fr (teleomorph: Botryotina fuckeliana (de Bary) Whetzel) is a necrotrophic pathogenic fungus with an exceptionally wide host range of at least 235 species. Modern hybrid tomato (Solanum lycopersicum) cultivars are susceptible to B. cinerea although there are cultivars with some

RNA interference silencing of chalcone synthase, the first step in the flavonoid biosynthesis pathway, leads to parthenocarpic tomato fruits

NARCIS (Netherlands)

Schijlen, E.G.W.M.; Vos, de C.H.; Martens, S.; Jonker, H.H.; Rosin, F.M.A.; Molthoff, J.W.; Tikunov, Y.M.; Angenent, G.C.; Tunen, van A.J.; Bovy, A.G.

2007-01-01

Parthenocarpy, the formation of seedless fruits in the absence of functional fertilization, is a desirable trait for several important crop plants, including tomato (Solanum lycopersicum). Seedless fruits can be of great value for consumers, the processing industry, and breeding companies. In this

Floral nectary, nectar production dynamics and chemical composition in five nocturnal Oenothera species (Onagraceae) in relation to floral visitors.

Science.gov (United States)

Antoń, Sebastian; Komoń-Janczara, Elwira; Denisow, Bożena

2017-12-01

Main conclusion The floral nectars were sucrose-dominant; however, nectar protein and amino acid contents differed, indicating that composition of nitrogenous compounds may vary considerably even between closely related plant species, irrespectively of nectary structure. Numerous zoophilous plants attract their pollinators by offering floral nectar; an aqueous solution produced by specialized secretory tissues, known as floral nectaries. Although many papers on nectaries and nectar already exist, there has been a little research into the structure of nectaries and/or nectar production and composition in species belonging to the same genus. To redress this imbalance, we sought, in the present paper, to describe the floral nectary, nectar production, and nectar composition in five nocturnal Oenothera species with respect to their floral visitors. The structure of nectaries was similar for all the species investigated, and comprised the epidermis (with nectarostomata), numerous layers of nectary parenchyma, and subsecretory parenchyma. Anthesis for a single flower was short (ca. 10-12 h), and flowers lasted only one night. The release of floral nectar commenced at the bud stage (approx. 4 h before anthesis) and nectar was available to pollinators until petal closure. Nectar concentration was relatively low (ca. 27%) and the nectar was sucrose-dominant, and composed mainly of sucrose, glucose and fructose. The protein content of the nectar was also relatively low (on average, 0.31 µg ml -1 ). Nevertheless, a great variety of amino acids, including both protein and non-protein types, was detected in the nectar profile of the investigated taxa. We noted both diurnal and nocturnal generalist, opportunistic floral insect visitors.

Nocturnal bees are attracted by widespread floral scents.

Science.gov (United States)

Carvalho, Airton Torres; Maia, Artur Campos Dalia; Ojima, Poliana Yumi; dos Santos, Adauto A; Schlindwein, Clemens

2012-03-01

Flower localization in darkness is a challenging task for nocturnal pollinators. Floral scents often play a crucial role in guiding them towards their hosts. Using common volatile compounds of floral scents, we trapped female nocturnal Megalopta-bees (Halictidae), thus uncovering olfactory cues involved in their search for floral resources. Applying a new sampling method hereby described, we offer novel perspectives on the investigation of nocturnal bees.

The role of jasmonates in floral nectar secretion.

Directory of Open Access Journals (Sweden)

Venkatesan Radhika

Full Text Available Plants produce nectar in their flowers as a reward for their pollinators and most of our crops depend on insect pollination, but little is known on the physiological control of nectar secretion. Jasmonates are well-known for their effects on senescence, the development and opening of flowers and on plant defences such as extrafloral nectar. Their role in floral nectar secretion has, however, not been explored so far. We investigated whether jasmonates have an influence on floral nectar secretion in oil-seed rape, Brassica napus. The floral tissues of this plant produced jasmonic acid (JA endogenously, and JA concentrations peaked shortly before nectar secretion was highest. Exogenous application of JA to flowers induced nectar secretion, which was suppressed by treatment with phenidone, an inhibitor of JA synthesis. This effect could be reversed by additional application of JA. Jasmonoyl-isoleucine and its structural mimic coronalon also increased nectar secretion. Herbivory or addition of JA to the leaves did not have an effect on floral nectar secretion, demonstrating a functional separation of systemic defence signalling from reproductive nectar secretion. Jasmonates, which have been intensively studied in the context of herbivore defences and flower development, have a profound effect on floral nectar secretion and, thus, pollination efficiency in B. napus. Our results link floral nectar secretion to jasmonate signalling and thereby integrate the floral nectar secretion into the complex network of oxylipid-mediated developmental processes of plants.

Spectrum of induced floral mutants in Petunia

International Nuclear Information System (INIS)

Padmaja, V.; Sudhakar, P.

1987-01-01

A total of six floral mutants of garden Petunia isolated from the populations raised from the seed treatment with γ-rays, 2, 4-D and sodium azide are described. Five of the mutants viz. stellata, Campyloflora, Rubriflora mixed, Grandiflora and Albiflora mixed originated as segregants in M 2 generation while the chimeral floral phenotype was expressed in M 1 generation itself. Breeding behaviour of these horticulturally interesting altered floral phenotypes were studied in subsequent generations and appropriate conclusions were drawn regarding mode of inheritance of the mutant traits. 15 refs., 4 figures, 1 table. (author)

Partial stem and leaf resistance against the fungal pathogen Botrytis cinerea in wild relatives of tomato

NARCIS (Netherlands)

Have, ten A.; Berloo, van R.; Lindhout, P.; Kan, van J.A.L.

2007-01-01

Tomato (Solanum lycopersicum) is one of many greenhouse crops that can be infected by the necrotrophic ascomycete Botrytis cinerea. Commercial cultivation of tomato is hampered by the lack of resistance. Quantitative resistance has been reported in wild tomato relatives, mostly based on leaf assays.

Sugar and acid interconversion in tomato fruits based on biopsy sampling of locule gel and pericarp tissue

NARCIS (Netherlands)

Schouten, R.E.; Woltering, E.J.; Tijskens, L.M.M.

2016-01-01

This study deals with quantifying sugar and acids levels important for the perceived taste of tomatoes (Solanum lycopersicum). Sugar and acids levels were measured repeatedly on the same tomato using tissue samples obtained with a biopsy needle in combination with HPLC protocols. Biopsies of

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75157 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr09 106.5-112.7 2.41 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75239 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr12 39.4-64.0 2.02 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75106 Solanum lycopersicum Solanaceae ... Seed quality_germination time reciprocal of time to 50% of the ger...mination of viable seeds (h-1) 2 ... Chr04 65.1-80.4 2.29 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75274 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-31.3 2.94 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75205 Solanum lycopersicum Solanaceae ... Seed quality_salt stress Salt II_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 15.4-26.6 3.43 ... 10.1111/j.1365-3040.2011.02463.x 22074055

QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available QT75233 Solanum lycopersicum Solanaceae ... Seed quality_osmotic stress Osmotic I_mean germination... rate (reciprocal of the mean germination time; MGT-1) 2,3 ... Chr02 7.6-23.7 3.5 ... 10.1111/j.1365-3040.2011.02463.x 22074055

Tomato whole genome transcriptional response to Tetranychus urticae identifies divergence of spider mite-induced responses between tomato and Arabidopsis

NARCIS (Netherlands)

Martel, C.; Zhurov, V.; Navarro, M.; Martinez, M.; Cazaux, M.; Auger, P.; Migeon, A.; Santamaria, M.E.; Wybouw, N.; Diaz, I.; Van Leeuwen, T.; Navajas, M.; Grbic, M.; Grbic, V.

2015-01-01

The two-spotted spider mite Tetranychus urticae is one of the most significant mite pests in agriculture, feeding on more than 1,100 plant hosts, including model plants Arabidopsis thaliana and tomato, Solanum lycopersicum. Here, we describe timecourse tomato transcriptional responses to spider mite

System-Wide Hypersensitive Response-Associated Transcriptome and Metabolome Reprogramming in Tomato

NARCIS (Netherlands)

Etalo, D.W.; Stulemeijer, I.J.E.; Esse, van H.P.; Vos, de R.C.H.; Bouwmeester, H.J.; Joosten, M.H.A.J.

2013-01-01

The hypersensitive response (HR) is considered to be the hallmark of the resistance response of plants to pathogens. To study HR-associated transcriptome and metabolome reprogramming in tomato (Solanum lycopersicum), we used plants that express both a resistance gene to Cladosporium fulvum and the

First report of Colletotrichum nigrum causing anthracnose disease on tomato fruit in New Jersey

Science.gov (United States)

Anthracnose fruit rot is one of the most serious diseases affecting the production of tomato (Solanum lycopersicum L.) in the United States and is typically incited by Colletotrichum coccodes, C. gloeosporioides or C. dematium (Farr and Rossman 2016). During the summer of 2013, symptoms characteris...

SIDREB2, a tomato dehydration-responsive element-binding 2 transcription factor, mediates salt stress tolerance in tomato and Arabidopsis

Czech Academy of Sciences Publication Activity Database

Hichri, I.; Muhovski, Y.; Clippe, A.; Žižková, Eva; Dobrev, Petre; Motyka, Václav; Lutts, S.

2016-01-01

Roč. 39, č. 1 (2016), s. 62-79 ISSN 0140-7791 R&D Projects: GA ČR(CZ) GAP506/11/0774 Institutional support: RVO:61389030 Keywords : Arabidopsis thaliana * Solanum lycopersicum * DREB2 Subject RIV: EF - Botanics Impact factor: 6.173, year: 2016

Identification of microRNA targets in tomato fruit development using high-throughput sequencing and degradome analysis

NARCIS (Netherlands)

Karlova, R.B.; Haarst, van J.C.; Maliepaard, C.A.; Geest, van de H.C.; Bovy, A.G.; Lammers, M.; Angenent, G.C.; Maagd, de R.A.

2013-01-01

MicroRNAs (miRNAs) play important roles in plant development through regulation of gene expression by mRNA degradation or translational inhibition. Despite the fact that tomato (Solanum lycopersicum) is the model system for studying fleshy fruit development and ripening, only a few experimentally

Structure-function analysis of the Fusarium oxysporum Avr2 effector allows uncoupling of its immune-suppressing activity from recognition

NARCIS (Netherlands)

Di, X.; Cao, L.; Hughes, R.K.; Tintor, N.; Banfield, M.J.; Takken, F.L.W.

2017-01-01

Plant pathogens employ effector proteins to manipulate their hosts. Fusarium oxysporum f. sp. lycopersici (Fol), the causal agent of tomato wilt disease, produces effector protein Avr2. Besides being a virulence factor, Avr2 triggers immunity in I-2 carrying tomato (Solanum lycopersicum). Fol

Biological control of Trialeurodes vaporariorum by Encarsia formosa on tomato in unheated greenhouses in the high altitude tropics

NARCIS (Netherlands)

Vis, de R.M.J.; Lenteren, van J.C.

2008-01-01

Biological control of Trialeurodes vaporariorum (Westwood) by Encarsia formosa Gahan was tested during three consecutive production cycles (16-28 weeks) on a beef tomato (Solanum lycopersicum L.) crop in a glasshouse and a plastic greenhouse on the Bogota Plateau in Colombia. During the course of

Identification of miRNAs with potential roles in regulation of anther development and male-sterility in 7B-1 male-sterile tomato mutant

Czech Academy of Sciences Publication Activity Database

Omidvar, Vahid; Mohorianu, I.; Dalmay, T.; Fellner, Martin

2015-01-01

Roč. 16, OCT 28 (2015), s. 878 ISSN 1471-2164 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : 7B-1 mutation * Solanum lycopersicum * Male-sterility Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

Quantifying lycopene synthesis and chlorophyll breakdown in tomato fruit using remittance VIS spectroscopy

NARCIS (Netherlands)

Schouten, R.E.; Farneti, B.; Tijskens, L.M.M.; Algarra Alarcon, A.; Woltering, E.J.

2014-01-01

The aim of this study was to increase the understanding of chlorophyll breakdown and lycopene synthesis at a quantitative level in Solanum lycopersicum fruit. To accomplish this, a kinetic model is proposed describing the transition from chloro- to chromoplast. Remittance VIS spectroscopy was used

Alternate partial root-zone drying irrigation improves fruit quality in tomatoes

DEFF Research Database (Denmark)

Sun, Y.; Holm, Peter Engelund; Liu, Fulai

2014-01-01

Alternate partial root-zone drying (PRD) irrigation and deficit irrigation (DI) are water-saving irrigation strategies. Here, comparative effects of PRD and DI on fruit quality of tomato (Solanum lycopersicum L.) were investigated. The results showed that the irrigation treatments had no effect o...

Isolation and characterization of beneficial indigenous endophytic ...

African Journals Online (AJOL)

Plant-associated bacteria that live inside plant tissues without causing any damage to plants are defined as endophytic bacteria. The present study was carried out to analyze the phenotypic and genotypic diversity of endophytic bacteria associated with Amaranthus hybridus, Solanum lycopersicum and Cucurbita maxima.

Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

Lifescience Database Archive (English)

Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

Methyl salicylate production in tomato affects biotic interactions

NARCIS (Netherlands)

Ament, K.; Krasikov, V.; Allmann, S.; Rep, M.; Takken, F.L.W.; Schuurink, R.C.

2010-01-01

The role of methyl salicylate (MeSA) production was studied in indirect and direct defence responses of tomato (Solanum lycopersicum) to the spider mite Tetranychus urticae and the root-invading fungus Fusarium oxysporum f. sp. lycopersici, respectively. To this end, we silenced the tomato gene

Efeito de doses de adubo 4-14-8 na competição entre tomateiro e Solanum americanum em convivência intra e interespecífica Effect of fertilizer 4-14-8 doses on competition between tomato and Solanum americanum under intra- and inter-specific coexistence

Directory of Open Access Journals (Sweden)

B.P. Silva

2010-01-01

Full Text Available O tomateiro (Lycopersicum esculentum é uma das mais importantes hortaliças produzidas no mundo, porém sua produtividade pode ser reduzida em função da convivência com Solanum americanum (maria-pretinha. O objetivo desta pesquisa foi avaliar o efeito da adubação na relação de interferência intra e interespecífica entre plantas de tomateiro e S. americanum. Duas plantas em condições de convivência intra e interespecífica, por espécie, foram plantadas em vasos e adubadas com 13, 18 e 24 g de 4-14-8 por vaso, sendo avaliadas características de crescimento de ambas as espécies aos 90 dias após o transplante das plantas. A adubação com 4-14-8 estimulou o desenvolvimento da área foliar e da massa seca de caules, folhas e frutos de S. americanum, além da área foliar e da massa seca de folhas e frutos do tomateiro. A convivência interespecífica proporcionou maior altura de plantas de S. americanum, bem como menor altura e massa seca de folhas e frutos do tomateiro. Houve interação dos fatores adubação e convivência somente para o tomateiro, sendo a altura e a massa seca de folhas da cultura influenciadas negativamente quando submetidas às maiores doses de adubo e à competição com S. americanum.Tomato (Lycopersicum esculentum is one of the leading vegetable crops grown worldwide, but its productivity may be reduced due to coexistence with Solanum americanum (black nightshade. This work aimed to evaluate the effect of fertilization on intra- and inter-specific interference between tomato and S. americanum plants. Two plants in intra- and inter-specific coexistence conditions of both species were planted in pots and fertilized with 13, 18 and 24 g of 4-14-8 per pot to evaluate the growth characteristics of both species at 90 days after transplanting. The 4-14-8 fertilization stimulated the development of the leaf area and dry mass of stems, leaves and fruit of S. americanum, consequently and equally influencing the leaf

Disentangling the role of floral sensory stimuli in pollination networks

DEFF Research Database (Denmark)

Kantsa, Aphrodite; Raguso, Robert A.; Dyer, Adrian G.

2018-01-01

Despite progress in understanding pollination network structure, the functional roles of floral sensory stimuli (visual, olfactory) have never been addressed comprehensively in a community context, even though such traits are known to mediate plant-pollinator interactions. Here, we use...... a comprehensive dataset of floral traits and a novel dynamic data-pooling methodology to explore the impacts of floral sensory diversity on the structure of a pollination network in a Mediterranean scrubland. Our approach tracks transitions in the network behaviour of each plant species throughout its flowering...... period and, despite dynamism in visitor composition, reveals significant links to floral scent, and/or colour as perceived by pollinators. Having accounted for floral phenology, abundance and phylogeny, the persistent association between floral sensory traits and visitor guilds supports a deeper role...

Purification, crystallization and preliminary X-ray diffraction analysis of a plant subtilase

International Nuclear Information System (INIS)

Rose, Rolf; Huttenlocher, Franziska; Cedzich, Anna; Kaiser, Markus; Schaller, Andreas; Ottmann, Christian

2009-01-01

The first crystallographic study of a plant subtilase, SBT3 from S. lycopersicum, is reported. The subtilase SBT3 from Solanum lycopersicum (tomato) was purified from a tomato cell culture and crystallized using the sitting-drop vapour-diffusion method. A native data set was collected to 2.5 Å resolution at 100 K using synchrotron radiation. For experimental phasing, CsCl-derivative and tetrakis(acetoxymercuri)methane (TAMM) derivative crystals were employed for MIRAS phasing. Three caesium sites and one TAMM site were identified, which allowed solution of the structure

floral bud distortion

Indian Academy of Sciences (India)

PRASHANT B. KALE

logical behaviour of floral reproductive organs and in silico characterization of differentially ... also prone to be attacked by various biotic and abiotic factors. ... environment. ..... play contributory role and also reported for synergistic effect.

Herbivory by a Phloem-feeding insect inhibits floral volatile production.

Science.gov (United States)

Pareja, Martin; Qvarfordt, Erika; Webster, Ben; Mayon, Patrick; Pickett, John; Birkett, Michael; Glinwood, Robert

2012-01-01

There is extensive knowledge on the effects of insect herbivory on volatile emission from vegetative tissue, but little is known about its impact on floral volatiles. We show that herbivory by phloem-feeding aphids inhibits floral volatile emission in white mustard Sinapis alba measured by gas chromatographic analysis of headspace volatiles. The effect of the Brassica specialist aphid Lipaphis erysimi was stronger than the generalist aphid Myzus persicae and feeding by chewing larvae of the moth Plutella xylostella caused no reduction in floral volatile emission. Field observations showed no effect of L. erysimi-mediated floral volatile emission on the total number of flower visits by pollinators. Olfactory bioassays suggested that although two aphid natural enemies could detect aphid inhibition of floral volatiles, their olfactory orientation to infested plants was not disrupted. This is the first demonstration that phloem-feeding herbivory can affect floral volatile emission, and that the outcome of interaction between herbivory and floral chemistry may differ depending on the herbivore's feeding mode and degree of specialisation. The findings provide new insights into interactions between insect herbivores and plant chemistry.

Evolution and developmental genetics of floral display-A review of progress

Institute of Scientific and Technical Information of China (English)

Qing Ma; Wenheng Zhang; Qiu-Yun (Jenny) Xiang

2017-01-01

Angiosperms evolved a great diversity of ways to display their flowers for reproductive success by variation in floral color,size,shape,scent,arrangements,and flowering time.The various innovations in floral forms and the aggregation of flowers into different kinds of inflorescences can drive new ecological adaptations,speciation,and angiosperm diversification.Evolutionary developmental biology (evo-devo) seeks to uncover the developmental and genetic basis underlying morphological diversification.Advances in the developmental genetics of floral display have provided a foundation for insights into the genetic basis of floral and inflorescence evolution.A number of regulatory genes controlling floral and inflorescence development have been identified in model plants (e.g.,Arabidopsis thaliana,Antirrhinum majus) using forward genetics and conserved functions of many of these genes across diverse non-model species have been revealed by reverse genetics.Gene-regulatory networks that mediated the developmental progresses of floral and inflorescence development have also been established in some plant species.Meanwhile,phylogeny-based comparative analysis of morphological and genetic character has enabled the identification of key evolutionary events that lead to morphological complexity and diversification.Here we review the recent progress on evo-devo studies of floral display including floral symmetry,petal fusion,floral color,floral scent,and inflorescences.We also review the molecular genetic approaches applied to plant evo-devo studies and highlight the future directions of evo-devo.

Chemical constituents of Solanum buddleifolium Sendtn; Constituintes quimicos de Solanum buddleifolium Sendtn

Energy Technology Data Exchange (ETDEWEB)

Pinto, Francisco das Chagas L.; Torres, Maria da conceicao M.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L., E-mail: opessoa@ufc.br [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Centro de Ciencias. Dept. de Quimica Organica e Inorganica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense, Campos, RJ (Brazil). Dept. de Quimica; Guedes, Maria Lenise da Silva [Universidade Federal da Bahia (UFBA), Ondina, BA (Brazil). Inst. de Biologia. Dept. de Botanica

2013-10-01

The chemical investigation of the stem EtOH extract of S. buddleifolium resulted in the isolation of terpenoids, amides, lignans and a steroidal alkaloid. Based on HRMS, IR and {sup 1}H and {sup 13}C NMR data analysis, the structures of the isolated compounds were identified as: 13-hydroxysolavetivone, betulinic acid, N-trans-caffeoyltyramine, N-trans-feruloyldopamine, N-trans-p-cumaroyltyramine, N-trans-feruloyltyramine, N-trans-feruloyl- 3'-O-methoxydopamine, alangilignoside C, isolariciresinol, polistachiol, (+)-(8R,7'S,8'S)-3{alpha}-O-({beta}-D-glucopiranosyl)-lioniresinol, (-)-(8S,7'R,8'R)-3{alpha}-O-({beta}-D-glucopiranosyl)-lioniresinol and solamargine. The occurrence of terpenoids and amides is common in Solanum, unlike lignans which are rare. The isolated lignans described in this work are reported for the first time in the genus Solanum. (author)

Three QTLs for Botrytis cinerea resistance in tomato

NARCIS (Netherlands)

Finkers, H.J.; Berg, van den P.M.M.M.; Berloo, van R.; Have, ten A.; Heusden, van A.W.; Kan, van J.A.L.; Lindhout, P.

2007-01-01

Tomato (Solanum lycopersicum) is susceptible to grey mold (Botrytis cinerea). Partial resistance to this fungus was identified in accessions of wild relatives of tomato such as S. habrochaites LYC4. In order to identify loci involved in quantitative resistance (QTLs) to B. cinerea, a population of

2692-IJBCS-Article-Dr Serigne Modou Sarr

African Journals Online (AJOL)

hp

enroulement des feuilles de tomate (Solanum lycopersicum L.) appelé Tomato Yellow Leaf Curl Virus (TYLCV). L'objectif de ce travail était d'identifier les différentes espèces d'aleurodes présentes dans les cultures de tomate de la zone des.

Evaluation of tomato genotypes for resistance to root-knot nematodes

African Journals Online (AJOL)

Tomato (Solanum lycopersicum) is one of the most popular vegetable crops worldwide, owing to its high nutritive value and diversified use. Tomato production in Ghana is threatened by plant parasitic nematodes, especially the root knot nematodes (Meloidogyne spp.), which are responsible for huge economic yield losses.

Effect of para-chlorophenoxyacetic acid on acid invertase gene ...

African Journals Online (AJOL)

Tomato cv. Liaoyuanduoli (Solanum lycopersicum) plants were cultivated in a greenhouse to allow sampling of the second fruit in the first cluster and comparison with tomato fruit that developed following para-chlorophenoxyacetic acid (PCPA) treatment. Sugar content, activities of sugar related enzymes and the effects of ...

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

The interspecific hybridization for tomato leaf curl virus (ToLCV) resistance was carried out among 10 genetically diverse tomato genotypes (diversified by 50 SSR markers). Among the 10 parents, four susceptible cultivars of Solanum lycopersicum were crossed with six resistant wilds, such as S. pimpinellifolium, ...

Identification of Genes Associated with Lemon Floral Transition and Flower Development during Floral Inductive Water Deficits: A Hypothetical Model.

Science.gov (United States)

Li, Jin-Xue; Hou, Xiao-Jin; Zhu, Jiao; Zhou, Jing-Jing; Huang, Hua-Bin; Yue, Jian-Qiang; Gao, Jun-Yan; Du, Yu-Xia; Hu, Cheng-Xiao; Hu, Chun-Gen; Zhang, Jin-Zhi

2017-01-01

Water deficit is a key factor to induce flowering in many woody plants, but reports on the molecular mechanisms of floral induction and flowering by water deficit are scarce. Here, we analyzed the morphology, cytology, and different hormone levels of lemon buds during floral inductive water deficits. Higher levels of ABA were observed, and the initiation of floral bud differentiation was examined by paraffin sections analysis. A total of 1638 differentially expressed genes (DEGs) were identified by RNA sequencing. DEGs were related to flowering, hormone biosynthesis, or metabolism. The expression of some DEGs was associated with floral induction by real-time PCR analysis. However, some DEGs may not have anything to do with flowering induction/flower development; they may be involved in general stress/drought response. Four genes from the phosphatidylethanolamine-binding protein family were further investigated. Ectopic expression of these genes in Arabidopsis changed the flowering time of transgenic plants. Furthermore, the 5' flanking region of these genes was also isolated and sequence analysis revealed the presence of several putative cis -regulatory elements, including basic elements and hormone regulation elements. The spatial and temporal expression patterns of these promoters were investigated under water deficit treatment. Based on these findings, we propose a model for citrus flowering under water deficit conditions, which will enable us to further understand the molecular mechanism of water deficit-regulated flowering in citrus. Based on gene activity during floral inductive water deficits identified by RNA sequencing and genes associated with lemon floral transition, a model for citrus flowering under water deficit conditions is proposed.

Fontes de resistência em acessos de Solanum (secção Lycopersicon a Verticillium dahliae raças 1 e 2 Sources of resistance to Verticillium dahliae races 1 and 2 in accessions of Solanum (section Lycopersicon

Directory of Open Access Journals (Sweden)

Bruno Eduardo C de Miranda

2010-12-01

Full Text Available A murcha-de-verticílio (Verticillium dahliae é uma das doenças mais severas do tomateiro (Solanum lycopersicum L.. Duas raças fisiológicas de V. dahliae foram caracterizadas infectando o tomateiro e ambas estão presentes no Brasil. A estratégia de controle mais efetiva para isolados da raça 1 tem sido a utilização de cultivares resistentes em associação com práticas culturais. Entretanto, não existem cultivares comerciais de tomate resistentes à raça 2 do patógeno. Neste contexto, torna-se importante a identificação de novas fontes de resistência que sejam efetivas contra as duas raças de V. dahliae. Buscou-se fontes de resistência a isolados de V. dahliae (raças 1 e 2. Cem acessos de uma coleção de germoplasma contendo espécies cultivadas e selvagens de Solanum (secção Lycopersicon foram inicialmente inoculados pelo método de imersão de raízes com um isolado de V. dahliae raça 1 (5 mL de uma suspensão de 10(6 conídios/mL em condições de casa de vegetação. A avaliação foi feita aos 30 dias após a inoculação, usando uma escala de notas variando de 1 (planta sadia a 5 (planta morta. Foram considerados resistentes os acessos que apresentaram nota média entre 1 e 2. Um grupo composto por 38 acessos classificados como resistentes neste primeiro ensaio foi reavaliado para resistência a outros quatro isolados de V. dahliae pertencentes às raças 1 e 2. As cultivares Ponderosa e Floradade foram utilizadas como controles. O ensaio foi conduzido em casa de vegetação em delineamento experimental de blocos ao acaso em arranjo fatorial 5 x 40, com três repetições (vasos com quatro plantas. A avaliação foi feita baseada nos parâmetros epidemiológicos: período de incubação e índice de doença. Foram identificados acessos com resistência raça-específica e também com resistência a ambas as raças. Estes acessos podem ser indicados para futuros programas de melhoramento genético visando incorporar

In vitro trypanocidal activity of solamargine and extracts from Solanum palinacanthum and Solanum lycocarpum of brazilian cerrado

OpenAIRE

MOREIRA, RAQUEL R.D.; MARTINS, GILMARCIO Z.; MAGALHAES, NATHALIA O.; ALMEIDA, ADELIA E.; PIETRO, ROSEMEIRE C.L.R.; SILVA, FLAVIA A. J.; CICARELLI, REGINA M.B.

2013-01-01

O objetivo deste estudo foi avaliar a potencial atividade tripanocida do extrato bruto etanólico dos frutos de Solanum palinacanthum, Solanum lycocarpum e do glicoalcalóide solamargina. Pó do fruto seco de S. palinacanthum e S. lycocarpum foram submetidos a extracção por refluxo com etanol a 96% e solamargina foi isolada a partir do extrato bruto de S. palinacanthum. Foram determinadas de ambos os extratos e a solamargina a atividade tripanocida utilizando o ensaio colorimétrico MTT. O Extrat...

Floral ontogeny in legume genera Petalostylis, Labichea, and Dialium (Caesalpinioideae: Cassieae), a series in floral reduction.

Science.gov (United States)

Tucker, S

1998-02-01

Floral ontogeny of taxa of two subtribes (Labicheinae, Dialiinae) of caesalpinioid tribe Cassieae, characterized by reduced number of floral organs, was compared. All three taxa studied are distichous; Petalostylis labicheoides flowers are solitary in leaf axils, Labichea lanceolata has few-flowered racemes, and Dialium guineense has numerous-flowered cymes. The first sepal primordium in each is initiated abaxially and nonmedianly. Order of organogenesis in Petalostylis is: five sepals bidirectionally, five petals and carpel simultaneously, then five stamens bidirectionally, starting abaxially. The order in Labichea is: five sepals helically (one lagging in time), five petals unidirectionally starting abaxially, the carpel and petals concurrently, then two stamens successively, starting laterally. Order in Dialium is: five sepals bidirectionally, the single petal adaxially, and lastly the carpel and two stamens concurrently. Specializations include (1) reduction of the five sepals to four by fusion in Petalostylis and Labichea; (2) reduction of petal number to one in Dialium; (3) reduction of stamen number to two in Labichea and Dialium, and reduction of functional stamens to three in Petalostylis; and (4) an elaborate, late-developing style in Petalostylis. Floral asymmetry, another specialization, characterizes Labichea, expressed by dissimilar stamens, while the other genera have zygomorphic flowers. Floral ontogenies are compared with other taxa of Cassieae.

Floral Nectar Guide Patterns Discourage Nectar Robbing by Bumble Bees

OpenAIRE

Leonard, Anne S.; Brent, Joshua; Papaj, Daniel R.; Dornhaus, Anna

2013-01-01

Floral displays are under selection to both attract pollinators and deter antagonists. Here we show that a common floral trait, a nectar guide pattern, alters the behavior of bees that can act opportunistically as both pollinators and as antagonists. Generally, bees access nectar via the floral limb, transporting pollen through contact with the plant's reproductive structures; however bees sometimes extract nectar from a hole in the side of the flower that they or other floral visitors create...

Circadian Rhythms in Floral Scent Emission.

Science.gov (United States)

Fenske, Myles P; Imaizumi, Takato

2016-01-01

To successfully recruit pollinators, plants often release attractive floral scents at specific times of day to coincide with pollinator foraging. This timing of scent emission is thought to be evolutionarily beneficial to maximize resource efficiency while attracting only useful pollinators. Temporal regulation of scent emission is tied to the activity of the specific metabolic pathways responsible for scent production. Although floral volatile profiling in various plants indicated a contribution by the circadian clock, the mechanisms by which the circadian clock regulates timing of floral scent emission remained elusive. Recent studies using two species in the Solanaceae family provided initial insight into molecular clock regulation of scent emission timing. In Petunia hybrida, the floral volatile benzenoid/phenylpropanoid (FVBP) pathway is the major metabolic pathway that produces floral volatiles. Three MYB-type transcription factors, ODORANT 1 (ODO1), EMISSION OF BENZENOIDS I (EOBI), and EOBII, all of which show diurnal rhythms in mRNA expression, act as positive regulators for several enzyme genes in the FVBP pathway. Recently, in P. hybrida and Nicotiana attenuata, homologs of the Arabidopsis clock gene LATE ELONGATED HYPOCOTYL (LHY) have been shown to have a similar role in the circadian clock in these plants, and to also determine the timing of scent emission. In addition, in P. hybrida, PhLHY directly represses ODO1 and several enzyme genes in the FVBP pathway during the morning as an important negative regulator of scent emission. These findings facilitate our understanding of the relationship between a molecular timekeeper and the timing of scent emission, which may influence reproductive success.

Host Status of Different Potato (Solanum tuberosum) Varieties and Hatching in Root Diffusates of Globodera ellingtonae.

Science.gov (United States)

Zasada, Inga A; Peetz, Amy; Wade, Nadine; Navarre, Roy A; Ingham, Russ E

2013-09-01

Globodera ellingtonae was detected in Oregon in 2008. In order to make decisions regarding the regulation of this nematode, knowledge of its biology is required. We determined the host status of a diversity of potato (Solanum tuberosum) varieties in soil-based experiments and identified hatching stimulants in in vitro hatching assays. 'Russet Burbank,' 'Desiree,' 'Modac,' 'Norland,' 'Umatilla,' and 'Yukon Gold' were good hosts (RF > 14) for G. ellingtonae. Potato varieties 'Maris Piper,' 'Atlantic,' and 'Satina,' all which contain the Ro1 gene that confers resistance to G. rostochiensis, were not hosts for G. ellingtonae. In in vitro hatching assays, G. ellingtonae hatched readily in the presence of diffusates from potato (PRD) and tomato (Solanum lycopersicum; TRD). Egg hatch occurred in an average of between 87% and 90% of exposed cysts, with an average of between 144 and 164 juveniles emerging per cyst, from PRD- and TRD-treated cysts, respectively. This nematode hatched rapidly in the presence of PRD and TRD, with at least 66% of total hatch occurring by day 3 of exposure. There was no dose-response of egg hatch to concentrations of PRD or TRD ranging from 1:5 to 1:100 diffusate to water. When G. ellingtonae was exposed to root diffusates from 21 different plants, hatch occurred in 0% to 70% of exposed cysts, with an average of between 0 to 27 juveniles emerging per cyst. When root diffusate-exposed cysts were subsequently transferred to PRD to test viability, root diffusates from arugula (Eruca sativa), sudangrass (Sorghum bicolor subsp. drummondii), and common vetch (Vicia sativa) continued to inhibit egg hatch compared with the other root diffusates or water in which hatch occurred readily (60 to 182 juveniles emerging per cyst). Previously known hatching stimulants of G. rostochiensis and G. pallida, sodium metavanadate, sodium orthovanadate, and sodium thiocyanate, stimulated some egg hatch. Although, Globodera ellingtonae hatched readily in PRD and TRD

Herbivory by a Phloem-feeding insect inhibits floral volatile production.

Directory of Open Access Journals (Sweden)

Martin Pareja

Full Text Available There is extensive knowledge on the effects of insect herbivory on volatile emission from vegetative tissue, but little is known about its impact on floral volatiles. We show that herbivory by phloem-feeding aphids inhibits floral volatile emission in white mustard Sinapis alba measured by gas chromatographic analysis of headspace volatiles. The effect of the Brassica specialist aphid Lipaphis erysimi was stronger than the generalist aphid Myzus persicae and feeding by chewing larvae of the moth Plutella xylostella caused no reduction in floral volatile emission. Field observations showed no effect of L. erysimi-mediated floral volatile emission on the total number of flower visits by pollinators. Olfactory bioassays suggested that although two aphid natural enemies could detect aphid inhibition of floral volatiles, their olfactory orientation to infested plants was not disrupted. This is the first demonstration that phloem-feeding herbivory can affect floral volatile emission, and that the outcome of interaction between herbivory and floral chemistry may differ depending on the herbivore's feeding mode and degree of specialisation. The findings provide new insights into interactions between insect herbivores and plant chemistry.

Specialist Osmia bees forage indiscriminately among hybridizing Balsamorhiza floral hosts

Science.gov (United States)

James H. Cane

2011-01-01

Pollinators, even floral generalists (=polyleges), typically specialize during individual foraging bouts, infrequently switching between floral hosts. Such transient floral constancy restricts pollen flow, and thereby gene flow, to conspecific flowers in mixed plant communities. Where incipient flowering species meet, however, weak cross-fertility and often similar...

AVALIAÇÃO DE MUDAS DO TOMATEIRO SOBINFLUÊNCIA DE BIOESTIMULADORES

Directory of Open Access Journals (Sweden)

Osvaldo Machado Pimenta Junior

2017-03-01

aplicação de ácido giberélico e indolbutírico resultaram em um efeito mais equilibrado no desenvolvimento aéreo das muda e maior ganho de massa seca. Palavras-chave: ácido giberélico, ácido indolbutírico, Solanum lycopersicum L.

Biochemical evaluation of tomato germplasm part I: workflow and methods

Science.gov (United States)

Of the seed crop species conserved at PGRU, tomato (Solanum lycopersicum L.) is the largest in terms of numbers of accessions. Furthermore, tomato ranks very high among vegetable crops in economic importance to the US. We are characterizing a tomato core collection for traits that are of interest to...

Expression profile of genes coding for carotenoid biosynthetic ...

Indian Academy of Sciences (India)

Fruit ripening process is associated with change in carotenoid profile and accumulation of lycopene in tomato (Solanum lycopersicum L.). In this study, we quantified the -carotene and lycopene content at green, breaker and red-ripe stages of fruit ripening in eight tomato genotypes by using high-performance liquid ...

'Omics' approaches in tomato aimed at identifying candidate genes ...

African Journals Online (AJOL)

Tomato (Solanum lycopersicum) is one of the most important vegetables in the world with significant importance for human health and nutrition. This species has long served as model system for plant genetics, development, physiology, pathology, and fleshy fruit ripening, resulting in the accumulation of many genetic and ...

MEMORIA Y APRENDIZAJE EN LA ESCOGENCIA FLORAL DE LAS ABEJAS

Directory of Open Access Journals (Sweden)

MARISOL AMAYA

2009-05-01

Full Text Available RESUMEN Los polinizadores altamente especializados en su dieta, no hacen escogencias florales, ellos visitan un recurso específico siguiendo el dictado de la información almacenada en sus genes. En contraste, para la abeja social Apis mellifera una escogencia floral implica, la toma de una decisión, usualmente con criterio económico, basada en información aprendida y almacenada en alguna forma de memoria. Aunque existen numerosos estudios y modelos sobre la escogencia floral en abejas, la gran mayoría de éstos, han derivado sus conclusiones a partir de condiciones temporalmente fijas de la interacción. Muy pocos estudios han abordado la dinámica propia del contexto ecológico, en el cual el mercado floral de las abejas cambia con las estaciones del año y con los patrones diarios de antesis floral. Este cambio en la disponibilidad de especies florales enfrenta a los polinizadores, a realizar escogencias secuenciales acerca del alimento a explotar. En este trabajo abordo el tema del forrajeo secuencial en parches florales heterospecíficos, enfocándome en el uso que la abeja melífera hace de la información previamente aprendida en un contexto, cuando se enfrenta a la explotación de alimento en un contexto ecológicamente diferente. He realizado experimentos sobre escogencia floral simulando las condiciones de cambio del paisaje floral, exponiendo abejas individuales de A. mellifera a decidir sobre cuales especies forrajear en cada parche. Los resultados indican que la abeja invierte en procesos de aprendizaje en un muestreo inicial, pero una vez almacenada la información, utiliza una pieza de la información previamente aprendida (color para explotar parches florales heteroespecíficos siguiendo una imagen de búsqueda de color. En esta revisión discuto situaciones biológicas de la interacción planta-abeja, las cuales apoyan la idea que en la naturaleza el uso de imágenes de búsqueda de color por parte de abejas sociales puede

Floral abundance, richness, and spatial distribution drive urban garden bee communities.

Science.gov (United States)

Plascencia, M; Philpott, S M

2017-10-01

In urban landscapes, gardens provide refuges for bee diversity, but conservation potential may depend on local and landscape features. Foraging and population persistence of bee species, as well as overall pollinator community structure, may be supported by the abundance, richness, and spatial distribution of floral resources. Floral resources strongly differ in urban gardens. Using hand netting and pan traps to survey bees, we examined whether abundance, richness, and spatial distribution of floral resources, as well as ground cover and garden landscape surroundings influence bee abundance, species richness, and diversity on the central coast of California. Differences in floral abundance and spatial distribution, as well as urban cover in the landscape, predicted different bee community variables. Abundance of all bees and of honeybees (Apis mellifera) was lower in sites with more urban land cover surrounding the gardens. Honeybee abundance was higher in sites with patchy floral resources, whereas bee species richness and bee diversity was higher in sites with more clustered floral resources. Surprisingly, bee species richness and bee diversity was lower in sites with very high floral abundance, possibly due to interactions with honeybees. Other studies have documented the importance of floral abundance and landscape surroundings for bees in urban gardens, but this study is the first to document that the spatial arrangement of flowers strongly predicts bee abundance and richness. Based on these findings, it is likely that garden managers may promote bee conservation by managing for floral connectivity and abundance within these ubiquitous urban habitats.

Silencing of the tomato phosphatidylinositol-phospholipase C2 (SlPLC2) reduces plant susceptibility to Botrytis cinerea

NARCIS (Netherlands)

Gonorazky, Gabriela; Guzzo, María Carla; Abd-El-Haliem, Ahmed M.; Joosten, Matthieu H.A.J.; Laxalt, Ana María

2016-01-01

The tomato [Solanum lycopersicum (Sl)] phosphatidylinositol-phospholipase C (PI-PLC) gene family is composed of six members, named SlPLC1 to SlPLC6, differentially regulated on pathogen attack. We have previously shown that the fungal elicitor xylanase induces a raise of SlPLC2 and SlPLC5

Root Exudate Effect on Germination and Mycelial Growth of ...

African Journals Online (AJOL)

The effect of some root exudates on the germination and mycelial growth of sclerotia of Sclerotium rolfsii Sacc. was studied. Root exudates of 5 – 10 days old seedlings from five plants viz: - tomato (Lycopersicum esculenta) maize (Zea mays), garden egg (Solanum melongena), pigeon pea (Cajanus cajan), and pepper ...

Overexpression of the tomato pollen receptor kinase LePRK1 rewires pollen tube growth to a blebbling mode

Science.gov (United States)

The tubular growth of a pollen tube cell is crucial for the sexual reproduction of flowering plants. LePRK1 is a pollen-specific and plasma membrane–localized receptor-like kinase from tomato (Solanum lycopersicum). LePRK1 interacts with another receptor, LePRK2, and with KINASE PARTNER PROTEIN (KPP...

Cross-protection or enhanced symptom display in greenhouse tomato co-infected with different Pepino mosaic virus isolates

NARCIS (Netherlands)

Hanssen, I.M.; Gutiérrez-Aguirre, I.; Paeleman, A.; Goen, K.; Wittemans, L.; Lievens, B.; Vanachter, A.C.R.C.; Ravnikar, M.; Thomma, B.P.H.J.

2010-01-01

The potential of three mild Pepino mosaic virus (PepMV) isolates, belonging to the CH2, EU and LP genotypes, to protect a tomato (Solanum lycopersicum) crop against an aggressive challenge isolate of the CH2 genotype was assessed in greenhouse trials and PepMV symptoms were rated at regular time

EL ÁCIDO ABSCÍSICO ACELERA EL DESARROLLO FLORAL DE SOLIDAGO EN DÍAS CORTOS ABSCISIC ACID SPEED UP FLORAL DEVELOPMENT OF SOLIDAGO UNDER SHORT DAYS

Directory of Open Access Journals (Sweden)

Víctor Julio Flórez Roncancio

2009-06-01

Full Text Available Solidago x luteus (M. L. Greene Broulliet y Semple (= x Solidaster hybridus, x S. luteus es una planta que responde a días cortos (DC para el desarrollo floral. En este proceso se ha establecido la participación de varias fitohormonas, entre éstas, la presencia del ácido abscísico (ABA en zonas y periodos específicos durante el desarrollo de la flor lo cual sugiere su acción promotora en la velocidad de antesis floral de esta especie en DC. En este trabajo se buscaron nuevos indicios de la participación de fitohormonas presentes en la fracción ácida con el proceso de floración. En una primera etapa, extractos foliares provenientes de hojas de plantas en días largos (caracterizadas por menor velocidad de antesis floral se aplicaron en botones florales de plantas en días cortos (caracterizadas por una mayor velocidad de antesis floral. Se realizaron ocho aplicaciones con diferentes frecuencias totalizando un periodo de tratamiento de 25 días. Los resultados mostraron que las sustancias presentes en los extractos de la fracción ácida, no alteran la velocidad promedio de antesis floral en los botones florales de plantas en DC. En la segunda etapa del experimento, la cuantificación de los extractos por ELISA, permitió establecer una mayor concentración de ABA en los extractos de hojas y de botones florales de plantas en DC y de botones florales en el inicio del tratamiento. Estos resultados confirman la relación del ABA con la mayor velocidad de antesis floral en plantas de Solidago x luteus en condiciones de DC.Solidago x luteus (M.L. Greene Broulliet & Semple (= x Solidaster hybridus, x S. luteus is a plant that respond to short days (SD for flower development. In this process, there has been established the involvement of many phytohormones, between these, the presence of the abscisic acid (ABA in zones and specific periods during flower development, suggests its promoter roll on the floral anthesis period of this species under

Chromosome evolution in Solanum traced by cross-species BAC-FISH

NARCIS (Netherlands)

Szinay, D.; Wijnker, E.; Berg, van den R.G.; Visser, R.G.F.; Jong, de J.H.S.G.M.; Bai, Y.

2012-01-01

Chromosomal rearrangements are relatively rare evolutionary events and can be used as markers to study karyotype evolution. This research aims to use such rearrangements to study chromosome evolution in Solanum. Chromosomal rearrangements between Solanum crops and several related wild species were

Reproductive biology of endemic Solanum melissarum Bohs (Solanaceae) and updating of its current geographic distribution as the basis for its conservation in the Brazilian Cerrado.

Science.gov (United States)

Coelho, C P; Gomes, D C; Guilherme, F A G; Souza, L F

2017-11-01

The genus Solanum (family Solanaceae) includes more than 1400 species and has buzz-pollinated flowers with poricidal anthers. The present study aimed to describe the distribution, breeding system and pollination mechanism of Solanum melissarum, a species endemic to Brazil. The study of breeding system was conducted in an urban forest fragment in Jataí, GO. Distribution data were gathered from floristic surveys and digital plant databases. The floral morphology and the pollination mechanism were studied on through field observations and preserved flowers. The breeding system was determined through hand pollination treatments. The species has a distribution only in the Brazilian Atlantic forest coastal, and this study provides the first records of S. melissarum for the state of Goiás. The pendulous flowers have poricidal anthers close to the stigma, with membranous thecae joined by a connective bearing osmophores that attract males of Euglossa cordata bees. As they collect fragrances, the bees press the thecae and pollen is released through a bellows mechanism. Based on the hand-pollination treatments, this species is self-incompatible. Isolated forest fragments may not include enough pollinators to ensure the pollination of plants with specialized systems. However, they are essential for the conservation of species with interesting phytogeographic patterns, such as the vicariance observed in S. melissarum, and for the conservation of regional diversity.

Building beauty: the genetic control of floral patterning

Energy Technology Data Exchange (ETDEWEB)

Lohmann, J. U., and Weigel, D.

2002-02-01

OAK-B135 Floral organ identity is controlled by combinatorial action of homeotic genes expressed in different territories within the emerging flower. This review discusses recent progress in our understanding of floral homeotic genes, with an emphasis on how their region-specific expression is regulated.

chemical profiles of honeys originating from different floral sources

African Journals Online (AJOL)

2015-02-05

Feb 5, 2015 ... FLORAL SOURCES AND GEOGRAPHIC LOCATIONS EXAMINED BY A ... quality honeys retail for premium prices, but these honeys are increasingly being counterfeited ... distinguish between two floral sources in Malaysia.

Genetic diversity of the African hexaploid species Solanum scabrum Mill. and S. nigrum L. (Solanaceae)

NARCIS (Netherlands)

Manoko, M.L.K.; Berg, van den R.G.; Feron, R.M.C.; Weerden, van der G.M.; Mariani, C.

2008-01-01

Two hexaploid species of Solanum sect. Solanum are present in Africa: Solanum scabrum and S. nigrum. Solanum scabrum is a widely cultivated species and is used as a leafy vegetable, as a source of medicine and as a source of ink dye. In previous studies a wide range of morphological diversity has

Variations on a theme: changes in the floral ABCs in angiosperms.

NARCIS (Netherlands)

Rijpkema, A.S.; Vandenbussche, M.; Koes, R.E.; Heijmans, K.; Gerats, T.

2010-01-01

Angiosperms display a huge variety of floral forms. The development of the ABC-model for floral organ identity, almost 20 years ago, has created an excellent basis for comparative floral development (evo-devo) studies. These have resulted in an increasingly more detailed understanding of the

Variations on a theme: changes in the floral ABCs in angiosperms.

NARCIS (Netherlands)

Rijpkema, A.S.; Vandenbussche, M.; Koes, R.E.; Heijmans, K.; Gerats, T.

2009-01-01

Angiosperms display a huge variety of floral forms. The development of the ABC-model for floral organ identity, almost 20 years ago, has created an excellent basis for comparative floral development (evo-devo) studies. These have resulted in an increasingly more detailed understanding of the

A developmental basis for stochasticity in floral organ numbers

Science.gov (United States)

Kitazawa, Miho S.; Fujimoto, Koichi

2014-01-01

Stochasticity ubiquitously inevitably appears at all levels from molecular traits to multicellular, morphological traits. Intrinsic stochasticity in biochemical reactions underlies the typical intercellular distributions of chemical concentrations, e.g., morphogen gradients, which can give rise to stochastic morphogenesis. While the universal statistics and mechanisms underlying the stochasticity at the biochemical level have been widely analyzed, those at the morphological level have not. Such morphological stochasticity is found in foral organ numbers. Although the floral organ number is a hallmark of floral species, it can distribute stochastically even within an individual plant. The probability distribution of the floral organ number within a population is usually asymmetric, i.e., it is more likely to increase rather than decrease from the modal value, or vice versa. We combined field observations, statistical analysis, and mathematical modeling to study the developmental basis of the variation in floral organ numbers among 50 species mainly from Ranunculaceae and several other families from core eudicots. We compared six hypothetical mechanisms and found that a modified error function reproduced much of the asymmetric variation found in eudicot floral organ numbers. The error function is derived from mathematical modeling of floral organ positioning, and its parameters represent measurable distances in the floral bud morphologies. The model predicts two developmental sources of the organ-number distributions: stochastic shifts in the expression boundaries of homeotic genes and a semi-concentric (whorled-type) organ arrangement. Other models species- or organ-specifically reproduced different types of distributions that reflect different developmental processes. The organ-number variation could be an indicator of stochasticity in organ fate determination and organ positioning. PMID:25404932

Wild bees preferentially visit Rudbeckia flower heads with exaggerated ultraviolet absorbing floral guides.

Science.gov (United States)

Horth, Lisa; Campbell, Laura; Bray, Rebecca

2014-03-15

Here, we report on the results of an experimental study that assessed the visitation frequency of wild bees to conspecific flowers with different sized floral guides. UV absorbent floral guides are ubiquitous in Angiosperms, yet surprisingly little is known about conspecific variation in these guides and very few studies have evaluated pollinator response to UV guide manipulation. This is true despite our rich understanding about learning and color preferences in bees. Historical dogma indicates that flower color serves as an important long-range visual signal allowing pollinators to detect the flowers, while floral guides function as close-range signals that direct pollinators to a reward. We initiated the work presented here by first assessing the population level variation in UV absorbent floral guides for conspecific flowers. We assessed two species, Rudbeckia hirta and R. fulgida. We then used several petal cut-and-paste experiments to test whether UV floral guides can also function to attract visitors. We manipulated floral guide size and evaluated visitation frequency. In all experiments, pollinator visitation rates were clearly associated with floral guide size. Diminished floral guides recruited relatively few insect visitors. Exaggerated floral guides recruited more visitors than smaller or average sized guides. Thus, UV floral guides play an important role in pollinator recruitment and in determining the relative attractiveness of conspecific flower heads. Consideration of floral guides is therefore important when evaluating the overall conspicuousness of flower heads relative to background coloration. This work raises the issue of whether floral guides serve as honest indicators of reward, since guide size varies in nature for conspecific flowers at the same developmental stage and since preferences for larger guides were found. To our knowledge, these are the first cut-and-paste experiments conducted to examine whether UV absorbent floral guides affect

Wild bees preferentially visit Rudbeckia flower heads with exaggerated ultraviolet absorbing floral guides

Directory of Open Access Journals (Sweden)

Lisa Horth

2014-07-01

Full Text Available Here, we report on the results of an experimental study that assessed the visitation frequency of wild bees to conspecific flowers with different sized floral guides. UV absorbent floral guides are ubiquitous in Angiosperms, yet surprisingly little is known about conspecific variation in these guides and very few studies have evaluated pollinator response to UV guide manipulation. This is true despite our rich understanding about learning and color preferences in bees. Historical dogma indicates that flower color serves as an important long-range visual signal allowing pollinators to detect the flowers, while floral guides function as close-range signals that direct pollinators to a reward. We initiated the work presented here by first assessing the population level variation in UV absorbent floral guides for conspecific flowers. We assessed two species, Rudbeckia hirta and R. fulgida. We then used several petal cut-and-paste experiments to test whether UV floral guides can also function to attract visitors. We manipulated floral guide size and evaluated visitation frequency. In all experiments, pollinator visitation rates were clearly associated with floral guide size. Diminished floral guides recruited relatively few insect visitors. Exaggerated floral guides recruited more visitors than smaller or average sized guides. Thus, UV floral guides play an important role in pollinator recruitment and in determining the relative attractiveness of conspecific flower heads. Consideration of floral guides is therefore important when evaluating the overall conspicuousness of flower heads relative to background coloration. This work raises the issue of whether floral guides serve as honest indicators of reward, since guide size varies in nature for conspecific flowers at the same developmental stage and since preferences for larger guides were found. To our knowledge, these are the first cut-and-paste experiments conducted to examine whether UV absorbent

Morphological Observation on Floral Variations of the Genus Cuscuta in Taiwan

Directory of Open Access Journals (Sweden)

Gwo-Ing Liao

2005-06-01

Full Text Available The variations in floral structure of Cuscuta in Taiwan were studied with special reference to C. campestris. The variations of the floral structure were described and illustrated by using light and scanning electron microscopy. The variations including the following: (1 the absence of floral organs; (2 the abnormal fusion of floral organs; (3 petaloid stamens; (4 the lack of distinctive anther lobes; (5 the unusual protrusions on ovaries; and (6 the extrusion of ovule on ovary surfaces. The variations occur in early developmental stages when the primordia of floral organ were initiated. The findings that the abnormal position of the ovule and the lateral fusion of the scale with the filament or the petal in the species of Cuscuta are first time reported here.

RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

Science.gov (United States)

Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

2016-03-16

Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.

Non-volatile floral oils of Diascia spp. (Scrophulariaceae).

Science.gov (United States)

Dumri, Kanchana; Seipold, Lars; Schmidt, Jürgen; Gerlach, Günter; Dötterl, Stefan; Ellis, Allan G; Wessjohann, Ludger A

2008-04-01

The floral oils of Diascia purpurea, Diascia vigilis, Diascia cordata, Diascia megathura, Diascia integerrima and Diascia barberae (Scrophulariaceae) were selectively collected from trichome elaiophores. The derivatized floral oils were analyzed by gas chromatography-mass spectrometry (GC-MS), whilst the underivatized samples were analysed by electrospray ionization mass spectrometry (ESI-MS) and Fourier-transform ion cyclotron resonance mass spectrometry (FTICR-MS). The most common constituents of the floral oils investigated are partially acetylated acylglycerols of (3R)-acetoxy fatty acids (C(14), C(16), and C(18)), as was proven with non-racemic synthetic reference samples. The importance of these oils for Rediviva bees is discussed in a co-evolutionary context.

Overhead irrigation increased winter chilling and floral bud ...

African Journals Online (AJOL)

Eucalyptus nitens requires a sufficiently cold winter to produce flower buds. In areas in South Africa where E. nitens commercial plantations as well as breeding and production seed orchards are located, winter chilling is often insufficient for floral bud initiation. Hence, under such conditions, E. nitens floral bud and seed ...

Do Plants Eavesdrop on Floral Scent Signals?

Science.gov (United States)

Caruso, Christina M; Parachnowitsch, Amy L

2016-01-01

Plants emit a diverse array of volatile organic compounds that can function as cues to other plants. Plants can use volatiles emitted by neighbors to gain information about their environment, and respond by adjusting their phenotype. Less is known about whether the many different volatile signals that plants emit are all equally likely to function as cues to other plants. We review evidence for the function of floral volatile signals and conclude that plants are as likely to perceive and respond to floral volatiles as to other, better-studied volatiles. We propose that eavesdropping on floral volatile cues is particularly likely to be adaptive because plants can respond to these cues by adjusting traits that directly affect pollination and mating. Copyright © 2015 Elsevier Ltd. All rights reserved.

Floral reward in Ranunculaceae species

Directory of Open Access Journals (Sweden)

Bożena Denisow

2016-04-01

Full Text Available Floral reward is important in ecological and evolutionary perspectives and essential in pollination biology. For example, floral traits, nectar and pollen features are essential for understanding the functional ecology, the dynamics of pollen transport, competition for pollinator services, and patterns of specialization and generalization in plant–pollinator interactions. We believe to present a synthetic description in the field of floral reward in Ranunculaceae family important in pollination biology and indicating connections between ecological and evolutionary approaches. The links between insect visitors’ behaviour and floral reward type and characteristics exist. Ranunculaceae is a family of aboot 1700 species (aboot 60 genera, distributed worldwide, however the most abundant representatives are in temperate and cool regions of the northern and southern hemispheres. The flowers are usually radially symmetric (zygomorphic and bisexual, but in Aconitum, Aquilegia are bilaterally symmetric (zygomorphic. Most Ranunculaceae flowers offer no nectar, only pollen (e.g., Ranunculus, Adonis vernalis, Thalictrum, but numerous species create trophic niches for different wild pollinators (e.g. Osmia, Megachile, Bombus, Andrena (Denisow et al. 2008. Pollen is a source of protein, vitamins, mineral salts, organic acids and hormones, but the nutritional value varies greatly between different plant species. The pollen production can differ significantly between Ranunculacea species. The mass of pollen produced in anthers differ due to variations in the number of developed anthers. For example, interspecies differences are considerable, 49 anthers are noted in Aquilegia vulgaris, 70 anthers in Ranunculus lanuginosus, 120 in Adonis vernalis. A significant intra-species differences’ in the number of anthers are also noted (e.g. 41 to 61 in Aquilegia vulgaris, 23-45 in Ranunculus cassubicus. Pollen production can be up to 62 kg per ha for Ranunculus acer

Experimental Conditions: SE3_S02_M01_D02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M01_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

Experimental Conditions: SE3_S02_M02_D03 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M02_D03 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

Experimental Conditions: SE3_S02_M01_D01 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M01_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

Experimental Conditions: SE3_S02_M03_D03 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M03_D03 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M03 6.7 mg [MassBase ID] MDLC1_25531 SE3_MS1 LC-FT-ICR-M

Experimental Conditions: SE3_S02_M03_D01 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M03_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M03 6.7 mg [MassBase ID] MDLC1_25531 SE3_MS1 LC-FT-ICR-M

Experimental Conditions: SE3_S02_M01_D03 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M01_D03 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

Experimental Conditions: SE3_S02_M02_D01 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M02_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

Experimental Conditions: SE3_S02_M03_D02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M03_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M03 6.7 mg [MassBase ID] MDLC1_25531 SE3_MS1 LC-FT-ICR-M

Experimental Conditions: SE3_S02_M02_D02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M02_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

Proteome modification in tomato plants upon long-term aluminum treatment

Science.gov (United States)

This study aimed to identify the aluminum (Al)-induced proteomes in tomato (Solanum lycopersicum, “Micro-Tom”) after long-term exposure to the stress factor. Plants were treated in Magnavaca’s solution (pH 4.5) supplemented with 7.5 uM Al3+ ion activity over a 4 month period beginning at the emergen...

Microbial diversity in the floral nectar of seven Epipactis (Orchidaceae) species

Science.gov (United States)

Jacquemyn, Hans; Lenaerts, Marijke; Tyteca, Daniel; Lievens, Bart

2013-01-01

Abstract Floral nectar of animal-pollinated plants is commonly infested with microorganisms, yet little is known about the microorganisms inhabiting the floral nectar of orchids. In this study, we investigated microbial communities occurring in the floral nectar of seven Epipactis (Orchidaceae) species. Culturable bacteria and yeasts were isolated and identified by partially sequencing the small subunit (SSU) ribosomal RNA (rRNA) gene and the D1/D2 domains of the large subunit (LSU) rRNA gene, respectively. Using three different culture media, we found that bacteria were common inhabitants of the floral nectar of Epipactis. The most widely distributed bacterial operational taxonomic units (OTUs) in nectar of Epipactis were representatives of the family of Enterobacteriaceae, with an unspecified Enterobacteriaceae bacterium as the most common. In contrast to previous studies investigating microbial communities in floral nectar, very few yeast species (mainly of the genus Cryptococcus) were observed, and most of them occurred in very low densities. Total OTU richness (i.e., the number of bacterial and yeast OTUs per orchid species) varied between 4 and 20. Cluster analysis revealed that microbial communities of allogamous species differed from those of autogamous and facultatively autogamous species. This study extends previous efforts to identify microbial communities in floral nectar and indicates that the floral nectar of the orchids investigated mainly contained bacterial communities with moderate phylogenetic diversity. PMID:23836678

Transcriptional signatures of ancient floral developmental genetics in avocado (Persea americana; Lauraceae).

Science.gov (United States)

Chanderbali, André S; Albert, Victor A; Leebens-Mack, Jim; Altman, Naomi S; Soltis, Douglas E; Soltis, Pamela S

2009-06-02

The debate on the origin and evolution of flowers has recently entered the field of developmental genetics, with focus on the design of the ancestral floral regulatory program. Flowers can differ dramatically among angiosperm lineages, but in general, male and female reproductive organs surrounded by a sterile perianth of sepals and petals constitute the basic floral structure. However, the basal angiosperm lineages exhibit spectacular diversity in the number, arrangement, and structure of floral organs, whereas the evolutionarily derived monocot and eudicot lineages share a far more uniform floral ground plan. Here we show that broadly overlapping transcriptional programs characterize the floral transcriptome of the basal angiosperm Persea americana (avocado), whereas floral gene expression domains are considerably more organ specific in the model eudicot Arabidopsis thaliana. Our findings therefore support the "fading borders" model for organ identity determination in basal angiosperm flowers and extend it from the action of regulatory genes to downstream transcriptional programs. Furthermore, the declining expression of components of the staminal transcriptome in central and peripheral regions of Persea flowers concurs with elements of a previous hypothesis for developmental regulation in a gymnosperm "floral progenitor." Accordingly, in contrast to the canalized organ-specific regulatory apparatus of Arabidopsis, floral development may have been originally regulated by overlapping transcriptional cascades with fading gradients of influence from focal to bordering organs.

Floral nectar guide patterns discourage nectar robbing by bumble bees.

Directory of Open Access Journals (Sweden)

Anne S Leonard

Full Text Available Floral displays are under selection to both attract pollinators and deter antagonists. Here we show that a common floral trait, a nectar guide pattern, alters the behavior of bees that can act opportunistically as both pollinators and as antagonists. Generally, bees access nectar via the floral limb, transporting pollen through contact with the plant's reproductive structures; however bees sometimes extract nectar from a hole in the side of the flower that they or other floral visitors create. This behavior is called "nectar robbing" because bees may acquire the nectar without transporting pollen. We asked whether the presence of a symmetric floral nectar guide pattern on artificial flowers affected bumble bees' (Bombus impatiens propensity to rob or access nectar "legitimately." We discovered that nectar guides made legitimate visits more efficient for bees than robbing, and increased the relative frequency of legitimate visits, compared to flowers lacking nectar guides. This study is the first to show that beyond speeding nectar discovery, a nectar guide pattern can influence bees' flower handling in a way that could benefit the plant.

Floral Nectar Guide Patterns Discourage Nectar Robbing by Bumble Bees

Science.gov (United States)

Leonard, Anne S.; Brent, Joshua; Papaj, Daniel R.; Dornhaus, Anna

2013-01-01

Floral displays are under selection to both attract pollinators and deter antagonists. Here we show that a common floral trait, a nectar guide pattern, alters the behavior of bees that can act opportunistically as both pollinators and as antagonists. Generally, bees access nectar via the floral limb, transporting pollen through contact with the plant’s reproductive structures; however bees sometimes extract nectar from a hole in the side of the flower that they or other floral visitors create. This behavior is called “nectar robbing” because bees may acquire the nectar without transporting pollen. We asked whether the presence of a symmetric floral nectar guide pattern on artificial flowers affected bumble bees’ (Bombus impatiens) propensity to rob or access nectar “legitimately.” We discovered that nectar guides made legitimate visits more efficient for bees than robbing, and increased the relative frequency of legitimate visits, compared to flowers lacking nectar guides. This study is the first to show that beyond speeding nectar discovery, a nectar guide pattern can influence bees’ flower handling in a way that could benefit the plant. PMID:23418475

Rapid screening of toxic glycoalkaloids and micronutrients in edible nightshades (Solanum spp.

Directory of Open Access Journals (Sweden)

Bo Yuan

2018-04-01

Full Text Available African indigenous vegetables (AIVs because of their nutrient density have the unique potential to reduce micronutrient deficiencies in sub-Saharan Africa, yet some may also contain anti-nutritive compounds. Vegetable nightshades from Solanum americanum, Solanum nigrum, Solanum scabrum and Solanum villosum are among the major AIVs used as a leafy vegetables and consumed regularly in many countries in sub-Sahara Africa. These under-recognized food crops have not been subjected to extensive studies for their nutritional and antinutritive factors. In this study, 15 entries of the vegetable nightshades were field-grown and the leaves which are the consumed product of commerce chemically profiled by LC/ESI-MS. Twenty-three flavones, eight saponins, and two glycoalkaloids along with a phenolic acid of chlorogenic acid were identified by MS and UV data. Anti-nutrient glycoalkaloids were quantified as total aglycones after acidic hydrolysis using MS detection and found to be within safe-consumption thresholds by comparison with the glycoalkaloid level in the globally consumed Solanum member eggplants. Edible nightshades were also found to be sources of β-carotene, vitamin E and total polyphenols and exhibited high antioxidant activity. Results of this study support that consumption of vegetable nightshades are safe from the presence of glycoalkaloids and thus, can contribute to the reduction of micronutrient deficiency in sub-Sahara Africa. Keywords: Alkaloids, Flavonoids, Carotene, Vitamin E, Antioxidant activity, Saponins, Solanum

Circadian rhythms in floral scent emission

Directory of Open Access Journals (Sweden)

Myles eFenske

2016-04-01

Full Text Available To successfully recruit pollinators, plants often release attractive floral scents at specific times of day to coincide with pollinator foraging. This timing of scent emission is thought to be evolutionarily beneficial to maximize resource efficiency while attracting only useful pollinators. Temporal regulation of scent emission is tied to the activity of the specific metabolic pathways responsible for scent production. Although floral volatile profiling in various plants indicated a contribution by the circadian clock, the mechanisms by which the circadian clock regulates timing of floral scent emission remained elusive. Recent studies using two species in the Solanaceae family provided initial insight into molecular clock regulation of scent emission timing. In Petunia hybrida, the benzenoid/phenylpropanoid (FVBP pathway is the major metabolic pathway that produces floral volatiles. Three MYB-type transcription factors, ODORANT1 (ODO1, EMISSION OF BENZENOIDS I (EOBI, and EOBII, all of which show diurnal rhythms in mRNA expression, act as positive regulators for several enzyme genes in the FVBP pathway. Recently, in P. hybrida and Nicotiana attenuata, homologs of the Arabidopsis clock gene LATE ELONGATED HYPOCOTYL (LHY have been shown to have a similar role in the circadian clock in these plants, and to also determine the timing of scent emission. In addition, in P. hybrida, PhLHY directly represses ODO1 and several enzyme genes in the FVBP pathway during the morning as an important negative regulator of scent emission. These findings facilitate our understanding of the relationship between a molecular timekeeper and the timing of scent emission, which may influence reproductive success.

Floral nectary, nectar production dynamics, and floral reproductive isolation among closely related species of Pedicularis.

Science.gov (United States)

Liu, Ya-Nan; Li, Yan; Yang, Fu-Sheng; Wang, Xiao-Quan

2016-02-01

Floral nectar is thought to be one of the most important rewards that attract pollinators in Pedicularis; however, few studies have examined variation of nectary structure and/or nectar secretion in the genus, particularly among closely related species. Here we investigated nectary morphology, nectar quality, and nectar production dynamics in flowers of Pedicularis section Cyathophora. We found a conical floral nectary at the base of the ovary in species of the rex-thamnophila clade. Stomata were found on the surface of the nectary, and copious starch grains were detected in the nectary tissues. In contrast, a semi-annular nectary was found in flowers of the species of the superba clade. Only a few starch grains were observed in tissues of the semi-annular nectary, and the nectar sugar concentration in these flowers was much lower than that in the flowers of the rex-thamnophila clade. Our results indicate that the floral nectary has experienced considerable morphological, structural, and functional differentiation among closely related species of Pedicularis. This could have affected nectar production, leading to a shift of the pollination mode. Our results also imply that variation of the nectary morphology and nectar production may have played an important role in the speciation of sect. Cyathophora. © 2015 Institute of Botany, Chinese Academy of Sciences.

Floral structure and ontogeny of Syndiclis (Lauraceae.

Directory of Open Access Journals (Sweden)

Gang Zeng

Full Text Available Generic delimitation in the Beilschmiedia group of the Lauraceae remains ambiguous because flowering specimens of a few genera with confined distribution are poorly represented in herbaria, and a few floral characters important for taxonomy are still poorly known. Syndiclis is sporadically distributed in southwestern China, and is represented in the herbaria by only a few flowering specimens. We conducted field investigations to collect floral materials of four species and observed structures and ontogeny of the tiny flowers using both light microscopy (LM and scanning electron microscopy (SEM. The results show that the genus Syndiclis possesses flowers with huge variation in both merosity and organ number. Flowers of the genus are dimerous, trimerous, or tetramerous, or have mixed merosity with monomerous and dimerous, or dimerous and trimerous, or trimerous and tetramerous whorls. The number of staminodes ranges from two to eight, depending on floral merosity, and on how many stamens of the third androecial whorl are reduced to staminodes. The staminodes of the fourth androecial whorl are comparable to the staminodes in Potameia, but the staminodes of the third androecial whorl of Syndiclis are relatively larger than the staminodes in Potameia. They are erect or curved inwards, covering the ovary. The anthers are usually two-locular, but rarely one-locular or three-locular. Each stamen of the third androecial whorl bears two conspicuous and enlarged glands at the base. The lability of floral merosity and organ number of Syndiclis may have been caused by changes of pollination system and loss of special selective pressures that are present in most Lauraceous plants with fixed floral organ number. This study furthers our understanding of variation and evolution of a few important characters of the Beilschmiedia group and provides essential data for a revised generic classification of the group.

Gene expression analysis of Solanum lycopersicum and Solanum habrochaites under drought conditions

Directory of Open Access Journals (Sweden)

Upama Mishra

2016-09-01

Full Text Available Drought is one of the limiting environmental factors that affect crop production worldwide. Understanding the molecular mechanism of drought stress is the key to developing drought tolerant crop. In this experiment we performed expression profiling of tomato plants under water deficit conditions using microarray technology. The data set we generated (available in the NCBI/GEO database under GSE22304 has been analyzed to identify genes that are involved in the regulation of tomato's responses to drought.

How scent and nectar influence floral antagonists and mutualists.

Science.gov (United States)

Kessler, Danny; Kallenbach, Mario; Diezel, Celia; Rothe, Eva; Murdock, Mark; Baldwin, Ian T

2015-07-01

Many plants attract and reward pollinators with floral scents and nectar, respectively, but these traits can also incur fitness costs as they also attract herbivores. This dilemma, common to most flowering plants, could be solved by not producing nectar and/or scent, thereby cheating pollinators. Both nectar and scent are highly variable in native populations of coyote tobacco, Nicotiana attenuata, with some producing no nectar at all, uncorrelated with the tobacco's main floral attractant, benzylacetone. By silencing benzylacetone biosynthesis and nectar production in all combinations by RNAi, we experimentally uncouple these floral rewards/attractrants and measure their costs/benefits in the plant's native habitat and experimental tents. Both scent and nectar increase outcrossing rates for three, separately tested, pollinators and both traits increase oviposition by a hawkmoth herbivore, with nectar being more influential than scent. These results underscore that it makes little sense to study floral traits as if they only mediated pollination services.

Aromas florales y su interacción con los insectos polinizadores Floral scents and their interaction with insect pollinators

Directory of Open Access Journals (Sweden)

Julieta Grajales-Conesa

2011-12-01

Full Text Available Las plantas emplean diversas señales visuales y olfativas con la finalidad de atraer a los polinizadores que en su mayoría son insectos. Algunas plantas han desarrollado mecanismos, basándose en mensajes olfativos que los hacen únicos para sus polinizadores específicos. Estos mecanismos, así como las variaciones intra- e interespecíficas en el perfil de los aromas florales han evolucionado para determinadas especies. Los aromas florales son un conjunto de compuestos volátiles orgánicos y para su estudio hay varios métodos que requieren de técnicas que cada vez son más eficientes. El uso de estos aromas podría ser una opción en determinados sistemas de polinización, utilizándolos como atrayente de polinizadores o de depredadores y/o herbívoro para incrementar la producción y disminuir los daños por plagas. En este trabajo se revisan las distintas interacciones de los insectos y los aromas florales, los sistemas específicos planta-polinizador, los métodos de análisis, así como algunos patrones o tendencias de estas interacciones y su aplicación e importancia.Plants use visual and olfactory cues to attract pollinators and to allow them to detect the presence of flowers, which most of them are insects. Some plants have evolved with their pollinators, based on the olfactory messages, which make them unique for their specific pollinators. These mechanisms have evolved in certain plants in relation to their pollinators, and there are also inter and intra-specific variation in fragrance cues which show specific chemical profile for each plant species, so insects attracted are specific to them. Most of the floral scents are organic compounds identified with techniques and methodologies which become more specific and efficient along the time. The application of floral scent could be used as a tool in pollination and pest management. In these studies, insect interaction with floral scent is reviewed and specificity of plant

Pollen diversity, viability and floral structure of some Musa genotypes

African Journals Online (AJOL)

Pollen diversity, viability and floral structure of some Musa genotypes. ... This experiment was designed to study the floral structure, pollen morphology and the potential pollen viability of five Musa genotypes obtained ... HOW TO USE AJOL.

UNA NUEVA ESPECIE DE SOLANUM SECCIÓN GEMINATA (SOLANACEAE DE COLOMBIA

Directory of Open Access Journals (Sweden)

GRANADOS-TOCHOY JUAN CARLOS

2006-06-01

Full Text Available Se describe Solanum sagittantherum Granados-Tochoy & C.I. Orozco, una nuevaespecie de Solanum sección Geminata encontrada en la Cordillera Oriental de losAndes de Colombia. Se presenta información sobre su distribución, hábitat y taxonomía.

Two new South American species of Solanum section Crinitum (Solanaceae

Directory of Open Access Journals (Sweden)

Frank Farruggia

2010-11-01

Full Text Available Two new species of Solanum section Crinitum are described here. Solanum falciforme Farruggia, sp. nov., closely resembles S. crinitum and S. lycocarpum, but differs by the presence of falcate trichomes on the young growth. It is endemic to the cerrado and adjacent woodlands of Distrito Federal, Bahia, Goiás and Minas Gerais, Brazil. The other species, Solanum pseudosycophanta Farruggia, sp.nov., has close affinities to S. sycophanta but differs from the latter inprominent long-stalked stellate hairs along the stem, calyx, petiole and the adaxial surface of the leaf, in contrast to S. sycophanta which is glabrous or pubescent with sessile to short-stalked multangulate hairs. This species is narrowly distributed in tropical montane forests of northern Peru and southern Ecuador.

Floral visitors of Ananas comosus in Ghana: A preliminary assessment

Directory of Open Access Journals (Sweden)

Peter Kwapong

2010-11-01

Full Text Available Ananas comosus var comosus (L. Merr. is the third most important tropical fruit in the world production and the leading foreign exchange earner among fresh fruits exported from Ghana. A survey was conducted in pineapple farms in the Central region of Ghana to identify floral visitors and their activities on the flowers. Nectar concentration and energetics and effect of floral visitors on fruit production were determined. Fourteen species of butterflies and one ant species were the main insect floral visitors as well as four species of sunbirds. The mean nectar concentration was 23.3% (± 0.39, SE and pollination limitation did not significantly affect fruit yield (weight: p = 0.285; length: p = 0.056; width: p= 0.268. The study showed that butterflies, ants and sunbirds are the main floral visitors on A. comosus. However their visits did not results in pollination and fruit production was not affected in any way by floral visitation. Still, it was found that A. comosus provides an important nectar resource for its foragers. Even if pollination is not crucial in pineapple cultivation, it is still essential in pineapple breeding programs to promote genetic diversity and conservation.

The genome sequence of the wild tomato Solanum pimpinellifolium provides insights into salinity tolerance

KAUST Repository

Razali, Rozaimi; Bougouffa, Salim; Morton, Mitchell J. L.; Lightfoot, Damien; Alam, Intikhab; Essack, Magbubah; Arold, Stefan T.; Kamau, Allan; Schmö ckel, Sandra M.; Pailles, Yveline; Shahid, Mohammed; Michell, Craig; Al-Babili, Salim; Ho, Yung Shwen; Tester, Mark A.; Bajic, Vladimir B.; Negrã o, Só nia

2017-01-01

Solanum pimpinellifolium, a wild relative of cultivated tomato, offers a wealth of breeding potential for several desirable traits such as tolerance to abiotic and biotic stresses. Here, we report the genome and annotation of S. pimpinellifolium LA0480. The LA0480 genome size (811 Mb) and the number of annotated genes (25,970) are within the range observed for other sequenced tomato species. We developed and utilized the Dragon Eukaryotic Analyses Platform (DEAP) to functionally annotate the LA0480 protein-coding genes. Additionally, we used DEAP to compare protein function between S. pimpinellifolium and cultivated tomato. Our data suggest enrichment in genes involved in biotic and abiotic stress responses. Moreover, we present phenotypic data from one field experiment that demonstrate a greater salinity tolerance for fruit- and yield-related traits in S. pimpinellifolium compared with cultivated tomato. To understand the genomic basis for these differences in S. pimpinellifolium and S. lycopersicum, we analyzed 15 genes that have previously been shown to mediate salinity tolerance in plants. We show that S. pimpinellifolium has a higher copy number of the inositol-3-phosphate synthase and phosphatase genes, which are both key enzymes in the production of inositol and its derivatives. Moreover, our analysis indicates that changes occurring in the inositol phosphate pathway may contribute to the observed higher salinity tolerance in LA0480. Altogether, our work provides essential resources to understand and unlock the genetic and breeding potential of S. pimpinellifolium, and to discover the genomic basis underlying its environmental robustness.

The genome sequence of the wild tomato Solanum pimpinellifolium provides insights into salinity tolerance

KAUST Repository

Razali, Rozaimi

2017-11-14

Solanum pimpinellifolium, a wild relative of cultivated tomato, offers a wealth of breeding potential for several desirable traits such as tolerance to abiotic and biotic stresses. Here, we report the genome and annotation of S. pimpinellifolium LA0480. The LA0480 genome size (811 Mb) and the number of annotated genes (25,970) are within the range observed for other sequenced tomato species. We developed and utilized the Dragon Eukaryotic Analyses Platform (DEAP) to functionally annotate the LA0480 protein-coding genes. Additionally, we used DEAP to compare protein function between S. pimpinellifolium and cultivated tomato. Our data suggest enrichment in genes involved in biotic and abiotic stress responses. Moreover, we present phenotypic data from one field experiment that demonstrate a greater salinity tolerance for fruit- and yield-related traits in S. pimpinellifolium compared with cultivated tomato. To understand the genomic basis for these differences in S. pimpinellifolium and S. lycopersicum, we analyzed 15 genes that have previously been shown to mediate salinity tolerance in plants. We show that S. pimpinellifolium has a higher copy number of the inositol-3-phosphate synthase and phosphatase genes, which are both key enzymes in the production of inositol and its derivatives. Moreover, our analysis indicates that changes occurring in the inositol phosphate pathway may contribute to the observed higher salinity tolerance in LA0480. Altogether, our work provides essential resources to understand and unlock the genetic and breeding potential of S. pimpinellifolium, and to discover the genomic basis underlying its environmental robustness.

Estudio de la resistencia a Bemisia tabaci (Gennadius (Hemiptera: Aleyrodidae en germoplasma cultivado y silvestre de tomate (Solanum lycopersicum L.

Directory of Open Access Journals (Sweden)

Yeimy García Valencia

2013-12-01

Full Text Available En la Universidad Nacional de Colombia sede Palmira, en condiciones de campo y casa de malla, se evaluaron por preferencia para oviposición y número de ninfas de mosca blanca (Bemisia tabaci (Gennadius varias accesiones silvestres y poblaciones segregantes de tomate resistentes al pasador del fruto, Neoleucinodes elegantalis (Guenée. Se utilizó un diseño de bloques completos al azar con cuatro repeticiones, donde se evaluaron como variables el número de huevos y de ninfas del insecto por hoja. En cada observación se incluyeron tres hojas del tercio superior, medio e inferior del tallo de la planta. Las poblaciones de mosca blanca fueron muy bajas en los dos primeros ciclos de cultivo (en campo debido, probablemente, a las altas precipitaciones. Estas condiciones no permitieron una selección de materiales resistentes o susceptibles a este insecto. En el tercer ciclo de cultivo, bajo condiciones de casa de malla, no se encontraron diferencias significativas entre los retrocruzamientos respecto al testigo susceptible para la variable preferencia por oviposición. El genotipo 4212P4 presentó el menor número de ninfas, mostrando que tiene posiblemente un mecanismo que le confiere menor atracción para B. tabaci. Se encontró que los genotipos menos preferidos para oviposición y con menor número de ninfas fueron PI 134417, PI 134418 y PI 126449 (Solanum habrochaites var. Glabratum S. Knapp y D. M Spooneer.

Disruption of a belowground mutualism alters interactions between plants and their floral visitors.

Science.gov (United States)

Cahill, James F; Elle, Elizabeth; Smith, Glen R; Shore, Bryon H

2008-07-01

Plants engage in diverse and intimate interactions with unrelated taxa. For example, aboveground floral visitors provide pollination services, while belowground arbuscular mycorrhizal fungi (AMF) enhance nutrient capture. Traditionally in ecology, these processes were studied in isolation, reinforcing the prevailing assumption that these above- and belowground processes were also functionally distinct. More recently, there has been a growing realization that the soil surface is not a barrier to many ecological interactions, particularly those involving plants (who live simultaneously above and below ground). Because of the potentially large impact that mycorrhizae and floral visitors can have on plant performance and community dynamics, we designed an experiment to test whether these multi-species mutualisms were interdependent under field conditions. Using benomyl, a widely used fungicide, we suppressed AMF in a native grassland, measuring plant, fungal, and floral-visitor responses after three years of fungal suppression. AMF suppression caused a shift in the community of floral visitors from large-bodied bees to small-bodied bees and flies, and reduced the total number of floral visits per flowering stem 67% across the 23 flowering species found in the plots. Fungal suppression has species-specific effects on floral visits for the six most common flowering plants in this experiment. Exploratory analyses suggest these results were due to changes in floral-visitor behavior due to altered patch-level floral display, rather than through direct effects of AMF suppression on floral morphology. Our findings indicate that AMF are an important, and overlooked, driver of floral-visitor community structure with the potential to affect pollination services. These results support the growing body of research indicating that interactions among ecological interactions can be of meaningful effect size under natural field conditions and may influence individual performance

Steroidal glycoalkaloids in Solanum species : consequences for potato breeding and food safety

NARCIS (Netherlands)

Gelder, van W.M.J.

1989-01-01

Tuberiferous and nontuberiferous wild Solanum species are increasingly being used in potato breeding as a source of genes for disease and pest resistances and for other valuable characteristics. A disadvantage of Solanum species, from a consumers point

Floral scent and pollinators of the holoparasite Pilostyles thurberi (Apodanthaceae

Directory of Open Access Journals (Sweden)

Sedonia D Sipes

2014-02-01

Full Text Available Floral scent is likely important to the pollination of parasitic plants, despite that it has not been well-studied. We studied the pollination ecology of the North American stem holoparasite Pilostyles thurberi (Apodanthaceae at two field sites in Texas. To identify effective pollinators, we collected floral visitors to P. thurberi flowers, observed their foraging behavior, and looked for P. thurberi pollen on their bodies. Augochloropsis metallica bees (Halictidae and eumenine potter wasps (Vespidae were pollinators. P. thurberi flowers are visually inconspicuous but produce a strong fruity fragrance. GC/MS analysis of whole floral extracts and dynamic headspace samples revealed the fragrance to be an unusually simple bouquet of raspberry ketone and several eugenols. Comparison of scent profiles to those from uninfected host plants (Dalea formosa allowed putative separation of parasite and host volatiles. This is the first report of the constituents of floral fragrance in Apodanthaceae.

UFO in the Arabidopsis inflorescence apex is required for floral-meristem identity and bract suppression.

Science.gov (United States)

Hepworth, Shelley R; Klenz, Jennifer E; Haughn, George W

2006-03-01

The UNUSUAL FLORAL ORGANS (UFO) gene of Arabidopsis encodes an F-box protein required for the determination of floral-organ and floral-meristem identity. Mutation of UFO leads to dramatic changes in floral-organ type which are well-characterized whereas inflorescence defects are more subtle and less understood. These defects include an increase in the number of secondary inflorescences, nodes that alternate between forming flowers and secondary inflorescences, and nodes in which a single flower is subtended by a bract. Here, we show how inflorescence defects correlate with the abnormal development of floral primordia and establish a temporal requirement for UFO in this process. At the inflorescence apex of ufo mutants, newly formed primordia are initially bract-like. Expression of the floral-meristem identity genes LFY and AP1 are confined to a relatively small adaxial region of these primordia with expression of the bract-identity marker FIL observed in cells that comprise the balance of the primordia. Proliferation of cells in the adaxial region of these early primordia is delayed by several nodes such that primordia appear "chimeric" at several nodes, having visible floral and bract components. However, by late stage 2 of floral development, growth of the bract generally ceases and is overtaken by development of the floral primordium. This abnormal pattern of floral meristem development is not rescued by expression of UFO from the AP1 promoter, indicating that UFO is required prior to AP1 activation for normal development of floral primordia. We propose that UFO and LFY are jointly required in the inflorescence meristem to both promote floral meristem development and inhibit, in a non-cell autonomous manner, growth of the bract.

Floral biology of Stachytarpheta maximiliani Scham. (Verbenaceae and its floral visitors Biologia floral de Stachytarpheta maximiliani Scham. (Verbenaceae e seus visitantes florais

Directory of Open Access Journals (Sweden)

Ivana de Freitas Barbola

2006-12-01

Full Text Available This study describes the reproductive system of Stachytarpheta maximiliani (Verbenaceae, including its floral biology, nectar and pollen availability and insect foraging patterns, identifying whose species act as pollinators. It was carried out in a Brazilian Atlantic rain forest site. Observations on the pollination biology of the Verbenaceae S. maximiliani indicate that their flowering period extends from September through May. Anthesis occurs from 5:30 a.m. to 5:00 p.m. and nectar and pollen are available during all the anthesis. Many species of beetles, hemipterans, flies, wasps, bees and butterflies visit their flowers, but bees and butterflies are the most frequent visitors. The flowers are generally small, gathered in dense showy inflorescences. A complex of floral characteristcs, such as violet-blue color of flowers, long floral tubes, without scents, nectar not exposed, high concentration of sugar in nectar (about 32%, allowed identification of floral syndromes (melittophily and psicophily and function for each visitor. The bees, Bombus morio, B. atratus, Trigonopedia ferruginea, Xylocopa brasilianorum and Apis mellifera and the butterflies Corticea mendica mendica, Corticea sp., Vehilius clavicula, Urbanus simplicius, U. teleus and Heraclides thoas brasiliensis, are the most important pollinators.Este estudo descreve alguns aspectos do sistema reprodutivo de Stachytarpheta maximiliani (Verbenaceae, incluindo características da flor, disponibilidade de néctar e pólen e o padrão de forrageio dos insetos visitantes florais, em uma área de Floresta Atlântica, no sul do Brasil. Observações sobre sua biologia floral indicam que esta espécie tem um período de floração que se estende de setembro a maio, antese diurna (das 5:30h às 17:00h e oferta de néctar e pólen praticamente durante todo o período de antese. Suas flores são visitadas por diferentes espécies de coleópteros, dípteros, hemípteros, himenópteros e lepid

Ontogeny of floral organs in flax (Linum usitatissimum; Linaceae).

Science.gov (United States)

Schewe, Lauren C; Sawhney, Vipen K; Davis, Arthur R

2011-07-01

Flax (Linum usitatissimum) is an important crop worldwide; however, a detailed study on flower development of this species is lacking. Here we describe the pattern of initiation and a program of key developmental events in flax flower ontogeny. This study provides important fundamental information for future research in various aspects of flax biology and biotechnology. Floral buds and organs were measured throughout development and examined using scanning electron microscopy. Floral organs were initiated in the following sequence: sepals, stamens and petals, gynoecium, and nectaries. The five sepals originated in a helical pattern, followed evidently by simultaneous initiation of five stamens and five petals, the former opposite of the sepals and the latter alternate to them. The gynoecium, with five carpels, was produced from the remaining, central region of the floral apex. Stamens at early stages were dominated by anther growth but filaments elongated rapidly shortly before anthesis. Early gynoecium development occurred predominantly in the ovary, and ovule initiation began prior to enclosure of carpels. A characteristic feature was the twisted growth of styles, accompanied by the differentiation of papillate stigmas. Petal growth lagged behind that of other floral organs, but petals eventually grew rapidly to enclose the inner whorls after style elongation. Flask-shaped nectaries bearing stomata developed on the external surface of the filament bases. This is the first detailed study on flax floral organ development and has established a key of 12 developmental stages, which should be useful to flax researchers.

Is floral structure a reliable indicator of breeding system in the Brassicaceae?

Directory of Open Access Journals (Sweden)

Phillip A Salisbury

Full Text Available This study investigated the usefulness of floral characters as a potential indicator of breeding system in the Brassicaceae. Initially, pod set, seed set and pollen tube growth experiments were carried out to confirm the breeding systems of 53 lines representing 25 different cultivated and weedy species from the Brassicaceae. The results of the pod set tests clearly differentiated between self-compatible and self-incompatible species. Floral characters were then evaluated on one or more lines of each of the 25 species. Fourteen floral characters were evaluated including, flower diameter, Cruden's outcrossing index, timing and direction of dehiscence and pollen-ovule ratio. Significant differences between species were evident in all of the floral characteristics evaluated. Flower diameter was generally larger in self-incompatible species than self-compatible species and pollen/ovule ratio was generally higher in self-incompatible species than self-compatible species. However, none of the floral characteristics was able to clearly differentiate the self-compatible and self-incompatible species and allow prediction of the breeding system with absolute confidence. The floral characteristic which was most effective at differentiating the two groups was anther direction at dehiscence.

Low levels of strigolactones in roots as a component of the systemic signal of drought stress in tomato

Czech Academy of Sciences Publication Activity Database

Visentin, I.; Vitali, M.; Ferrero, M.; Zhang, Y.; Ruyter-Spira, C.; Novák, Ondřej; Strnad, Miroslav; Lovisolo, C.; Schubert, A.; Cardinale, F.

2016-01-01

Roč. 212, č. 4 (2016), s. 954-963 ISSN 0028-646X R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : abscisic-acid * plant-responses * lotus-japonicus * biosynthesis * arabidopsis * pea * hormone * growth * xylem * soil * abscisic acid (ABA) * drought * strigolactones (SL) * systemic signalling * tomato (Solanum lycopersicum) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.330, year: 2016

Engineered drought tolerance in tomato plants is reflected in chlorophyll fluorescence emission

Czech Academy of Sciences Publication Activity Database

Mishra, Kumud; Iannacone, R.; Petrozza, A.; Mishra, Anamika; Armentano, N.; La Vecchia, G.; Trtílek, M.; Cellini, F.; Nedbal, Ladislav

2012-01-01

Roč. 182, SI (2012), s. 79-86 ISSN 0168-9452 R&D Projects: GA MŠk OC08055; GA MŠk 2B06068; GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : Chlorophyll fluorescence * Drought * High-throughput screening * Solanum lycopersicum * Transcription factor * Transgenic plant Subject RIV: EH - Ecology, Behaviour Impact factor : 2.922, year: 2012

Floral associations of cyclocephaline scarab beetles.

Science.gov (United States)

Moore, Matthew Robert; Jameson, Mary Liz

2013-01-01

The scarab beetle tribe Cyclocephalini (Coleoptera: Scarabaeidae: Dynastinae) is the second largest tribe of rhinoceros beetles, with nearly 500 described species. This diverse group is most closely associated with early diverging angiosperm groups (the family Nymphaeaceae, magnoliid clade, and monocots), where they feed, mate, and receive the benefit of thermal rewards from the host plant. Cyclocephaline floral association data have never been synthesized, and a comprehensive review of this ecological interaction was necessary to promote research by updating nomenclature, identifying inconsistencies in the data, and reporting previously unpublished data. Based on the most specific data, at least 97 cyclocephaline beetle species have been reported from the flowers of 58 plant genera representing 17 families and 15 orders. Thirteen new cyclocephaline floral associations are reported herein. Six cyclocephaline and 25 plant synonyms were reported in the literature and on beetle voucher specimen labels, and these were updated to reflect current nomenclature. The valid names of three unavailable plant host names were identified. We review the cyclocephaline floral associations with respect to inferred relationships of angiosperm orders. Ten genera of cyclocephaline beetles have been recorded from flowers of early diverging angiosperm groups. In contrast, only one genus, Cyclocephala, has been recorded from dicot flowers. Cyclocephaline visitation of dicot flowers is limited to the New World, and it is unknown whether this is evolutionary meaningful or the result of sampling bias and incomplete data. The most important areas for future research include: (1) elucidating the factors that attract cyclocephalines to flowers including floral scent chemistry and thermogenesis, (2) determining whether cyclocephaline dicot visitation is truly limited to the New World, and (3) inferring evolutionary relationships within the Cyclocephalini to rigorously test vicarance hypotheses

Chemical constituents of Solanum buddleifolium Sendtn

International Nuclear Information System (INIS)

Pinto, Francisco das Chagas L.; Torres, Maria da conceicao M.; Silveira, Edilberto R.; Pessoa, Otilia Deusdenia L.; Braz-Filho, Raimundo; Guedes, Maria Lenise da Silva

2013-01-01

The chemical investigation of the stem EtOH extract of S. buddleifolium resulted in the isolation of terpenoids, amides, lignans and a steroidal alkaloid. Based on HRMS, IR and 1 H and 13 C NMR data analysis, the structures of the isolated compounds were identified as: 13-hydroxysolavetivone, betulinic acid, N-trans-caffeoyltyramine, N-trans-feruloyldopamine, N-trans-p-cumaroyltyramine, N-trans-feruloyltyramine, N-trans-feruloyl- 3’-O-methoxydopamine, alangilignoside C, isolariciresinol, polistachiol, (+)-(8R,7’S,8’S)-3α-O-(β-D-glucopiranosyl)-lioniresinol, (-)-(8S,7’R,8’R)-3α-O-(β-D-glucopiranosyl)-lioniresinol and solamargine. The occurrence of terpenoids and amides is common in Solanum, unlike lignans which are rare. The isolated lignans described in this work are reported for the first time in the genus Solanum. (author)

Potato (Solanum tuberosum L.).

Science.gov (United States)

Chetty, Venkateswari J; Narváez-Vásquez, Javier; Orozco-Cárdenas, Martha L

2015-01-01

Agrobacterium-mediated transformation is the most common method for the incorporation of foreign genes into the genome of potato as well as many other species in the Solanaceae family. This chapter describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp. tuberosum (Desiréé), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena using internodal segments as explants.

Molecular marker screening of tomato, (solanum lycopersicum L ...

African Journals Online (AJOL)

user

2011-02-28

Suscept. check). TGRC, V. Williamson and young seedlings can be screened very early for the presence or absence of a particular trait (Luc et al., 1999;. Hussey and Janssen, 2002). Standard bioassays used for the screening of ...

Metabolite modifications in Solanum lycopersicum roots and leaves ...

African Journals Online (AJOL)

During the treatment, Cd accumulated significantly in the roots compared to stems and leaves. Plant growth (root, stem and leaf) decreased when Cd concentration increased. The analysis of 1H-NMR spectra of polar extracts showed clear differences between metabolites amounts (soluble sugars, organic and amino acids) ...

Sequence analysis of PROTEOLYSIS 6 from Solanum lycopersicum

Science.gov (United States)

Roslan, Nur Farhana; Chew, Bee Lyn; Goh, Hoe-Han; Isa, Nurulhikma Md

2018-04-01

The N-end rule pathway is a protein degradation pathway that relates the protein half-life with the identity of its N-terminal residues. A destabilizing N-terminal residues is created by enzymatic reaction or chemical modifications. This destabilized substrate will be recognized by PROTEOLYSIS 6 (PRT6) protein, which encodes an E3 ligase enzyme and resulted in substrate degradation by proteasome. PRT6 has been studied in Arabidopsis thaliana and barley but not yet been studied in fleshy fruit plants. Hence, this study was carried out in tomato that is known as the model for fleshy fruit plants. BLASTX analysis identified that Solyc09g010830 which encodes for a PRT6 gene in tomato based on its sequence similarity with PRT6 in A. thaliana. In silico gene expression analysis shows that PRT6 gene was highly expressed in tomato fruits breaker +5. Co-expression analysis shows that PRT6 may not only involved in abiotic stresses but also in biotic stresses. The objective is to analyze the sequence and characterize PRT6 gene in tomato.

Molecular marker screening of tomato, ( solanum lycopersicum L ...

African Journals Online (AJOL)

Tomato is one of the crops in which genetic resistance has specially been effective against root-knot nematodes. In this study, molecular screening was done on some tomato germplasm to detect markers for the gene that confers resistance (Mi) with specific primer (Mi23/F//Mi23/R). The cultivars; VFNT, FLA 505-BL 1172, ...

Steroidal glycoalkaloids and molluscicidal activity of Solanum asperum Rich. fruits

OpenAIRE

Silva, Tania M. S.; Camara, Celso A.; Freire, Kristerson R. L.; Silva, Thiago G. da; Agra, Maria de F.; Bhattacharyya, Jnanabrata

2008-01-01

Bioassay-guided fractionation of the alkaloidal extract of the green fruits of Solanum asperum afforded a new compound, solanandaine along with solasonine and solamargine. The total crude alkaloids as well as the isolated pure alkaloids exhibited significant molluscicidal activity. O fracionamento bio-monitorado do extrato alcaloídico dos frutos verdes de Solanum asperum forneceu um novo alcalóide esteroidal, denominado solanandaina, juntamente com a solasonina e a solamargina. Tanto o ext...

Floral anatomy of Delphinieae (Ranunculaceae: comparing flower organization and vascular patterns

Directory of Open Access Journals (Sweden)

Andrew V. Novikoff

2014-04-01

Full Text Available Species of the tribe Delphinieae have dorsoventralized flowers; their pentamerous calyx and reduced corolla are dorsally spurred and inner spurs are nectariferous. Based on this common floral scheme, Delphinieae species exhibit a wide diversity of floral structures and morphologies. We present here the first investigation of the floral anatomy in Delphinieae. The organization of the floral vascular system has been studied in species representative of the floral morphological diversity of Delphinieae: Aconitum lasiocarpum, Delphinium elatum, and Consolida regalis. The three species show a similar vascularization of the calyx and of the reproductive organs, but exhibit distinct anatomical features in the corolla where the nectaries are borne. The sepals and the stamens have a trilacunar three-traced and a unilacunar one-traced vascularization, respectively. Three free carpels in D. elatum and A. lasiocarpum are basically supplied by six vascular bundles – three independent dorsal bundles and three fused lateral bundles. In C. regalis the single carpel is supplied by three independent vascular bundles (one dorsal and two ventral. Staminodes are not vascularized. The basic type of petal vascularization is unilacunar one-traced, but in the case of C. regalis the derived bilacunar two-traced type has been observed. This latter state arose as a result of the fusion of the two dorsal petal primordia. The results of this first comparative study of the floral anatomy of Delphinieae are discussed with the recent phylogenetic, morphological, and evo-devo findings concerning the tribe.

Floral humidity as a reliable sensory cue for profitability assessment by nectar-foraging hawkmoths.

Science.gov (United States)

von Arx, Martin; Goyret, Joaquín; Davidowitz, Goggy; Raguso, Robert A

2012-06-12

Most research on plant-pollinator communication has focused on sensory and behavioral responses to relatively static cues. Floral rewards such as nectar, however, are dynamic, and foraging animals will increase their energetic profit if they can make use of floral cues that more accurately indicate nectar availability. Here we document such a cue--transient humidity gradients--using the night blooming flowers of Oenothera cespitosa (Onagraceae). The headspace of newly opened flowers reaches levels of about 4% above ambient relative humidity due to additive evapotranspirational water loss through petals and water-saturated air from the nectar tube. Floral humidity plumes differ from ambient levels only during the first 30 min after anthesis (before nectar is depleted in wild populations), whereas other floral traits (scent, shape, and color) persist for 12-24 h. Manipulative experiments indicated that floral humidity gradients are mechanistically linked to nectar volume and therefore contain information about energy rewards to floral visitors. Behavioral assays with Hyles lineata (Sphingidae) and artificial flowers with appropriate humidity gradients suggest that these hawkmoth pollinators distinguish between subtle differences in relative humidity when other floral cues are held constant. Moths consistently approached and probed flowers with elevated humidity over those with ambient humidity levels. Because floral humidity gradients are largely produced by the evaporation of nectar itself, they represent condition-informative cues that facilitate remote sensing of floral profitability by discriminating foragers. In a xeric environment, this level of honest communication should be adaptive when plant reproductive success is pollinator limited, due to intense competition for the attention of a specialized pollinator.

Floral humidity as a reliable sensory cue for profitability assessment by nectar-foraging hawkmoths

Science.gov (United States)

von Arx, Martin; Goyret, Joaquín; Davidowitz, Goggy; Raguso, Robert A.

2012-01-01

Most research on plant–pollinator communication has focused on sensory and behavioral responses to relatively static cues. Floral rewards such as nectar, however, are dynamic, and foraging animals will increase their energetic profit if they can make use of floral cues that more accurately indicate nectar availability. Here we document such a cue—transient humidity gradients—using the night blooming flowers of Oenothera cespitosa (Onagraceae). The headspace of newly opened flowers reaches levels of about 4% above ambient relative humidity due to additive evapotranspirational water loss through petals and water-saturated air from the nectar tube. Floral humidity plumes differ from ambient levels only during the first 30 min after anthesis (before nectar is depleted in wild populations), whereas other floral traits (scent, shape, and color) persist for 12–24 h. Manipulative experiments indicated that floral humidity gradients are mechanistically linked to nectar volume and therefore contain information about energy rewards to floral visitors. Behavioral assays with Hyles lineata (Sphingidae) and artificial flowers with appropriate humidity gradients suggest that these hawkmoth pollinators distinguish between subtle differences in relative humidity when other floral cues are held constant. Moths consistently approached and probed flowers with elevated humidity over those with ambient humidity levels. Because floral humidity gradients are largely produced by the evaporation of nectar itself, they represent condition-informative cues that facilitate remote sensing of floral profitability by discriminating foragers. In a xeric environment, this level of honest communication should be adaptive when plant reproductive success is pollinator limited, due to intense competition for the attention of a specialized pollinator. PMID:22645365

Reproduction and survival of a solitary bee along native and exotic floral resource gradients.

Science.gov (United States)

Palladini, Jennifer D; Maron, John L

2014-11-01

Native bee abundance has long been assumed to be limited by floral resources. This paradigm has been established in large measure because more bees are often found in areas supporting greater floral abundance. This could result from attraction to resource-rich sites as well as greater local demographic performance in sites supporting high floral abundance; however, demographic performance is usually unknown. Factors other than floral resources such as availability of nest sites, pressure from natural enemies, or whether floral resources are from a mixed native or mostly monodominant exotic assemblage might influence survival or fecundity and hence abundance. We examined how the survival and fecundity of the native solitary bee Osmia lignaria varied along a gradient in floral resource abundance. We released bees alongside a nest block at 27 grassland sites in Montana (USA) that varied in floral abundance and the extent of invasion by exotic forbs. We monitored nest construction and the fate of offspring within each nest. The number of nests established was positively related to native forb abundance and was negatively related to exotic forb species richness. Fecundity was positively related to native forb species richness; however, offspring mortality caused by the brood parasite Tricrania stansburyi was significantly greater in native-dominated sites. These results suggest that native floral resources can positively influence bee populations, but that the relationship between native floral resources and bee population performance is not straightforward. Rather, bees may face a trade-off between high offspring production and low offspring survival in native-dominated sites.

Biologia floral de Virola surinamensis (Rol. Warb. (Myristicaceae Virola surinamensis (Rol. Warb. (Myristicaceae floral biology

Directory of Open Access Journals (Sweden)

Mario Augusto Gonçalves Jardim

2007-12-01

Full Text Available Neste artigo são apresentadas informações sobre a biologia floral de Virola surinamensis (Rol. Warb. (Myristicaceae, espécie florestal dióica de relevante importância econômica na região amazônica. O estudo foi realizado em uma área de várzea próximo à bacia do igarapé Murutucum, lado direito do rio Guamá, localizada no Campus da Faculdade de Ciências Agrárias do Pará, na cidade de Belém, Estado do Pará, no período de janeiro a dezembro de 2001. Avaliou-se a biologia floral desde o aparecimento dos botões florais até a senescência das flores estaminadas, bem como a formação de frutos nas flores pistiladas. Testes bioquímicos foram aplicados para verificação de odor, pigmentos, osmóforos e receptividade do estigma. A observação no comportamento dos visitantes florais foi realizada durante o período diurno, registrando-se os horários de visitas, tempo de permanência na flor e freqüência; alguns indivíduos foram coletados com rede entomológica e identificados no Departamento de Zoologia do Museu Paraense Emílio Goeldi. A antese ocorreu entre 6 e 16 h nas flores estaminadas e entre 8 e 16 h nas flores pistiladas; a presença de odor foi constatada apenas nas flores estaminadas, enquanto os pigmentos e osmóforos foram encontrados em ambas as flores; o estigma mostrou-se receptivo no período entre 12 e 14 h. Os insetos da ordem diptera foram os visitantes mais freqüentes nas flores estaminadas e pistiladas e as espécies Copestylum sp. e Erystalys sp., as responsáveis pela polinização.Information was obtained on the floral biology of Virola surinamensis (Rol. Warb. (Myristicaceae, a dioecious arboreal species of great importance for the Amazon region economy. The study was carried out in the floodplain area near the Murucutu stream, on the right side of the Guamá River, at the Universidade Federal Rural da Amazônia-UFRA, Belém-Pará , from January to December 2001. Floral biology was assessed from

Mechanism and control of Solanum lycocarpum

NARCIS (Netherlands)

Pinto, L.V.A.; Silva, Da E.A.A.; Davide, A.C.; Mendes de Jesus, V.A.; Toorop, P.E.; Hilhorst, H.W.M.

2007-01-01

Background Solanaceae seed morphology and physiology have been widely studied but mainly in domesticated crops. The present study aimed to compare the seed morphology and the physiology of germination of Solanum lycocarpum, an important species native to the Brazilian Cerrado, with two species with

Dependency on floral resources determines the animals' responses to floral scents

OpenAIRE

Junker, Robert R; Blüthgen, Nico

2010-01-01

Animal-pollinated angiosperms either depend on cross-pollination or may also reproduce after self-pollination—the former are thus obligately, the latter facultatively dependent on the service of animal-pollinators. Analogously, flower visitors either solely feed on floral resources or complement their diet with these, and are hence dependent or not on the flowers they visit. We assume that obligate flower visitors evolved abilities that enable them to effectively forage on flowers including m...

Floral scents and their interaction with insect pollinators

OpenAIRE

Grajales-Conesa, Julieta; Meléndez-Ramírez, Virginia; Cruz-López, Leopoldo

2011-01-01

Las plantas emplean diversas señales visuales y olfativas con la finalidad de atraer a los polinizadores que en su mayoría son insectos. Algunas plantas han desarrollado mecanismos, basándose en mensajes olfativos que los hacen únicos para sus polinizadores específicos. Estos mecanismos, así como las variaciones intra- e interespecíficas en el perfil de los aromas florales han evolucionado para determinadas especies. Los aromas florales son un conjunto de compuestos volátiles orgánicos y para...

Tomato strigolactones are derived from carotenoids and their biosynthesis is promoted by phosphate starvation

OpenAIRE

López-Ráez, Juan A.; Charnikhova, Tatsiana;; Gómez-Roldán,Victoria;; Matusova, Radoslava;; Kohlen, Wouter;; De Vos, Ric;; Verstappe, Francel;; Puech-Pages, Virginie;; Bécard, Guillaume;; Mulder, Patrick;; Bouwmeester, Harro;

2008-01-01

Strigolactones are rhizosphere signalling compounds that mediate host location in arbuscular mycorrhizal (AM) fungi and parasitic plants. Here, the regulation of the biosynthesis of strigolactones is studied in tomato (Solanum lycopersicum). * Strigolactone production under phosphate starvation, in the presence of the carotenoid biosynthesis inhibitor fluridone and in the abscisic acid (ABA) mutant notabilis were assessed using a germination bioassay with seeds of Orobanche ramosa; a hyphal b...

Self-pollination rate and floral-display size in Asclepias syriaca (Common Milkweed) with regard to floral-visitor taxa.

Science.gov (United States)

Howard, Aaron F; Barrows, Edward M

2014-06-23

Animals fertilize thousands of angiosperm species whose floral-display sizes can significantly influence pollinator behavior and plant reproductive success. Many studies have measured the interactions among pollinator behavior, floral-display size, and plant reproductive success, but few studies have been able to separate the effects of pollinator behavior and post-pollination processes on angiosperm sexual reproduction. In this study, we utilized the highly self-incompatible pollinium-pollination system of Asclepias syriaca (Common Milkweed) to quantify how insect visitors influenced male reproductive success measured as pollen removal, female reproductive success measured as pollen deposition, and self-pollination rate. We also determined how floral-display size impacts both visitor behavior and self-pollination rate. Four insect taxonomic orders visited A. syriaca: Coleoptera, Diptera, Hymenoptera, and Lepidoptera. We focused on three groups of visitor taxa within two orders (Hymenoptera and Lepidoptera) with sample sizes large enough for quantitative analysis: Apis mellifera (Western Honey Bee), Bombus spp. (bumble bees) and lepidopterans (butterflies and moths). Qualitatively, lepidopterans had the highest pollinator importance values, but the large variability in the lepidopteran data precluded meaningful interpretation of much of their behavior. The introduced A. mellifera was the most effective and most important diurnal pollinator with regard to both pollen removal and pollen deposition. However, when considering the self-incompatibility of A. syriaca, A. mellifera was not the most important pollinator because of its high self-pollination rate as compared to Bombus spp. Additionally, the rate of self-pollination increased more rapidly with the number of flowers per inflorescence in A. mellifera than in the native Bombus spp. Apis mellifera's high rate of self-pollination may have significant negative effects on both male and female reproductive successes

Enantiostyly in Chamaecrista ramosa (Fabaceae-Caesalpinioideae): floral morphology, pollen transfer dynamics and breeding system.

Science.gov (United States)

Almeida, N M de; Castro, C C de; Leite, A V de Lima; Novo, R R; Machado, I C

2013-03-01

Enantiostyly is a form of reciprocal herkogamy, in which floral morphs present reciprocal differences in the position of sexual elements, and occurs in monomorphic and dimorphic forms. This polymorphism maximises cross-pollination and reduces self-pollination, being very common within the subtribe Cassiinae (Fabaceae). Nevertheless, few studies have investigated the functionality of enantiostyly, particularly in this plant group. The present study aimed to investigate enantiostyly and its functionality in Chamaecrista ramosa, a monomorphic enantiostylous shrub, in an area of coastal vegetation in northeast Brazil. Pollen deposition and capture on the body of floral visitors, the relationship of these data with floral biology and breeding system, and morph ratio were evaluated. Pollen deposition and capture occurred in specific sites of the floral visitor body, showing the functionality of enantiostyly. The floral architecture, associated with the floral visitor behaviour, resulted in indirect pollen deposition on the floral visitor body. This occurred through a loop made by the pollen upon the inner petal surface, similar that generally reported for other Cassiinae. Chamaecrista ramosa is self-compatible, although no fruit set was observed through spontaneous self-pollination. The occurrence and number of floral morphs was similar within clumps. Enantiostyly seems to be advantageous for this species, as it results in efficient pollen capture and deposition, reduces the chances of autogamy and maximises intermorph pollen flow. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

Floral scent composition predicts bee pollination system in five butterfly bush (Buddleja, Scrophulariaceae) species.

Science.gov (United States)

Gong, W-C; Chen, G; Vereecken, N J; Dunn, B L; Ma, Y-P; Sun, W-B

2015-01-01

Traditionally, plant-pollinator interactions have been interpreted as pollination syndrome. However, the validity of pollination syndrome has been widely doubted in modern studies of pollination ecology. The pollination ecology of five Asian Buddleja species, B. asiatica, B. crispa, B. forrestii, B. macrostachya and B. myriantha, in the Sino-Himalayan region in Asia, flowering in different local seasons, with scented inflorescences were investigated during 2011 and 2012. These five species exhibited diverse floral traits, with narrow and long corolla tubes and concealed nectar. According to their floral morphology, larger bees and Lepidoptera were expected to be the major pollinators. However, field observations showed that only larger bees (honeybee/bumblebee) were the primary pollinators, ranging from 77.95% to 97.90% of total visits. In this study, floral scents of each species were also analysed using coupled gas chromatography and mass spectrometry (GC-MS). Although the five Buddleja species emitted differentiated floral scent compositions, our results showed that floral scents of the five species are dominated by substances that can serve as attractive signals to bees, including species-specific scent compounds and principal compounds with larger relative amounts. This suggests that floral scent compositions are closely associated with the principal pollinator assemblages in these five species. Therefore, we conclude that floral scent compositions rather than floral morphology traits should be used to interpret plant-pollinator interactions in these Asian Buddleja species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

A comparison of the low temperature transcriptomes and CBF regulons of three plant species that differ in freezing tolerance: Solanum commersonii, Solanum tuberosum, and Arabidopsis thaliana

OpenAIRE

Carvallo, Marcela A.; Pino, María-Teresa; Jeknić, Zoran; Zou, Cheng; Doherty, Colleen J.; Shiu, Shin-Han; Chen, Tony H. H.; Thomashow, Michael F.

2011-01-01

Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of ...

Dosage-dependent impacts of a floral volatile compound on pollinators, larcenists, and the potential for floral evolution in the alpine skypilot Polemonium viscosum.

Science.gov (United States)

Galen, Candace; Kaczorowski, Rainee; Todd, Sadie L; Geib, Jennifer; Raguso, Robert A

2011-02-01

All volatile organic compounds (VOCs) vary quantitatively, yet how such variation affects their ecological roles is unknown. Because floral VOCs are cues for both pollinators and floral antagonists, variation in emission may have major consequences for costs and benefits in plant-pollinator interactions. In Polemonium viscosum, the emission rate for the floral VOC 2-phenylethanol (2PE) spans more than two orders of magnitude. We investigated the ecological and evolutionary impacts of this immense phenotypic variation. The emission rate of 2PE varies independently of nectar rewards and thus is uninformative of profitability. Emission is elevated in flowers that are morphologically vulnerable to ant larcenists, suggesting that chemical deterrence may compensate for weak physical barriers. In nature, plants emitting more 2PE than their neighbors escape ant damage. Flower-damaging ants die when exposed to 2PE in the laboratory, and they avoid high 2PE emitters in the field. High 2PE also reduces bumblebee visitation and pollination, suggesting an ecological cost of defense in pollinator service. However, at more moderate emission rates, 2PE enhances the amount of nectar left in flowers, at no pollination cost. In conclusion, repellency of 2PE is highly sensitive to dosage, giving it a key role in shaping ecological interactions between skypilot plants and their floral visitors.

Pengaruh Variasi Penambahan Sari Buah Terung Belanda (Solanum Betaceum) Hasil Sambung Pucuk Dengan Lancing (Solanum Mauritianum) Pada Pembuatan Nata De Coco Dengan Menggunakan Acetobacter Xylinum

OpenAIRE

Lubis, Adilah Wirdhani

2015-01-01

One of the benefit from coconut water is making nata de coco through phosphate pentose pathway by using Acetobacter xylinum bacteria. Making its became nata de coco by variation of Tamarillo (Solanum betaceum) bud grafting yield with Lancing (Solanum mauritianum) produced red colour of nata de coco that it fermented for 14 days and had good nutrient value. The yield of this product was analyzed with qualitative and quantitative analysis. The variation volume of it used 10, 20, 30, 40 and 50 ...

The modular structure of the floral phenotype in Mimulus luteus var. luteus (Phrymaceae Estructura modular del fenotipo floral en Mimulus luteus var. luteus (Phrymaceae

Directory of Open Access Journals (Sweden)

GASTÓN CARVALLO

2005-12-01

Full Text Available Most studies of multivariate evolution on the floral phenotype assume that traits evolve independently one from each other, ignoring the modular structure that results from genetic correlations or developmental constraints. In this paper we describe the interdependence of nine floral traits in the herb Mimulus luteus var. luteus (Phrymaceae, as an attempt to characterize functional modules on which natural selection can potentially act upon. Using edge exclusion deviance analysis, we detected four modules: (a an attractiveness module, (b a stigma behavior module, (c a stigma surface module, and (d a herkogamy module. Consequences of these findings for future studies of natural selection in this species are discussedLa mayor parte de los estudios de evolución multivariada sobre el fenotipo floral suponen que los rasgos evolucionan independientemente unos de otros, ignorando la estructura modular que resulta de correlaciones genéticas o restricciones impuestas por el desarrollo. En este trabajo describimos la interdependencia de nueve rasgos florales en Mimulus luteus var. luteus (Phrymaceae, en un intento por caracterizar los módulos funcionales sobre los cuales la selección natural pudiera eventualmente actuar. Mediante análisis de desviación límite-excluyente detectamos cuatro módulos: (a un módulo de atractividad floral, (b un módulo de comportamiento estigmático, (c un módulo de superficie estigmática, y (d un módulo de hercogamia. Se discuten las consecuencias de estos hallazgos para futuros estudios de selección natural en esta especie

Terrestrial floral change during the ETM2 hyperthermal

Science.gov (United States)

Wing, S. L.; Currano, E. D.

2017-12-01

Hyperthermal events during the Eocene are defined by negative shifts in carbon isotope composition, global temperature increase and carbonate dissolution in marine settings. These features suggest repeated releases of large amounts of carbon followed by increasing concentration of CO2in the atmosphere and ocean, climate change, and biotic responses such as rapid evolution and changes in geographic range and trophic relationships. The Paleocene-Eocene Thermal Maximum (PETM, 56.0 Ma) is the largest Eocene hyperthermal in terms of carbon cycle, climate and biotic effects, including dwarfing of mammalian lineages. Terrestrial floral turnover at the PETM documented in the Bighorn Basin, Wyoming, USA, is very high. Almost all late Paleocene species, most belonging to mesic, warm-temperate lineages, disappeared during the PETM. The PETM flora was composed of species belonging to dry tropical lineages present only during the body of the PETM. Most mesic, warm-temperate species returned to the area immediately after the PETM. Such extreme change in floral composition makes it difficult to assess how much floral turnover is associated with how much change in temperature. The ETM2 hyperthermal event ( 53.7 Ma) is characterized by a carbon isotope excursion and warming about half as great as during the PETM, and by half as much mammalian dwarfing. Here we report on a new fossil flora from ETM2 that demonstrates the magnitude of floral change was also less than during the PETM. Some characteristic PETM plant species reappeared in the Bighorn Basin during ETM2, including species of Fabaceae that dominate PETM assemblages but are less common during ETM2. Many stratigraphically long-ranging plant species that preferred mesic climates remain common in the ETM2 flora. We conclude that warm climate during ETM2 shifted ranges of plant species such that some PETM species returned to northern Wyoming, but was not so severe as to cause local extirpation of species preferring 'background

Genetic variation of inbreeding depression among floral and fitness traits in Silene nutans

DEFF Research Database (Denmark)

Thiele, Jan; Hansen, Thomas Møller; Siegismund, Hans Redlef

2010-01-01

The magnitude and variation of inbreeding depression (ID) within populations is important for the evolution and maintenance of mixed mating systems. We studied ID and its genetic variation in a range of floral and fitness traits in a small and large population of the perennial herb Silene nutans......, using controlled pollinations in a fully factorial North Carolina II design. Floral traits and early fitness traits, that is seed mass and germination rate, were not much affected by inbreeding (delta0.4). Lack of genetic correlations indicated that ID in floral, early and late traits is genetically...... was statistically significant in most floral and all seed traits, but not in late fitness traits. However, some paternal families had delta...

In vitro trypanocidal activity of solamargine and extracts from Solanum palinacanthum and Solanum lycocarpum of brazilian cerrado

Directory of Open Access Journals (Sweden)

RAQUEL R.D. MOREIRA

2013-09-01

Full Text Available The present investigation was to evaluate the potential trypanocidal activity of crude ethanolic extract of the fruits of Solanum palinacanthum, Solanum lycocarpum and the glycoalcaloid, solamargine. S. palinacanthum and S. lycocarpum fruit powders were submitted to exhaustively extraction with 96% ethanol and solamargine were isolated from the extract of S. palinacanthum. Both extracts and solamargine were analysed for trypanocidal activity by using MTT colorimetric assay. Extracts of S. palinacanthum showed to be more active (IC50 = 175.9 µg.ml–1 than S. lycocarpum (IC50 = 194.7 µg.ml–1. Solamargine presented a strong activity (IC50 = 15.3 µg.ml–1, which can explain the better activity of the both extracts. Benznidazol (IC50 = 9.0 µg.ml–1 is the only drug used to treat Chagas' disease. These findings demonstrate for the first time that ethanol extracts obtained from both fruits of S. palinacanthum and S. lycocarpum and also solamargine have a potential anti-trypanosomal activity.

Desarrollo y maduraci??n de la microspora de tomate (Lycopersicum esculentum M.)

OpenAIRE

Carretero G??mez, Bego??a

1993-01-01

Esta memoria presenta los resultados del estudio evolutivo del grano de polen de tomate (Lycopersicum esculentum, M.), desde la microspora reci??n formada hasta la consecuci??n del gametofito masculino o grano de polen propiamente dicho, constituido por las c??lulas generativa y vegetativa. Se contemplan las transformaciones metab??licas que experimenta el citoplasma durante la maduraci??n del grano as?? como el posible papel de microcuerpos o glioxisomas en los estadios de m??...

Herbivory as an important selective force in the evolution of floral traits and pollinator shifts

Science.gov (United States)

Overson, Rick P.; Raguso, Robert A.; Skogen, Krissa A.

2017-01-01

Abstract Floral trait evolution is frequently attributed to pollinator-mediated selection but herbivores can play a key role in shaping plant reproductive biology. Here we examine the role of florivores in driving floral trait evolution and pollinator shifts in a recently radiated clade of flowering plants, Oenothera sect. Calylophus. We compare florivory by a specialist, internal feeder, Mompha, on closely related hawkmoth- and bee-pollinated species and document variation in damage based on floral traits within sites, species and among species. Our results show that flowers with longer floral tubes and decreased floral flare have increased Mompha damage. Bee-pollinated flowers, which have substantially smaller floral tubes, experience on average 13% less Mompha florivory than do hawkmoth-pollinated flowers. The positive association between tube length and Mompha damage is evident even within sites of some species, suggesting that Mompha can drive trait differentiation at microevolutionary scales. Given that there are at least two independent shifts from hawkmoth to bee pollination in this clade, florivore-mediated selection on floral traits may have played an important role in facilitating morphological changes associated with transitions from hawkmoth to bee pollination. PMID:28011456

POWERDRESS and diversified expression of the MIR172 gene family bolster the floral stem cell network.

Directory of Open Access Journals (Sweden)

Rae Eden Yumul

Full Text Available Termination of the stem cells in the floral meristem (also known as floral determinacy is critical for the reproductive success of plants, and the molecular activities regulating floral determinacy are precisely orchestrated during the course of floral development. In Arabidopsis thaliana, regulators of floral determinacy include several transcription factor genes, such as APETALA2 (AP2, AGAMOUS (AG, SUPERMAN (SUP, and CRABSCLAW (CRC, as well as a microRNA (miRNA, miR172, which targets AP2. How the transcription factor and miRNA genes are coordinately regulated to achieve floral determinacy is unknown. A mutation in POWERDRESS (PWR, a previously uncharacterized gene encoding a SANT-domain-containing protein, was isolated in this study as an enhancer of the weakly indeterminate ag-10 allele. PWR was found to promote the transcription of CRC, MIR172a, b, and c and/or enhance Pol II occupancy at their promoters, without affecting MIR172d or e. A mutation in mature miR172d was additionally found to enhance the determinacy defects of ag-10 in an AP2-dependent manner, providing direct evidence that miR172d is functional in repressing AP2 and thereby contributes to floral determinacy. Thus, while PWR promotes floral determinacy by enhancing the expression of three of the five MIR172 members as well as CRC, MIR172d, whose expression is PWR-independent, also functions in floral stem cell termination. Taken together, these findings demonstrate how transcriptional diversification and functional redundancy of a miRNA family along with PWR-mediated co-regulation of miRNA and transcription factor genes contribute to the robustness of the floral determinacy network.

Lessons from Red Data Books: Plant Vulnerability Increases with Floral Complexity.

Science.gov (United States)

Stefanaki, Anastasia; Kantsa, Aphrodite; Tscheulin, Thomas; Charitonidou, Martha; Petanidou, Theodora

2015-01-01

The architectural complexity of flower structures (hereafter referred to as floral complexity) may be linked to pollination by specialized pollinators that can increase the probability of successful seed set. As plant-pollinator systems become fragile, a loss of such specialized pollinators could presumably result in an increased likelihood of pollination failure. This is an issue likely to be particularly evident in plants that are currently rare. Using a novel index describing floral complexity we explored whether this aspect of the structure of flowers could be used to predict vulnerability of plant species to extinction. To do this we defined plant vulnerability using the Red Data Book of Rare and Threatened Plants of Greece, a Mediterranean biodiversity hotspot. We also tested whether other intrinsic (e.g. life form, asexual reproduction) or extrinsic (e.g. habitat, altitude, range-restrictedness) factors could affect plant vulnerability. We found that plants with high floral complexity scores were significantly more likely to be vulnerable to extinction. Among all the floral complexity components only floral symmetry was found to have a significant effect, with radial-flower plants appearing to be less vulnerable. Life form was also a predictor of vulnerability, with woody perennial plants having significantly lower risk of extinction. Among the extrinsic factors, both habitat and maximum range were significantly associated with plant vulnerability (coastal plants and narrow-ranged plants are more likely to face higher risk). Although extrinsic and in particular anthropogenic factors determine plant extinction risk, intrinsic traits can indicate a plant's proneness to vulnerability. This raises the potential threat of declining global pollinator diversity interacting with floral complexity to increase the vulnerability of individual plant species. There is potential scope for using plant-pollinator specializations to identify plant species particularly at

Evolutionary Recycling of Light Signaling Components in Fleshy Fruits: New Insights on the Role of Pigments to Monitor Ripening

OpenAIRE

Llorente, Briardo; D?Andrea, Lucio; Rodr?guez-Concepci?n, Manuel

2016-01-01

Besides an essential source of energy, light provides environmental information to plants. Photosensory pathways are thought to have occurred early in plant evolution, probably at the time of the Archaeplastida ancestor, or perhaps even earlier. Manipulation of individual components of light perception and signaling networks in tomato (Solanum lycopersicum) affects the metabolism of ripening fruit at several levels. Most strikingly, recent experiments have shown that some of the molecular mec...

Characteristics of the tomato chromoplast revealed by proteomic analysis

OpenAIRE

Barsan, Cristina; Sanchez-Bel, Paloma; Rombaldi, César Valmor; Egea, Isabel; Rossignol, Michel; Kuntz, Marcel; Zouine, Mohamed; Latché, Alain; Bouzayen, Mondher; Pech, Jean-Claude

2010-01-01

Chromoplasts are non-photosynthetic specialized plastids that are important in ripening tomato fruit (Solanum lycopersicum) since, among other functions, they are the site of accumulation of coloured compounds. Analysis of the proteome of red fruit chromoplasts revealed the presence of 988 proteins corresponding to 802 Arabidopsis unigenes, among which 209 had not been listed so far in plastidial databanks. These data revealed several features of the chromoplast. Proteins of lipid metabolism ...

A Virus-Induced Assay for Functional Dissection and Analysis of Monocot and Dicot Flowering Time Genes.

Science.gov (United States)

Qin, Cheng; Chen, Weiwei; Shen, Jiajia; Cheng, Linming; Akande, Femi; Zhang, Ke; Yuan, Chen; Li, Chunyang; Zhang, Pengcheng; Shi, Nongnong; Cheng, Qi; Liu, Yule; Jackson, Stephen; Hong, Yiguo

2017-06-01

Virus-induced flowering (VIF) uses virus vectors to express Flowering Locus T ( FT ) to induce flowering in plants. This approach has recently attracted wide interest for its practical applications in accelerating breeding in crops and woody fruit trees. However, the insight into VIF and its potential as a powerful tool for dissecting florigenic proteins remained to be elucidated. Here, we describe the mechanism and further applications of Potato virus X (PVX)-based VIF in the short-day Nicotiana tabacum cultivar Maryland Mammoth. Ectopic delivery of Arabidopsis ( Arabidopsis thaliana ) AtFT by PVX/AtFT did not induce the expression of the endogenous FT ortholog NtFT4 ; however, it was sufficient to trigger flowering in Maryland Mammoth plants grown under noninductive long-day conditions. Infected tobacco plants developed no systemic symptoms, and the PVX-based VIF did not cause transgenerational flowering. We showed that the PVX-based VIF is a much more rapid method to examine the impacts of single amino acid mutations on AtFT for floral induction than making individual transgenic Arabidopsis lines for each mutation. We also used the PVX-based VIF to demonstrate that adding a His- or FLAG-tag to the N or C terminus of AtFT could affect its florigenic activity and that this system can be applied to assay the function of FT genes from heterologous species, including tomato ( Solanum lycopersicum ) SFT and rice ( Oryza sativa ) Hd3a Thus, the PVX-based VIF represents a simple and efficient system to identify individual amino acids that are essential for FT-mediated floral induction and to test the ability of mono- and dicotyledonous FT genes and FT fusion proteins to induce flowering. © 2017 American Society of Plant Biologists. All Rights Reserved.

Molecular diversity among seven Solanum (eggplant and relatives ...

African Journals Online (AJOL)

Admin

2012-11-08

Nov 8, 2012 ... Seven Solanum species (eggplants) were investigated for molecular diversity. Besides its ... Eggplant comprises three closely related cultivated species .... generated with SSR data was submitted to 2-way Mantel test (Man-.

Study on the Development of Yunnan Floral E-commerce

Institute of Scientific and Technical Information of China (English)

Yulan; KUANG; Qifang; LI; Wangyun; NING

2013-01-01

Cut flower production in Yunnan accounts for 80%nationwide.In order to expand the Yunnan Flower sales channels,the promotion of the development of e-commerce is necessary.In 2012 China’s online shopping users reached 247 million people,but e-commerce of fresh flowers lagged behind due to the constraints of preservation facilities and logistics cost.The analysis of the factors restricting the development of floral e-commerce and the proposition of solutions to this problem can promote faster development of Yunnan floral e-commerce.

Inbreeding, heterosis, fertility, plasmon differentiation and Phytophthora resistance in Solanum verrucosum Schlechtd., and some interspecific crosses in Solanum

NARCIS (Netherlands)

Abdalla, M.M.F.

1970-01-01

Solanum verrucosum (2n = 24) is a self-compatible, highly fertile species. This conclusion is drawn from the results of studies on 21 various introductions of this species. In spite of self-compatibility and good male and female fertility, the species generally needs a pollinating agent to

Flowerlocation in Solanum dulcamara L. (Solanaceae

Directory of Open Access Journals (Sweden)

Irina Zhuravlyeva

2013-01-01

Full Text Available The morphology of inflorescence of Solanum dulcamara is studied. Pseudolateral location of inflorescence relatively to plant body is set, the absence of bracteae and the sympodial type of growing of branches are found out. From W. Troll point of view the inflorescence of nightshade is defined as the polytelica synflorescence – complex dichasium.

Comparative anatomy of floral elaiophores in Vitekorchis Romowicz & Szlach., Cyrtochilum Kunth and a florally dimorphic species of Oncidium Sw. (Orchidaceae: Oncidiinae).

Science.gov (United States)

Davies, Kevin L; Stpiczyńska, Małgorzata; Rawski, Michał

2014-06-01

Recently, molecular approaches have been used to investigate the phylogeny of subtribe Oncidiinae, resulting in the re-alignment of several of its genera. Here, a description is given of the structure of the floral elaiophores (oil glands) of four species formerly assigned to Oncidium Sw. Those of Vitekorchis excavata (Lindl.) Romowicz & Szlach., Cyrtochilum meirax (Rchb.f.) Dalström and a species of Oncidium displaying floral dimorphism, namely O. heteranthum Poepp. & Endl. var. album, are compared with that of Gomesa longipes (Lindl.) M.W. Chase & N.H. Williams, whose epithelial elaiophores are typical of many Oncidiinae, in order to extend our understanding of elaiophore diversity within this subtribe. Floral elaiophore structure was examined and compared at anthesis for all four species using light microscopy, scanning electron microscopy, transmission electron microscopy and histochemistry. In all species investigated, with the exception of C. meirax, the floral elaiophore occurs on the labellar callus and is of the intermediate type, possessing both glabrous and trichomatous regions. By contrast, although all four species produce lipid secretions, C. meirax lacks an obvious elaiophore. In each case, the secretory tissue is represented by a single-layered epidermis of cuboidal cells (trichomatous and/or atrichomatous). Palisade cells are absent. The secretion may be wax- or oil-like and is usually produced by smooth endoplasmic reticulum (SER). However, in C. meirax, where rough endoplasmic reticulum (RER) predominates, oil accumulates as plastoglobuli within elaioplasts. These plastoglobuli are then discharged into the cytoplasm, forming oil bodies. In some species, oil usually accumulates within vesicles at the plasmalemma or in the periplasmic space before traversing the cell wall and accumulating beneath the cuticle, sometimes with distension of the latter. Gomesa longipes is unusual in its production of a heterogeneous secretion, whereas Vitekorchis

Florally rich habitats reduce insect pollination and the reproductive success of isolated plants.

Science.gov (United States)

Evans, Tracie M; Cavers, Stephen; Ennos, Richard; Vanbergen, Adam J; Heard, Matthew S

2017-08-01

Landscape heterogeneity in floral communities has the potential to modify pollinator behavior. Pollinator foraging varies with the diversity, abundance, and spatial configuration of floral resources. However, the implications of this variation for pollen transfer and ultimately the reproductive success of insect pollinated plants remains unclear, especially for species which are rare or isolated in the landscape. We used a landscape-scale experiment, coupled with microsatellite genotyping, to explore how the floral richness of habitats affected pollinator behavior and pollination effectiveness. Small arrays of the partially self-compatible plant Californian poppy ( Eschscholzia californica) were introduced across a landscape gradient to simulate rare, spatially isolated populations. The effects on pollinator activity, outcrossing, and plant reproduction were measured. In florally rich habitats, we found reduced pollen movement between plants, leading to fewer long-distance pollination events, lower plant outcrossing, and a higher incidence of pollen limitation. This pattern indicates a potential reduction in per capita pollinator visitation, as suggested by the lower activity densities and richness of pollinators observed within florally rich habitats. In addition, seed production reduced by a factor of 1.8 in plants within florally rich habitats and progeny germination reduced by a factor of 1.2. We show this to be a consequence of self-fertilization within the partially self-compatible plant, E. californica . These findings indicate that locally rare plants are at a competitive disadvantage within florally rich habitats because neighboring plant species disrupt conspecific mating by co-opting pollinators. Ultimately, this Allee effect may play an important role in determining the long-term persistence of rarer plants in the landscape, both in terms of seed production and viability. Community context therefore requires consideration when designing and

Divergence of the Floral A-Function between an Asterid and a Rosid Species.

Science.gov (United States)

Morel, Patrice; Heijmans, Klaas; Rozier, Frédérique; Zethof, Jan; Chamot, Sophy; Bento, Suzanne Rodrigues; Vialette-Guiraud, Aurélie; Chambrier, Pierre; Trehin, Christophe; Vandenbussche, Michiel

2017-07-01

The ABC model is widely used as a genetic framework for understanding floral development and evolution. In this model, the A-function is required for the development of sepals and petals and to antagonize the C-function in the outer floral whorls. In the rosid species Arabidopsis thaliana , the AP2-type AP2 transcription factor represents a major A-function protein, but how the A-function is encoded in other species is not well understood. Here, we show that in the asterid species petunia ( Petunia hybrida ), AP2B/BLIND ENHANCER ( BEN ) confines the C-function to the inner petunia floral whorls, in parallel with the microRNA BLIND BEN belongs to the TOE-type AP2 gene family, members of which control flowering time in Arabidopsis. In turn, we demonstrate that the petunia AP2-type REPRESSOR OF B-FUNCTION ( ROB ) genes repress the B-function (but not the C-function) in the first floral whorl, together with BEN We propose a combinatorial model for patterning the B- and C-functions, leading to the homeotic conversion of sepals into petals, carpels, or stamens, depending on the genetic context. Combined with earlier results, our findings suggest that the molecular mechanisms controlling the spatial restriction of the floral organ identity genes are more diverse than the well-conserved B and C floral organ identity functions. © 2017 American Society of Plant Biologists. All rights reserved.

More lessons from linalool: insights gained from a ubiquitous floral volatile.

Science.gov (United States)

Raguso, Robert A

2016-08-01

Linalool (3,7-dimethyl-1,6-octadien-3-ol) is a common floral volatile with two distinct enantiomers and related metabolites involved in the full spectrum of plant-pollinator interactions. Recent studies reveal a complex interplay between pollinator attraction and plant defense mediated by linalool and its derivatives, from the smallest (Arabidopsis, Mitella) to the largest (Datura) flowers studied. Accordingly, fig wasps, fungus gnats and moths of all sizes show remarkable electrophysiological, neural and behavioral sensitivity to different enantiomers and quantitative ratios of linalool in floral bouquets. The diverse functions of linalool, ranging from toxin to long distance pollinator attractant are discussed in the broader context of floral volatile ecology and evolution. Copyright © 2016 Elsevier Ltd. All rights reserved.

New functionally dioecious bush tomato from northwestern Australia, Solanum ossicruentum, may utilize "trample burr" dispersal.

Science.gov (United States)

Martine, Christopher T; Cantley, Jason T; Frawley, Emma S; Butler, Alice R; Jordon-Thaden, Ingrid E

2016-01-01

A new Australian species of functionally dioecious bush tomato of Solanum subgenus Leptostemonum is described. Solanum ossicruentum Martine & J.Cantley, sp. nov., is thought to be allied with members of the problematic "Dioicum Complex" lineage, but differs in its short silvery indumentum, long calyx lobes, larger stature, and an unusual fruit morphology that may represent "trample burr" seed dispersal. The species occurs in a range extending from the eastern Kimberley in Western Australia to far northwestern Northern Territory and has been recognized for decades as a variant of Solanum dioicum W.Fitzg. Specimens of this species were previously referred to by D.E. Symon and others as Solanum dioicum 'Tanami.' Ex situ crossing studies and SEM images of inaperturate pollen grains produced in morphologically hermaphrodite flowers indicate that this taxon is functionally dioecious. The scientific name was chosen with the help of 150 seventh grade life science students from Pennsylvania, USA.

Interspecific and Intersexual Differences in the Chemical Composition of Floral Scent in Glochidion Species (Phyllanthaceae in South China

Directory of Open Access Journals (Sweden)

Daihong Huang

2015-01-01

Full Text Available Plants of the Glochidion (Phyllanthaceae genus are pollinated exclusively by host-specific Epicephala (Gracillariidae moths. Floral scent has been thought to play key role in the obligate pollination mutualism between Glochidion plants and Epicephala moths, but few studies have been reported about chemical variation in floral volatiles of Glochidion species in China. Floral volatiles of male and female flowers of five Glochidion species in south China were collected by dynamic headspace absorption technique and then were chemically analyzed by using gas chromatography-mass spectrometry. A total of 69 compounds were identified from floral scents of five investigated species. Glochidion hirsutum and G. zeylanicum showed no qualitative differences in floral scent, whereas there were clear variations of floral scent among other species (G. eriocarpum, G. daltonii, and G. sphaerogynum and also they distinctly differed from these two species. Male flowers emitted significantly more scent than female flowers. Glochidion plants exhibited qualitative and quantitative differences in floral scent between two sexes of flowers. The findings suggest that the volatile variation of floral scent among Glochidion species reflects adaptations to specific pollinators. Sexual dimorphism in floral scent has evolved to signal alternative rewards provided by each sex to Epicephala moths.

Pólen 2n e mecanismos meióticos de formação em Solanum commersonii ssp 2n pollen and meiotic mechanisms of Formation in Solanum commersonii ssp

Directory of Open Access Journals (Sweden)

Lívia Gracielle Oliveira Tomé

2009-04-01

Full Text Available Solanum commersonii subsp. commersonii Dun. e Solanum commersonii subsp. malmeanum Bitt. (2n=2x=24 - 1EBN não podem ser diretamente cruzadas com a batata cultivada de S. tuberosum subsp. tuberosum L. (2n=4x=48 -4 EBN em razão da barreira da ploidia e do número de equilíbrio do endosperma (EBN. No entanto, a produção de pólen não reduzido por S. commersonii ssp. (2x=2n=24 - 1EBN, permite o cruzamento desta com dihaplóides de batata e com as espécies diplóides S. phureja Juz. & Bukasov. e S. chacoense Bitt., que possuem 2 EBN. Conduziu-se este trabalho, com o objetivo de determinar o mecanismo meiótico e a freqüência dos grãos de pólen não reduzidos em cinco clones de Solanum commersonii ssp. Foram avaliados três clones de S. commersonii subsp. commersonii (SCC e dois de S. commersonii subsp. malmeanum (SCM. Nas avaliações, duzentos grãos de pólen viáveis foram corados (carmim acético 2% e mensurados, sendo considerados não reduzidos aqueles com o diâmetro igual ou superior a 25 µm. O clone Solanum commersonii subsp. commersonii Dun. (SCC 100 produz 26.1% de polen não reduzido, por fusos fundidos e fusos paralelos, o qual pode ser utilizado em programas de melhoramento.Solanum commersonii subsp. commersonii Dun. and Solanum commersonii subsp. malmeanum Bitt. (2n=2x=24 -1EBN cannot be directly crossed with the cultivated Solanum tuberosum subsp. Tuberosum L. (2n=4x=48 - 4EBN species due to ploidy barriers and endosperm balance number (EBN. However, non-reduced pollen production by the wild species S. commersonii ssp. (2x=2n=24 -1EBN, allows the crossing of these species with dihaploids of potato and with the diploids species, S. phureja Juz. & Bukasov. and S. chacoense Bitt., all with 2EBN. The aim of this work was to determine the meiotic mechanism and frequency of non-reduced pollen production of five clones of S. commersonii ssp. Three different clones of S. commersonii subsp. commersonii Dun. (SCC and two of S

The effect of flower position on variation and covariation in floral traits in a wild hermaphrodite plant.

Science.gov (United States)

Zhao, Zhi-Gang; Du, Guo-Zhen; Huang, Shuang-Quan

2010-05-20

Floral traits within plants can vary with flower position or flowering time. Within an inflorescence, sexual allocation of early produced basal flowers is often female-biased while later produced distal flowers are male-biased. Such temporal adjustment of floral resource has been considered one of the potential advantages of modularity (regarding a flower as a module) in hermaphrodites. However, flowers are under constraints of independent evolution of a given trait. To understand flower diversification within inflorescences, here we examine variation and covariation in floral traits within racemes at the individual and the maternal family level respectively in an alpine herb Aconitum gymnandrum (Ranunculaceae). We found that floral traits varied significantly with flower position and among families, and position effects were family-specific. Most of the variance of floral traits was among individuals rather than among flowers within individuals or among families. Significant phenotypic correlations between traits were not affected by position, indicating trait integration under shared developmental regulation. In contrast, positive family-mean correlations in floral traits declined gradually from basal to distal flowers (nine significant correlations among floral traits in basal flowers and only three in distal flowers), showing position-specificity. Therefore, the pattern and magnitude of genetic correlations decreased with flower position. This finding on covariation pattern in floral reproductive structures within racemes has not been revealed before, providing insights into temporal variation and position effects in floral traits within plants and the potential advantages of modularity in hermaphrodites.

Comparación cuantitativa de ácido abscísico y citoquininas en la tuberización de Solanum tuberosum L. y Solanum phureja Juz. et Buk.

OpenAIRE

Ortiz Luz Yineth; Flórez Víctor Julio

2008-01-01

De las 30 variedades de papa cultivadas en Colombia tan solo 10 poseen importancia comercial. Entre otros factores, este número es limitado por la acción de hormonas endógenas que aceleran diferentes fases del proceso de tuberización, especialmente en las especies más precoces. En este trabajo fueron recolectadas muestras de tubérculos de diferentes especies de papa (Solanum tuberosum L. var. ICA-Única y Tuquerreña, y Solanum phureja